An Inducible T7 Polymerase System for High-Level Protein Expression in Diverse Gram-Negative Bacteria

ABSTRACT

A broad host range (BHR)-inducible T7 RNA polymerase system was developed, enabling induction with isopropyl-β-d-thiogalactopyranoside (IPTG), similar to the Escherichia coli strain BL21(DE3) protocol, but it is now applicable in a wide range of bacteria. This system allows for high protein yields and purification from diverse Gram-negative bacteria, including the native host.

ANNOUNCEMENT

High-level expression of proteins for purification is commonly performed using Escherichia coli BL21(DE3). BL21(DE3) harbors a prophage (DE3) encoding the T7 RNA polymerase (gene 1) that recognizes the P_T7 promoter (TAATACGACTCACTATAG), which is under the control of an isopropyl-β-d-thiogalactopyranoside (IPTG)-inducible promoter (1). Purification of heterologous proteins from E. coli intrinsically removes them from their native physiological context and any endogenous modification or regulation. Ectopic expression of proteins in their native hosts is often used to study their native function, with expression under the control of a regulated promoter, commonly the lac promoter (P_lac). While these systems drive expression, there are drawbacks to each. For example, purification of protein from the native host is often limited, with current systems providing insufficient expression. Here, we develop a bipartite broad host range (BHR) plasmid-based P_T7 expression system. Similar to E. coli protein expression protocols, the protein of interest (POI) is expressed from the T7 promoter that is carried here on a pVS-based (spectinomycin resistance, Sp^r) BHR plasmid (2). A second compatible plasmid (pBBR origin; gentamycin resistance, Gm^r) provides the T7 polymerase gene, expressed from P_lac and carrying lacI^Q, allowing efficient regulation with IPTG (3, 4). An alternate T7 polymerase expression plasmid (IncP origin; tetracycline resistance, Tc^r) was also created (5).

The inducible T7 polymerase plasmid pJLG038 is a derivative of the BHR plasmid pSRKGm (derived from pBBR1MCS) (3, 4). To construct pJLG038, gene 1 was amplified from BL21(DE3) using forward (GTACTCTAGAATGAACACGATTAACATCGC [restriction enzyme sites are underlined]) and reverse (GTACGTCGACTTACGCGAACGCGAAGTCCG) primers and was ligated into pSRKGm digested with XbaI and SalI. The IncP plasmid was constructed in a similar manner. The plasmid was purified and sequenced before electroporation into Agrobacterium tumefaciens (6). The plasmids can also be introduced by conjugation (see Fig. 1A to C).

FIG 1.

Plasmid maps and protein production in A. tumefaciens. Boxes with text indicate the relative position of genes. (A) Map of pJLG209 and pMAT36. The gene of interest is indicated in blue and the T7 terminator sequence in white. pVS1 staA, pVS1 rep, and pVS1 ori are a plasmid stability gene from the pVS1 plasmid, a replication protein, and the origin of replication, respectively (black). Bom is the basis of the mobility gene and is necessary for conjugation. The ColE1 ori is active in E. coli (white), and aadA encodes an aminoglycoside transferase (green), conferring resistance to spectinomycin and streptomycin. (B and C) Maps of pJLG038 and pJLG039. lacI (purple) encodes the lactose repressor, and T7 polymerase (gold) is ligated at the indicated sites. The origin, replication proteins, and conjugation proteins are indicated by black boxes. pBBR1 rep and pBBR1 ori encode the replication protein and origin, for pJLG038, traJ (for conjugation) and incP-oriV, and oriT for pJLG039. For antibiotic resistance genes (green), gnt encodes gentamicin acetyltransferase and tetA encodes a tetracycline efflux pump. (D) Expression of untagged PruR by the lac promoter or a DsbA_SS-PruR-3XFLAG with IPTG-inducible P_T7. (E) Periplasmic fractionation of the strains used in A (except for the negative control). (F) Expression of MirA, a cytoplasmic protein, using either P_lac fused upstream of its native promoter (due to low yield from P_lac alone) and a 3XFLAG tagged version of the protein under the control of the T7 promoter. E.V., empty vector; P_L-T7 polymerase, constitutively expressed T7 polymerase; (C/M), cytoplasmic/membrane fraction; (P), periplasmic fraction.

In addition to the inducible T7 polymerase plasmid, a second compatible plasmid carrying the POI is required. Here, we used derivatives of pRA301 (2) constructed using isothermal assembly with the POI fused to an efficient secretion signal (dsbA_SS) and a 3XFLAG tag for purification.

While this work was performed and validated in Agrobacterium tumefaciens, the plasmids contain BHR replication origins and are compatible with a diversity of Gram-negative taxa (3, 4). With the aim to purify protein from A. tumefaciens, we discovered that available expression systems (based on P_lac, P_N25, and P_traI) were insufficient for high-level protein expression (3, 7, 8). An existing system provided constitutive expression from the T7 polymerase in A. tumefaciens (9). However, we observed surprisingly weak expression and hypothesized that the constitutively expressed T7 polymerase negatively impacted cellular physiology, which has been noted in BL21(DE3) (10).

Unlike these systems, our IPTG-inducible T7 polymerase system provided tight regulation and high protein yields (Fig. 1D). No growth inhibition was observed during induction for the proteins tested. We initially designed and implemented this system to purify the A. tumefaciens periplasmic PruR protein (11), and periplasmic fractionation confirmed that the protein is efficiently targeted to the periplasm (Fig. 1E). The system is also effective for expression of cytoplasmic proteins, such as A. tumefaciens MirA (Fig. 1F) (12).

Data availability.

The complete sequences of plasmids pMAT36 (P_T7-mirA-3XFLAG, cytoplasmic protein), pJLG029 (P_T7-dsbA_SS-pruR-3XFLAG, periplasmic protein), pJLG038 (inducible T7 polymerase, pBBR, Gm^r), and pJLG039 (inducible T7 polymerase, IncP, Tet^r) have been deposited into GenBank (accession numbers OP627879, OP627880, OP627881, and OP627882) and are available from Addgene (identifier [ID] numbers 19279, 12980, 12981, and 12982). Plasmid inserts were sequenced using Sanger sequencing either through ACGT (Wheeling, IL) or Eurofins (Louisville, KY). These data are available upon request.