Skip to main content

This is a preprint.

It has not yet been peer reviewed by a journal.

The National Library of Medicine is running a pilot to include preprints that result from research funded by NIH in PMC and PubMed.

bioRxiv logoLink to bioRxiv
[Preprint]. 2023 Feb 10:2023.02.10.528045. [Version 1] doi: 10.1101/2023.02.10.528045

RNA polymerase sliding on DNA can couple the transcription of nearby bacterial operons

Debora Tenenbaum 1,2,3, Koe Inlow 1, Larry Friedman 1, Anthony Cai 1, Jeff Gelles 1,*, Jane Kondev 2,*
PMCID: PMC9934669  PMID: 36798213

Abstract

DNA transcription initiates after an RNA polymerase (RNAP) molecule binds to the promoter of a gene. In bacteria, the canonical picture is that RNAP comes from the cytoplasmic pool of freely diffusing RNAP molecules. Recent experiments suggest the possible existence of a separate pool of polymerases, competent for initiation, which freely slide on the DNA after having terminated one round of transcription. Promoter-dependent transcription reinitiation from this pool of post-termination RNAP may lead to coupled initiation at nearby operons, but it is unclear whether this can occur over the distance- and time-scales needed for it to function widely on a bacterial genome in vivo. Here, we mathematically model the hypothesized reinitiation mechanism as a diffusion-to-capture process and compute the distances over which significant inter-operon coupling can occur and the time required. These quantities depend on previously uncharacterized molecular association and dissociation rate constants between DNA, RNAP and the transcription initiation factor σ70; we measure these rate constants using single-molecule experiments in vitro. Our combined theory/experimental results demonstrate that efficient coupling can occur at physiologically relevant σ70 concentrations and on timescales appropriate for transcript synthesis. Coupling is efficient over terminator-promoter distances up to ∼ 1, 000 bp, which includes the majority of terminator-promoter nearest neighbor pairs in the E. coli genome. The results suggest a generalized mechanism that couples the transcription of nearby operons and breaks the paradigm that each binding of RNAP to DNA can produce at most one messenger RNA.

Keywords: Reaction-diffusion model, Single-molecule fluorescence, Gene coupling

INTRODUCTION

The core RNA polymerase (RNAP) in bacteria, which is composed of five subunits (β, β, αI, αII , and ω), can catalyze the synthesis of RNA, but cannot recognize specific promoter sequences. To recognize promoters, RNAP must first bind an initiation factor such as the E. coli housekeeping σ70, forming an RNAP holoenzyme (σ70RNAP) 13. DNA transcription initiates when σ70RNAP is recruited from cytoplasm to bind to the promoter region of a gene. Controlling this process is thought to be the principal means through which transcription repressors and activators modulate gene transcription.

Bacterial metabolism requires the coordinated expression of multiple genes 4. A basic way in which this coordination is achieved in bacterial cells is by the organization of functionally related genes into operons, which are groups of consecutive genes that can be transcribed from the same promoter 5,6. Functionally related operons often reside in contiguous regions of the bacterial genome 7. Proximally located operons show higher levels of correlated expression than distant operons in E. coli 810. The same is true of closely spaced genes in eukaryotes 11,12.

While specific groups of bacterial operons may have correlated activities simply because they have common regulatory proteins (e.g., alternative sigma factors), there are also proximity-based mechanisms that can couple transcription of adjacent operons. Terminator readthrough, in which the RNAP fails to read a terminator signal and keeps elongating the mRNA molecule, can generate the joint transcription of co-directional neighboring operons. Transcription-coupled DNA supercoiling 13 can induce coupled transcription of divergently transcribed genes 14,15.

Recently, a new mechanism of proximity-based transcription coupling was observed. Using single-molecule microscopy, Harden et al. 16 and Kang et al. 17,18 observed that RNAP can remain bound to DNA after termination for at least hundreds of seconds in vitro. This post-termination RNAP-DNA complex may retain a partially open bubble in the DNA 19. The retained RNAP exhibits one-dimensional diffusive sliding over hundreds or thousands of base pairs along the DNA. In the presence of σ70 in solution, the sliding RNAP can re-initiate transcription at a nearby promoter. This post-termination behavior of bacterial RNAP may couple transcription of nearby operons in a way that is dependent on both the distance between the two transcription units and the available concentration of σ70. Genome-wide transcription measurements are consistent with this mechanism, but do not prove that it operates in vivo in both E. coli and B. subtilis 16.

In this work, we test whether RNAP post-termination sliding followed by σ70 rebinding can efficiently couple the transcription of nearby operons. First, we mathematically model the mechanism as a diffusion-to-capture process, in which the association of a σ70 molecule with the sliding RNAP is required for reinitiation at a nearby promoter sequence. Next, we use single-molecule microscopy experiments under conditions designed to mimic the ionic composition of bacterial cytoplasm to measure the values of the model kinetic parameters. Finally, we input the measured values into the model to predict the distances and times over which post-termination sliding of RNAP could couple expression of neighboring genes.

RESULTS

Model of operon coupling by sliding RNAP

We model transcriptional coupling between proximal operons using the sliding RNAP mechanism depicted in Fig. 1. The distance between the terminator of the first operon and the promoter of the second operon is d. Upon reaching the terminator sequence T of the primary operon (at time t = 0), the RNAP releases an RNA transcript but remains non-specifically bound, enabling it to diffuse along the DNA with a diffusion coefficient D. During this time interval of sliding, the RNAP can either dissociate from the DNA with rate koff, or bind a σ70 molecule from solution with a rate kb[σ70], where [σ70] denotes the free σ70 solution concentration. In the latter case, the RNAP-σ70 complex continues diffusing along the DNA molecule, and can dissociate with a rate koff,s, or can encounter and be captured by the promoter for the secondary operon. We define the time it takes the captured RNAP-σ70 complexes to find the secondary promoter as the search time tf. In this mechanism, σ70 can have conflicting effects because it can stimulate RNAP dissociation from DNA via the koff,s step and yet is also required for secondary promoter capture.

Figure 1: Model of operon coupling by sliding RNAP.

Figure 1:

(i) An RNAP molecule (green) terminates transcription of the primary operon (blue), and (ii) starts sliding along the DNA molecule with a diffusion constant D. (iii) While sliding, the RNAP can either dissociate from the DNA with rate koff, or bind σ70 (gray) with rate kb[σ70]. (iv) After binding of σ70, the RNAP-σ70 complex can either dissociate with a rate koff,s, or find the promoter (bent arrow) for the secondary operon (pink), which is located is at a distance d along the DNA from the primary operon terminator (T).

For simplicity, we assume that the binding of σ70 to sliding RNAP is irreversible. This is equivalent to assuming that the unbinding of σ70 from the sliding RNAP is significantly slower than the dissociation of the RNAP-σ70 complex from the DNA. This assumption is reasonable, given previous measurements of σ70 dissociation from free 20,21 and DNA-bound RNAP 17. Also for simplicity, we assume that the diffusion coefficient on DNA of the RNAP-σ70 complex and RNAP are the same.

In this work we will refer to the complex that is formed by binding of σ70 to DNA-bound RNAP as RNAP-σ70-DNA and to the complex formed by binding σ70RNAP holoenzyme to DNA as holoenzyme-DNA. It is not currently known whether these different orders of assembly produce complexes with the same structure (see Discussion).

Calculation of coupling efficiency

To quantify how transcriptional coupling by sliding RNAP changes with varying distance between operons and with [σ70], we define the coupling efficiency (E) as the probability that an RNAP molecule, which terminates transcription of the primary operon, reaches the promoter of the secondary promoter by the sliding RNAP mechanism. To reach the secondary promoter, (i) the sliding RNAP has to bind a σ70 molecule from solution before falling off the DNA, and (ii) the RNAP-σ70 complex then has to reach the secondary promoter before falling off the DNA. The probability of (i), Pbind, is given by the partition ratio

Pbind=kbσ70kbσ70+koff, (1)

while the probability of (ii), Pfind, can be computed as the probability that a RNAP-σ70 complex remains bound to DNA for at least the time needed to find the secondary promoter before dissociating.

To determine Pfind, we combine the distribution of times it takes RNAP-σ70 complexes to encounter the secondary promoter for the first time, pfirst passage(t), and the probability that the complex will stay bound on the DNA long enough for the encounter to happen. Thus, Pfind is given by

Pfind =0pfirst passage texpkoff,s tdt. (2)

Here we use uppercase P to refer to probabilities, and lowercase p to represent probability density functions (PDFs).

RNAP terminates transcription of the primary operon at x = 0 and starts performing a one-dimensional random walk along the DNA with diffusion coefficient D. How long it takes for a RNAP-σ70 complex to first encounter the secondary promoter will depend on its position on the DNA (xb) when it starts the search, i.e., when σ70 binds the sliding RNAP molecule. xb in turn depends on how long after termination at the primary terminator σ70 binds (tb). At a time tb drawn at random from the exponential distribution

pbind ,ttb=kbσ70+koff expkbσ70+koff tb, (3)

the sliding RNAP will either bind a σ70 molecule or dissociate from the DNA. If it binds a σ70 molecule, the binding position will be a random value drawn from

pbind ,xcond xbtb=𝒩0,2Dtb, (4)

where 𝒩(μ,var) describes a normal distribution with mean μ and variance var. Eq. 4 represents the conditional probability distribution for xb given the binding time tb. Now we can calculate the unconditional distribution of binding positions

pbind ,xxb=0pbind ,xcond xb|tpbind ,ttdt=kb[σ]+koff4Dexpkb[σ]+koffDxb. (5)

The distribution of times tfp it would take the RNAP-σ70 complex to reach the secondary promoter at x = d for the first time is then given by the first-passage-time density for a one-dimensional random walk 22

pfirst passage cond tfpxb=dxb4πDtfp3expdxb24Dtfp, (6)

which is conditional on xb. The unconditional distribution of first passage times is then calculated as

pfirst passage tfp=+pfirst passage cond tfpxpbind,xxdx. (7)

Finally, substituting Eq. 7 into Eq. 2 to get Pfind, and multiplying by Pbind (Eq. 1), we get the expressions in Eq. 8.

Ed,σ70=kbσ70kbσ70+koffkoff,sexpkoff,sDdkoff,kbσ70+koff expkbσ70+koff Dd,ifkbσ70+koffkoff,kbσ702expkoff,sDddkoff,sD+1koff,s, if kbσ70+koff =koff,s  (8)

Coupling regimes and calculation of coupling distance

We can distinguish three different coupling regimes depending on the availability of free σ70 molecules. For this, we define a critical σ70 concentration at which the diffusion time intervals available before and after σ70 binding to RNAP are equal, σ70c=koff,koff kbkoff,kb. Here we used koff << koff,s based on prior studies 23and our experimental results (see below).

1. When [σ70] ≫ [σ70]c, the coupling efficiency at small d is given by Pbind (Eq. 1) since any RNAP that binds σ70 will subsequently encounter the promoter. For larger d the efficiency decays exponentially,

EPbind expkoff,s Dd. (9)

In this regime, we can define the coupling distance as the characteristic decay distance of the coupling, dcDkoff,s.

2. When [σ70] ≪ [σ70]c, the decay is also exponential but in this case,

EPbindkbσ70+koffkoff,sexpkbσ70+koffDd, (10)

and the characteristic distance is dcDkbσ70+koff . However, in this case kbσ70+koffkoff,s1, which means that there is no significant coupling between adjacent transcription units no matter the distance between them.

3. For [σ70] ≈ [σ70]c, we get the bottom expression in Eq. 8. Even though it is not exponential, we can still define a coupling distance dc over which the coupling efficiency decays by a factor of e. Following the calculations in Appendix S1, we get

dc2.15Dkoff, s =2.15Dkbσ70+koff =1.08Dkoff,s+Dkbσ70+koff. (11)

In simple terms, the regimes differ by whether most of the diffusional search for the secondary promoter takes place after (regime 1) or before (regime 2) the binding of σ70. In addition, given that Dkbσ70+koff Dkoff, ,s in regime 1, and Dkoff,sDkbσ70+koff in regime 2, for all three regimes we can then approximate the coupling distance as dcDkb[σ]+koff+Dkoff,s, which is roughly the sum of the root mean squared displacements of the RNAP before and after binding a σ70 molecule (Fig. S1). Efficiency curves as a function of distance scaled by the critical distance are shown for all three regimes in Fig. 2. As expected, when the concentration of σ70 is well below its critical concentration, the efficiency is small for any distance between the two promoters, while the efficiency can be of order one when [σ70] is well above [σ70]c.

Figure 2: Predicted relationship of Coupling efficiency E to the distance between operons.

Figure 2:

The coupling efficiency is the probability of an RNAP that terminated transcription at the end of the primary operon reaching the secondary promoter. Efficiency curves are shown for the three regimes of σ70 concentration described in the text, for a chosen set of parameter values: kb = 107 M1s1, koff = 103 s1, koff,s = 1 s1, D = 4 × 104 bp2s1. Curves were calculated using Eq. 8. Distance is represented in units of the coupling distance dcDkbσ70+koff1+Dkoff,s1. Inset: enlarged plot of the curve for [σ70] ≪ [σ70]c.

Single-molecule microscopy experiments to measure model parameters

To estimate the coupling efficiency E, coupling distance dc, and search times tf that can be achieved via the proposed mechanism (Fig. 1), we need values for the model parameters D, kb, koff, and koff,s.

The diffusion coefficient of RNAP post termination, D = (3.9 ± 0.5) × 104 bp2s−1, was experimentally measured in ref. 16. Those investigators also sometimes observed a non-diffusing post termination RNAP-DNA complex in their experiments, but attributed this to RNAP binding to the ends of the linear DNA molecules they used.

We performed single-molecule experiments to measure kb, koff and koff,s. Specifically, we quantified the dwell times of RNAP on promoterless DNA templates in the presence of different concentrations of σ70 (Fig. 3A). These experiments allow us to measure all three rate constants. This is because at low σ70 concentrations the measured dwell times are limited by the rate of RNAP dissociation from DNA, at intermediate σ70 concentrations they are limited by the rate of σ70 binding to the RNAP-DNA complex, and at high σ70 concentrations they are limited by the rate of RNAP-σ70 complex dissociation from DNA.

Figure 3: Single-molecule experiments to measure kb, koff, and koff,s.

Figure 3:

a. Experiment schematic. Fluorescently labeled, promoterless circular DNA templates (DNA Long Cy5; black circles) were tethered to the surface of a glass flow chamber (blue) through polyethylene glycol linkers (dotted black curves). The chamber was then incubated with fluorescently labeled core RNAP (RNAP549) to form RNAP-DNA nonspecific complexes, which correspond to the post-termination complex. In each of six experiments, a different concentration of σ70 (gray) was introduced at t = 0, and the lifetime of each RNAP549 that colocalized with a surface-tethered DNA molecule was monitored by single-molecule fluorescence microscopy. B. Example of experiment record. Left: DNA Long Cy5 and RNAP549 fluorescence images of the same field of view (65 µm diameter) upon introducing 1.19 µM σ70 at t = 0. Right: Time record excerpt of RNAP549 fluorescence at the location of a single DNA molecule. Gallery shows 5 × 5 pixel images centered on the DNA molecule; graph shows the summed, background-corrected intensity of the 3 × 3 pixels centered on the DNA. tdwell represents the duration of the fluorescent spot. C. tdwell survival probability distributions in the presence of 0, 0.59, and 1.19 µM σ70. D. Rates (with 68% C.I.s) of σ70-dependent dissociation of RNAP549 from DNA Long Cy5 (black) and DNA shortCy5 (gray) as a function of σ70 concentration, and global fit (red; see eq. (12) and accompanying text).

For experimental convenience, we did not use core RNAP-DNA complexes that were formed after termination of transcription. Instead, we directly formed sequence non-specific RNAP-DNA complexes by adding core RNAP to a DNA that lacks known promoter sequences. The two types of complexes have the same protein composition and have similar properties: both are long-lived, in both RNAP slides on DNA, both are sensitive to the polyanion heparin 16, and both are rapidly disassembled by the bacterial SNF2 ATPase RapA 24.

To implement these experiments we designed and synthesized a biotinylated, 3,033 bp circular DNA lacking known promoter sequences that was labeled with the red-excited dye Cy5 (we refer to this construct as DNALong Cy5). Circular DNAs were used to avoid possible binding of RNAP to DNA ends 25, which are largely non-physiological since the E. coli chromosome is circular.

We immobilized DNALong Cy5 molecules on the surface of a glass flow chamber via a biotin-streptavidin linkage (Fig. 3A). We then incubated the chamber with a solution containing E. coli core RNAP labeled with a green-excited dye (RNAP549) for ∼ 10 min, and washed it out at time t = 0 with a solution containing σ70 in the 0 to 1.2 μM range. Single-molecule total internal reflection microscopy was performed with alternating red and green excitation for observation of DNALong Cy5 and RNAP549, respectively. An example of the fluorescence records used for extracting the dwell times of the RNAP549 molecules on the DNALong Cy5 template for each experiment is shown in Fig. 3B.

Given that these experiments study sequence-nonspecific interactions between RNAP549 and DNALong Cy5, it was expected that multiple RNAP549 molecules could be bound to the same DNALong Cy5 template simultaneously. To reduce complications in the dwell time measurements arising from multiple RNAP549 molecules bound to the same template, we restricted the analysis to only those DNALong Cy5 locations with a single colocalized RNAP549. The number of RNAP549 molecules bound to each DNALong Cy5 template was quantified by counting the number of decreasing steps present in the RNAP549 fluorescence intensity records (Fig. S2 and Appendix S3).

Distributions of RNAP dwell times on DNA

Example dwell time probability distributions of RNAP549 on promoterless circular DNA templates for different concentrations of σ70 are shown in Fig. 3C. Consistent with the results in 23, σ70 accelerates the dissociation of RNAP from DNA.

In the absence of promoter sequences in the DNA, the model in Fig. 1 predicts that the dwell time distributions for RNAP obtained in the limits of low and high [σ70] are exponential. Theoretically, at intermediate [σ70] the dwell time distributions are non-exponential, due to the presence of two sequential steps (kb and koff,s). Still, for reasonable values of the rate constants the distribution is well approximated by an exponential and the effective rate constant has a hyperbolic dependence on [σ70],

keffkoff+koff,skbσ70kbσ70+koff,s. (12)

However, the experimental distributions are in fact described not by a single exponential, but by the sum of multiple exponential components with very different rate constants. Specifically, for the experiments in which [σ70] > 0 the distributions are well fit by a sum of three exponentials with characteristic rates kslow, kinter, and kfast (Fig. S3). This suggests that in these experiments there are at least three types of RNAP-σ70-DNA complexes. The resulting fits, obtained using a maximum likelihood method, are shown in Fig. S4, and the fit parameters are summarized in Table 1. In all cases, non-specific binding of RNAP549 to the chamber surface was minimal (Table S1), and therefore was not considered when fitting the data.

Table 1:

Parameters for fits to dwell time distributions of RNAP549-promoterless DNA complexes at different σ70 concentrations.

[σ70] (μM) N Nd afast (×10−1) ainter (×10−1) kfast (×10−2 s−1) kinter (×10−3 s−1) kslow (×10−4 s−1) DNA preparation
0 65 60 8.6(6.8 − 9.4) - 0.16(0.13 − 0.22) - 1.59(0 − 3.99) DNA Long Cy5, preparation 1
0.15 60 42 1.2(0.4 − 2.0) 1.6(0.4 − 2.9) 1.63(1.24 − 2.26) 3.11(2.27 − 4.52) 1.90(1.44 − 2.33) DNA Long Cy5, preparation 2
0.30 139 85 1.8(1.3 − 2.1) 1.3(0.7 − 3.8) 2.22(1.80 − 2.90) 1.23(0.53 − 2.04) 1.27(0.48 − 1.52) DNA Long Cy5, preparation 2
0.59 106 100 3.4(2.5 − 4.8) 5.4(4.1 − 6.2) 2.59(1.52 − 3.77) 2.61(1.87 − 3.37) 2.18(0.26 − 3.63) DNA Long Cy5, preparation 1
0.74 106 60 1.8(1.2 − 2.2) 2.0(1.0 − 5.2) 2.57(1.77 − 3.96) 0.81(0.34 − 1.72) 1.05(0 − 1.54) DNA Long Cy5, preparation 3
1.19 74 71 3.4(2.3 − 4.9) 5.8(4.4 − 6.8) 3.90(2.47 − 5.47) 3.88(2.45 − 5.26) 1.61(0 − 3.24) DNA Long Cy5, preparation 1
1.19 76 68 5.8(4.0 − 6.7) 3.0(2.0 − 4.7) 4.91(3.63 − 8.32) 5.77(4.03 − 10.09) 0.72(0 − 1.56) DNA ShortCy5

The models used for the fit are described in Methods (Eqs. 13 and 14). N is the number of DNA sites with co-localized RNAP that were used in the analysis. Nd is the number of DNA sites for which the co-localized RNAPs disappeared before the end of the experiment. The values are presented with 68% CI. In some cases, the lower confidence limit on kslow is poorly defined because kslow1 exceeds the duration of the experiment. DNA Long Cy5 preparations 1, 2, and 3 were made by the same method on different occasions.

For the experiments with [σ70] > 0, kfast showed a hyperbolic dependence of [σ70] (Fig. 3D); kinter and kslow did not (Table 1). Therefore, we hypothesize that the fastest component corresponds to σ70-induced dissociation of RNAP549 bound to DNA, keff = kfast. This suggests that at low σ70 concentrations binding of σ70 to the sliding RNAP is rate-limiting so that the dissociation rate of RNAP from DNA increases linearly with σ70 concentration, while at high concentrations the dissociation of the RNAP-σ70 complex from DNA becomes limiting, and the dissociation rate saturates. Possible origins of the longer-lived RNAP-DNA complexes with [σ70]-independent dissociation rates kinter and kslow are discussed in the Appendix S4.

To confirm that kfast depends on [σ70] and not on the DNA template used, we repeated the 1.19 μM σ70 experiment using a different DNA template, the promoterless 586 bp circular DNAShort Cy5 . Similar values were obtained for kfast for both templates (Table 1, Fig. 3D), supporting the idea that kfast depends on σ70 concentration, and not on the length or sequence of the DNA template used.

Two characteristic rates were observed for the experiment with [σ70] = 0. The slower one is similar to the values of kslow observed in the presence of σ70 (Table 1). The faster one is similar to the mean dissociation rate observed for the post-termination RNAP-DNA complex in the absence of σ70, as well as to the mean dissociation rate observed for core RNAP sequence-nonspecifically bound to DNA 16. Therefore, we assume that the faster rate corresponds to the dissociation rate of RNAP549 from DNA in the limit where [σ70] = 0.

Extraction of model parameters kb, koff, and koff,s

Having established the hyperbolic dependence of the σ70-induced dissociation rate kfast on σ70 concentration, we can now determine the values for the Fig. 1 model parameters kb, koff, and koff,s. For this, we jointly fit the data from experiments at different σ70 concentrations to a global model that incorporates our conclusions about the origins of the different components of the dwell time distributions (see Appendix S4). The σ70-independent rates kinter and kslow were globally fit for all six experiments performed with DNALongCy5  (Table S3 and Fig. S8). A separate set of parameters kinter' and kslow' were obtained by fitting the dwell time distribution from the experiment with DNAShort Cy5 . The global model explicitly included the [σ70] dependency of kfast (Eq. 12, where keff = kfast).

The model fit well to the data (Fig. S8) and gave well-constrained values for the rate constants (Table 2). The rate constants, together with the diffusion coefficient D measured in ref. 16 provide the information needed to calculate the extent and kinetics of operon coupling.

Table 2:

Global model parameters.

Parameter Description Value (68% C.I.) Source
D Diffusion coefficient of sliding RNAP 3.9 × 104 bp2s−1 16
k b Binding rate of σ70 to sliding RNAP 1.2(0.7 − 2.7) × 105 M−1s−1 Fit
k off Dissociation rate of RNAP before binding σ70 1.6(1.3 − 1.9) × 10−3 s−1 Fit
k off,s Dissociation rate of RNAP-σ70 complex 5.1(3.4 − 12.2) × 10−2 s−1 Fit

Kang et al 17 measured a somewhat lower value corresponding to 0.8 × 104bp2s1 at similar ionic strength but in a different buffer.

Extent of operon coupling by sliding RNAP

Operon coupling cannot be biologically functional if it takes an infeasibly long time for RNAP to find the secondary promoter after terminating transcription at the terminator of the primary operon. To compute the distribution of search times, we used the experimental results for D, kb, koff, and koff,s to simulate the mechanism for a realistic σ70 concentration and terminator-promoter spacing (Fig. 4A). The distribution of the search times is roughly exponential with a mean ⟨tf⟩ ∼ 7 s, which is comparable to the time for transcription initiation at well-studied promoters (a few seconds to a few minutes 26,27). This indicates that transcription re-initiation by sliding RNAP is capable of effectively increasing expression of the secondary operon.

Figure 4: Extent of operon coupling predicted by the sliding RNAP model, using the kinetic parameter values from Table 2.

Figure 4:

a. Distribution of search times that end in a promoter encounter tf obtained by simulating the model in Figure 1 for d = 600 bp and [σ70] = 5 μM. b. Coupling efficiency dependence on the distance d between primary operon terminator and secondary operon promoter, for two possible free σ70 concentrations. Shaded areas show the 68% C.I.s. c. Distribution of distances between operon final terminators and the nearest operon initial promoter in the E. coli genome determined from data in ref. 29.

Inputting the experimental results for D, kb, koff, and koff,s into Eq. 8, we can predict the value of the efficiency as a function of the distance between operons and the σ70 concentration. The total concentration of σ70 in E. coli is on order 10 μM28, but its availability is highly regulated through sequestration by anti-σ factors, whose activity is also tightly regulated. This means that at any time, the free σ70 concentration could be anything below roughly 10 μM. Thus, the free σ70 concentration in the cell could be either above or below [σ70]c, which we calculate to be 0.4 μM. To test whether the model predicts appreciable coupling at typical operon spacings, we calculated the predicted coupling efficiency as a function of the distance d between the primary terminator and the secondary promoter at high and low σ70 concentrations (Figure 4B). At 5 μM σ70, this calculation predicts efficient coupling at distances d up to 1, 000 bp. At a much lower free σ70 concentration of 50 nM, the model predicts a smaller but still significant amount of coupling on this distance scale, with less dependence on operon spacing. Regulation of the free σ70 concentration would therefore allow the cell to vary the amount of coupling in response to internal and environmental conditions.

The spacing between the final terminator of an operon and the nearest operon initial promoter has a broad distribution in the E. coli genome (Figure 4C). Nevertheless, based on our calculations, a large fraction of these pairs are capable of efficient coupling by sliding RNAP. For example, 52% of the terminator-promoter pairs are at distances where the coupling efficiency is at least 50% at [σ70] = 5 μM. In other words, at this σ70 concentration (and in general when [σ70] >> [σ70]c ≈ 0.4 μM) the predicted critical distance dc ≈ 1, 000 bp is of the same order of magnitude as the typical inter-operon distance (median 600 bp). This could allow many pairs of adjacent operons in the genome to be coupled, while at the same time enabling other operons to be transcribed independently of their neighbors, depending on the terminator-promoter spacing. Thus, the model predicts significant coupling under relevant cellular conditions and predicts that coupling can be regulated by tuning these conditions.

The model makes the simplifying assumption that every encounter of the RNAP-σ70 complex with a promoter is productive and leads to synthesis of a transcript. To the extent that not all encounters are productive, the model will overestimate efficiency (Fig. 4B) and underestimate search time (Fig. 4A).

DISCUSSION

Using a combination of theory, stochastic simulations, and single-molecule microscopy experiments, we characterized the potential spatial and temporal reach of transcriptional coupling between adjacent operons mediated by diffusive sliding of RNAP that remains bound to DNA following transcription termination. We predict that σ70 has both stimulatory and inhibitory effects on reinitiation. The stimulatory effect arises from the fact that only RNAP with bound σ70 can recognize the secondary promoter. On the other hand, we show that RNAP-σ70 has only a short lifetime on DNA, during which the sliding σ70RNAP must find a promoter on the fly to reinitiate transcription. Despite the latter difficulty, we show that reinitiation is expected to be common and efficient for physiological ranges of terminator-promoter spacings and σ70 concentrations. Thus, our results show that the proposed reinitiation mechanism is consistent with experiments that demonstrate reinitiation in vitro 16,17 and in vivo 16.

To quantitatively define the reinitiation process, we measured three previously uncharacterized rate constants: the second-order rate constant for binding of σ70 to the RNAP-DNA complex, kb = 1.2 × 105 M−1s−1, the rate constant for the dissociation of the RNAP-DNA complex, koff = 1.6 × 10−3 s−1, and the rate constant for the dissociation of the RNAP-σ70-DNA complex, koff,s = 5.1 × 10−2 s−1. The value obtained for kb is an order of magnitude smaller than the rate constant of formation of a stable σ70-RNAP complex in the absence of DNA, 1.5 × 106 M−1s−1 21, which suggests that the presence of bound DNA significantly impedes σ70 association with RNAP. The value obtained for koff,s is an order of magnitude smaller than the value obtained for k1D, the dissociation rate of the RNAP holoenzyme-DNA complex (see Appendix S4 and Table S2). This suggests that the RNAP-σ70-DNA complex (formed by RNAP-DNA binding σ70 from solution) and the holoenzyme-DNA complex (formed by mixing σ70RNAP with non-promoter DNA) have different conformations, despite them having the same protein and DNA constituents. It is possible that in the two complexes different subsets of σ70 subregions interact with RNAP and/or DNA. More information, kinetic and structural, will be required to understand these differences.

The search for target sequences by proteins sliding on DNA has been demonstrated both in vitro and in vivo (e.g., 30,31). Post-termination sliding of core RNAP on DNA is atypically slow compared to a sample of other DNA binding proteins 16,32, possibly because RNAP maintains an open bubble of non-base-paired DNA in the post-termination RNAP-DNA complex 19. The presence in cells of sliding RNAP molecules that may take on order of 10 s after termination to reinitiate transcription (Fig. 4A) is consistent with demonstration of a substantial population in vivo of slowly diffusing RNAP molecules that are neither bound to a fixed site on DNA nor freely diffusing in solution 33,34.

Rapid, efficient reinitiation of transcription through sliding of post-termination RNAP over relevant genomic distances may have significant implications for transcription homeostasis and regulation in both natural and engineered genomes. Under particular growth conditions, transcription activity is often concentrated in clusters of genes or operons in confined genomic regions 4,6,7,35,36. Sliding-mediated reinitiation may help to maintain a localized pool of RNAP molecules that are efficiently reused in these transcriptionally active regions. Indeed, the efficiency of reinitiation by sliding core RNAP compared to conventional initiation by RNAP holoenzyme from solution may be one of the factors that confers a selective advantage to the clustering of functionally related operons. In the context of synthetic biology, reinitiation by sliding might cause problems by giving rise to non-intended connectivity between transcription units that are intended to act modularly, but conversely could be a used as a tool to introduce correlations in designed genetic circuits.

MATERIALS AND METHODS

Plasmids

Plasmid pDT4 is identical to pCDW11616 except for mutation of CTGGAGTGCG to CTGGAGACCG to introduce a second BsaI site.

DNA templates

Circular DNA templates DNALongCy5  and DNAShort Cy5  were built by Golden Gate Assembly 37 using a plasmid or PCR product and a synthetic ‘ligator” duplex oligonucleotide containing both dye and biotin modifications. Ligator was made by annealing two complementary oligonucleotides: 5′-CGATTAGGTCTCGGGCTAGTAC TGGTTTCTAGAG/iCy5/GTTCCAAGCC/iBiodTCACGGCGGCCGCCCATCGAGACCGGTTAACC-3′ and 5′-GGTTA ACCGGTCTCGATGGGCGGCCGCCGTGAGGCTTGGAACCTCTAGAAACCAGTACTAGCCCGAGACCTAATCG-3′ (IDT).

For making template DNALongCy5 , two identical Golden Gate Assembly reactions were carried out by mixing 7 μl of each ∼ 20 nM DT4 plasmid and ∼ 20 nM ligator fragment with 1 μl of Golden Gate Mix (New England Biolabs) in T4 DNA Ligase Buffer (New England Biolabs), in total volumes of 20 μl. The mixtures were incubated for alternating cycles of 5 min at 37°C and 10 min at 16°C 35 times, followed by 5 min at 55°C. After the reaction, the ligase was inactivated for 10 min at 65°C. The resulting 40 μl of reaction product was mixed with 4 μl of T5 Exonuclease (New England Biolabs) in NEB Buffer 4, to a total of 50 μl and incubated at 37°C for 30 min. The digestion was stopped by adding 15 mM of EDTA, and a Qiagen PCR Cleanup Kit was used to remove the cleaved nucleotides and enzymes.

For making template DNAShort Cy5 , a linear DNA fragment was first amplified by PCR from plasmid pCDW114 (16, Addgene #70061), using primers 5′-GAAGGTCTCCAGCCGTACCAACCAGCGGCTTATC-3′ and 5′-CCGGGTCTCACCATACCCGCTGTCTGAGATTACG-3′. A Golden Gate Assembly reaction was carried out by mixing 2 μl of 343 nM PCR product, 0.6 μl of 1 μM ligator and 1 μl of Golden Gate Mix in T4 DNA Ligase Buffer, in a total volume of 20 μl. The mixture was incubated for alternating cycles of 5 min at 37°C and 10 min at 16°C 35 times, followed by 5 min 55°C. After the reaction, the ligase was inactivated for 10 min at 65°C. The resulting reaction product was mixed with 1 μl Exonuclease V (New England Biolabs) and 3 μl of 10 mM ATP in NEB Buffer 4, in a total volume of 30 μl, and incubated at 37°C for 30 min. Exonuclease V was then inactivated for 30 min at 70°C. Finally, a Qiagen PCR Cleanup Kit was used to remove the cleaved nucleotides and enzymes.

Proteins

Fluorescent labeling of core RNAP

E. coli core RNAP with a SNAP tag on the C-terminus of β38 (RNAP-SNAP, gift from the Robert Landick lab) was labeled with SNAP-Surface 549, yielding RNAP549, as follows: 13.65 μM SNAP-RNAP (core) and 45.5 μM of SNAP-Surface 549 were mixed in a buffer containing 9 mM Tris-Cl- pH 7.9, 5 mM MgCl2, 1 mM DTT, 20% glycerol, and 90 mM NaCl, and incubated for 30 min at room temperature. The sample was then mixed with an equivalent amount of Dilution buffer (11 mM Tris-Cl- pH 8.0, 30% glycerol, 110 mM NaCl, 1 mM DTT), flash-frozen in liquid nitrogen and stored at −80°C.

Expression and purification of His-tagged σ70

His6-tagged E. coli σ70 (σ70) was overexpressed in T7 Express cells (New England Biolabs) as inclusion bodies from the pET-28a-σ70 overexpression plasmid 39 by growing the cells at 37°C to an OD600 of ∼ 0.8, and then inducing by addition of IPTG to 0.4 mM. The temperature was decreased to 20°C and cells were left shaking at 200 rpm overnight. Cells were then harvested by centrifugation at 4°C, followed by sonication in Lysis buffer (50 mM Tris-Cl-, pH 7.9, 5 mM imidazole, 5% [v/v] glycerol, 233 mM NaCl, 2 mM EDTA, 10 mM β-mercaptoethanol) plus 1× cOmpleteprotease inhibitor cocktail (Roche). The lysate was centrifuged at 22, 000 × g for 30 min at 4°C and the supernatant was discarded. To remove E. coli membrane and cell wall material, the pellet was resuspended in 10 ml of 2 M Urea Cleaning buffer (20 mM Tris-Cl- pH 8.0, 500 mM NaCl, 2 M urea, 2% Triton X-100, 10 mM β-mercaptoethanol) and sonicated. The resulting sample was centrifuged again at 22, 000 × g for 30 min at 4°C and the supernatant was discarded. Four consecutive resuspension-centrifugation cycles were carried out, two of them in 2 M Urea Cleaning buffer, and the other two in Wash buffer (20 mM Tris-Cl- pH 8.0, 500 mM NaCl, 7% glycerol, 20 mM imidazole, 10 mM β-mercaptoethanol) to remove Triton X-100 from the pellet. To solubilize and denature the protein, the washed pellet was resuspended in 6 M Guanidine Binding buffer (20 mM Tris-Cl- pH 8.0, 500 mM NaCl, 5 mM imidazole, 6 M guanidine hydrochloride, 2 mM β-mercaptoethanol), stirred for 1 hour, and centrifuged at 22, 000 × g for 30 min at 4°C. The supernatant was passed through a 0.22 μm filter and injected into a 1 ml HisTrap column (Cytiva Life Sciences), followed by a wash with Wash buffer supplemented with 6 M urea. Refolding of the bound protein was performed using a linear 1-hour-long 6 M to 0 M urea gradient in Wash buffer. The refolded protein was eluted with 500 mM imidazole in Wash buffer. The purified protein was dialyzed overnight into σ70 storage buffer (10 mM Tris-Cl-, pH 8.0, 30% [v/v] glycerol, 0.1 mM EDTA, 100 mM NaCl, 20 μM ZnCl2, 1 mM MgCl2, 0.1 mM DTT) and aliquots were flash-frozen in liquid N2 and stored at −80°C.

Fluorescent labeling of σ70

An N-terminal His6-tagged single-cysteine derivative of E. coli σ70 (C132S C291S C295S S366C) 40 (see Appendix S4) was overexpressed and purified following the same protocol used for σ70. The purified protein was concentrated 5× using an Amicon Ultra-0.5ml 30K filter by centrifuging for 11 minutes at 14, 000 × g at 4°C. For fluorescent labeling, the concentrated protein was mixed with Cy5-maleimide dye (Cytiva) (1:15 protein:dye ratio), incubated first for 10 min at room temperature, and then left overnight at 4° C. The excess dye was then removed using a Centrispin 20 column (Princeton Separations). After addition of glycerol and BSA to 30% and 1 mg/ml respectively, the samples were flash-frozen in liquid N2, and aliquots were stored at −80°C.

Reconstitution of doubly-labeled holoenzyme

Cy5-σ70RNAP549 holoenzyme (see Appendix S4) was reconstituted by incubating 121 nM of RNAP549 and 280 nM of Cy5-σ70 for 30 min at 37°C.

Colocalization Single-Molecule Spectroscopy (CoSMoS) Experiments

Single-molecule total internal reflection fluorescence microscopy was performed 41 at excitation wavelengths 532 and 633 nm, for observation of DNACy5 template (and/or Cy5-σ70) and RNAP549, respectively; focus was automatically maintained 42. A stage heating device was used to keep the samples at 30°C. Single-molecule observations were performed in glass flow chambers (volume ∼ 30 μl) passivated with a mPEG-SG2000:biotin-PEG-SVA5000 (Laysan Bio) 200 : 1 w/w mixture as described in 43. Neutravidin (#21125; Life Technologies) was introduced at 220 nM in KO buffer (50 mM TrisOAc, 100 mM KOAc, 8 mM Mg(OAC)2, 27 mM NH4(OAc), 0.1 mg/ml bovine serum albumin (BSA) (#126615 EMB Chemicals), pH 8.0), incubated for 45 s, and washed out (this and all subsequent wash steps used two washes each of two chamber volumes of KO buffer). The chamber was then incubated with ∼1 nM Cy5-DNA (DNAShort Cy5  or DNALongCy5 ) in KO buffer for ∼ 20 min and washed out with Imaging buffer (KO buffer supplemented with an O2 scavenging system: 4.5 mg/ml glucose, 40 units/ml glucose oxidase, and 1, 500 units/ml catalase 43).

For the experiments to measure the dwell time of RNAP549 on DNA at different concentrations of σ70, ∼ 1 nM of RNAP549 was introduced into the chamber in Imaging buffer supplemented with 3.5% w/v PEG 8, 000 and 1 mg/ml BSA for ∼ 10 min. Image acquisition was performed by alternating 1 s exposures to 532 and 633 nm, at 450 and 200 μW respectively (all laser powers were measured incident to the micromirror optics), and the flow chamber was washed with Imaging buffer supplemented with 3.5% w/v PEG 8, 000 and containing 0, 148 nM, 297 nM, 593 nM, 741 nM or 1.19 μM of σ70. In the cases where the concentration of σ70 was lower than 1.19 μM, the appropriate amount of σ70 storage buffer was added in replacement so that all experiments were performed at the same solute concentrations: 47.0 mM TrisOAc, pH 8.0, 93.0 mM KOAc, 7.4 mM Mg(OAc)2, 25 mM NH4(OAc), 3% w/v 8, 000 PEG, 0.2 mM Tris-Cl-, 2.0 mM NaCl, 0.4 μM ZnCl2, 20 μM MgCl2, 4.5 mg/ml glucose, 40 units/ml gluclose oxidase, 1, 500 units/ml catalase, 0.6% glycerol, 2 μM EDTA, 0.1 mg/ml BSA, 2 mM DTT, 10 nM DTT-quenched Cy5.5 maleimide dye.

The experiments to measure dwell time of σ70RNAP on DNA (see Appendix S4) were performed similarly to the ones described in the previous paragraph, with three differences. First, a photobleaching step was performed after DNA surface attachment. Cy5 photobleaching was induced by 633 nm excitation at ∼ 1 mW in the presence of Imaging buffer without DTT. Second, instead of σ70, ∼ 1 nM of Cy5-σ70RNAP549 (which also contained an additional 1.5 nM Cy5-σ70) was introduced into the chamber in Imaging buffer supplemented with 3.5% w/v PEG 8, 000 and no subsequent wash was performed. The final composition of the solution was 47.5 mM of TrisOAc, pH 8.0, 95.1 mM KOAc, 7.4 mM Mg(OAc)2, 25.7 mM NH4(OAc), 3.3% w/v 8, 000 PEG, 0.1 mg/ml BSA, 1 mM DTT, 0.1 mM Tris-Cl-, 0.3% glycerol, 1 mM NaCl, 8 μM MgCl2, 36 nM ZnCl2, 1.8 μM EDTA, 1.1 nM SNAP-RNAP, 2.5 nM unreacted SNAP-Surface 549, 2.5 nM Cy5-σ70, 4.5 mg/ml glucose, 40 units/ml glucose oxidase, 1, 500 units/ml catalase. Third, image acquisition was performed by continuous exposure to 532 and 633 nm lasers, at 450 and 200 μW respectively, at an acquisition rate of 1 frame per second.

CoSMoS Data analysis

Analysis of CoSMoS video recordings was done using custom software and algorithms for mapping between wavelength channels, spatial drift correction, and detection of spot colocalization as described 41. In each recording, we selected DNALongCy5  or DNAShort Cy5  fluorescence spots that co-localized with RNAP549 spots at t = 0. For the selected DNA molecules, we computed RNAP549 fluorescence intensity time records by summing the intensity over 3 × 3 pixel squares centered at DNA molecule locations in each recorded frame. Fluorescence intensity values were corrected for background fluorescence and non-uniform illumination across the microscope field of view, yielding normalized values for spot intensities 44. This allowed us to directly compare integrated intensity values for different spots located throughout the field of view. The numbers of decreasing intensity steps in the resulting time traces were counted to assess the initial number of RNAP549 molecules present at each DNA molecule location (Fig. S2A). Records that showed more than a single RNAP549 molecule bound at t = 0 were excluded from subsequent analysis. The times of the first image with no spot at each DNA location were taken to be the dwell times of the RNAP549 molecules present at the beginning of the recording. Spots that persisted until the end of the recording were separately counted as censored dwell times equal to the recording duration.

Fits to RNAP-DNA complex dwell time distributions

The probability distribution of RNAP-DNA complex dwell times measured in each individual experiment was modeled as the sum of two exponential terms

f1=afast kfast expkfast t+1afast kslow expkslow t (13)

or the sum of three exponential terms

f2=afast kfast expkfast t+ainter kinter expkinter t+1ainter afast kslow expkslow t. (14)

For each distribution, lifetimes of RNAP549 binding events that terminated by disappearance of the fluorescent spot, and those that were censored by the end of the experiment, were jointly fit using the maximum likelihood algorithm by an approach analogous to the one used in 45. Confidence intervals were calculated by bootstrapping 41.

Extraction of model parameters kb, koff, and koff,s

To get values for kb, koff, and koff,s, we globally fit dwell times collected at all concentrations of σ70 to the models in equation 13 (for [σ70] = 0) or equation 14 (for [σ70] > 0), where kfast was explicitly constrained to depend on [σ70]:

kfast =koff+koff,skbσ70koff,s+kbσ70. (15)

In this formulation, kinter and kslow are assumed to be independent of [σ70], and therefore were globally fit across distributions obtained for template DNA Long Cy5. For the experiment performed with template DNA ShortCy5, we fit independent values kinter' and kslow' for these parameters. Censored data were treated using the same approach as described above for the individual experiment fits to dwell time distributions.

Fit to holoenzyme-DNA dwell time distribution

To account for non-specific binding of holoenzyme to the glass flow chamber (see Appendix S4), we first randomly selected locations on the chamber surface that did not contain DNA molecules. We then fit the distribution of dwell times for Cy5-σ70RNAP549 holoenzyme molecules bound at these non-DNA locations to a biexponential model

fnD(t)=a1nDk1nDexpk1nDt+1a1nDk2nDexpk2nDt/fnD0, (16)

with

fnD0=a1nDexpk1nDtmin+1a1nDexpk2nDtmin, (17)

where fnD(t) is normalized so that it integrates to 1 over all dwell times t greater than the minimum detectable dwell time tmin = 0.2 s.

By analogy to 41, the dwell time distribution for Cy5-σ70RNAP549 at DNA locations was then fit to the background-corrected model

fD(t)=FDFnDa1Dk1Dexpk1Dt+a2Dk2Dexpk2Dt+1a1Da2Dk3Dexpk3Dt/fD0+FnDfnDML(t), (18)

with

fD0=a1Dexpk1Dtmin+a2Dexpk2Dtmin +1a1Da2Dexpk3Dtmin, (19)

where FD and FnD represent the total binding frequency at DNA and non-DNA locations, respectively, and fnDML stands for fnD evaluated on the maximum likelihood estimators obtained by fitting the non-DNA locations data. As before, we jointly fit the censored and uncensored data using the maximum likelihood method 45.

Simulation of search times

In order to calculate the mean search time ⟨tf⟩ required for the RNAP to find the secondary promoter, we used numerical simulations of the mechanism depicted in Fig. 1. In particular, we used the Gillespie algorithm 46 to generate the stochastic trajectory of an RNAP molecule on a DNA molecule. In the simulation, the state of the system is characterized by the position of the RNAP on DNA and whether it is bound to σ70 or not. Initially, the RNAP is at position x = 0 (which corresponds to the position of the terminator from the primary transcription unit), and it is not bound to σ70. We then draw a time t1 at random from an exponential distribution with p(t) = λ exp (−λt) with λ = kb[σ70] + koff, and choose between two possible transitions: binding σ70 or dissociating from the DNA. Which of the transitions takes place is chosen at random according to their relative weights kbσ70kbσ70+koff and koff kbσ70+koff . If the RNAP dissociates from the DNA, its attempt to find the secondary promoter is considered unsuccessful, and the simulation starts over with a new trial. If the RNAP binds σ70, the position on the DNA x1 at which binding occurs is dependent on the amount of diffusion away from the primary terminator. x1 is determined by drawing at random from a normal distribution with mean μ = 0 and variance var = 2Dt1. The time t2 that is required to diffuse from x1 to the secondary promoter located at xp is then drawn at random from the first passage time density

pt2=xpx14πDt2expxpx124Dt2.

An RNAP-σ70 complex dissociation time t3 is drawn at random from an exponential distribution with λ = koff,s. If t2 < t3, the RNAP-σ complex is considered to have found the secondary promoter at time tf = t1 + t2. If t2 > t3, the attempt to find the secondary promoter was unsuccessful. The whole process is repeated multiple times, generating a distribution of search times.

Genome-wide analysis of terminator-promoter distances

Using the promoter and terminator annotations reported by Conway et al 29, we measured the distance of each operon-ending terminator to the nearest operon initial promoter in the E. coli genome.

Supplementary Material

Supplement 1

SIGNIFICANCE STATEMENT.

After transcribing an operon, a bacterial RNA polymerase can stay bound to DNA, slide along it, and reinitiate transcription of the same or a different operon. Quantitative single-molecule biophysics experiments combined with mathematical theory demonstrate that this reinitiation process can be quick and efficient over gene spacings typical of a bacterial genome. Reinitiation may provide a mechanism to orchestrate the transcriptional activities of groups of nearby operons.

ACKNOWLEDGMENTS

We thank Bob Landick, and Rachel Mooney, and for providing us with plasmids and proteins. We would like to thank members of the Landick, Kondev and Gelles labs for insightful discussion. We are grateful to Johnson Chung for help with microscopy, and with Liuyu Chen for help in plasmid preparation. This work was funded by grants from NIGMS (R01 GM081648 to J.G.), from NSF (DMR-1610737 to JK), and the Simons Foundation (to JK).

Footnotes

AUTHOR COMPETING INTERESTS

The authors declare no competing interests.

REFERENCES

  • [1].Feklístov A, Sharon BD, Darst SA, Gross CA, Bacterial sigma factors: A historical, structural, and genomic perspective. Annual Review of Microbiology 68, 357–376 (2014). [DOI] [PubMed] [Google Scholar]
  • [2].Burgess RR, Travers AA, Dunn JJ, Bautz EK, Factor stimulating transcription by RNA polymerase. Nature 221, 43–46 (1969). [DOI] [PubMed] [Google Scholar]
  • [3].Browning DF, Busby SJ, Local and global regulation of transcription initiation in bacteria. Nature Reviews Microbiology 14, 638–650 (2016). [DOI] [PubMed] [Google Scholar]
  • [4].Fischbach M, Voigt CA, Prokaryotic gene clusters: A rich toolbox for synthetic biology. Biotechnology Journal 5, 1277–1296 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [5].Jacob F, Perrin D, Sanchez C, Monod J, L’opéron: groupe de gènes à expresion coordonnée par un opérateur. Comptes Rendus Academie des Sciences Paris 250, 514–520 (1960). [Google Scholar]
  • [6].Zhang H, Yin Y, Olman V, Xu Y, Genomic Arrangement of Regulons in Bacterial Genomes. PLOS ONE 7, e29496 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [7].Yin Y, Zhang H, Olman V, Xu Y, Genomic arrangement of bacterial operons is constrained by biological pathways encoded in the genome. Proceedings of the National Academy of Sciences of the United States of America 107, 6310–6315 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [8].Zampieri M, Soranzo N, Bianchini D, Altafini C, Origin of co-expression patterns in E. coli and S. cerevisiae emerging from reverse engineering algorithms. PLoS ONE 3, 1–10 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [9].Korbel JO, Jensen LJ, Mering CV, Bork P, Analysis of genomic context: Prediction of functional associations from conserved bidirectionally transcribed gene pairs. Nature Biotechnology 22, 911–917 (2004). [DOI] [PubMed] [Google Scholar]
  • [10].Pannier L, Merino E, Marchal K, Collado-Vides J, Effect of genomic distance on coexpression of coregulated genes in E. coli. PLoS ONE 12, 1–20 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [11].Kruglyak S, Tang H, Regulation of adjacent yeast genes. Trends in Genetics 16, 109–111 (2000). [DOI] [PubMed] [Google Scholar]
  • [12].Williams EJ, Bowles DJ, Coexpression of Neighboring Genes in the Genome of Arabidopsis thaliana. Genome Research 14, 1060–1067 (2004). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [13].Liu LF, Wang JC, Supercoiling of the DNA template during transcription. Proceedings of the National Academy of Sciences of the United States of America 84, 7024–7027 (1987). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [14].Tan J, Shu L, Wu HY, Activation of the leu-500 promoter by adjacent transcription. Journal of Bacteriology 176, 1077–1086 (1994). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [15].Rhee KY, et al. , Transcriptional coupling between the divergent promoters of a prototypic LysR-type regulatory system, the ilvYC operon of Escherichia coli. Proceedings of the National Academy of Sciences of the United States of America 96, 14294–14299 (1999). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [16].Harden TT, et al. , Alternative transcription cycle for bacterial RNA polymerase. Nature Communications 11, 448 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [17].Kang W, et al. , Transcription reinitiation by recycling RNA polymerase that diffuses on DNA after releasing terminated RNA. Nature Communications 11, 450 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [18].W Kang, Hwang S, Kang JY, Kang C, Hohng S, Hopping and flipping of rna polymerase on dna during recycling for reinitiation after intrinsic termination in bacterial transcription. International Journal of Molecular Sciences 22, 1–13 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [19].You L, et al. , Structural basis for intrinsic transcription termination. Nature 2023 pp. 1–7 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [20].Maeda H, Fujita N, Ishihama A, Competition among seven Escherichia coli subunits: relative binding affinities to the core RNA polymerase. Nucleic Acids Research 28, 3497–3503 (2000). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [21].Wu FYH, Yarbrough LR, Wu CW, Conformational Transition of Escherichia coli RNA Polymerase Induced by the Interaction of σ Subunit with Core Enzyme. Biochemistry 15, 3254–3258 (1976). [DOI] [PubMed] [Google Scholar]
  • [22].Redner S, A Guide to First-Passage Processes. (Cambridge University Press; ), (2001). [Google Scholar]
  • [23].Arndt KM, Chamberlin MJ, Transcription termination in Escherichia coli. Journal of Molecular Biology 202, 271–285 (1988). [DOI] [PubMed] [Google Scholar]
  • [24].Inlow K, Tenenbaum D, Friedman L, Kondev J, Gelles J, Mechanism of Post-Termination Recycling of E. coli RNA Polymerase by the Swi2/Snf2 ATPase RapA (manuscript in preparation). (2023). [Google Scholar]
  • [25].Vogt V, Breaks in DNA stimulate transcription by core RNA polymerase. Nature 223, 854–855 (1969). [DOI] [PubMed] [Google Scholar]
  • [26].Choubey S, Kondev J, Sanchez A, Distribution of Initiation Times Reveals Mechanisms of Transcriptional Regulation in Single Cells. Biophysical Journal 114, 2072–2082 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [27].Golding I, Paulsson J, Zawilski SM, Cox EC, Real-time kinetics of gene activity in individual bacteria. Cell 123, 1025–1036 (2005). [DOI] [PubMed] [Google Scholar]
  • [28].Grigorova IL, Phleger NJ, Mutalik VK, Gross CA, Insights into transcriptional regulation and sigma competition from an equilibrium model of RNA polymerase binding to DNA. Proceedings of the National Academy of Sciences of the United States of America 103, 5332–5337 (2006). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [29].Conway T, et al. , Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing. mBio 5 (2014) e01442–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [30].Blainey PC, Oijen AM Van, Banerjee A, Verdine GL, Xie XS, A base-excision DNA-repair protein finds intrahelical lesion bases by fast sliding in contact with DNA. Proceedings of the National Academy of Sciences of the United States of America 103, 5752–5757 (2006). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [31].Hammar P, et al. , The lac repressor displays facilitated diffusion in living cells. Science 336, 1595–1598 (2012). [DOI] [PubMed] [Google Scholar]
  • [32].Blainey PC, et al. , Nonspecifically bound proteins spin while diffusing along DNA. Nature Structural and Molecular Biology 16, 1224–1229 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [33].Stracy M, et al. , Live-cell superresolution microscopy reveals the organization of RNA polymerase in the bacterial nucleoid. Proceedings of the National Academy of Sciences of the United States of America 112, E4390–E4399 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [34].Stracy M, et al. , Transient non-specific DNA binding dominates the target search of bacterial DNA-binding proteins. Molecular cell 81, 1499–1514 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [35].Fang G, Rocha EP, Danchin A, Persistence drives gene clustering in bacterial genomes. BMC Genomics 9, 4 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [36].Nicolas P, et al. , Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science 335, 1103–1106 (2012). [DOI] [PubMed] [Google Scholar]
  • [37].Padgett KA, Sorge JA, Creating seamless junctions independent of restriction sites in PCR cloning. Gene 168, 31–35 (1996). [DOI] [PubMed] [Google Scholar]
  • [38].Tetone LE, et al. , Dynamics of GreB-RNA polymerase interaction allow a proofreading accessory protein to patrol for transcription complexes needing rescue. Proceedings of the National Academy of Sciences of the United States of America 114, E1081–E1090 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [39].Mumm JP, Friedman LJ, Gelles J, Mechanism of upstream promoter element stimulation of transcription at a ribosomal RNA promoter determined by single-molecule imaging. bioRxiv (2020) doi: 10.1101/2020.02.17.953182. [DOI] [Google Scholar]
  • [40].Callaci S, Heyduk E, Heyduk T, Conformational Changes of Escherichia coli RNA Polymerase 70 Factor Induced by Binding to the Core Enzyme. Journal of Biological Chemistry 273, 32995–33001 (1998). [DOI] [PubMed] [Google Scholar]
  • [41].Friedman LJ, Gelles J, Multi-wavelength single-molecule fluorescence analysis of transcription mechanisms. Methods (San Diego, Calif.) 86, 27 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [42].DJ Crawford, Hoskins AA, Friedman LJ, Gelles J, Moore MJ, Visualizing the splicing of single pre-mRNA molecules in whole cell extract. RNA (New York, N.Y.) 14, 170–179 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [43].Friedman LJ, Gelles J, Mechanism of transcription initiation at an activator-dependent promoter defined by single-molecule observation. Cell 148, 679–689 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [44].Jesús-Kim LD, et al. , DDK regulates replication initiation by controlling the multiplicity of Cdc45-GINS binding to Mcm2–7. eLife 10, 1–83 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [45].Bombardier JP, et al. , Single-molecule visualization of a formin-capping protein ‘decision complex’ at the actin filament barbed end. Nature communications 6, 8707 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [46].Gillespie DT, Exact stochastic simulation of coupled chemical reactions. Journal of Physical Chemistry 81, 2340–2361 (2002). [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplement 1

Articles from bioRxiv are provided here courtesy of Cold Spring Harbor Laboratory Preprints

RESOURCES