Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2023 Feb 18;13(3):88. doi: 10.1007/s13205-023-03512-3

Cloning, recombinant expression, purification, and functional characterization of AGAAN antibacterial peptide

Ya’u Sabo Ajingi 1,2, Neeranuch Rukying 1, Nafiu Usman Jiddah 1,3, Yuichi Koga 4, Nujarin Jongruja 1,✉
PMCID: PMC9938847  PMID: 36811032

Abstract

A recombinant version of the AGAAN antimicrobial peptide (rAGAAN) was cloned, expressed, and purified in this study. Its antibacterial potency and stability in harsh environments were thoroughly investigated. A 15 kDa soluble rAGAAN was effectively expressed in E. coli. The purified rAGAAN exhibited a broad antibacterial spectrum and was efficacious against seven Gram-positive and Gram-negative bacteria. The minimal inhibitory concentration (MIC) of rAGAAN against the growth of M. luteus (TISTR 745) was as low as 60 µg/ml. Membrane permeation assay reveals that the integrity of the bacterial envelope is compromised. In addition, rAGAAN was resistant to temperature shock and maintained a high degree of stability throughout a reasonably extensive pH range. The bactericidal activity of rAGAAN ranged from 36.26 to 79.22% in the presence of pepsin and Bacillus proteases. Lower bile salt concentrations had no significant effect on the function of the peptide, whereas higher concentrations induced E. coli resistance. Additionally, rAGAAN exhibited minimal hemolytic activity against red blood cells. This study indicated that rAGAAN may be produced on a large scale in E. coli and that it had an excellent antibacterial activity and sufficient stability. This first work to express biologically active rAGAAN in E. coli yielded 8.01 mg/ml at 16 °C/150 rpm for 18 h in Luria Bertani (LB) medium supplemented with 1% glucose and induced with 0.5 mM IPTG. It also assesses the interfering factors that influence the activity of the peptide, demonstrating its potential for research and therapy of multidrug-resistant bacterial infections.

Keywords: Antibacterial peptide, Recombinant expression, Purification, Propidium iodide, Stability

Introduction

Antibiotic resistance upsurge in recent decades results from the overuse and misuse of antibiotics, aided by healthcare organizations (Chandran et al. 2022). Pharmaceutical companies' paucity of novel antimicrobials development is linked to microbial resistance (Mantravadi et al. 2019; Wang et al. 2020). In recent years, evidence of pan-resistant bacteria has evolved, putting humanity on the brink of a post-antibiotic era. Thus, novel antibacterial agents are desperately required to combat microbial resistance. Antimicrobial peptides (AMPs) are deemed to be the best options for chemical antibiotics (Mookherjee et al. 2020). AMPs are naturally occurring short amphipathic cationic polypeptides (Li et al. 2021). They were important participants in most living species' defensive systems, directly killing pathogens and boosting the immune response (Deptuła et al. 2018; Pantic et al. 2017). So far, approximately 3000 natural AMPs have been found in a variety of taxa, notably plants (Retzl et al. 2020), insects (Johanna Toro Segovia et al. 2017), fungi (Nakamura et al. 2017), fishes (Chen et al. 2020), frogs (Barran et al. 2020), and mammals (Mardirossian et al. 2018). AMPs are reportedly less susceptible to drug resistance than conventional antibiotics due to their unique structures and mechanisms of action (Almaaytah et al. 2017; Wei et al. 2018).

Compounds from frog skin secretion have antimicrobial properties, making them a promising candidate for future clinical application. Environmental pressures on frogs may have prompted the evolution of a diverse arsenal of antimicrobial defenses (Varga et al. 2019). Amphibians of diverse families, genera, or species retain discrete groups of peptides from several AMP families with additional biological functions (Lekshmipriya et al. 2021). A recent study from our lab employed a consensus sequence technique to generate a potent antibacterial peptide (AGAAN) from Agalychnis annae skin secretion (Ajingi et al. 2021). AGAAN is an alpha-helical having 40 amino acid residues peptide and a net charge of + 6. The synthetic analog of the peptide was found to be efficient against Gram-positive (Bacillus subtilis, Staphylococcus aureus, and Enterococcus faecalis) and Gram-negative (Escherichia coli, Pseudomonas aeruginosa and Salmonella Typhimurium) organisms. The chemically synthesized peptide displayed minimal or no significant toxicity to mammalian red blood cells. The major drawbacks of the chemical method of synthesis are its high cost, the insolubility of certain peptides, which may result in low yield, and the use of hazardous chemicals during synthesis, which may contribute to the emergence of harmful byproducts. To obtain large amounts of AGAAN for further physiological research and overcome these constraints, low-cost and efficient production methods are required.

Borrowing from the wisdom of nature is among the most powerful and straightforward techniques for peptide production. The high yield, ease of DNA manipulation, and relatively inexpensiveness of recombinant peptide production has attracted much interest (Wei et al. 2018). In the laboratory and the commercial context, recombinant peptides are produced for various applications. Despite the broad host range of AGAAN, pharmacological and therapeutic promise, it is unclear whether molecular modification and recombinant production will influence its antibacterial activity. In the current study, AGAAN was effectively cloned, expressed in E. coli, purified, and functionally characterized. Under regulated laboratory conditions, the peptide was successfully produced in soluble form without needing a fusion tag. Its hemo-toxicity, pH, temperature, proteases and bile salt stability, and ultrastructural membrane integrity were also investigated.

Materials and methods

Bacteria, plasmids, and enzymes

Seven bacterial strains were provided by the Department of Microbiology, King Mongkut’s University of Technology Thonburi KMUTT, Bangkok. They were Pseudomonas aeruginosa DMST 15,501, Salmonella Typhimurium ATCC 13311, Escherichia coli ATCC 8739, Bacillus subtilis ATCC 6633, Micrococcus luteus TISTR 745, Staphylococcus aureus ATCC 6538, and Enterococcus faecalis ATCC 19433. The pET-25b( +) plasmid (Novagen, Sigma Aldrich) was employed as a cloning vector. For gene manipulation, E. coli DH5α was used and BL21 (DE3) (Novagen, Madison, WI, USA) for expression. Both the strains were grown in LB broth with 50 µg/ml ampicillin and chloramphenicol at 37 °C. NdeI and BamHI restriction enzymes were purchased from New England BioLabs (UK) Ltd, while T4 DNA ligase and Taq DNA polymerase were purchased from Thermo Scientific (Lithuania).

Synthesis, PCR, and expression vector

The AGAAN gene with an accession number OQ326597 containing proper codons for E. coli was synthesized by Humanizing Genomics Macrogen Company Bangkok, Thailand, and cloned into pBHA (Bioneer, US). QIAN prep Mini Plasmid Kit (Qiagen, Hilden, Germany) was used to extract plasmid DNA. Taq DNA polymerase (Thermo Scientific) was used to achieve the AGAAN gene amplification. (5'GGGTTTCATATGGGCATGTGGAG 3'), and (5'CGCGGATCCTCATTAATGGTGG 3') were the forward and reverse primers, respectively. Under the following conditions, 25 PCR reaction cycles were performed. Hot start at 94 °C for 5 min, denaturing at 94 °C for 30 s, annealing at 54 °C for 30 s, extension at 72 °C for 45 s, and incubation at 72 °C for 10 min. 1.5% gel electrophoresis was used to separate the PCR products, which were then purified using a DNA gel extraction kit (Qiagen). After that, the pET-25b( +) vector was incubated overnight in New England Biolabs (NEB) buffer with the NdeI and BamH1 restriction enzymes. After successful digestion, the T4 DNA Ligase was used to join the AGAAN gene into the vector. E. coli DH5α was transformed with the ligated combination. The presence of the recombinant plasmid was confirmed using colony PCR and sequencing.

rAGAAN peptide expression

The competent E. coli BL21 (DE3) was transformed with the pET-AGAAN plasmid. A single colony of the recombinant expression strain was incubated in LB broth containing 50 µg/ml each of ampicillin and chloramphenicol at 37 °C with shaking at 200 rpm all night. Then, 1.5% from the culture was added to fresh 1L LB broth supplemented with the same antibiotics concentrations as above. The culture was grown to an optical density (OD600) between 0.4 and 0.6 at 37 °C and 200 rpm. After that, IPTG (0.5 mM) was added to stimulate the expression of the rAGAAN at 16 °C and 150 rpm for 18 h. The cells were collected by centrifugation at 5000 rpm for 20 min at 4 °C and resuspension in 10 ml buffer consisting of 10 mM Tris–HCl, 1 M NaCl, pH 8.0. The harvested cells were then disrupted by sonication for 20 s and 10 s rest, 60% amplitude for 5 min on ice. After centrifugation at 5000 rpm for 20 min at 4℃, the supernatant was removed for tricine-SDS-PAGE assessment.

rAGAAN peptide purification

The supernatant was purified with the HisTrap FF column connected to ÄKTA prime FPLCsystem (GE Healthcare). The column was pre-equilibrated with binding buffer (which also served as the lysis buffer). The bound peptide was eluted using an isocratic gradient of buffer B (10 mM Tris–HCl, 1 M NaCl, 250 mM imidazole, pH 8.0). The eluted fractions were analyzed by 16% tricine-SDS-PAGE, dialyzed overnight at 4 °C against 50 mM Tris–HCl. A total of four liters of culture were treated and purified, yielding approximately 32 mg of rAGAAN following concentration in a Centricon tube (Amicon, Germany). Lastly, the concentration of the rAGAAN was determined using the Bradford protein assay (Bio-Rad).

Western blotting

The purified and concentrated rAGAAN peptide was subjected to a 16% tricine-SDS-PAGE analysis. Upon loading the peptide to the PVDF membrane (Millipore), an AntiHis HRP Conjugate antibody (QIAexpress) was used for sensitive and fast detection of the His-tagged protein (1:3,000 dilution). A 5% Alkali-soluble Casein blocking reagent (Millipore) was also utilized, a unique blocking reagent for ultra-low background. The Image-Quanta LAS 500 (GE-Health care) was used to visualize the protein band.

LC–MS/MS analysis

Liquid chromatography–tandem mass spectrometry (LC–MS/MS) was performed using a Dionex Ultimate 3000, RSLCnano System coupled to an ESI Model Q-ToF Compact II, Bruker, Germany. Samples of rAGAAN peptide were loaded onto the RSLCnano setup and trapped and desalted on a C18 trap column (Acclaim PepMap RSLC 75 µm × 15 cm, nanoViper C18), protected by a guard column (C18 PepMap100, 300 µm × 5 mm, 5 μm), eluted at 0.3 μl/min at gradient settings of 2–85% B for 50 min. A comprises water and formic acid (99.9:0.1, v/v), whereas B comprises water and acetonitrile (20:80, v/v). MS was conducted in positive ion mode, with internal mass calibration. The peptide sequence was identified using the MASCOT searching engine. Search parameters in MASCOT MS/MS Ions search were followed by oxidation at methionine residues as variable modification, peptide tolerance of ± 1.2 Da, and MS/MS fragment tolerance of ± 0.6 Da. Mass spectral data were collected over a m/z range of 200 to 1400 m/z.

Bacterial growth inhibition assay

The MIC of the rAGAAN was measured following the Clinical and Laboratory Standards Institute (CLSI) standards. Overnight cultured strains were diluted to 1 X 105 CFU/ml with Mueller Hinton (MH) broth, and 50 µl of aliquot was placed into the wells of a 96-well plate. The peptide was then successively diluted with purified type 1 distilled water. Then, 50 µl of aliquot was administered onto the bacterial suspensions in the plates. The assays were carried out in triplicate. The plate was evaluated by measuring the OD600 following an 18-h incubation period at 37 °C. The MIC is the lowest concentration necessary to hinder bacterial growth (Wei et al. 2016).

Propidium iodide (PI) uptake

The PI infiltration experiment was used to investigate if rAGAAN may alter the membrane of the bacteria. PI can be used to stain DNA, but the cell membrane cannot be thoroughly infiltrated. Thus, there is a positive association between the intensity of PI fluorescence and the severity of membrane disruption. The reference strain E. coli ATCC 8739 was cultured at 37 °C for 12 h and then diluted to 105 CFU/ml. The diluted bacterial solution was then treated with 10 µg/ml of PI (Exbio, Vestec, Czech Republic). The cell suspension was distributed into a 96-well microtiter plate (Corning, Corning, NY, USA). Next, rAGAAN was added to the 96-well plate at varying concentrations levels. The fluorescence measurement was performed using a corresponding microplate reader (Synergy H1, Bio Tek, Winooski, VT, USA) at 535 nm for excitation and 617 nm for emission. The fluorescence readings were evaluated every 10 min during the 150-min process. PBS was a negative control, whereas 0.05% SDS was a positive control.

pH, temperature, proteases, and bile salt stability assessment of rAGAAN

The stability of the rAGAAN on a broad pH scale (3–12) was assessed. The peptide was evaluated for residual antibacterial activity using E. coli ATCC 8739 and S. aureus ATCC 6538 as markers. The cell suspension was treated for 2 h with 50 µl of the recombinant peptide at twice the MIC. Then, incubation was changed to 16 h at 37 °C. We computed the percentage inhibition of the bacteria from the percentage growth of the untreated samples (control). The temperature stability of purified rAGAAN was tested in a thermostatic water bath. Temperatures of 37, 50, 60, 70, 80, 90, and 100 °C were employed for 15 min. The residual activity was assessed using the markers. Control samples were treated with 50 mM Tris–HCl buffer, pH 8.0.

The sensitivity of rAGAAN to pepsin and Bacillus proteases was also evaluated by adding 10 µg/ml of the different proteases. The microdilution method was used to detect the stability of rAGAAN against the reference strains of E. coli and S. aureus. Additionally, bile salt's effect on the peptide's activity was examined. The bovine bile salt used in this study was purchased from Sigma Aldrich company US. Different bile concentrations of 0.25%, 0.5%, 1%, and 2% were incubated with a fixed concentration of rAGAAN at 1X the MIC of the reference strains for 1 h at ambient temperature. The bacterial suspensions were treated with the combinations and incubated overnight. Percentage inhibition of the bacteria by the rAGAAN under each condition was calculated. The percentage inhibition refers to the proportion of bacterial cells killed by the rAGAAN compared to the control.

Hemolytic assay

The hemotoxicity of the rAGAAN on human red blood cells (RBCs) was measured using a hemolysis assay. After two washes with 10 mM PBS, 180 µl of fresh RBCs were put into the 96-well plate. Type I water was used to dilute rAGAAN into a range of concentration gradients. Then, 20 µl of each concentration of rAGAAN was poured into the 96-well plate and stored for one hour at 37 °C. After centrifuging at 1000g for 5 min, the supernatants were aspirated. Hemolytic activity was measured at an absorbance of 414 nm. The positive and negative controls were 0.1% (v/v) Triton X-100 and PBS, respectively. Below is the formula for estimating the percentage of hemolysis:

%hemolysis=OD414 of sample-OD414 of negative controlOD414 of positive control-OD414 of negative control×100

Statistic evaluation

The information displayed is the average and standard deviation (S.D.) of at least three separate investigations. GraphPad Prism (GraphPad software, San Diego, CA, USA) was used to conduct the analysis. The one-way ANOVA test was used to determine whether a difference between the means was significant (p < 0.05). The standard error bars reflect the means' S.D.

Results

Plasmid construction, gene cloning, amplification, and sequencing

The schematic representation of the recombinant expression plasmid construction and amplification is depicted in Fig. 1. The Humanizing Genomics Macrogen company synthesized gene was inserted into the plasmid construct described earlier. After successful transformation, PCR amplification and DNA sequencing verified the insert's proper orientation (100%) (data not shown).

Fig. 1.

Fig. 1

Open in a new tab

Schematic presentation of the plasmid construction

Recombinant expression, purification, western blotting, and LC–MS/MS analysis

The recombinant plasmid containing the peptide was transfected into E. coli BL21 (DE3) cells for expression. The gene was produced in soluble form in recombinant BL21 (DE3) after induction with 0.5 mM IPTG. After disrupting the cells and centrifuging them, the supernatant is passed over a HisTrap FF column for chromatographic purification. The purification ensuing chromatogram is depicted in Fig. 2A. The purified rAGAAN yielded approximately 8.01 mg/ml. Coomassie blue-stained Tricine-SDS-PAGE revealed three bands exceeding the estimated 4.11 kDa theoretical molecular weight of the peptide (Fig. 2B). A single band of roughly 15 kDa was seen after the peptide was blotted on a nitrocellulose membrane, as shown in Fig. 2C. This band was subjected to LC–MS/MS analysis, which confirmed the presence of the AGAAN sequence (Fig. 3). This finding suggests that the peptide may have formed a dimer or merged with other proteins.

Fig. 2.

Fig. 2

Open in a new tab

Purification, Tricine-SDS-PAGE, and western blotting of the expressed rAGAAN peptide. A The chromatogram during the purification of the rAGAAN using the ÄKTA Prime FPLC system and Histrap FF column. B The purified and concentrated peptide on 16% Tricine-SDS-PAGE with about three visible bands. C Western blot analysis revealed a single 15 kDa protein band

Fig. 3.

Fig. 3

Open in a new tab

LC–MS analysis, showing fragments of the rAGAAN peptide obtained with highest peak of 871.1304 m/z. The x-axis shows the mass to charge number of ions (m/z) and the y-axis shows the relative signal intensity

Biological activity

The bactericidal activity of rAGAAN was assessed using the micro broth dilution method (Table 1). The peptide significantly (p < 0.05) inhibits the growth of the Gram-positive and the Gram-negative strains tested. The peptide inhibited P. aeruginosa and S. Typhimurium at a 125 µg/ml concentration each. The most susceptible organisms to the effect of the recombinant peptide were M. luteus, E. coli, and E. faecalis at a concentration range of 60–62.5 µg/ml. A minor resistance was observed with B. subtilis and S. aureus, which were inactivated at higher concentrations up to 220 µg/ml and 150 µg/ml, respectively. The antibacterial activity demonstrated by the rAGAAN on the bacteria tested is comparable to the synthetic analogue. In fact, it shows higher activity on about three strains than the chemically synthesized AGAAN. The result indicates that the rAGAAN can effectively prevent the proliferation of these pathogens.

Table 1.

The minimal inhibitory concentrations (MICs) of the rAGAAN and some selected peptides as positive control on the bacterial strains (µg/ml)

Peptides P. aeruginosa DMST 15,501 E. coli ATCC 8739 S. Typhimurium ATCC 13,311 B. subtilis ATCC 6633 M. luteus TISTR 745 S. aureus ATCC 6538 E. faecalis ATCC 19,433 References
rAGAAN 125 62.5 125 220 60 150 62.5 This study
GBP NT 200 NT NT NT 200 NT Zhao et al. (2017); Ning et al. (2019)
Pa-MAP 1.9  > 271.4 14.16 NT NT NT  > 271.4 3.54 Cardoso et al. (2016)
H5 2.9 4.9 1.9 NT NT 3.8  > 32 Jodoin and Hinck (2018)
P7 31.6–127.6 31.6–63.1 3.91 15.8 NT 63.1 31.6 Klubthawee and Aunpad (2021); Alfei et al. (2022)
Thanatin 48.8–97.6 1.5–2.9 1.5–2.9 6.1–12.2 2.9–6.1 NA NT Dash and Bhattacharjya (2021)
Open in a new tab

NT Not tested, NA No activity, DMST Department of Medical Sciences, Thailand, ATCC American Type Culture Collection, TISTR Thailand Institute of Scientific and Technological Research

*The MICs of the peptides shown in the table are against bacterial species from previous investigations in the references

Membrane permeability test

A PI uptake test was carried out to investigate the impact of rAGAAN on bacterial membranes. The outcomes demonstrated that rAGAAN significantly increased the fluorescence of PI in E. coli ATCC 8739 (Fig. 4). The concentrations of the rAGAAN and PI fluorescence were correlated. When the reference strain was exposed to the rAGAAN at doses of 1X, 2X, 3X, and 4X MIC for 40 min, the absorption of PI fluorescence increased by 25.5%, 32.9%, 53.1%, and 76.9%, respectively. Additionally, the fluorescence increased by 65.4%, 74.4%, 122.4%, and 147.9%, respectively, after 120 min of treatment. The fluorescence intensities of 1X, 2X, 3X, and 4X MIC were substantially different from the PBS control at 70 min, 100 min, and 120 min, respectively.

Fig. 4.

Fig. 4

Open in a new tab

The absorption of propidium iodide (PI) by E. coli ATCC 8239 after pure AGAAN treatment. The reference fluorescence (100%) was obtained from samples treated with 0.05% SDS, with PBS serving as a negative control. The data presented are averages of three independent replicates. The error bars displayed the standard deviation. For statistical analysis, one-way ANOVA and Dunnett's multiple comparisons test were utilized. At 70 and 120 min, ***p < 0.01 and ###p < 0.01 indicate a significant change compared to the PBS control, respectively

Effect of pH, temperature, proteases, and bile salt on rAGAAN activity

The activity of rAGAAN was assessed following treatment at various pHs, temperatures, proteases, and bile salt to explore its stability. The effect of pH on the antibacterial function of the recombinant peptide was studied in various buffers with varying pH scales (3 to 12). The outcomes demonstrated that rAGAAN retained its antibacterial efficacy at various pH levels. Intriguingly, the rAGAAN retained between 50 and 80% of its activity from pH 3 to 8 (Fig. 5A). However, a significant (p < 0.05) decline in activity to between 30 and 40% was observed at a pH range of 9 to 12. Likewise, the thermal stability of the recombinant peptide was assessed using E. coli and S. aureus as indicators. The results demonstrated that rAGAAN was temperature stable, as its antibacterial activity was virtually preserved completely after 15 min of exposure to higher temperatures (Fig. 5B). Under these conditions, the peptide was more effective against the Gram-negative bacterium than against the Gram-positive strain.

Fig. 5.

Fig. 5

Open in a new tab

Effects of pH, temperature, proteases, and bile salt on the activity of the rAGAAN. A Percentage inhibition of the two bacterial strains at various pHs (G3-G4 = Glycine pH3-4, A4-A7 = Acetate pH4-7, T7-T9 = Tris HCl pH7-9, G9-G12 = Glycine pH9-12). The 50 mM Tris HCl treated cell samples served as a control. B The percentage inhibition of the two indicator strains treated at various temperatures. The bacterial samples without any peptide treatment were used as a control (untreated). C and D Percentage inhibition of the E. coli and S. aureus cells treated with pepsin and Bacillus protease. The cells treated with only the rAGAAN was used as the control. PA and BPA are cells treated with pepsin-rAGAAN and Bacillus protease- rAGAAN combination. (E and F) The percentage inhibition of the two indicator strains treated with fix concentration of rAGAAN and bile salts (0.25%, 0.5%, 1%, and 2%). The cells treated with only the rAGAAN was used as the control. The graphs were created using the average values from three duplicate trials, and error bars reflect standard deviations. The indicator strains were E. coli ATCC 8739 and S. aureus ATCC 6538. The percentage inhibition refers to the proportion of bacterial cells killed by the rAGAAN in comparison to the control

The results of the protease stability assay demonstrate that rAGAAN can sustain its activity in the presence of the two proteases (Fig. 5C, D). The percentage inhibition of E. coli cells by rAGAAN was 36.36% in pepsin and 58.77% in the presence of Bacillus proteases. While against S. aureus, the activity was 62.67% and 79.22%, respectively. The finding reveals that Bacillus protease has no significant (p < 0.05) effect on the activity of rAGAAN. Furthermore, the influence of various bile salt concentrations on the activity of the rAGAAN peptide was analyzed (Fig. 5E, F). The presence of a low concentration of bile salt (0.25% and 0.5%) did not significantly (p < 0.05) affect the activity of the peptide. The peptide maintained its activity against E. coli up to 74.38% and 66.42%. However, the inhibition efficiency declines by 32.44% and 26.58% at 1% and 2% bile salt concentrations. The activity of the rAGAAN in the presence of the bile salt at a similar concentration against S. aureus was also examined. The percentage rate of inhibition at the lower concentrations of the bile salt was 94.49% and 83.25%. However, as the concentration increases, the inhibition decreases to 40.2% and 50.25%, respectively.

Hemolytic activity of the rAGAAN

The hemolytic activity of the rAGAAN against red blood cells was measured using serial peptide concentrations, as presented in Fig. 6. Red blood cell lysis was only 0.89%, 2.13%, 2.45%, and 2.67% at lower values between 60 and 180 µg/ml. Thus, the toxicity of rAGAAN against red blood cells was proven to be negligible. Even at the highest concentration of 220 µg/ml, only 3.2% of hemolysis occurred.

Fig. 6.

Fig. 6

Open in a new tab

Hemolytic effect of purified rAGAAN on red blood cells. The displayed data are the mean of three separate replicates. Error bars illustrated the standard deviation

Discussion

The global health of people is in danger due to the advent of increasingly antibiotic-resistant bacteria. If new antimicrobial drugs are not quickly created, we risk a fatal fate. Multicellular organisms synthesize broad-spectrum peptide antibiotics to counteract microbial infections. Clinical and industrial applications of AMPs require efficient production techniques. AMPs have been manufactured using various techniques, including liquid-phase peptide synthesis and extraction from natural sources. Nevertheless, natural extraction and liquid-phase peptide production are both expensive and ineffective. A cost-effective method of mass production is necessary to investigate the pharmaceutical prospects and medicinal significance of AGAAN. The large-scale generation of AMPs can be accomplished via the recombinant expression technique.

Various expression platforms for synthesizing recombinant AMPs have been developed (Dyo and Purton 2018; Havlik et al. 2017; Le et al. 2018; Magaña-Ortiz et al. 2018; Sittipol et al. 2021). A typical method for producing AMPs is an expression in the E. coli system. In this study, AGAAN was over-expressed recombinantly in soluble form in E. coli BL21(DE3) without needing fusion proteins. The HisTrap HP column purification yielded a sharp peak chromatogram of the rAGAAN (Fig. 2A). This high production of this recombinant peptide was achieved at 16 °C overnight following induction with 0.5 mM IPTG. This result indicates the effectiveness of using this laboratory-controlled strategy. Our Tris-Tricine-SDS-PAGE results displayed that rAGAAN was 15 kDa more than the expected 4.11 kDa as confirmed by western blot (Fig. 2B, C). This mass increase is likely due to some modifications occurring during recombinant synthesis. It could also be because some proteins polymerize during the SDS-PAGE process, preventing them from moving along the gel based on their monomeric molecular weight. An additional reason may be the formation of protein complexes that can still exist in homo- or heteromeric complexes (Szczesna and Karolina 2019). We used LC/MS/MS analysis to confirm the presence of our protein in the discovered 15 kDa band. The resultant visible band contains 100% of the rAGAAN sequence Fig. 3.

The rapid destruction of microbial pathogens is a crucial characteristic of AMPs. According to the biological activity findings in this work, the purified rAGAAN possesses significant antibacterial action against the two different types of bacteria. More interestingly, the antibacterial activity of the rAGAAN was higher or comparable to that of synthetic peptide. The theoretical isoelectric point of the cationic antibacterial AGAAN is 11.05. Therefore, we hypothesize that the cationic domain of rAGAAN and the negatively charged region of phospholipids in the bacterial cell membrane interact electrostatically to produce antibacterial activity. The broad-spectrum activity of the rAGAAN against a diverse array of bacterial pathogens implies that the recombinant synthesis may not impair its antibacterial action.

The membrane permeability of rAGAAN was investigated further using the PI uptake test. PI cannot penetrate through an undamaged bacterial envelope, so its uptake suggests membrane disruption. According to our results, the rAGAAN increased membrane permeability in a concentration-dependent manner. With increasing amounts of the recombinant peptide, PI uptake increases. These results also suggested that the rAGAAN is a promising peptide that may cause bacterial death by compromising the integrity of the bacterial membrane. Future studies will include immunofluorescence images of microbial cells cultivated on various substrates to clarify the antibacterial characteristics of rAGAAN.

The interfering factors that influence the biological property of this recombinant peptide must be evaluated for further applications. For instance, knowing how peptides function in the gastrointestinal pH range is vital for developing an effective oral animal drug (Wei et al. 2018). The pH tolerance test findings showed significant activity across the pH range of 3 to 8. This characteristic permits the rAGAAN to display its capability in controlling microbes. However, at higher basic pHs, the activity was seen to decrease. We hypothesize that severe basic pH affects antibacterial effectiveness by changing the recombinant peptide's charge state. Hence, this will require additional investigation in our future study. Thermal stability is vital since medicines undergo multiple heat treatments before reaching the market. Therefore, the temperature effects on the activity of the recombinant peptide against E. coli and S. aureus were determined. The results of the heat tolerant test revealed that the rAGAAN was heat stable. Even more encouraging, the antibacterial function was unaffected by exposure to higher temperatures up to 80 °C for 15 min. Nonetheless, temperatures exceeding 80 °C relatively decreased the activity of the recombinant peptide (Fig. 5B). The feasibility of using the rAGAAN in animals was demonstrated by its strong stability across a temperature scale of 37–80 °C.

The impact of proteases on the antibacterial activity of recombinant peptides must be studied. According to the findings of this investigation, rAGAAN can partially resist proteolytic digestion by pepsin against E. coli and S. aureus. However, when rAGAAN was treated with Bacillus protease, the antibacterial activity on both indicator strains was significantly preserved. This result is also supported by physicochemical parameter analysis performed on the protoplasm web server (Gasteiger et al. 2005). The result obtained from this online server stated that, the peptide may have an approximate half-life of 30 h in mammalian reticulocytes in vitro, over 20 h in yeast in vivo, and over 10 h in E. coli in vivo. The findings of this study suggested that rAGAAN may function well in the presence of Bacillus proteases and moderately with pepsin.

The bile salts, which make up most of the human hepatic bile, are present in the small intestine at concentrations ranging from 0.2 to 2% (wt/vol) (Pumbwe et al. 2007). These salts have been shown to destabilize integral membrane proteins and bacterial lipid membranes, causing intracellular material to leak out and bacterial death. Nevertheless, enteric bacteria can effectively withstand the harmful effects of bile (Gadishaw-Lue et al. 2021). Pathogens can employ bile salts as stimuli to improve fitness and regulate virulence factor expression (Eade et al. 2016). In this study, the rAGAAN was subjected to varying amounts of bile salt similar to that found in the small intestine against two types of bacteria. The results show that even at low bile salt concentrations, rAGAAN can considerably inhibit pathogen growth. However, activity reduces dramatically as concentration increases, especially with E. coli. Under identical conditions, the activity was greater against S. aureus. This difference in susceptibility to the bile salt between the two species could be attributed to the development of virulence factors induced by the bile salt in E. coli. It was reported that when E. coli (EHEC) was exposed to physiologically appropriate quantities of bile salts, the two-component system, pmrAB, and the arnBCADTEF operon were upregulated. This action leads to lipopolysaccharide alteration and enhanced resistance to a cationic AMP polymyxin B (Kunwar et al. 2020). Based on the data obtained in this work, the rAGAAN appears to withstand a variety of variables. These qualities could be considered when exploring other uses of this peptide. Future research should examine whether virulence factors were upregulated or downregulated in the indicator strains studied.

In therapeutic applications, the mild hemolytic activity of AMPs on mammalian red blood cells is crucial. To assess the hemolytic activity, peptide concentrations that led to 50% red blood cell lysis at 540 nm are evaluated (Wei et al. 2016). The red blood cell lytic of the rAGAAN was insignificant. Interestingly, even at the highest concentration tested, the hemolytic activity was not up to 4% (Fig. 6). These findings suggested that rAGAAN production could have medical applications.

Conclusion

In conclusion, an efficient method for overproducing rAGAAN in E. coli was developed. After effective purification, a high quantity of rAGAAN with preserved antibacterial activity was produced. Purified AGAAN had the same antibacterial and hemolytic properties as chemically synthesized AGAAN. Antimicrobial action was seen at pH and temperature levels prevalent in animal bodies. The good qualities of the rAGAAN are predicted to make it an effective antibacterial treatment drug. This study suggests that the rAGAAN could be an essential addition to the plethora of recombinant antibacterial peptides.

Acknowledgements

This research was supported by King Mongkut’s University of Technology Thonburi’s Postdoctoral Fellowship.

Abbreviations

MIC

Minimum Inhibitory Concentration

PI

Propidium Iodide

MHB

Mueller Hinton Broth

IPTG

Isopropyl-1-thio-β-D-galactopyranoside

LC–MS/MS

Liquid chromatography-tandem mass spectrometry

SDS

PAGE – Sodium dodecyl Sulphate–Polyacrylamide Gel Electrophoresis

KDa

Kilo Dalton

Author contributions

YSA performed the experiments and original draft of the manuscript. NR assisted in performing the experiments. NUJ proofread the manuscript and provide technical writing assistance. YK data curation, conceptualization, and discussion. NJ funding acquisition, methodology, data curation and supervision.

Funding

Funding from Research, Innovation and Partnerships Office, King Mongkut’s University of Technology Thonburi, KMUTT.

Data availability

All the data has been presented in the paper and any additional information will be available on request.

Declarations

Conflict of interest

The authors declare that they have no conflict of interest in the publication.

Ethical approval

This article does not contain any studies with human participants or animals performed by any of the authors.

Contributor Information

Ya’u Sabo Ajingi, Email: yau.aji@kmutt.ac.th, Email: ysajingi@kustwudil.edu.ng.

Neeranuch Rukying, Email: neeranuch.ruk@mail.kmutt.ac.th.

Nafiu Usman Jiddah, Email: nafiu.jidas09@mail.kmutt.ac.th, Email: jiddasnafiu@gsu.edu.ng.

Yuichi Koga, Email: y-koga@ous.ac.jp.

Nujarin Jongruja, Email: nujarin.jon@kmutt.ac.th.

References

  1. Ajingi YS, Muhammad A, Khunrae P, Rattanarojpong T, Pattanapanyasat K, Sutthibutpong T, Jongruja N. Antibacterial potential of a novel peptide from the consensus sequence of dermaseptin related peptides secreted by Agalychnis annae. Curr Pharm Biotech. 2021;22:1216–1227. doi: 10.2174/1389201021666201020161428. [DOI] [PubMed] [Google Scholar]
  2. Alfei S, Piatti G, Caviglia D, Schito GC, Zuccari G, Schito AM. Biocidal cationic macromolecules irrespective of bacterial resistance: our best achievements. Med Sci Forum. 2022;7:10. doi: 10.3390/ecms2021-10833. [DOI] [Google Scholar]
  3. Almaaytah A, Mohammed GK, Abualhaijaa A, Al-Balas Q. Development of novel ultrashort antimicrobial peptide nanoparticles with potent antimicrobial and antibiofilm activities against multidrug-resistant bacteria. Drug Design Dev Ther. 2017;11:3159. doi: 10.2147/DDDT.S147450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Barran G, Kolodziejek J, Coquet L, Leprince J, Jouenne T, Nowotny N, Conlon JM, Mechkarska M. Peptidomic analysis of skin secretions of the caribbean frogs leptodactylus insularum and leptodactylus nesiotus (leptodactylidae) identifies an ocellatin with broad spectrum antimicrobial activity. Antibiotics. 2020 doi: 10.3390/antibiotics9100718. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chandran C, Tham HY, Rahim RA, Lim SHE, Yusoff K, Song AA-L. Lactococcus lactis secreting phage lysins as a potential antimicrobial against multi-drug resistant Staphylococcus aureus. PeerJ. 2022;10:e12648. doi: 10.7717/peerj.12648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cardoso MH, Ribeiro SM, Nolasco DO, De La Fuente-Núñez C, Felício MR, Gonçalves S, Matos CO, Liao LM, Santos NC, Hancock REW, Franco OL, Migliolo L. A polyalanine peptide derived from polar fish with anti-infectious activities OPEN. Nat: Publ. Gr; 2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chen Y, Wu J, Cheng H, Dai Y, Wang Y, Yang H, Xiong F, Xu W, Wei L. Anti-infective effects of a fish-derived antimicrobial peptide against drug-resistant bacteria and its synergistic effects with antibiotic. Front Microb. 2020;11:602412. doi: 10.3389/fmicb.2020.602412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Dash R, Bhattacharjya S. Thanatin: an emerging host defense antimicrobial peptide with multiple modes of action. Int J Mol Sci. 2021;22:1–13. doi: 10.3390/ijms22041522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Deptuła M, Wardowska A, Dzierżyńska M, Rodziewicz-Motowidło S, Pikuła M. Antibacterial peptides in dermatology–strategies for evaluation of allergic potential. Molec. 2018;23:414. doi: 10.3390/molecules23020414. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Dyo YM, Purton S. The algal chloroplast as a synthetic biology platform for production of therapeutic proteins. Microbiology. 2018;164:113–121. doi: 10.1099/mic.0.000599. [DOI] [PubMed] [Google Scholar]
  11. Eade CR, Hung CC, Bullard B, Gonzalez-Escobedo G, Gunn JS, Altiera C. Bile acids function synergistically to repress invasion gene expression in salmonella by destabilizing the invasion regulator hilD. Infect Immunity. 2016;84:2198–2208. doi: 10.1128/IAI.00177-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gadishaw-Lue C, Banaag A, Birstonas S, Francis A-S, Foster DB, Kus JV, Gebremedhin A, Dang V, Tran SL, Serbanescu A, Barnett D. Bile salts differentially enhance resistance of enterohemorrhagic Escherichia coli O157:H7 to host defense peptides. J Bacteriol. 2021;193:4509–4515. doi: 10.1128/JB.00200-11. [DOI] [Google Scholar]
  13. Gasteiger E, Hoogland C, Gattiker A, Wilkins MR, Appel RD, Bairoch A, et al. Protein identification and analysis tools on the ExPASy server. In: Min H, et al., editors. The proteomics protocols handbook. Human Press; 2005. pp. 571–607. [Google Scholar]
  14. Havlik D, Brandt U, Bohle K, Fleißner A. Establishment of Neurospora crassa as a host for heterologous protein production using a human antibody fragment as a model product. Microb Cell Fact. 2017;16:128. doi: 10.1186/s12934-017-0734-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Jodoin J, Hincke MT. Histone H5 is a potent antimicrobial agent and a template for novel antimicrobial peptides. Sci Rep. 2018;8(1):1–15. doi: 10.1038/s41598-018-20912-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Johanna Toro Segovia L, Alberto Tellez Ramírez G, Carolina Henao Arias D, David Rivera Duran J, Pablo Bedoya J, Carlos Castano Osorio J. Identification and characterization of novel cecropins from the Oxysternon conspicillatum neotropic dung beetle. PLoS ONE. 2017 doi: 10.1371/journal.pone.0187914. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Klubthawee N, Aunpad R. A thermostable, modified cathelicidin-derived peptide with enhanced membrane-active activity against Salmonella enterica serovar Typhimurium. Front Microbiol. 2021 doi: 10.3389/fmicb.2020.592220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kunwar CB, Birstonas S, McPhee JB, Foster DB. Molecular basis of bile-salt-and iron-induced enterohaemorrhagic E. coli resistance to cationic antimicrobial peptides. Microbiology (united Kingdom) 2020;166:1149–1159. doi: 10.1099/mic.0.000988. [DOI] [PubMed] [Google Scholar]
  19. Le LTM, Nyengaard JR, Golas MM, Sander B. Vectors for expression of signal peptide-dependent proteins in baculovirus/insect cell systems and their application to expression and purification of the high-affinity immunoglobulin gamma Fc receptor I in complex with its gamma chain. Mol Biotech. 2018;60:31–40. doi: 10.1007/s12033-017-0041-8. [DOI] [PubMed] [Google Scholar]
  20. Lekshmipriya P, Vineethkumar TV, Joseph J, Asha R, Thomas S, George S. Synergistic effect of frog skin antimicrobial peptides in combination with antibiotics against multi host gram-negative pathogens. Int J Pept Res Ther. 2021;27:1529–1540. doi: 10.1007/s10989-021-10189-w. [DOI] [Google Scholar]
  21. Li J, Hu S, Jian W, Xie C, Yang X. Plant antimicrobial peptides: structures, functions, and applications. Bot Stud. 2021;62:1–15. doi: 10.1186/s40529-021-00312-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Magaña-Ortiz D, Fernández F, Loske AM, Gómez-Lim MA. Extracellular expression in Aspergillus niger of an antibody fused to Leishmania sp. antigens. Curr Microb. 2018;75:40–48. doi: 10.1007/s00284-017-1348-1. [DOI] [PubMed] [Google Scholar]
  23. Mantravadi PK, Kalesh KA, Dobson RCJ, Hudson AO, Parthasarathy A. Antibiotics the quest for novel antimicrobial compounds: emerging trends in research, development, and technologies. Antibio. 2019;8:8. doi: 10.3390/antibiotics8010008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Mardirossian M, Barrière Q, Timchenko T, Müller C, Pacor S, Mergaert P, Scocchi M, Wilsona DN. Fragments of the nonlytic proline-rich antimicrobial peptide Bac5 kill Escherichia coli cells by inhibiting protein synthesis. Antimic Agt and Chem. 2018;62:8. doi: 10.1128/AAC.00534-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Mookherjee N, Anderson MA, Haagsman HP, Davidson DJ. Antimicrobial host defence peptides: functions and clinical potential. Nat Res. 2020 doi: 10.1038/s41573-019-0058-8. [DOI] [PubMed] [Google Scholar]
  26. Nakamura I, Yoshimura S, Masaki T, Takase S, Ohsumi K, Hashimoto M, Furukawa S, Fujie A. ASP2397: a novel antifungal agent produced by Acremonium persicinum MF-347833. J Antibiot. 2017;70:45–51. doi: 10.1038/ja.2016.107. [DOI] [PubMed] [Google Scholar]
  27. Ning HQ, Li YQ, Tian QW, Wang ZS, Mo HZ. The apoptosis of Staphylococcus aureus induced by glycinin basic peptide through ROS oxidative stress response. LWT. 2019;99:62–68. doi: 10.1016/j.lwt.2018.09.028. [DOI] [Google Scholar]
  28. Pantic JM, Jovanovic IP, Radosavljevic GD, Arsenijevic NN, Conlon JM, Lukic ML. The potential of frog skin-derived peptides for development into therapeutically-valuable immunomodulatory agents. Molecules. 2017;22(12):2071. doi: 10.3390/molecules22122071. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Pumbwe L, Skilbeck CA, Nakano V, Avila-Campos MJ, Piazza RMF, Wexler HM. Bile salts enhance bacterial co-aggregation, bacterial-intestinal epithelial cell adhesion, biofilm formation and antimicrobial resistance of Bacteroides fragilis. Micr Pathog. 2007;43(2):78–87. doi: 10.1016/j.micpath.2007.04.002. [DOI] [PubMed] [Google Scholar]
  30. Retzl B, Hellinger R, Muratspahic EM, Pinto MEF, Bolzani VS, Gruber CW. Discovery of a beetroot protease inhibitor to identify and classify plant-derived cystine knot peptides. J Nat Prod. 2020;2020:3305–3314. doi: 10.1021/acs.jnatprod.0c00648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Sittipol D, Rodpan S, Ajingi YS, Lohnoo T, Lerksuthirat T, Kumsang Y, Yingyong W, Khunrae P, Rattanarojpong T, Pattanapanyasat K, Jongruja N. Identification, overexpression, purification, and biochemical characterization of a novel hyperthermostable keratinase from Geoglobus acetivorans. 3 Biotech. 2021 doi: 10.1007/s13205-020-02538-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Szczesna K. Why does the molecular weight of my protein differ from the theoretically expected weight? | Technology Networks [WWW Document]. URL https://www.technologynetworks.com/proteomics/articles/why-does-the-molecular-weight-of-my-protein-differ-from-the-theoretically-expected-weight-322079. Accessed 25 Jan 2023
  33. Varga JFA, Bui-Marinos MP, Katzenback BA. Frog skin innate immune defences: sensing and surviving pathogens. Front Immunol. 2019;9:3128. doi: 10.3389/fimmu.2018.03128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Wang DY, van der Mei HC, Ren Y, Busscher HJ, Shi L. Lipid-based antimicrobial delivery-systems for the treatment of bacterial infections. Front Chem. 2020 doi: 10.3389/fchem.2019.00872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Wei X-B, Wu R-J, Si D-Y, Liao X-D, Zhang L-L, Zhang R-J. Novel hybrid peptide cecropin A (1–8)-LL37 (17–30) with potential antibacterial activity. Int J Mol Sci. 2016;17(7):983. doi: 10.3390/ijms17070983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Wei X, Wu R, Zhang L, Ahmad B, Si D, Zhang R. Expression, purification, and characterization of a novel hybrid peptide with potent antibacterial activity. Molecules. 2018;23:6. doi: 10.3390/molecules23061491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Zhao GP, Li YQ, Sun GJ, Mo HZ. Antibacterial actions of glycinin basic peptide against Escherichia coli. J Agric Food Chem. 2017;65(25):5173–5180. doi: 10.1021/acs.jafc.7b02295. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All the data has been presented in the paper and any additional information will be available on request.

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES