Skip to main content

This is a preprint.

It has not yet been peer reviewed by a journal.

The National Library of Medicine is running a pilot to include preprints that result from research funded by NIH in PMC and PubMed.

bioRxiv logoLink to bioRxiv
[Preprint]. 2023 Feb 7:2023.02.06.527416. [Version 1] doi: 10.1101/2023.02.06.527416

Inducing vulnerability to InhA inhibition restores isoniazid susceptibility in drug resistant Mycobacterium tuberculosis

Gregory A Harrison 1, Kevin Cho 2,3,4, Erin R Wang 1, Souvik Sarkar 5, Fredrik Almqvist 5,6, Gary J Patti 2,3,4, Christina L Stallings 1,*
PMCID: PMC9934558  PMID: 36798348

Abstract

Of the approximately 10 million cases of Mycobacterium tuberculosis (Mtb) infections each year, over 10% are resistant to the frontline antibiotic isoniazid (INH). INH resistance is predominantly caused by mutations that decrease the activity of the bacterial enzyme KatG, which mediates conversion of the pro-drug INH to its active form INH-NAD. We previously discovered an inhibitor of Mtb respiration, C10, that enhances the bactericidal activity of INH, prevents the emergence of INH-resistant mutants, and re-sensitizes a collection of INH-resistant mutants to INH through an unknown mechanism. To investigate the mechanism of action of C10, we exploited the toxicity of high concentrations of C10 to select for resistant mutants. We discovered two mutations that confer resistance to the disruption of energy metabolism and allow for growth of Mtb in high C10 concentrations, indicating that growth inhibition by C10 is associated with inhibition of respiration. Using these mutants as well as direct inhibitors of the Mtb electron transport chain, we provide evidence that inhibition of energy metabolism by C10 is neither sufficient nor necessary to potentiate killing by INH. Instead, we find that C10 acts downstream of INH-NAD synthesis, causing Mtb to become particularly sensitive to inhibition of the INH-NAD target, InhA, without changing the concentration of INH-NAD or the activity of InhA, the two predominant mechanisms of potentiating INH. Our studies revealed that there exists a vulnerability in Mtb that can be exploited to render Mtb sensitive to otherwise subinhibitory concentrations of InhA inhibitor.

Introduction:

The disease tuberculosis (TB), caused by Mycobacterium tuberculosis (Mtb), remains a global health threat. As of 2019, TB was reported to be the 13th leading cause of death worldwide, and the current COVID-19 pandemic has exacerbated challenges in TB disease surveillance and global control efforts (1, 2). A major obstacle in the treatment of Mtb infections is that the sterilizing activity of antibiotics is slow and sometimes incomplete at the site of infection due to several contributing factors. The penetration of antibiotics into the Mtb lesion can be limited, causing Mtb to be exposed to fluctuating and often subinhibitory concentrations of antibiotic. In addition, Mtb has the propensity to develop phenotypically drug tolerant populations in the host, which allows a population of Mtb to persist in spite of exposure to antibiotic (36). Long treatment regimens are required to overcome the issues of drug penetration and bacterial drug tolerance to ultimately clear the infection. The standard of care for the treatment of active TB lasts 6 months, including a 2-month intensive phase of regular doses of isoniazid (INH), rifampicin, pyrazinamide, and ethambutol followed by a 4-month continuation phase of INH and rifampicin (7). Recently, the World Health Organization approved the recommendation for a shortened 4-month treatment regimen that can be made available to some patients, which includes a 2-month intensive phase of INH, rifapentine, pyrazinamide, and moxifloxacin, followed by 2 months and 1 week of INH, rifapentine, and moxifloxacin (7). As a component of the intensive and continuation phases of both longer and shorter treatment regimens, INH is a critical frontline antibiotic that is the cornerstone of our current anti-TB regimens.

The utility of INH for the treatment of Mtb infections is threatened by the emergence and prevalence of INH resistant mutant strains of Mtb. An estimated 10.7% of newly infected and 27.2% of previously treated cases are INH-resistant (8). INH is a prodrug, and resistance is most commonly caused by mutations in the gene katG, which encodes the sole bifunctional catalase-peroxidase enzyme in Mtb that is also responsible for converting INH to its active form within the bacteria (810). KatG is an oxidative defense enzyme, and its typical substrates are H2O2 and other peroxides (11). However, KatG acts on INH as a non-canonical substrate to generate a radical intermediate of INH (12), which spontaneously reacts with and attaches to the abundant cofactor NAD(H), forming INH-NAD (10, 13). The INH-NAD adduct, the activated form of INH, inhibits the enzyme InhA (10, 13, 14), which is the enoyl-acyl carrier protein reductase enzyme that functions in the fatty acid synthase II (FAS-II) system (15, 16). InhA is required for the FAS-II system to elongate the shorter fatty acids synthesized by FAS-I to generate long lipid precursors that are subsequently converted to mycolic acids (MAs) through a multi-step process. MAs are an essential structural component of the outermost layer of the Mtb cell envelope and, therefore, by inhibiting InhA, INH-NAD compromises the integrity of the Mtb cell envelope, leading to growth inhibition and death (17, 18).

Identifying ways to enhance the antibacterial activity of INH has the potential to greatly improve the standard of care for TB. To this end, we recently reported the identification of the bicyclic 2-pyridone compound C10 as a potentiator of INH activity in Mtb (19). At concentrations that on its own do not inhibit growth, C10 promotes killing by INH and prevents the emergence of spontaneous INH-resistant mutants (19). Whereas high-level resistance to INH mediated by mutations in katG is generally considered to render INH ineffective (20), we discovered that C10 was able to re-sensitize multiple INH-resistant katG mutants to inhibition by INH, which had previously not been thought to be possible. The ability of C10 to potentiate INH activity in both WT and INH-resistant katG mutant strains of Mtb demonstrates that there is a vulnerability in the bacteria that can be exploited to enhance the antimicrobial activity of INH and even circumvent INH resistance (19). Understanding the target and mechanism of action of C10 could lead to the discovery of novel therapeutic approaches that can be used in the clinic to disarm INH resistance in katG mutants.

In previous work, we performed RNA-sequencing on C10-treated Mtb and found that C10 induces a transcriptional signature consistent with inhibition of respiration (19). We subsequently demonstrated that C10 blocked Mtb oxygen consumption and decreased bacterial ATP levels, suggesting that C10 disrupts Mtb energy metabolism (19). In the current study, we aimed to determine how C10 potentiates killing by INH and whether this potentiation is linked to inhibition of Mtb energy metabolism. We use a combination of forward genetics and chemical biology to reveal that the inhibition of respiration by C10 is not required for C10 to potentiate INH, thereby uncoupling these two effects of C10 on Mtb physiology. Instead, we present evidence that C10 restores INH susceptibility in a subset of resistant mutants by enhancing the bacterial vulnerability to InhA inhibition. Our findings reveal potential strategies to improve the efficacy of INH as well as other antibiotics that target mycolic acid metabolism in Mtb.

Results:

Isolation of mutants that are resistant to C10

To better understand the mechanism of action of C10 (Fig. 1A), we chose a forward genetic approach and isolated mutants that are resistant to C10, with the goal of identifying mutations in genes linked to the mechanism of action of C10. Previous studies used 25μM of C10 to disrupt Mtb energy homeostasis and deplete bacterial ATP (19). But 25μM of C10 only results in a modest decrease in Mtb growth (19). Therefore, to select for C10 resistant mutants, we first determined the concentration of C10 that was sufficient to inhibit growth of wild-type (WT) Mtb. By increasing the C10 concentration above 25μM, we found that C10 caused dose-dependent inhibition of Mtb growth both in liquid media and on agar plates (Fig. 1BC), consistent with our previous studies (19). 200μM C10 completely inhibited Mtb growth in both conditions, so we used this concentration to select for resistant mutants. By spreading Mtb on agar containing 200μM C10 and allowing these agar plates to incubate for a total of 9 weeks, we eventually observed the emergence of spontaneous resistant colonies. We isolated 11 resistant mutants and performed whole genome sequencing to identify mutations that confer the C10-resistance. We found that each resistant strain harbored one of 3 different mutations (Fig. 1D). To probe how these mutations impact C10 sensitivity, we chose representative strains that each harbor one of these 3 mutations as the sole nucleotide change that could be identified by whole genome sequencing. Strain GHTB136 harbors an intergenic mutation between the putative S-adenosylmethionine (SAM)-methyl transferase Rv0731c and the secY-adk-mapA operon, a C to A substitution 69 bp from the start of Rv0731c and 92 base pairs (bp) from the start of secY. To determine if this mutation impacts the expression level of the neighboring genes we performed qRT-PCR and found that the GHTB136 strain exhibited >100-fold up-regulation of the Rv0731c gene and 2–6-fold up-regulation of the secY-adk-mapA operon compared to WT (Fig. S1A). The GHTB146 strain harbors an intergenic mutation between the lpdA-glpD2 operon and the uncharacterized gene Rv3304, an A to G substitution 12 bp from the start of the lpdA coding region. Since lpdA is a leaderless transcript (21), this mutation is likely located within the RNA polymerase binding region. The GHTB146 mutant exhibited 4–8-fold up-regulation of the lpdA-glpD2 operon, but no change in expression of the Rv3304 gene compared to WT (Fig. S1B), suggesting that this mutation enhances lpdA-glpD2 promoter activity. The third representative strain, GHTB149, harbors a missense mutation within the putative SAM-methyl transferase Rv0830 that results in the substitution of valine for a leucine residue at position 292 (L292V).

Figure 1: Isolation and characterization of C10-resistant mutants.

Figure 1:

(A) Chemical structure of C10. (B) WT Mtb was cultured in Sauton’s medium containing the indicated concentration of C10, and growth was measured by OD600 over time. (C) WT Mtb was spread on Sauton’s agar medium containing the indicated concentration of C10 and incubated at 37°C for 3 weeks. (D) Whole genome sequencing of 11 C10-resistant mutants revealed 3 groups of mutants. The mutant loci are depicted along with the resultant nucleotide or amino acid change, and the GHTB strain numbers indicate the mutant isolates that harbored the depicted mutation. Representative strains GHTB136, GHTB146, and GHTB149 were selected for follow up studies. (E) The indicated strain of Mtb was cultured in the presence of increasing concentrations of C10 for 1 week, and the % inhibition of Mtb growth and metabolism was determined using the resazurin assay, n=6. (F) The indicated strain of Mtb was cultured in Sauton’s liquid medium containing 0 or 25μM C10 for 24 hours before ATP levels were measured by the BacTiter Glo assay. The relative luminescence units (RLU) were normalized to the optical density (OD600) of the culture to control for differences in cell density. Fold change in ATP levels were calculated relative to the 0μM C10 control for each strain, n=4–7. A 2-way ANOVA with Tukey’s post test was performed to determine statistically significant differences across samples. Select comparisons are depicted in the figure. ns not significant and **** P<0.0001. For all pairwise comparisons, please see Supplementary Table S1.

To determine how these mutations impact the sensitivity of Mtb to C10, we quantified the level of C10 resistance in these strains using a resazurin microplate assay. This assay takes advantage of the redox-sensitive dye resazurin, which is blue in its oxidized form but becomes reduced to the fluorescent pink product resorufin as a result of bacterial growth and metabolism. Therefore, fluorescence can be monitored as a proxy for bacterial growth and metabolism. C10 inhibits WT Mtb in this assay with a half-maximal inhibitory concentration (IC50) of 25μM (Fig. 1E) (19). The IC50 of C10 in GHTB149, which harbors the Rv0830 L292V mutation, was 59μM (Fig. 1E), a 2.4-fold increase over WT Mtb, indicating that this mutant exhibits a low level of resistance to C10. In contrast, the C10 IC50 in both GHTB136 and GHTB146 was >100μM (Fig. 1E). Therefore, while this assay confirmed that all 3 representative isolates are resistant to C10, the mutations in GHTB136 and GHTB146 confer a higher level of resistance than the GHTB149 strain.

C10 inhibits respiration and depletes ATP levels in WT Mtb (19). Therefore, to directly determine how the mutations in the C10-resistant strains affected ATP-depletion by C10, we cultured WT, GHTB136, GHTB146, and GHTB149 in the presence and absence of 25μM C10 for 24 hours and quantified bacterial ATP levels using a luciferase-based BacTiter Glo assay (Fig. 1F). Similar to WT, the GHTB149 strain exhibited a decrease in bacterial ATP in response to C10, suggesting that the low level of resistance conferred by the Rv0830 L292V mutation is not sufficient to overcome the depletion of ATP by C10. In contrast, C10 did not significantly decrease the ATP levels in the GHTB136 and GHTB146 strains (Fig. 1F), demonstrating that these mutants are resistant to the ATP-depleting effects of C10. Collectively these findings demonstrate that C10-mediated growth inhibition is linked to ATP depletion, as mutants that maintain ATP levels in the presence of C10 are able to overcome the toxicity of C10. Notably, none of the mutants exhibited an altered level of ATP at baseline (Fig. S2), indicating that these strains do not overcome the effects of C10 simply by harboring increased pools of ATP. Furthermore, the C10-resistant strains were not cross-resistant to compounds known to inhibit ATP synthesis by targeting the electron transport chain (ETC), such as the ATP synthase inhibitor bedaquiline (BDQ) or the protonophore CCCP (Fig. S3). Therefore, GHTB136, GHTB146, and GHTB149 are specifically resistant to the effects of C10, and the mechanism of resistance in these strains does not confer cross-resistance to respiration inhibitors in general.

C10 potentiates INH independently of its effect on energy homeostasis

Since GHTB136 and GHTB146 overcome the depletion of ATP by C10, we used these mutants to test whether disruption of energy homeostasis by C10 contributes to its ability to enhance the bactericidal activity of INH. We cultured WT Mtb, GHTB136, and GHTB146 in media containing 25μM C10 and/or 0.25μg/mL INH and enumerated the colony forming units (CFU) to determine the number of viable bacteria after 10 days of treatment. Similar to our previously reported results, C10 enhanced the bactericidal effect of INH against WT Mtb, leading to approximately 2 orders of magnitude fewer CFU/mL after 10 days of treatment compared to INH alone (Fig. 2A) (19). We found that C10 still potentiated the bactericidal activity of INH against GHTB136 and GHTB146 strains to a similar or even greater extent compared to WT (Fig. 2BC). Therefore, C10 can enhance killing by INH in strains that maintain ATP levels during exposure to C10, demonstrating that ATP depletion is not required for C10 to potentiate INH. In support of this finding, when we examined whether the direct ATP synthase inhibitor BDQ could recapitulate the effect of C10, we found that depletion of bacterial ATP with BDQ did not potentiate killing by INH (Fig. 2DE). Instead, BDQ in combination with INH resulted in a 1–2-log increase in the number of viable bacteria compared to INH alone. These findings are consistent with previous reports that BDQ and other ETC inhibitors, including Q203 and CCCP, antagonize killing by INH (2224). Depletion of ATP is, therefore, not sufficient to potentiate INH, indicating that C10 must impart another effect on Mtb that is not reversed in the GHTB136 and GHTB146 mutants to elicit the increased sensitivity to INH.

Figure 2: Depletion of ATP by C10 is neither necessary nor sufficient to potentiate the bactericidal activity of INH.

Figure 2:

(A) WT, (B) GHTB136, or (C) GHTB146 Mtb was cultured in Sauton’s liquid medium containing the indicated concentrations of C10 and INH and the CFU/mL were enumerated, n=5. (D) WT Mtb was cultured in Sauton’s liquid medium containing 25μM C10 or 0.05μg/mL BDQ for 24 hours before ATP levels were measured by the BacTiter Glo assay. The RLU were normalized to the OD600 of the culture to control for differences in cell density. Fold change in ATP levels were calculated relative to the DMSO control, n=5–7. (E) WT Mtb was cultured in Sauton’s liquid medium containing the indicated concentrations of C10, BDQ, and/or INH and the CFU/mL were enumerated, n=5–7. A 2-way ANOVA with Tukey’s post test was performed to determine statistically significant differences across samples. Select comparison are depicted in the figure. ns not significant, ** P<0.01, and **** P<0.0001. For all pairwise comparisons, please see Supplementary Table S2.

Isolation of mutants that are resistant to the combination of C10 and INH

To specifically address how C10 potentiates INH activity in Mtb, we sought to identify genes that are required for C10 to potentiate INH by selecting for spontaneous Mtb mutants that can grow in the presence of C10 and INH. We had previously been unable to select for mutants that grew in the presence of 25μM C10 and 0.5μg/mL INH (19). Therefore, we decreased the selective pressure by lowering the concentration of INH. We inoculated WT Mtb onto agar media containing 25μM C10 and 0.2μg/mL INH, and incubated the bacteria for 4 months at 37°C. We isolated 3 spontaneous mutants that could grow on agar media containing 25μM C10 and 0.2μg/mL INH and performed whole genome sequencing to identify the genetic basis for resistance. Two of the mutant strains harbored large genomic deletions. One strain, GHTB089, was deleted for 27.9 kilobases (kb) of its genome (Δ2145809–2173696), which disrupted 27 annotated genes, including deleting the first 1183 bp of katG. The second isolate, GHTB092, was deleted for 38.6 kb of its genome (Δ2132215–2170824), which included the entire katG gene and 36 additional annotated genes. In contrast, the third strain harbored a single point mutation when compared to the parental WT strain, a nucleotide change in katG that results in an early stop codon at tryptophan 198. We designated this strain katGW198*.

KatG is a 740-amino acid protein with several residues that are critical for catalase-peroxidase activity, including a heme-coordinating histidine at position 270 and catalytic residues at R104, H108, and W321. The katGW198* mutation is predicted to result in truncation of over two thirds of the KatG protein, including several of these essential residues. The selection of the katGW198* mutant on media containing INH and C10 was perplexing because in our earlier study we had shown that C10 still potentiates INH in multiple INH-resistant katG mutants, including a katG mutant that harbors a frameshift mutation at amino acid 6 that results in an early stop codon (katGFS6) and a katG mutant with a single amino acid substitution of a leucine for a tryptophan at position 328 (katGW328L) (19). To determine if the katGW198* mutant was truly unique from the previously studied INH-resistant katG mutants, we compared the ability of the katGW198*, katGFS6, and katGW328L mutants to grow on agar medium containing 0.5μg/mL INH and/or 25μM C10 (Fig. 3A). As expected based on our previous data, the katGFS6 and katGW328L mutants grow well in the presence of either C10 or INH alone, but are re-sensitized to INH in the presence of C10 such that their growth is inhibited on agar containing both C10 and INH together (Fig. 3A). In contrast, the katGW198* mutant grew on agar containing C10 alone, INH alone, and the combination (Fig. 3A), demonstrating that this strain is resistant to INH even in the presence of C10.

Figure 3: Forward genetic selection results in isolation of a katGW198* mutant that is resistant to INH even in the presence of C10.

Figure 3:

(A) The indicated strain of Mtb was spread on Sauton’s agar medium containing 25μM C10 and/or 0.5μg/mL INH and incubated at 37°C for 3 weeks. (B) WT (C) katGFS6, (D) katGW328L, and (E) katGW198* Mtb was cultured in Sauton’s liquid medium containing the indicated concentrations of C10 and INH and the CFU/mL were enumerated. (F) Mtb harboring the indicated katG allele was cultured in Sauton’s liquid medium containing 0, 10, or 25μM C10 for 24 hours before ATP levels were measured by the BacTiter Glo assay. The RLU were normalized to the OD600 of the culture to control for differences in cell density. Fold change in ATP levels were calculated relative to the 0μM C10 control for each strain, n=3–11. (G) The indicated strain of Mtb was cultured in the presence of increasing concentrations of C10 for 1 week, and the % inhibition of Mtb growth and metabolism was determined using the resazurin assay, n=3. A 2-way ANOVA with Tukey’s post test was performed to determine statistically significant differences across samples. Select comparison are depicted in the figure. ns not significant, * P<0.05, ** P<0.01, *** P<0.001, and **** P<0.0001. For all pairwise comparisons, please see Supplementary Table S3.

We monitored the effects of C10 and INH on the viability of each katG mutant strain compared to WT by culturing the bacteria in liquid media with or without C10 and/or INH for 10 days and enumerating CFU (Fig 3BE). Similar to our previously reported results, while the katGFS6 mutant can grow in the presence of INH or C10 alone, 25μM C10 in combination with INH caused a significant decrease in the number of viable bacteria compared to C10 or INH alone (Fig. 3C)(19). Similar to the katGFS6 mutant, the katGW328L mutant can grow in the presence of INH or C10 alone, but in combination with INH, 10 or 25μM C10 was able to decrease the number of CFU/mL 3–4 orders of magnitude below the inoculum (Fig. 3D), demonstrating that C10 restores the bactericidal activity of INH against this mutant. In contrast, the CFU/mL of the katGW198* mutant increased from day 0 to 10 in cultures treated with C10 alone, INH alone, and the combination (Fig. 3E). 25μM C10 significantly decreased the CFU/mL on day 10 compared to the untreated controls, but this was not enhanced by the addition of INH, indicating that C10 inhibits growth of the katGW198* mutant, but is unable to potentiate INH in this strain.

The ability of the katGW198* mutant to grow in the presence of C10 and INH could be due to resistance to the C10/INH combination or resistance to C10 specifically. To determine if the katGW198* mutant was resistant to C10 activity, we examined the effect of C10 treatment on ATP levels in the katGFS6, katGW328L, and katGW198* mutants by treating with 10 μM or 25 μM C10 for 24 hours and then measuring ATP levels using the luciferase-based BacTiter Glo assay. C10 treatment caused a similar dose-responsive decrease in ATP in WT Mtb and the katG mutants as compared to the DMSO-treated cultures (Fig. 3F). C10 also inhibited the katG mutants to a similar or even greater extent compared to WT in the resazurin microplate assay, with the IC50 of C10 in the WT, katGFS6, katGW328L, and katGW198* strains being 22μM, 12μM, 7.4μM, and 14μM, respectively (Fig. 3G). These findings demonstrate that C10 is still able to disrupt Mtb energy homeostasis in katGW198* and, therefore, the loss of INH potentiation in katGW198* is not due to insensitivity to C10 activity.

KatG expression and activity is required for C10 to enhance INH inhibitory activity in Mtb

Given the finding that C10 was able to re-sensitize both katGFS6 and katGW328L mutant strains but not katGW198* to INH, we hypothesized that there may be a functional difference between the KatG protein variant expressed in the katGW198* mutant compared to katGFS6 and katGW328L. To begin to investigate this possibility, we probed the expression of KatG protein in each strain by western blot using a monoclonal α-KatG antibody (Fig. 4A). katGW328L Mtb harbored similar or higher levels of KatG protein compared to WT Mtb, whereas katGW198* Mtb did not express any full length KatG protein, similar to a ΔkatG strain. In contrast, the katGFS6 strain expressed a low abundance protein species that was recognized by the α-KatG antibody and migrated slightly faster than the full length KatG protein expressed in WT Mtb (Fig. 4A). Upon closer examination of the katG mRNA sequence, we noted that there is a putative alternative GUG start codon downstream from the early stop codon introduced by the frameshift mutation in katGFS6 that may re-initiate translation in the correct frame beginning at codon 23. Therefore, we postulate that the faint band detected by western blot from katGFS6 cell lysate represents low level expression of a variant KatG protein with a small N-terminal truncation (Δ1–22) that still contains all necessary catalytic residues (Fig. 4AB).

Figure 4: Some level of KatG expression and activity is necessary for C10 to potentiate INH.

Figure 4:

(A) Western blot against whole cell lysate from the indicated strain of Mtb. CarD was used as a loading control in this experiment. (B) Diagram of KatG protein indicating the required catalytic residues in the protein as well as the variant proteins expressed in each katG mutant. (C-G) The indicated strain of Mtb was treated with or without 0.25μg/mL INH and growth was monitored over time by the optical density (OD600), n=4. (H) ΔkatG Mtb was spread on Sauton agar medium containing 25μM C10 and/or 0.5μg/mL INH and incubated at 37°C for 3 weeks before images were taken. (I) ΔkatG Mtb was cultured in Sauton’s liquid medium containing 0, 10, or 25μM C10 with or without 0.25μg/mL INH and the CFU/mL were enumerated on 7H11 agar with no antibiotics to determine the number of viable bacteria in each culture at days 0 and 10 of treatment. A 2-way ANOVA with Tukey’s post test was performed to determine statistically significant differences. ns not significant, **** P<0.0001. Relevant comparisons are depicted in the figure, but for all pairwise comparisons please see Supplementary Table S4.

Western blot analysis indicates that the katGFS6 and katGW328L mutants express KatG protein variants that contain all necessary catalytic residues, while katGW198* does not (Fig. 4AB). To determine if the katGFS6 and katGW328L mutants retained KatG catalytic activity, we cultured each strain in liquid media with or without 0.25 μg/mL INH and monitored the growth of the culture by measuring OD600 over time. We found that while WT Mtb was completely inhibited by 0.25 μg/mL INH (Fig. 4C), the katGFS6 and katGW328L mutants were able to grow in the presence of INH, eventually reaching an OD600 over 10-fold above the inoculum (Fig. 4DE). However, both mutants exhibited a significant decrease in the OD600 compared to the untreated controls, indicating that although the katGFS6 and katGW328L mutants exhibit decreased sensitivity to INH, some KatG activity was retained to impart this modest growth inhibition in the presence of INH (Fig. 4DE). In contrast, the katGW198* and ΔkatG mutants were completely resistant and grew uninhibited in the presence of INH (Fig. 4FG), supporting that both of these mutations are katG-null alleles. Therefore, the katGFS6 and katGW328L mutants that are re-sensitized to INH by C10 are hypomorphic for katG, exhibiting decreased KatG activity leading to INH resistance, but retaining a residual level of KatG enzymatic activity (Fig. 4DE). In contrast, the katGW198* mutant that is not re-sensitized to INH by C10 exhibits no KatG activity (Fig. 4F), similar to a katG-null strain (Fig. 4G). Based on these data, we hypothesized that some KatG activity is required for C10 to enhance INH sensitivity. To test this hypothesis, we examined whether C10 could sensitize a ΔkatG mutant to INH. Deletion of katG phenocopied the katGW198* mutant and enabled Mtb to grow on agar and in liquid media containing both C10 and INH (Fig. 4HI), demonstrating that some KatG expression and activity is required for C10-mediated sensitization to INH.

C10 induces vulnerability to inhibition by INH without altering KatG activity or INH-NAD levels

Most strategies that renew sensitivity of bacterial pathogens to antibiotics do so by increasing the levels of active antibiotic. Key examples of this are β-lactamase inhibitors that prevent the degradation of β-lactam antibiotics (25) and the recent discovery of SMARt-420, which increases the conversion of ethionamide (ETH) to its active form, ETH-NAD, in Mtb (26). In addition, Mtb encodes the enzyme CinA that cleaves NAD-drug adducts to promote tolerance to antibiotics like INH and ETH (27), highlighting that regulation of active drug concentration is a major mechanism of modulating drug efficacy. Therefore, we investigated whether C10 sensitizes Mtb to INH by promoting KatG activity to enhance the conversion of INH to INH-NAD, thus increasing the levels of INH-NAD in the cell. We monitored the effects of C10 on KatG enzymatic activity in vitro by incubating purified KatG protein with H2O2, a natural substrate of KatG, and monitoring KatG catalase activity as measured by the H2O2 degradation rate. We found that C10 did not enhance the rate or kinetics of H2O2 degradation by KatG in vitro, indicating that C10 did not directly affect KatG catalase activity (Fig. S4A). We next tested if C10 could specifically promote INH activation by KatG by monitoring the conversion of INH to INH-NAD in vitro. Previous work showed that INH activation by KatG occurred most efficiently in the presence of Mn2+ (10, 28). Therefore, we incubated KatG protein in buffer containing Mn2+ with INH and NAD+ in the presence or absence of C10 and monitored the levels of C10, INH, NAD+, and INH-NAD by liquid chromatography-mass spectrometry (LC-MS). We found that while the level of C10 remained unchanged over the course of the experiment, INH and NAD+ were depleted from the reaction with a concomitant increase in INH-NAD, as expected since INH and NAD+ are consumed to produce INH-NAD (Fig. 5AD). C10 did not impact the rate or level of INH-NAD produced in these conditions. In addition, although we were able to detect the interaction between KatG and INH in vitro (Fig. S4B), we were unable to detect a direct interaction between C10 and KatG using a thermal shift assay (Fig. S4C), together supporting that C10 does not directly bind KatG or promote its enzymatic activity in vitro.

Figure 5: C10 enhances the bacterial sensitivity to INH-NAD without changing its activation.

Figure 5:

(A-D) Purified KatG protein (200nM) was incubated in 50mM potassium phosphate buffer pH 7.0 containing INH, NAD+, and 50μM MnCl2 with 0, 10, or 25μM C10, and samples were taken at the indicated time points and analyzed via LC/MS. For each ion, the peak intensity was calculated as the area under the curve for (A) INH-NAD, (B) INH, (C) NAD+, and (D) C10, n=3. (E) Either WT (top) or katGFS6 Mtb (bottom) was cultured in Sauton’s liquid medium in the presence of 0, 5, or 25μM C10 for 3 days, and whole cell lysate was collected for a Western blot using a monoclonal α-KatG antibody or an α-RpoB antibody as a loading control, n=3. Note that the KatG blot from the katGFS6 samples has a high amount of background since the exposure time for this blot is substantially longer than for WT samples due to the very low level of KatG protein in this strain. (F) WT or katGFS6 Mtb was cultured in Sauton’s liquid medium in the presence of 0, 10, or 25μM C10 for 6 days, and whole cell lysate was collected to measure the catalase activity of the sample as a proxy for KatG activity, n=2. Catalase activity is normalized to the amount of total protein in the whole cell lysate sample. Note that lysate from the ΔkatG mutant, n=3, harbors no detectable amount of catalase activity compared to buffer alone, n=3, demonstrating that the assay is specific for KatG. (G) Mtb with the indicated katG allele was cultured for 3 days in Sauton’s liquid medium in the presence and absence of 25μM C10 and/or 0.25μg/mL INH, after which polar metabolites were extracted from the culture and analyzed by LC/MS. The area under the curve was calculated by the integration of the peak to determine the peak intensity of INH-NAD in each bacterial sample, n=3. Statistically significant differences were identified by a 2-way ANOVA with Tukey’s post test, and the relevant comparisons are indicated on the graph. ns not significant, *** P<0.001, **** P<0.0001. For all pairwise comparisons see Supplementary Table S5.

To determine if C10 affects KatG activity within the bacterium, we examined whether C10 promotes KatG expression, which could explain how C10 sensitizes WT and katG hypomorphic strains to INH but does not sensitize katG-null strains. We treated both WT and katGFS6 Mtb with C10 for 3 days and collected whole cell lysate to perform a western blot analysis for KatG. We found that C10 did not increase the protein levels of KatG in these conditions (Fig. 5E). We also monitored the effect of C10 on KatG catalase activity in Mtb by treating the bacteria with C10 for 6 days, collecting whole cell lysate, and measuring the H2O2 degradation rate of the lysate. The ΔkatG mutant exhibited no H2O2 degradation in this assay, demonstrating that the assay is specific for KatG (Fig. 5F). While the lysate from katGFS6 Mtb had significantly more activity than the ΔkatG mutant, this strain exhibited a greater than 10-fold reduction in catalase activity compared to WT, consistent with the katGFS6 strain being hypomorphic for katG. We found that C10 did not change the H2O2 degradation rate of WT or katGFS6 Mtb (Fig. 5F), confirming that C10 treatment does not enhance the expression or activity level of KatG within Mtb. However, this finding did not rule out whether C10 could enhance the levels of INH-NAD within the bacteria without affecting KatG activity. For example, deletion of cinA, which encodes an INH-NAD degrading enzyme, leads to elevated INH-NAD accumulation and increased INH sensitivity by decreasing the rate of INH-NAD degradation in Mtb (27). To determine if C10 promotes INH-NAD accumulation in Mtb, we cultured WT, katGFS6, and katGW328L Mtb with and without C10 and/or INH for 3 days, collected aqueous metabolite extracts from the bacteria, and measured the amount of activated INH-NAD in the bacterial extract using LC-MS. We included the katG-null mutants katGW198* and ΔkatG as controls. We found that upon treatment with INH alone, WT, katGFS6, and katGW328L strains all accumulated INH-NAD, and the katGFS6 and katGW328L mutants produced significantly decreased levels of INH-NAD compared to WT Mtb, confirming that these strains are indeed hypomorphic for katG (Fig. 5G). As expected, the katG-null mutants katGW198* and ΔkatG were deficient in INH-NAD synthesis (Fig. 5G). C10 did not significantly increase the amount of INH-NAD in any of the strains tested (Fig. 5G) and, therefore, does not affect INH-NAD synthesis or degradation. This data demonstrates that C10 sensitizes Mtb to INH through a novel mechanism of action without impacting the levels of INH-NAD in the bacteria.

C10 sensitizes Mtb to direct inhibition of InhA without inhibiting InhA itself

Our data indicates that although the effect of C10 on INH sensitivity relies on KatG activity, C10 does not increase the expression or enzymatic activity of KatG. Based on these findings, we hypothesize that C10 acts downstream of KatG to enhance the antibacterial activity of INH-NAD after it is produced, such that even the katG hypomorphic strains that produce lower levels of INH-NAD become inhibited by this lower concentration in the presence of C10. INH-NAD inhibits Mtb growth by binding the NADH binding pocket in the enoyl-acyl carrier protein reductase InhA, leading to inhibition of mycolic acid biosynthesis (13, 14, 18, 29, 30). Therefore, it is possible that C10 renders Mtb more sensitive to inhibition of InhA. To test this possibility, we cultured WT Mtb with C10 and/or NITD-916, a direct inhibitor of InhA that does not require KatG or any other known enzyme for activation (31), and quantified the surviving CFU after 10 days of treatment. Similar to the effect of C10 on INH sensitivity, we found that treating Mtb with C10 in combination with NITD-916 caused a significant decrease in the number of surviving bacteria compared to NITD-916 alone, leading to an additional 2–3 orders of magnitude decrease in survival (Fig. 6A). Therefore, C10 increases the bacterial sensitivity to direct InhA inhibition.

Figure 6: C10 enhances the vulnerability of Mtb to InhA inhibition without altering bacterial InhA activity.

Figure 6:

(A) WT Mtb was cultured in Sauton’s liquid medium with the indicated concentrations of C10, INH, and/or NITD-916, and CFU/mL were enumerated on day 0 and 10 of treatment to determine the number of viable bacteria in each sample, n=6. (B) WT or katGW328L Mtb was cultured in Sauton liquid medium, treated with 25μM C10 and/or 0.25μg/mL INH, and immediately exposed to 2μCi/mL of 14C-labeled acetate. After 20 hours, lipids were extracted and analyzed by TLC to measure the de novo synthesis of mycolic acids and other lipids. The TLC plate was developed with 75:10:1 Chloroform:Methanol:H2O and radioactivity was analyzed by phosphorimaging. Bands corresponding to free mycolic acid (MA), fatty acid, trehalose dimycolate (TDM), and 14C-acetate were identified by comigration with a standard. Trehalose monomycolate (TMM) is indicated with a * to emphasize that this lipid is putatively identified, and not correlated with a standard. The plate in (B) is representative of 3 biological replicates, and the standards and additional replicates are shown in Supplementary Figure S5. (C-D) The intensity of bands corresponding to (C) TDM or (D) free MA were quantified in Image J, and normalized to the DMSO sample, with each WT sample being normalized to WT DMSO and each katGW328L sample being normalized to katGW328L DMSO in order to compare across replicates on separate plates, n=3. Statistically significant differences were determined by 2-way ANOVA and select pairwise comparisons are depicted in the figure. ns not significant, *** P<0.001, **** P<0.0001. For all pairwise comparisons see Supplementary Table S6.

One possible mechanism by which C10 could enhance the susceptibility of Mtb to InhA inhibition would be to decrease the expression or activity of InhA, thereby lowering the amount of INH-NAD or NITD-916 required to inhibit this target (32). When we analyzed our previously published RNA-sequencing data from C10-treated cultures, we found that after treatment with 25μM C10 for 48 hours, inhA was expressed at 1.1-fold relative to the untreated control (19), demonstrating that C10 does not decrease inhA expression at the transcriptional level. We next examined whether C10 compromises InhA activity by culturing Mtb with 14C-acetate and measuring de novo mycolic acid biosynthesis by thin layer chromatography (TLC). In the final steps of mycolic acid biosynthesis, the mycolic acid moiety is coupled to trehalose to form trehalose monomycolate (TMM), which can be transported out of the cell to the envelope (33, 34). The mycolic acid can then be trans-esterified from TMM to the arabinose moieties of arabinogalactan to form the inner leaflet of the mycolic acid layer that is covalently attached to the underlying cell wall layers (3537). Alternatively, the mycolic acid can be trans-esterified to a second TMM molecule to form trehalose dimycolate (TDM) (38), which comprises a major component of the freely associated lipid layer that is intercalated within the covalently attached mycolic acids. Free mycolic acid, TMM, and TDM are the primary forms of mycolic acid that are not covalently linked to the cell wall, making them readily extractable and easy to separate by TLC, so we focused our analysis on these mycolic acid species as a read-out for de novo biosynthesis. Cultures of WT and katGW328L Mtb were labeled with 14C-acetate for 20 hours in the presence or absence of C10 and/or INH before extracting whole cell lipids and monitoring the incorporation of the 14C into mycolic acids by TLC (Fig. 6BD; Fig. S5). As standards, we used TDM purified from H37Ra (Invivogen), free mycolic acid saponified and extracted from the H37Ra TDM, the representative fatty acid oleic acid, and free 14C-acetate. Although we did not have a standard for TMM, we identified a band that we predict corresponds to TMM in our samples since it migrated slower than TDM due to the overall increased polarity and based on the migration pattern reported in published studies (39).

As expected, INH treatment of WT Mtb decreased the intensity of bands corresponding to free mycolic acid, TDM, and TMM (Fig. 6BD; Fig. S5AD), and significantly increased the intensity of a band that co-migrates with oleic acid (Fig. S5E). We believe this oleic acid co-migrating band represents FAS-I-generated fatty acids that serve as substrates for mycolic acid biosynthesis, thus, it is not surprising that inhibition of InhA would lead to their accumulation (1517). In contrast, INH treatment of katGW328L Mtb did not affect the levels of free mycolic acids, TDM, or TMM over the 20 hour period, supporting less efficient InhA inhibition due to the mutation in katG and decreased INH-NAD levels (Fig. 6BD; Fig. S5). Addition of C10 on its own or in combination with INH did not decrease the synthesis of free mycolic acid, TDM, or TMM in the bacteria (Fig. 6BD; Fig. S5), demonstrating that C10 does not inhibit InhA within the bacteria. While these studies do not rule out that C10 impacts the mycobacterial cell envelope in other ways, our data demonstrate that C10 potentiates the bactericidal effect of InhA inhibition without inhibiting InhA itself or enhancing the ability of INH-NAD to inhibit InhA in Mtb.

Discussion:

Together, our findings show that C10 sensitizes Mtb to INH without changing the concentration of INH-NAD or decreasing the activity of its target InhA, which are the two predominant mechanisms of potentiating INH reported in the literature thus far (27, 32, 40, 41). Preventing DosR-induced growth arrest and increasing Mtb respiration has also been shown to enhance the bactericidal effect of INH (42, 43). However, C10 does not inhibit DosR signaling and decreases Mtb respiration (19), indicating that C10 is also not working through these mechanisms. In addition, our studies herein uncouple the effect of C10 on ATP production from the sensitization to INH. Instead, our data supports a model where C10 potentiates INH by making Mtb particularly vulnerable to the depletion of cell wall mycolic acids, even in the INH-resistant katG hypomorphs that accumulate a significantly lower concentration of INH-NAD. Mycolic acid biosynthesis is essential in mycobacteria and not conserved in non-actinobacteria or eukaryotes, making this process a very attractive target for the development of specific antimycobacterials to treat TB. This is exemplified by INH, which remains a cornerstone of TB treatment, as well as the recent approval of mycolic acid inhibitors delamanid and pretomanid for the treatment of TB and the ongoing development of direct InhA inhibitors, such as NITD-916 (31, 44, 45). In contrast to the potentiation strategies that increase the INH-NAD concentration or decrease InhA expression, which would be specific for INH or InhA inhibitors, respectively, it remains possible that C10 could sensitize Mtb more generally to inhibitors of mycolic acid biosynthesis.

The clinical utility of INH is currently being threatened by the increasing rates of INH-resistant TB cases. While resistance to INH can occur through multiple mechanisms, the predominant cause of INH resistance is mutation of katG, which accounts for an estimated 78.6% of INH resistant strains (8). Clinically, mutations in katG are considered to confer a high level of resistance, often necessitating the use of an alternative treatment regimen. However, the overwhelming majority of these katG mutations are not null alleles. The most common resistance variant is an S315T amino acid substitution in KatG that decreases the enzyme’s affinity for INH (8, 46, 47). This S315T mutation and other single amino acid substitutions that are commonly identified in resistant isolates significantly impair the ability of KatG to activate INH, but these mutations do not completely abolish INH-NAD synthesis by the KatG enzyme in vitro (47, 48). The complete inactivation of KatG is likely detrimental to Mtb survival in the host due to the role of KatG in the oxidative stress response, which could explain why the majority of INH resistant clinical isolates harbor single amino acid substitutions as opposed to more deleterious mutations (4951). We found that C10 selectively potentiates killing by INH in katG mutants that express katG and retain its enzymatic activity, revealing that it is possible to rescue the utility of INH against clinically relevant INH-resistant isolates that retain a low level of KatG activity.

INH resistance can also occur upon mutation of the inhA locus that either results in increased expression of inhA or in expression of an InhA variant that has decreased binding to INH-NAD. An estimated 6.8% of INH-resistant clinical isolates harbor mutations in the inhA promoter without a concurrent katG mutation (8). Since these mutations confer a low level of INH resistance, patients infected with these strains can be treated with a higher dose of INH to successfully clear the infection (52). Although it has not been directly tested, we anticipate that C10 would potentiate INH efficacy against inhA promoter mutants by inducing sensitivity to even low level inhibition of mycolic acid synthesis in these strains.

In addition to resistance, INH efficacy can be limited by subinhibitory concentrations of antibiotic at the site of infection. For instance, a clinical study that quantified the distribution of antibiotic across lung lesions from TB patients within 24 hours of dosing showed that approximately 35% of lesions harbored sub-inhibitory concentrations of INH, likely due to a combination of drug diffusion and host metabolism (5). Therefore, the Mtb within these lesions likely experiences fluctuating concentrations of antibiotic that can be sub-inhibitory. By making Mtb more sensitive to InhA inhibition, C10 represents a possible strategy to sensitize Mtb to even sub-inhibitory concentrations of antibiotic, suggesting that in addition to circumventing INH resistance, C10 could enhance the efficacy of INH at the site of infection, although this remains to be tested. While the precise mechanism by which C10 induces sensitivity to InhA inhibition remains unclear, by deciphering how C10 promotes susceptibility to INH and NITD-916, we could reveal cryptic vulnerabilities in Mtb that can be exploited to enhance our current antimicrobial regimen.

Materials and Methods

Bacterial strains and growth conditions

Mtb Erdman strains (Table 1) were inoculated from a freezer stock into Middlebrook 7H9 liquid medium supplemented with 60 μL/L oleic acid, 5 g/L BSA, 2 g/L dextrose, 0.003 g/L catalase (OADC), 0.5% glycerol, and 0.05% Tween 80 and cultured at 37°C. Actively growing Mtb was then inoculated into Sauton’s liquid medium (0.5 g/L KH2PO4, 0.5 g/L MgSO4, 4.0 g/L L-asparagine, 6% glycerol, 0.05 g/L ferric ammonium citrate, 2.0 g/L citric acid, and 0.01% (wt/vol) ZnSO4, pH 7.0) supplemented with 0.05% Tween 80 and grown to late-log phase before use in growth curve and survival experiments. The ΔkatG strain was generated using specialized transduction with the temperature sensitive phage phAE87 engineered to harbor sequence homologous to regions upstream (Erdman nucleotides 2144027–2144776) and downstream (Erdman nucleotides 2146989–2147705) of katG and selected on 50μg/mL hygromycin as previously described (53). For Mtb growth and survival experiments, Mtb was inoculated into roller bottles containing Sauton’s medium supplemented with Tween 80 at a starting OD600 of 0.1, and growth was measured by OD600 and survival was monitored as CFU/mL. Viable CFU from bacterial cultures were enumerated on Middlebrook 7H11 agar medium supplemented with OADC and 0.5% glycerol and plates were incubated at 37°C with 5% CO2 for 2–3 weeks. To select for mutants resistant to both C10 and INH, the equivalent of 0.5mL of OD600=1.0 of Mtb growing in 7H9+OADC media was spread on Sauton’s agar containing 25μM C10 and 0.2μg/mL INH and incubated at 37°C and 5% CO2 for 4 months. Isolated colonies were passaged on agar containing 25μM C10 and 0.2μg/mL INH to ensure that they were resistant before performing whole genome sequencing. For agar growth assays, 0.003 g/L bovine catalase was included in the Sauton’s agar, and the equivalent of 2.5mL of OD600=1.0 of Mtb was spread on the agar surface to enhance the reproducibility of Mtb growth on the agar plates.

Table 1:

Mtb strains used in this study

Strain Description Source
WT Erdman
GHTB136 Erdman selected on 200μM C10, harbors a C to A single nucleotide substitution 69 bp from Rv0731c and 92 bp from secY This study
GHTB146 Erdman selected on 200μM C10, harbors an A to G single nucleotide substitution 12 bp from lpdA This study
GHTB149 Erdman selected on 200μM C10, harbors a single nucleotide substitution in Rv0830 resulting in a L292V amino acid change This study
katG FS6 Erdman selected on 0.5μg/mL INH (19)
katG W328L Erdman selected on 0.5μg/mL INH (19)
katGW198* Erdman selected on 0.2μg/mL INH and 25μM C10, harbors a C to T single nucleotide substitution at position 2146398 This study
GHTB089 Erdman selected on 0.2μg/mL INH and 25μM C10, harbors deletion of Erdman nucleotides 2145809–2173696 This study
GHTB092 Erdman selected on 0.2μg/mL INH and 25μM C10, harbors deletion of Erdman nucleotides 2132215–2170824 This study
ΔkatG Erdman mutant generated by specialized transduction, in which nucleotides 2144776–2146988 were replaced with a Hygromycin resistance marker via double homologous recombination This study

Whole genome sequencing

Genomic DNA was isolated using cetyltrimethylammonium bromide-lysozyme lysis, followed by chloroform-isoamyl alcohol extraction and isopropanol precipitation, as previously described (54). Whole-genome sequencing was performed by use of an Illumina NovaSeq 6000. The identification of single nucleotide polymorphisms was done using SeqMan NGen software (DNASTAR). The genomes were assembled and compared to the genomic DNA from the WT parental control strain, using Integrative Genome Viewer to visualize and confirm changes within regions of interest (55). Whole genome sequencing data is deposited in the Sequence Read Archive (Accession #XXXX).

Preparation of compounds

C10 was synthesized using previously described methods (56, 57) and prepared as an imidazole salt as described previously (19). Stocks of C10-imidazole were resuspended in DMSO. INH (Sigma) was dissolved in water, and NITD-916 (Sigma) was dissolved in DMSO. In all experiments, the concentration of both DMSO and imidazole were normalized across all samples to ensure that any differences were due to the effect of the indicated compounds and not due to DMSO or imidazole.

Detection of ATP

Mtb growing in Sauton’s media was treated with the indicated concentration of C10 for 24 hours before the OD600 of each culture was measured and samples were removed. Mtb samples were inactivated at >95°C for 20 min and stored at −20°C until analyzing the ATP levels using the BacTiter Glo assay (Promega) as previously described (19). Samples were diluted 1:10, then mixed 1:1 with the BacTiter Glo reagent in a white, opaque 96-well dish, and the luminescence was read on a Synergy HT plate reader with a 1 second integration. The relative luminescence units (RLU) were calculated by subtracting the luminescence of a media only control from the luminescence value of each sample. The RLU/OD600 was determined to account for differences in bacterial density, and the fold-change in each sample was calculated relative to the average of the 0μM C10 control from that experiment to facilitate combining of multiple experiments onto a single graph.

Resazurin assay

Logarithmically growing Mtb was inoculated into Sauton’s medium in 96 well plates with wells containing increasing concentrations of C10. M. tuberculosis was inoculated at an ODλ600 of 0.0025 in 200 μL per well. The plates were incubated at 37°C in 5% CO2 for 1 week, at which point 32.5 μL of a mixture containing an 8:5 ratio of 0.6 mM resazurin (Sigma) dissolved in 1X phosphate-buffered saline to 20% Tween 80 was added, and the production of fluorescent resorufin was measured on a Synergy HT plate reader with excitation λex = 530 nm and emission λem = 590 nm after incubation at 37°C in 5% CO2 overnight. For each assay, medium alone served as a negative control, and untreated Mtb was included as a positive control. The percent inhibition was calculated as the {[(fluorescence of the positive control – fluorescence of the negative control) – (fluorescence of the sample – fluorescence of the negative control)]/(fluorescence of the positive control – fluorescence of the negative control)} × 100.

Quantitative reverse transcription PCR (qRT-PCR)

RNA was isolated from WT, GHTB136, and GHTB146 Mtb growing in Sauton’s medium using Trizol, and purified by chloroform extraction followed by isopropanol precipitation. cDNA was prepared using the SuperScript III first strand synthesis kit (Invitrogen), and qPCR was performed using a SYBR green kit (Bio-Rad) with gene-specific primers (Table 2) on a CFX96 Real Time System (Bio Rad). The relative expression of genes was calculated using the 2−ΔΔCt method, with sigA serving as an internal reference control gene.

Table 2:

Primers used in this study

Primer # Primer Name Sequence
GHP102 lpdA qPCR FWD ACCCGGAAACAACCCAAGTTAC
GHP103 lpdA qPCR REV TGGCGTCGTCGAAGTCGATATG
GHP104 glpD2 qPCR FWD AGCCGCTCCTCGAAGATGTTCC
GHP105 glpD2 qPCR REV ACGGCAGCGGCTTGACCAAATG
GHP106 Rv0731c qPCR FWD CTTGGCGTCCAGTGTGGGTTTG
GHP107 Rv0731c qPCR REV ACTGGCCATGCGTACGAAGAAG
GHP140 Rv3304 qPCR FWD GCGGACGAGAAGAACCTTGAC
GHP141 Rv3304 qPCR REV GGCCATCACACCTAGATAGCG
GHP142 secY qPCR FWD CTGGGCATCGTCATTCTCTAC
GHP143 secY qPCR REV CCGGAGAACAGGTTGATCAG
GHP144 adk qPCR FWD GGAAGCCAAACGCTACTTGGATG
GHP145 adk qPCR REV CGTTCGAGCATCTCGTGAAG
GHP146 mapA qPCR FWD GCGACAAGGGAATCGCTTCAG
GHP147 mapA qPCR REV TCCCGAACGAGCGTCCATAAC
GHP001 katG DS FWD XmaI GCCCGGGGTTGGCCACCTCCGTGTCGAGC
GHP002 katG DS REV XbaI GTCTAGATGCGCTGATTCGGGTTGATCG
GHP003 katG US FWD HindIII GAAGCTTCACAGCATTCCTTCCAGGAGTTGGTG
GHP004 katG US REV XhoI GCTCGAGACCCTCTACCACCTTCCTGCC
GHP097 katG pGEX FWD EcoRI GGAATTCGTGCCCGAGCAACACCCACCCATTAC
GHP098 katG pGEX REV NotI GGCGGCCGCATCAGCGCACGTCGAACCTGTCGAG

Western blot for KatG protein

Mtb samples were pelleted and resuspended in buffer containing 10mM sodium phosphate pH 8.0, 150mM NaCl, 2mM ETDA, 1mM PMSF, 0.1% NP-40, and a 1X protease inhibitor cocktail (Roche), then lysed by bead beating, and filtered twice through a 0.22μm Spin-X column (Costar) to remove unlysed Mtb. SDS-polyacrylamide gel electrophoresis was performed and samples were transferred to a nitrocellulose membrane, after which KatG was detected using a mouse monoclonal α-KatG antibody used at 1:500 dilution (clone IT-57; BEI Resources). Either CarD or RpoB served as a loading control, using a mouse monoclonal α-CarD antibody at 1:2000 dilution (clone 10F05; Memorial Sloan-Kettering Cancer Center) or a mouse monoclonal α-RpoB antibody at 1:1000 dilution (clone 8RB13; Neoclone). The membrane was probed with a goat anti-mouse antibody conjugated to horseradish peroxidase and bands were visualized using the Western Lighting Plus-ECL reagent (Perkin Elmer). When performing the KatG expression analysis in response to C10 treatment, the amount of protein in each sample was measured by BCA (Pierce) and the amount of protein loaded in each lane was normalized to 67ng to facilitate comparisons between samples.

Purification of Mtb KatG protein

The Mtb katG coding region was cloned into NotI and EcoRI sites in the pGEX-6P-1 expression vector to translationally fuse glutathione-S-transferase to the N-terminus of the KatG protein and the expression of the fusion protein was induced in logarithmically growing E. coli BL21-DE3 cells by treating 1L of cells with 0.1mM IPTG for 4 hours. Cells were pelleted, resuspended in 20mL 1X PBS containing a 1X protease inhibitor cocktail, and lysed twice in a cell disruptor. Lysate was treated with 9U/mL benzonase (Sigma) and clarified by centrifugation. GST-KatG was purified from the supernatant by incubating lysate overnight with glutathione agarose resin (Goldbio), washed with 300mL 1X PBS, and eluted from the resin by cleaving the KatG protein from the GST tag using PreScission protease in buffer containing 50mM Tris-HCl pH 7.0, 150mM NaCl, 1mM EDTA, and 1mM DTT.

Thermal shift assay on KatG protein

The melting temperature (Tm) of KatG in the presence of C10 or INH was determined by differential scanning fluorimetry. Purified Mtb KatG protein (1.1μM) was incubated with INH or C10 in 50mM potassium phosphate buffer pH 7.0 containing 50μM MnCl2 before mixing samples with SYPRO Orange (ThermoFisher) at a final concentration of 1X in a 96-well PCR plate. The plate was incubated for 5 seconds at increasing temperatures in 0.5°C increments from 10–95°C and fluorescence was monitored over time in the HEX channel on a CFX96 Real Time System (Bio Rad). The Tm was calculated by fitting curves with a Boltzmann sigmoidal equation in GraphPad Prism, and the ΔTm was calculated as the difference between the Tm of each sample and the average of the untreated control samples

Hydrogen peroxide degradation assay

The catalase activity of either purified KatG or Mtb cell lysates was measured in a UV/Vis spectrophotometer using quartz cuvettes. For in vitro assays of purified KatG activity, 1.9mL of 50mM potassium phosphate buffer pH 7.0 containing 25nM purified KatG was incubated with or without C10 and/or INH at 30°C for 5min and the sample was used to blank the spectrophotometer before the indicated concentration of H2O2 was added to initiate the reaction, bringing the final volume of the reaction to 2mL. For samples containing Mtb lysate, the samples were bead beat as described above and the protein concentration in the lysate was measured by BCA (Pierce). Samples were normalized such that 25μg of total cell protein was present in each assay sample in 1.9mL of 50mM potassium phosphate buffer pH 7.0, and the reactions were initiated with the addition of H2O2 to a concentration of 5mM in 2mL final volume. The absorbance at 240nm was read every 10 seconds for 2 min, and the negative slope of the curve was used to calculate the rate of H2O2 degradation. The absorbance was converted to molarity using the extinction coefficient for H2O2, ε240=43.6M−1cm−1.

INH-activation assay and detection of INH-NAD in Mtb

The activation of INH was monitored in vitro using 200nM purified KatG protein in 50mM potassium phosphate buffer pH 7.0, 50μM NAD+, 50μM INH, 50μM MnCl2, and the indicated concentration of C10 in a final volume of 1mL. At the indicated time points, 100μL were removed from the reaction and inactivated in 100μL ice cold methanol and stored at −20°C before liquid chromatography/mass spectrometry (LC/MS). To monitor INH activation in live Mtb, 50mL cultures of Mtb in Sauton’s media without Tween 80 were treated with the indicated concentration of C10 and/or INH for 3 days. To extract polar metabolites, the cultures were pelleted, washed twice in H2O, and resuspended in 1.5mL of 2:1 chloroform:methanol in glass conicals. Samples were kept on ice and vortexed each for 1 minute in 20 second intervals, and stored at 4°C overnight. 375μL of H2O was added, the samples were vortexed for 1 minute in 20 second intervals, keeping the samples on ice. Samples were incubated at room temperature for 1 hour with constant agitation, and then centrifuged for 10 minutes at 1000 RPM. The top aqueous layer was transferred to a fresh 1.5mL microcentrifuge tube, stored overnight at −20°C, centrifuged for 5 minutes to pellet any insoluble material, and the supernatant was transferred to a fresh tube. INH-NAD was detected using methods similar to those previously described (27, 41, 58) with some modifications. UPLC/MS was performed with an Agilent 1290 Infinity UHPLC system interfaced with an Agilent 6530 QTOF mass spectrometer. Hydrophilic interaction liquid chromatography (HILIC) analysis was performed by using a HILICON iHILIC-(P) Classic column with the following specifications: 100 mm × 2.1 mm, 5 μm. Mobile-phase solvents were composed of A = 20 mM ammonium bicarbonate, 0.1% ammonium hydroxide (adjusted to pH 9.2) and 2.5 μM medronic acid in water:acetonitrile (95:5) and B = 2.5 μM medronic acid in acetonitrile:water (95:5). The column compartment was maintained at 45°C for all experiments. The following linear gradient was applied at a flow rate of 250 μL/min: 0–1 min: 90% B, 1–12 min: 90–35% B, 12–12.5 min: 35–20% B, 12.5–14.5 min: 20% B. The column was re-equilibrated with 20 column volumes of 90% B. The injection volume was 2 μL for all experiments. Data were acquired in both positive and negative ion modes. The mass/charge (m/z) and retention times (RT) of the compounds were as follows: INH m/z=138.066188, RT=1.87 min; C10 m/z=378.11584, 0.92 min; NAD+ m/z=664.116399, RT=6.12 min; INH-NAD m/z=769.137863, RT=5.70 min.

Measurement of de novo lipid synthesis by 14C labeling and TLC

To monitor de novo mycolic acid biosynthesis, Mtb growing in Sauton’s liquid medium was adjusted to OD600 0.5, treated with the indicated concentrations of C10 and/or INH in 1mL final volume, and immediately exposed to 2μCi/mL 14C-acetate (Perkin Elmer). After incubation at 37°C for 20 hours, the cells were pelleted, and resuspended in 2:1 chloroform:methanol, vortexed, then samples were pelleted to remove insoluble cell debris, and the supernatant was transferred to a fresh vial. To separate lipid species by TLC, 40μL of the sample was added dropwise to a HPTLC plate coated with silica gel 60 matrix (Sigma). TLC plates were developed in 75:10:1 chloroform:methanol:H2O and imaged by phosphorimaging on a Typhoon laser-scanner (Cytiva). The intensity of each band was quantified in ImageJ, normalized to the total intensity in the whole lane, and the fold change was quantified relative to the untreated control for each replicate. To assign putative identities to relevant bands, standards for 14C-acetate, TDM, free mycolic acid, and oleic acid were run on each plate. TDM purified from H37Ra (Invivogen) was derivatized to generate a free mycolic acid standard using methods similar to those previously described (59). Briefly, 100μL of 0.5mg/mL TDM in isopropanol was subjected to an alkaline ester hydrolysis by mixing with 2μL H2O and 5μL of 10M KOH, and heating to 90°C for 1 hour to ensure efficient saponification. The resulting mycolic acids were purified from the trehalose by neutralizing the reaction with 50μL 1.2M HCl, adding 100μL chloroform, 100 μL H2O, vortexing, and separating the organic phase from the aqueous layer to obtain free mycolic acids in chloroform.

Supplementary Material

Supplement 1

Significance:

Isoniazid (INH) is a critical frontline antibiotic to treat Mycobacterium tuberculosis (Mtb) infections. INH efficacy is limited by its suboptimal penetration of the Mtb-containing lesion and by the prevalence of clinical INH-resistance. We previously discovered a compound, C10, that enhances the bactericidal activity of INH, prevents the emergence of INH-resistant mutants, and re-sensitizes a set of INH-resistant mutants to INH. Resistance is typically mediated by katG mutations that decrease the activation of INH, which is required for INH to inhibit the essential enzyme InhA. Our current work demonstrates that C10 re-sensitizes INH-resistant katG-hypomorphs without enhancing the activation of INH. We furthermore show that C10 causes Mtb to become particularly vulnerable to InhA inhibition without compromising InhA activity on its own. Therefore, C10 represents a novel strategy to curtail the development of INH resistance and to sensitize Mtb to sub-lethal doses of INH, such as those achieved at the infection site.

Acknowledgements

We thank Drs. Michael Glickman and Allison Fay for helpful guidance with the 14C labeling experiments. We thank the Genome Technology Access Center in the Department of Genetics at Washington University School of Medicine for help with genomic analysis. The Center is partially supported by NCI Cancer Center Support Grant #P30 CA91842 to the Siteman Cancer Center and by ICTS/CTSA Grant# UL1TR002345 from the National Center for Research Resources (NCRR), a component of the National Institutes of Health (NIH), and NIH Roadmap for Medical Research. This publication is solely the responsibility of the authors and does not necessarily represent the official view of NCRR or NIH. This work was supported by a National Science Foundation Graduate Research Fellowship DGE-1745038 (G.A.H.), NIH T32AI007172 (E.R.W.), a Beckman Young Investigator Award from the Arnold and Mabel Beckman Foundation (C.L.S.), an Interdisciplinary Research Initiative grant from the Children’s Discovery Institute of Washington University and St. Louis Children’s Hospital (C.L.S.), NIH R01 AI134847 (C.L.S. and F.A), and NIH R35 ES028365 (G.P.J.). Parts of this project were also supported by the Swedish Research Council 2018-04589 and 2021-05040J (F.A.), the Kempe Foundation SMK-1755 (F.A.), the Erling-Persson Foundation (F.A.), and support under the framework of the JPIAMR – Joint Programming Initiative on Anti-microbial Resistance 2018-00969 (F.A.).

Footnotes

Competing Interests

The authors have no competing financial interests to declare, but acknowledge that C.L.S. and F.A. have ownership in the company QureTech Bio AB that licenses C10 and, therefore, may financially benefit if the company is successful in marketing its product, and the Patti laboratory has a research collaboration agreement with Agilent Technologies.

References:

  • 1.World Health Organization. 2020. Global Health Estimates 2020: Deaths by Cause, Age, Sex, by Country and by Region. Geneva. [Google Scholar]
  • 2.Pai M, Kasaeva T, Swaminathan S. 2022. Covid-19’s Devastating Effect on Tuberculosis Care — A Path to Recovery. New England Journal of Medicine 386:1490–1493. [DOI] [PubMed] [Google Scholar]
  • 3.Jain P, Weinrick BC, Kalivoda EJ, Yang H, Munsamy V, Vilcheze C, Weisbrod TR, Larsen MH, O’Donnell MR, Pym A, Jacobs WR. 2016. Dual-Reporter Mycobacteriophages (Φ2DRMs) Reveal Preexisting Mycobacterium tuberculosis Persistent Cells in Human Sputum. mBio 7:e01023–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sarathy JP, Via LE, Weiner D, Blanc L, Boshoff H, Eugenin EA, Barry CE, Dartois VA. 2018. Extreme drug tolerance of mycobacterium tuberculosis in Caseum. Antimicrob Agents Chemother 62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Prideaux B, Via LE, Zimmerman MD, Eum S, Sarathy J, O’Brien P, Chen C, Kaya F, Weiner DM, Chen PY, Song T, Lee M, Shim TS, Cho JS, Kim W, Cho SN, Olivier KN, Barry CE, Dartois V. 2015. The association between sterilizing activity and drug distribution into tuberculosis lesions. Nat Med 21:1223–1227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Lavin RC, Tan S. 2022. Spatial relationships of intra-lesion heterogeneity in Mycobacterium tuberculosis microenvironment, replication status, and drug efficacy. PLoS Pathog 18:e1010459-. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.World Health Organization. 2022. WHO consolidated guidelines on tuberculosis. Module 4: treatment – drug-susceptible tuberculosis treatment. Geneva. [PubMed] [Google Scholar]
  • 8.Dean AS, Zignol M, Cabibbe AM, Falzon D, Glaziou P, Cirillo DM, Köser CU, Gonzalez-Angulo LY, Tosas-Auget O, Ismail N, Tahseen S, Ama MCG, Skrahina A, Alikhanova N, Kamal SMM, Floyd K. 2020. Prevalence and genetic profiles of isoniazid resistance in tuberculosis patients: A multicountry analysis of cross-sectional data. PLoS Med 17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Johnsson K, Schultz PG. 1994. Mechanistic Studies of the Oxidation of Isoniazid by the Catalase Peroxidase from Mycobacterium tuberculosis. J Am Chem Soc 116:7425–7426. [Google Scholar]
  • 10.Lei B, Wei C-J, Tu S-C. 2000. Action Mechanism of Antitubercular Isoniazid: Activation by Mycobacterium tuberculosis KatG, Isolation, and Characterization of InhA Inhibitor. Journal of Biological Chemistry 275:2520–2526. [DOI] [PubMed] [Google Scholar]
  • 11.Zhang Y, Heym B, Allen B, Young D, Cole S. 1992. The catalase - Peroxidase gene and isoniazid resistance of Mycobacterium tuberculosis. Nature 358:591–593. [DOI] [PubMed] [Google Scholar]
  • 12.Wengenack NL, Rusnak F. 2001. Evidence for Isoniazid-Dependent Free Radical Generation Catalyzed by Mycobacterium tuberculosis KatG and the Isoniazid-Resistant Mutant KatG(S315T). Biochemistry 40:8990–8996. [DOI] [PubMed] [Google Scholar]
  • 13.Rozwarski DA, Grant GA, Barton DHR, Jacobs WR, Sacchettini JC. 1998. Modificafion of the NADH of the lsoniazid Target (InhA) from Mycobacterium tuberculosis. Science (1979) 279:19–23. [DOI] [PubMed] [Google Scholar]
  • 14.Rawat R, Whitty A, Tonge PJ. 2003. The isoniazid-NAD adduct is a slow, tight-binding inhibitor of InhA, the Mycobacterium tuberculosis enoyl reductase: Adduct affinity and drug resistance. Proc Natl Acad Sci U S A 100:13881–13886. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Quemard A, Sacchettini JC, Dessen A, Vilcheze C, Bittman R, Jacobs WR, Blanchard JS. 1995. Enzymic Characterization of the Target for Isoniazid in Mycobacterium tuberculosis. Biochemistry 34:8235–8241. [DOI] [PubMed] [Google Scholar]
  • 16.Marrakchi H, Lanéelle G, Quémard A. 2000. InhA, a target of the antituberculous drug isoniazid, is involved in a mycobacterial fatty acid elongation system, FAS-II. Microbiology (N Y) 146:289–296. [DOI] [PubMed] [Google Scholar]
  • 17.Vilchèze C, Morbidoni HR, Weisbrod TR, Iwamoto H, Kuo M, Sacchettini JC, Jacobs WR. 2000. Inactivation of the inhA-Encoded Fatty Acid Synthase II (FASII) Enoyl-Acyl Carrier Protein Reductase Induces Accumulation of the FASI End Products and Cell Lysis of Mycobacterium smegmatis. J Bacteriol 182:4059–4067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Vilchèze C, Wang F, Arai M, Hazbón MH, Colangeli R, Kremer L, Weisbrod TR, Alland D, Sacchettini JC, Jacobs WR. 2006. Transfer of a point mutation in Mycobacterium tuberculosis inhA resolves the target of isoniazid. Nat Med 12:1027–1029. [DOI] [PubMed] [Google Scholar]
  • 19.Flentie K, Harrison GA, Tükenmez H, Livny J, Good JAD, Sarkar S, Zhu DX, Kinsella RL, Weiss LA, Solomon SD, Schene ME, Hansen MR, Cairns AG, Kulén M, Wixe T, Lindgren AEG, Chorell E, Bengtsson C, Krishnan KS, Hultgren SJ, Larsson C, Almqvist F, Stallings CL. 2019. Chemical disarming of isoniazid resistance in Mycobacterium tuberculosis. Proc Natl Acad Sci U S A 116:10510–10517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.World Health Organization. 2018. WHO treatment guidelines for isoniazid-resistant tuberculosis: Supplement to the WHO treatment guidelines for drug-resistant tuberculosis. Geneva. [PubMed]
  • 21.Shell SS, Wang J, Lapierre P, Mir M, Chase MR, Pyle MM, Gawande R, Ahmad R, Sarracino DA, Ioerger TR, Fortune SM, Derbyshire KM, Wade JT, Gray TA. 2015. Leaderless Transcripts and Small Proteins Are Common Features of the Mycobacterial Translational Landscape. PLoS Genet 11:e1005641. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Shetty A, Dick T. 2018. Mycobacterial cell wall synthesis inhibitors cause lethal ATP burst. Front Microbiol 9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Lee BS, Kalia NP, Jin XEF, Hasenoehrl EJ, Berney M, Pethe K. 2019. Inhibitors of energy metabolism interfere with antibiotic-induced death in mycobacteria. J Biol Chem 294:1936–1943. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Zeng S, Soetaert K, Ravon F, Vandeput M, Bald D, Kauffmann J-M, Mathys V, Wattiez R, Fontaine V. 2019. Isoniazid Bactericidal Activity Involves Electron Transport Chain Perturbation. Antimicrob Agents Chemother 63:e01841–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hugonnet J-E, Tremblay LW, Boshoff HI, Barry CE, Blanchard JS. 2009. Meropenem-Clavulanate Is Effective Against Extensively Drug-Resistant Mycobacterium tuberculosis. Science (1979) 323:1215–1218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Blondiaux N, Moune M, Desroses M, Frita R, Flipo M, Mathys V, Soetaert K, Kiass M, Delorme V, Djaout K, Trebosc V, Kemmer C, Wintjens R, Wohlkönig A, Antoine R, Huot L, Hot D, Coscolla M, Feldmann J, Gagneux S, Locht C, Brodin P, Gitzinger M, Déprez B, Willand N, Baulard AR. 2017. Reversion of antibiotic resistance in Mycobacterium tuberculosis by spiroisoxazoline SMARt-420. Science 355:1206–1211. [DOI] [PubMed] [Google Scholar]
  • 27.Kreutzfeldt KM, Jansen RS, Hartman TE, Gouzy A, Wang R, Krieger I v, Zimmerman MD, Gengenbacher M, Sarathy JP, Xie M, Dartois V, Sacchettini JC, Rhee KY, Schnappinger D, Ehrt S. 2022. CinA mediates multidrug tolerance in Mycobacterium tuberculosis. Nat Commun 13:2203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Zabinski RF, Blanchard JS. 1997. The Requirement for Manganese and Oxygen in the Isoniazid-Dependent Inactivation of Mycobacterium tuberculosis Enoyl Reductase. J Am Chem Soc 119:2331–2332. [Google Scholar]
  • 29.Takayama K, Wang L, David HL. 1972. Effect of Isoniazid on the In Vivo Mycolic Acid Synthesis, Cell Growth, and Viability of Mycobacterium tuberculosis. Antimicrob Agents Chemother 2:29–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Winder FG, Collins PB. 1970. Inhibition by Isoniazid of Synthesis of Mycolic Acids in Mycobacterium tuberculosis. J Gen Microbiol 63:41–48. [DOI] [PubMed] [Google Scholar]
  • 31.Manjunatha UH, Rao SPS, Kondreddi RR, Noble CG, Camacho LR, Tan BH, Ng SH, Ng PS, Ma NL, Lakshminarayana SB, Herve M, Barnes SW, Yu W, Kuhen K, Blasco F, Beer D, Walker JR, Tonge PJ, Glynne R, Smith PW, Diagana TT. 2015. Direct inhibitors of InhA are active against Mycobacterium tuberculosis. Sci Transl Med 7:269ra3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Li S, Poulton NC, Chang JS, Azadian ZA, DeJesus MA, Ruecker N, Zimmerman MD, Eckartt KA, Bosch B, Engelhart CA, Sullivan DF, Gengenbacher M, Dartois VA, Schnappinger D, Rock JM. 2022. CRISPRi chemical genetics and comparative genomics identify genes mediating drug potency in Mycobacterium tuberculosis. Nat Microbiol 7:766–779. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Grzegorzewicz AE, Pham H, Gundi VAKB, Scherman MS, North EJ, Hess T, Jones V, Gruppo V, Born SEM, Korduláková J, Chavadi SS, Morisseau C, Lenaerts AJ, Lee RE, McNeil MR, Jackson M. 2012. Inhibition of mycolic acid transport across the Mycobacterium tuberculosis plasma membrane. Nat Chem Biol 8:334–341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Xu Z, Meshcheryakov VA, Poce G, Chng SS. 2017. MmpL3 is the flippase for mycolic acids in mycobacteria. Proc Natl Acad Sci U S A 114:7993–7998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.McNeil M, Daffe M, Brennan PJ. 1991. Location of the mycolyl ester substituents in the cell walls of mycobacteria. Journal of Biological Chemistry 266:13217–13223. [PubMed] [Google Scholar]
  • 36.Jackson M, Raynaud C, Lanéelle M-A, Guilhot C, Laurent-Winter C, Ensergueix D, Gicquel B, Daffé M. 1999. Inactivation of the antigen 85C gene profoundly affects the mycolate content and alters the permeability of the Mycobacterium tuberculosis cell envelope. Mol Microbiol 31:1573–1587. [DOI] [PubMed] [Google Scholar]
  • 37.Puech V, Guilhot C, Perez E, Tropis M, Armitige LY, Gicquel B, Daffé M. 2002. Evidence for a partial redundancy of the fibronectin-binding proteins for the transfer of mycoloyl residues onto the cell wall arabinogalactan termini of Mycobacterium tuberculosis. Mol Microbiol 44:1109–1122. [DOI] [PubMed] [Google Scholar]
  • 38.Belisle JT, Vissa VD, Sievert T, Takayama K, Brennan PJ, Besra GS. 1997. Role of the Major Antigen of Mycobacterium tuberculosis in Cell Wall Biogenesis. Science (1979) 276:1420–1422. [DOI] [PubMed] [Google Scholar]
  • 39.Fay A, Czudnochowski N, Rock JM, Johnson JR, Krogan NJ, Rosenberg O, Glickman MS. 2019. Two accessory proteins govern MmpL3 mycolic acid transport in mycobacteria. mBio 10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Wakamoto Y, Dhar N, Chait R, Schneider K, Signorino-Gelo F, Leibler S, McKinney JD. 2013. Dynamic Persistence of Antibiotic-Stressed Mycobacteria. Science (1979) 339:91–95. [DOI] [PubMed] [Google Scholar]
  • 41.Ma S, Morrison R, Hobbs SJ, Soni V, Farrow-Johnson J, Frando A, Fleck N, Grundner C, Rhee KY, Rustad TR, Sherman DR. 2020. Transcriptional regulator-induced phenotype screen reveals drug potentiators in Mycobacterium tuberculosis. Nat Microbiol 10.1038/s41564-020-00810-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Zheng H, Colvin CJ, Johnson BK, Kirchhoff PD, Wilson M, Jorgensen-Muga K, Larsen SD, Abramovitch RB. 2016. Inhibitors of Mycobacterium tuberculosis DosRST signaling and persistence. Nat Chem Biol 13:218–225. [DOI] [PubMed] [Google Scholar]
  • 43.Vilcheze C, Hartman T, Weinrick B, Jain P, Weisbrod TR, Leung LW, Freundlich JS, Jacobs WRJ. 2017. Enhanced respiration prevents drug tolerance and drug resistance in Mycobacterium tuberculosis. Proc Natl Acad Sci U S A 114:4495–4500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Matsumoto M, Hashizume H, Tomishige T, Kawasaki M, Tsubouchi H, Sasaki H, Shimokawa Y, Komatsu M. 2006. OPC-67683, a Nitro-Dihydro-Imidazooxazole Derivative with Promising Action against Tuberculosis In Vitro and In Mice. PLoS Med 3:e466-. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Stover CK, Warrener P, VanDevanter DR, Sherman DR, Arain TM, Langhorne MH, Anderson SW, Towell JA, Yuan Y, McMurray DN, Kreiswirth BN, Barry CE, Baker WR. 2000. A small-molecule nitroimidazopyran drug candidate for the treatment of tuberculosis. Nature 405:962–966. [DOI] [PubMed] [Google Scholar]
  • 46.Yu S, Girotto S, Lee C, Magliozzo RS. 2003. Reduced affinity for isoniazid in the S315T mutant of Mycobacterium tuberculosis KatG is a key factor in antibiotic resistance. Journal of Biological Chemistry 278:14769–14775. [DOI] [PubMed] [Google Scholar]
  • 47.Zhao X, Yu H, Yu S, Wang F, Sacchettini JC, Magliozzo RS. 2006. Hydrogen Peroxide-Mediated Isoniazid Activation Catalyzed by Mycobacterium tuberculosis Catalase–Peroxidase (KatG) and Its S315T Mutant,. Biochemistry 45:4131–4140. [DOI] [PubMed] [Google Scholar]
  • 48.Cade CE, Dlouhy AC, Medzihradszky KF, Salas-Castillo SP, Ghiladi RA. 2010. Isoniazid-resistance conferring mutations in Mycobacterium tuberculosis KatG: catalase, peroxidase, and INH-NADH adduct formation activities. Protein Sci 19:458–474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Wilson TM, de Lisle GW, Collins DM. 1995. Effect of inhA and katG on isoniazid resistance and virulence of Mycobacterium bovis. Mol Microbiol 15:1009–1015. [DOI] [PubMed] [Google Scholar]
  • 50.Li Z, Kelley C, Collins F, Rouse D, Morris S. 1998. Expression of katG in Mycobacterium tuberculosis Is Associated with Its Growth and Persistence in Mice and Guinea Pigs. J Infect Dis 177:1030–1035. [DOI] [PubMed] [Google Scholar]
  • 51.Pym AS, Saint-Joanis B, Cole ST. 2002. Effect of katG mutations on the virulence of Mycobacterium tuberculosis and the implication for transmission in humans. Infect Immun 70:4955–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Dooley KE, Miyahara S, von Groote-Bidlingmaier F, Sun X, Hafner R, Rosenkranz SL, Ignatius EH, Nuermberger EL, Moran L, Donahue K, Swindells S, Vanker N, Diacon AH, Issa R, Lane C, Lojacono M, Mahachi R, Murtaugh W, Purdue L, Shahkolahi A, Ssenyonga R. 2020. Early Bactericidal Activity of Different Isoniazid Doses for Drug-Resistant Tuberculosis (INHindsight): A Randomized, Open-Label Clinical Trial. Am J Respir Crit Care Med 201:1416–1424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Bardarov S, Bardarov S, Pavelka MS, Sambandamurthy V, Larsen M, Tufariello J, Chan J, Hatfull G, Jacobs WR. 2002. Specialized transduction : an efficient method for generating marked and unmarked targeted gene disruptions in Mycobacterium tuberculosis, M. bovis BCG, and M. smegmatis. Microbiology (N Y) 148:3007–3017. [DOI] [PubMed] [Google Scholar]
  • 54.Larsen MH, Biermann K, Tandberg S, Hsu T, Jacobs WR. 2007. Genetic Manipulation of Mycobacterium tuberculosis. Curr Protoc Microbiol 6:10A.2.1–10A.2.21. [DOI] [PubMed] [Google Scholar]
  • 55.Robinson JT, Thorvaldsdóttir H, Winckler W, Guttman M, Lander ES, Getz G, Mesirov JP. 2011. Integrative genomics viewer. Nat Biotechnol 29:24–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Chorell E, Edvinsson S, Almqvist F. 2010. Improved procedure for the enantioselective synthesis of dihydrooxazolo and dihydrothiazolo ring-fused 2-pyridones. Tetrahedron Lett 51:2461–2463. [Google Scholar]
  • 57.Chorell E, Pinkner JS, Phan G, Edvinsson S, Buelens F, Remaut H, Waksman G, Hultgren SJ, Almqvist F. 2010. Design and Synthesis of C-2 Substituted Thiazolo and Dihydrothiazolo Ring-Fused 2-Pyridones: Pilicides with Increased Antivirulence Activity. J Med Chem 53:5690–5695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Mahapatra S, Woolhiser LK, Lenaerts AJ, Johnson JL, Eisenach KD, Joloba ML, Boom WH, Belisle JT. 2012. A Novel Metabolite of Antituberculosis Therapy Demonstrates Host Activation of Isoniazid and Formation of the Isoniazid-NAD+ Adduct. Antimicrobial Agents and Chemotherapy 56:28–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Noll H, Bloch H. 1955. Studies on the chemistry of the cord factor of Mycobacterium tuberculosis. Journal of Biological Chemistry 214:251–265. [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplement 1

Articles from bioRxiv are provided here courtesy of Cold Spring Harbor Laboratory Preprints

RESOURCES