Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2023 Feb 19.
Published in final edited form as: Arch Insect Biochem Physiol. 2020 May 11;104(4):e21688. doi: 10.1002/arch.21688

The effect of E93 knockdown on female reproduction in the red flour beetle, Tribolium castaneum

Duaa Musleh Eid 1, Shankar C R R Chareddy 1, Subba Reddy Palli 1
PMCID: PMC9939234  NIHMSID: NIHMS1870336  PMID: 32394503

Abstract

The E93 transcription factor is a member of helix-turn-helix transcription factor family containing a Pip-squeak motif. This ecdysone primary response gene was identified as a regulator of cell death in Drosophila melanogaster where it is involved in ecdysone-induced autophagy and caspase activity that mediate degeneration of larval tissues during metamorphosis from larva to pupa. However, its function in adult insects is not well studied. To study E93 function in the red flour beetle, Tribolium castaneum, double-stranded RNA (dsRNA) targeting E93 (dsE93) was injected into newly emerged adults. Knockdown of E93 caused a decrease in the synthesis of vitellogenin (Vg), oocyte development, and egg-laying. Sequencing of RNA isolated from adults injected with dsE93 and control dsmalE (dsRNA targeting Escherichia coli malE gene) followed by differential gene expression analysis showed upregulation of genes involved in the metabolism of reserved nutrients. E93 knockdown induced changes in gene expression resulted in a decrease in Vg synthesis in the fat body and oocyte maturation in ovaries. Mating experiments showed that females injected with dsE93 did not lay eggs. Knockdown of E93 caused a reduction in the number and size of lipid droplets in the fat body when compared with that in control beetles injected with dsmalE. These data suggest that during the first 2–3 days after the emergence of adult females, E93 suppresses genes coding for enzymes that metabolize reserved nutrients until initiation of vitellogenesis and oogenesis.

Keywords: E93, reproduction, RNAi, Tribolium, vitellogenesis

1 ∣. INTRODUCTION

The E93, a member of helix-turn-helix (HTH) transcription factor family containing a Pip-squeak motif (Siegmund & Lehmann, 2002). This ecdysteroid (20-hydroxyecdysone, 20E, is the most active form often referred to as ecdysone) primary response gene was identified as a regulator of cell death in Drosophila melanogaster (Baehrecke & Thummel, 1995; Buszczak & Segraves, 2000; Lee, Wendel et al., 2000). In D. melanogaster E93 transduces 20E signals to induce autophagy and caspase activity to mediate remodeling of fat body (H. Liu, Wang, & Li, 2014), midgut (Lee & Baehrecke, 2001; Lee, Cooksey, & Baehrecke, 2002a), and salivary glands (Berry & Baehrecke, 2007; Lee, Simon, Woodard, & Baehrecke, 2002; Lee, Wendel et al., 2000) during larval–pupal metamorphosis (Lee, Cooksey et al., 2002). E93 is also expressed widely during the pupal stage and is required for the development of adult structures in preparation for the pupa to adult metamorphosis (Mou, Duncan, Baehrecke, & Duncan, 2012). E93 plays an essential role in the metamorphosis by acting in harmony with the juvenile hormones (JH) and ecdysteroids to regulate the transition from juvenile to adult stages (Belles & Santos, 2014; Jindra, Belles, & Shinoda, 2015). Studies in both hemimetabolous and holometabolous insects showed that E93 is upregulated at the end of the juvenile stage which is important to repress the expression of both Kr-h1 and Br-C during the last immature stage to ensure transition to the adult form, and therefore called a universal adult specifier (Gujar & Palli, 2016; Urena, Manjon, Franch-Marro, & Martin, 2014). In Bombyx mori, E93 expression in the fat body during larval–pupal metamorphosis is regulated by 20E and JH (Tian, Guo, Diao et al., 2010; Tian, Guo, Wang et al., 2010). The two HTH domains present in E93 are critical for inducing the expression of a subset of 20E response genes such as ecdysone receptor (EcR), ultraspiracle (USP), E74, broad complex (Br-C), and Atg1. Moreover, it acts through GAGA-containing motifs to modulate 20E signaling to induce remodeling of larval tissues and formation of adult tissues during metamorphosis (X. Liu et al., 2015). Recent studies in Tribolium castaneum showed that E93 as a general metamorphosis trigger functioning independently of the threshold size of the insect (Chafino et al., 2019).

For successful insect reproduction, the synthesis of yolk protein, vitellogenin (Vg), and its deposition into the ovary must be achieved. The major site for Vg synthesis is the fat body which gets ready during the previtellogenesis stage for synthesis and secretion of large quantities of Vg during vitellogenesis. During the vitellogenesis, fat body synthesizes and secretes Vg into the hemolymph, and the Vg is taken up by maturing oocytes (Telfer, 1965, 2009). The oocyte maturation takes place after adult eclosion in most holometabolous insects except for a few lepidopterans (Ramaswamy, Shu, Park, & Zeng, 1997).

Vitellogenesis and oogenesis are controlled by the two major classes of insect hormones, ecdysteroids, and JH. They assume a gonadotrophic role in adult female insects and regulate vitellogenesis and oogenesis (Bownes, 1989; Bownes, Ronaldson, & Mauchline, 1996). In some insects such as cockroaches and locusts, JH induces synthesis of Vg in the adult female fat body and it may also enhance patency of the follicle cells facilitating the uptake of Vg (Telfer, 2009). In T. castaneum, JH regulates Vg gene expression and 20E regulates oocyte development (Parthasarathy, Sheng, Sun, & Palli, 2010; Parthasarathy, Sun, Bai, & Palli, 2010). EcR and USP are required for the ovarian growth and primary oocyte maturation (Parthasarathy, Sheng et al., 2010). However, there is no information on the role of E93 in the regulation of reproduction in this insect. In the current study, we conducted experiments to elucidate the role of this important transcription factor in regulation of female reproduction in T. castaneum using RNAi and RNA sequencing (RNA seq). The results suggest that E93 is required for vitellogenesis and oogenesis in T. castaneum.

2 ∣. MATERIALS AND METHODS

2.1 ∣. Rearing and staging

Strain GA-1 T. castaneum beetles were reared on organic wheat flour containing 10% yeast at 30°C under standard conditions as described previously (Parthasarathy, Tan, Bai, & Palli, 2008). The adults soon after their emergence with untanned cuticle were designated as 0 hr and staged thereafter. The adults were separated into males and females based on the presence of a sex patch (a small patch of short bristles on the inner side of the first pair of legs) in males. This patch is absent in the females. (https://www.ars.usda.gov/plains-area/mhk/cgahr/spieru/docs/tribolium-stock-maintenance/).

2.2 ∣. Double-stranded RNA synthesis, injection, total RNA extraction, cDNA synthesis, and RT-qPCR

The templates for double-stranded RNA (dsRNA; E93, meiosis arrest female protein 1 [MARF1], or Prismalin-14) synthesis were obtained by polymerase chain reaction (PCR) amplification using gene-specific primers containing T7 polymerase promoter sequence at their 5′ ends (Table S1) and cDNA as a templet. The dsRNA was synthesized using purified PCR product and MEGAscript T7 Transcription kit by following the manufacturer's protocol (Thermo Fisher Scientific Inc., Waltham, MA). The dsRNA was treated with DNase I and then purified using phenol/chloroform extraction followed by ethanol precipitation. The concentration of dsRNA was measured using NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific Inc.). Newly emerged (within 6 hr after emergence) T. castaneum adult females were anesthetized with ether vapor (4–5 min) and lined on a glass slide covered with 2-sided tape. The dsRNA was injected into the ventral side of the first or second abdominal segment using a microinjector fitted with an injection needle prepared with 3.5 capillary tubes (Drummond Scientific Co.) pulled by needle puller (Model P-2000 Sutter Instrument Co.). About 1 μg (0.2 μl) dsRNA was injected into each adult female beetle. Newly emerged T. castaneum adult females were also injected with the same amount of malE dsRNA as a control. The dsmalE was prepared using a fragment of Escherichia coli malE gene amplified using T7 primer (TAATACGACTCACTATAGGG) and Litmus28i Mal plasmid (New England Biolabs, Ipswich, MA) as a template. The injected beetles were allowed to recover at room temperature for 3 hr and returned to whole-wheat flour and reared at 30 ± 1°C. Total RNA was extracted from whole beetles or dissected fat body and ovaries. The TRI reagent (Molecular Research Centre Inc., Cincinnati, OH) was used for RNA isolation. About 2 μg of total RNA for each sample was used for cDNA synthesis using MMLV reverse transcriptase (Thermo Fisher Scientific Inc.). The cDNA was used as a template to quantify the relative messenger RNA (mRNA) levels using quantitative reverse-transcription PCR (RT-qPCR). Expression of rp49 (ribosomal protein 49) was used as an internal control for normalization.

2.3 ∣. E93 knockdown and RNA sequencing

Newly emerged T. castaneum adult females were injected with 1 μg of malE or E93 dsRNA and maintained on organic wheat flour containing 10% yeast for 12, 24, 48, 72, 96, and 120 hr. Total RNA was extracted, cDNA was synthesized and RT-qPCR was performed to determine the knockdown efficiency. The 72 hr samples were chosen for sequencing based on knockdown efficiency and the effect of E93 knockdown on the expression of Vg and other genes. About 5 μg of total RNA per sample was used to prepare libraries and the libraries were sequenced using an Illumina Hi-seq 4000 sequencer (Sequencing and Genomics Technologies Centre of Duke University, NC). Raw sequencing data statistics are shown in Table S2.

2.4 ∣. RNA sequencing data analysis

The reads were mapped to the reference genome of the GA-2 T. castaneum strain using CLC Genomics Workbench (Version 12, Qiagen Bioinformatics). The default settings used for mapping include mismatch cost = 2, insertion cost = 3, deletion cost = 3, length fraction = 0.8, and similarity fraction = 0.8. The read counts were Log10 transformed then normalized using the scaling method. To obtain estimates for relative expression levels, RPKM algorithm (in CLC Genomics Workbench) was used to correct the biases in the sequence datasets and different transcript sizes. Finally, the genes differentially expressed between dsE93 and dsmalE injected beetles were identified using Empirical analysis of differential gene expression (EDGE) tool using the standard parameters, p value cut off of ≤ .05 and cut off of ±2-fold change as a threshold value for being significant. The differentially expressed genes were functionally annotated using the cloud blast feature in the Blast2GO (in CLC Genomics Workbench) by comparing the sequences with a nr_alias_arthropod database with blast expectation value (e-value) 1.0E–6. Gene Ontology (GO) enrichment analysis was performed using Web Gene Ontology Annotation Plot (WEGO tool; Ye et al., 2006) by plotting the GO information of the target samples against all the GOs from T. castaneum genome in WEGO. The annotated transcripts were assigned with both annex and GOSlim (Gene Ontology multilevel) terms to improve the GO term identification in the three GO categories (biological process, molecular function, and cellular component).

2.5 ∣. RT-qPCR validation

RT-qPCR was conducted to validate the RNA seq results with a subset of 17 genes selected based on their differential expression between E93 knockdown and control samples. Primers were designed using primer design software (www.idtdna.com) using parameters such as length 18–25 nt, melting temperature 55–65°C, GC content 50–60%, and product size 100–150 bp (Table S1). Two micrograms of RNA was used for cDNA synthesis. RT-qPCR was performed using SYBR Green Supermix (Bio-rad). The melt curve was generated to ensure single product amplification after each run. The relative mRNA levels were calculated using the 2−ΔΔCt method and rp49 as a reference gene.

2.6 ∣. Statistical analysis

Student's t test and analysis of variance were used to analyze the significance of differences between the control and treatments (JMP Pro 13. Ink software). Three biological replicates were used in RNA seq and RNAi studies, while three to four biological replicates were used in RT-qPCR assays. Statistical packages included in CLC Genomics Workbench (version 12, Qiagen Bioinformatics) were used to conduct principle component analysis, DGE analysis, and to generate heat maps. A p-value ≤ .05 between groups was considered as a significant difference, Tukey–Kramer honestly significant difference (HSD) adjustment's mean separation test was used for comparing multiple means.

2.7 ∣. Mating assays

E93, MARF1, or Prismlin-14 dsRNA at 1 μg /insect was injected into newly emerged female beetles. At 24 hr after injection, the injected virgin females were mated with uninjected virgin males in separate cups. At 7 days after mating, the adult beetles were removed and the eggs laid were incubated until hatching, and the hatched larvae were counted.

2.8 ∣. Tissue preparation, staining, imaging, and documentation

Newly emerged females were injected with E93, MARF1, or Prismlin-14 dsRNA at 1 μg /insect and the injected beetles were dissected at 120 hr after injection. The ovaries were dissected in 1× phosphate buffer saline and stained with the nuclear stain 4′,6-diamidino-2-phenylindole (Sigma) for 5 min (1 mg/ml concentration) and mounted on a slide. More than 10 ovaries were observed for each treatment. The fat body was dissected from dsE93 and dsmalE injected females at 120 hr postadult emergence (PAE) and stained with Oil red O. Olympus 1×71 Inverted Research Microscope fitted with reflected fluorescence system was used for documenting fluorescent images. MegnaFire software version 1.5 was used to control the microscope and image acquisition. The exposure setting was adjusted to a level that minimized oversaturated pixels in the final images. Images were taken under bright field and under the DAPI filter for the ovaries and taken under the red filter for the fat body.

3 ∣. RESULTS

3.1 ∣. E93 knockdown and RNA sequencing

To determine if E93 has any function in T. castaneum adult females, newly emerged beetles were injected with dsE93 or dsmalE. The mRNA levels of E93 and Vg2 genes were determined at 12, 24, 48, 72, 96, and 120 hr after dsRNA injection. The RT-qPCR analysis showed an 80–90% decrease in mRNA levels of E93 in dsE93 injected adults when compared with their levels in control beetles injected with dsmalE (Figure 1). An 80% decrease in Vg2 mRNA levels was detected at 72, 96, and 120 hr after injection of dsE93 when compared their levels in control beetles injected with dsmalE (Figure 1). These data suggest that the expression of E93 is required for the synthesis of Vg2 in T. castaneum females.

FIGURE 1.

FIGURE 1

Open in a new tab

Expression profile and knockdown efficiency of E93 and its knockdown effect on the expression on other genes of adult female Tribolium castaneum as determined by RT-qPCR. About 1 μg of dsE93 or dsmalE (control) was injected into adult females soon after emergence. Total RNA was extracted at 12, 24, 48, 72, 96, and 120 hr after injection. The relative mRNA levels were determined by RT-qPCR using the ribosomal protein (rp49) gene as a reference. Mean ± SE (n = 3) are shown. Data were analyzed using Student's t test, *indicates the significant differences between treatment and control at p ≤ .05, **p ≤ .01, and ***p ≤ .001. mRNA, messenger RNA; RT-qPCR, quantitative reverse-transcription polymerase chain reaction; SE, standard error

To identify target genes of E93 during vitellogenesis in T. castaneum (Table S2), dsE93 or dsmalE injected into female beetles soon after adult emergence. RNA isolated from beetles at 72 hr after dsRNA injection was sequenced. The sequences were mapped back to the reference genome of T. castaneum. To identify the genes regulated by E93, mapped reads from control and E93 knockdown samples were used for DGE analysis using EDGE tool. The genes differentially expressed in dsE93 and dsmalE injected beetles are shown as a volcano plot, with red dots indicating the genes that showed statistically significant differences (p < .05 and ≥2-fold) between dsE93 and dsmalE treatments (Figure 2a). The expression patterns of upregulated and downregulated genes (≥2-fold difference with p ≤ .05) in dsmalE (control) and dsE93-treated beetles are shown as heatmaps (Figure 2b,c). Three hundred and four genes showed differential expression, out of these 198 genes were upregulated (Figure 2b), while 106 genes were downregulated (Figure 2b) in E93 knockdown female beetles compared with their expression in control beetles injected with dsmalE.

FIGURE 2.

FIGURE 2

FIGURE 2

Open in a new tab

Volcano plot and the heat map of RNA seq data based on the differential gene expression analysis of RNA isolated from dsmalE (control) and dsE93 knockdown beetles. (a) Volcano plot showing the differentially expressed genes (p ≤ .05 and ±2-fold change) in E93 knockdown beetles. The red dots indicate the genes that are significantly up and downregulated. (b and c) The heat map of the differentially expressed genes in beetles injected with dsmalE or dsE93. The color spectrum key, stretching from black to yellow represents the Log2 transformed fold differences between the E93 knockdown and control. The black color represents the highly downregulated genes and the yellow represents the highly upregulated genes. The heat maps were generated by the CLC Genomic software version 10 (Qiagen Bioinformatics). (b) This is the heat map of 198 genes upregulated when E93 is knocked down as compared with the expression in the control (ds malE) at p ≤ .05 and ≥ 2-fold change. (c) Here is the heat map of 106 genes downregulated when E93 is knocked down as compared with the expression in the control (ds malE) at p ≤ .05 and ≥ 2-fold change. (d) WEGO output for E93 downregulated genes (106) in female Tribolium castaneum. The histogram shows the percent and number of genes with GO terms enriched in each category compared with the reference genome (T. castaneum). Arrows indicate the enrichment of important GO categories under molecular function and biological process categories. (e) WEGO output for E93 upregulated genes (198) in female T. castaneum. The histogram shows the percent and number of genes with GO terms enriched in each category compared with the reference genome (T. castaneum). Arrows indicate the enrichment of important GO categories mainly under molecular function and biological process categories. (f) Correlation between fold change determined by differential gene expression analysis of RNA seq data and RT-qPCR. The line breaks in the y-axis were used to account for higher fold change levels without compromising the integrity of the plot. GO, Gene Ontology; RT-qPCR, quantitative reverse-transcription polymerase chain reaction

3.2 ∣. Annotation of E93 regulated genes and RT-qPCR validation

For annotation of differentially expressed genes, Blast X search was performed using the Blast2Go feature in CLC Genomics Workbench. The GO enrichment analysis of the downregulated genes revealed considerable enrichment in cellular component especially membrane and membrane part, molecular functions such as catalytic activity, binding, structural molecule activity, and transcriptional regulatory activity. Metabolic process, cellular process, regulation of the biological process, biological regulation, and detoxification showed enrichment (Figure 2d). The GO enrichment analysis of the upregulated genes revealed considerable enrichment in cellular component especially membrane and membrane part; molecular functions such as catalytic activity, binding and structural molecule activity, and biological processes such as metabolic process, nitrogen compound metabolic process, organic substance metabolic process, and primary metabolic process (Figure 2e). To validate DGE patterns observed in RNA-Seq data, RT-qPCR was performed to quantify the mRNA levels of 17 candidate genes including nine upregulated and eight downregulated genes that were selected based on their expression levels and predicted functions (Figures S1 and S2). Expression patterns of all tested genes were confirmed by the RT-qPCR, but the magnitude of change in mRNA levels detected by the two methods was somewhat different (Figure 2f).

3.3 ∣. Function of E93, MARF1, and prismalin-14 in reproduction

To study the function of E93 transcription factor in reproduction, dsE93 or dsmalE as control was injected into female adults within 24 hr after emergence. The dsRNA injected female beetles were mated with uninjected virgin male beetles. The eggs laid and the number of hatched larvae were recorded over a 2-week period. Knockdown of E93 blocked egg-laying; no eggs were laid by dsRNA injected females compared with 90 eggs/female laid by dsmalE injected beetles (Figure 3; Table S3). The two genes that showed the maximum levels of upregulation in E93 knockdown beetles are (MARF1) and prismalin-14 as the mRNA levels of these genes increased by 1,122- and 1,072-fold, respectively in the E93 knockdown samples in comparison with their levels in control beetles. We investigated the function of these two proteins in reproduction.

FIGURE 3.

FIGURE 3

Open in a new tab

Effect of knockdown of E93, MARF1 and prismalin-14 on female reproduction and embryonic development. Females were injected with 1 μg/insect, dsE93, dsMARF1, dsprismalin-14, or dsmalE. Each female was kept in cup and mated with uninjected virgin males. The number of eggs laid was counted after 1 week and the offspring produced were counted at 3 weeks after matting. MARF1, meiosis arrest female protein 1

MARF1 is essential for controlling meiosis, retrotransposon surveillance in oocytes and function in the protection of dsDNA from breaks and mutations in this gene cause infertility in female mice (Su, Sun, Handel, Schimenti, & Eppig, 2012). Prismalin-14 is known to be involved in calcification of the prismatic layer of the shell in the Japanese pearl oyster (Pinctada fucata; Suzuki et al., 2004). Females were injected with dsMARF1 or dsprismalin-14 soon after adult ecdysis. The egg-laying and development of eggs to first instar larvae were recorded over a 2-week period. The results showed that MARF1 knockdown did not affect egg-laying but blocked embryonic development (Figure 3; Table S3). Prismalin-14 affected neither egg-laying nor embryonic development.

To determine if E93 transcription factor silencing influences egg-laying by effecting oogenesis, the ovaries from female beetles injected with dsE93, or dsmalE as a control soon after ecdysis to the adult stage were dissected on the 5th day (120 hr) PAE, stained with DAPI and examined under a microscope. The oocytes were scored based on a scale of 1–8 as described previously (Parthasarathy, Sheng et al., 2010). In the females injected with dsmalE, the primary oocytes matured by 5 days after adult emergence. Therefore, all the dsRNA injected females were dissected on the 5th day PAE. The ovarioles in control beetles on 5th-day PAE were at Stages 7–8 (Figure 4a,b). The knockdown of E93 caused a severe effect on oocyte maturation. The oocytes in ovaries dissected from the beetles injected with dsE93 were at Stages 1–2, the oocytes were dormant and arranged side by side in the neck region of the ovariole. The follicular epithelial cells were indistinguishable (Figure 4a,b).

FIGURE 4.

FIGURE 4

Open in a new tab

Knockdown of E93 affects oocyte maturation. (a) Whole mounts of ovaries showing ovarian growth and primary oocyte maturation in control (dsmalE injected) in comparison with E93, MARF1 or prismalin-14 knocked down females. Females were injected on Day 0 (post-adult emergence [PAE]) with dsmalE, dsE93, dsMARF1, or dsprismalin-14. Ovaries were dissected at 120 hr (5 days PAE) after treatment and stained with DAPI. Scale bar = 200 μm. (b) Higher magnification images of a single ovariole from ovaries shown in (a). DAPI, 4′,6-diamidino-2-phenylindole

Injection of dsMARF1 into newly emerged adults did not block the maturation of the primary oocytes and the stage of the oocytes was similar to that observed in control (Stages 7–8; Figure 4a,b). Knockdown of prismalin-14 also did not block the maturation of the primary oocytes and the stage of the oocytes was similar to that observed in control beetles injected with dsmalE (Figure 4a,b).

3.4 ∣. Expression levels of E93, Vg2, MARF1, and prismalin-14 genes in female T. castaneum

The expression levels of E93, Vg2, MARF1, and prismalin-14 genes were determined in the female whole body during 0–120 hr PAE by RT-qPCR. E93 mRNA levels were high soon after adult emergence and the mRNA levels decreased gradually from 24 to 120 hr PAE (Figure 5). Two Vg genes were identified in T. castaneum, the expression levels of Vg2 are higher than the expression levels of Vg1 (Parthasarathy, Sun et al., 2010), therefore, we determined only Vg2 mRNA levels in this study. The mRNA levels of Vg2 were not detected until 72 hr PAE, and then the Vg2 mRNA levels started to increase from 72 hr and reached the maximum levels by 120 hr PAE. The MARF1 mRNA levels were low during 0 hr PAE, then the mRNA levels increased between 48 and 120 hr PAE. The prismalin-14 mRNA levels were high at 0 hr PAE then decreased by 24 hr PAE followed by an increase to the maximum levels by 72 hr PAE, then decreased again to low levels by 120 hr PAE.

FIGURE 5.

FIGURE 5

Open in a new tab

The E93, Vg2, meiosis arrest female protein 1 (MARF1), and prismalin-14 mRNA levels in the whole body of adult females from Day 0 PAE to Day 5 PAE. Mean ± SE (n = 4) are shown. The mean expression levels marked with the same alphabet do not differ significantly at p < .05 by the Tukey–Kramer HSD test. HSD, honestly significant difference; mRNA, messenger RNA; PAE, post-adult emergence; SE, standard error

3.5 ∣. Expression levels of E93, Vg2, MARF1, and prismalin-14 in female fat body and ovaries

In the fat body, E93 mRNA levels were high at 24 and 48 hr PAE, then the mRNA levels decreased from 72 to 120 hr PAE. The E93 mRNA was detected in the ovary dissected from 48 to 120 hr PAE insects. However, the E93 mRNA levels in the ovary are lower than in the fat body (Figure 6a,b). The Vg2 mRNA levels in the fat body began to increase starting at 72 hr PAE and reached the maximum by 120 hr PAE. Also, Vg2 mRNA levels in ovaries at 120 hr PAE are higher than those at 48 hr PAE, and the expression levels at both time points were lower than the levels in the fat body (Figure 6a,b). Prismalin-14 mRNA levels in the fat body were lower soon after adult emergence, then the mRNA levels increased at 72 and 96 hr PAE, then they decreased again at 120 hr PAE. The expression levels of prismalin-14 in the fat body are more than their levels in ovaries. In contrast to the MARF1 expression levels in the whole body, the expression levels in the fat body were high at 24 hr PAE, then decrease to the minimum levels by 96 hr PAE followed by a slight increase again at 120 hr PAE. The MARF1 gene is expressed at higher levels in ovaries than in the fat body (Figure 6a,b).

FIGURE 6.

FIGURE 6

Open in a new tab

Expression profile of E93, Vg2, meiosis arrest female protein 1 (MARF1), and prismalin-14 from Day 1 to Day 5 PAE (120 hr) in adult female Tribolium castaneum fat body and ovaries. (a) Expression profile of E93, Vg2, MARF1, and prismalin-14 genes in the fat body of adult females from Day 1 to 5 PAE. The total RNA which was extracted from each replicate with pools of fat body dissected from 10 females. Mean + SE are shown. The mean expression levels marked with the same alphabetical letter did not differ significantly at p < .05 by the Tukey–Kramer HSD test. (b) Comparison of the expression levels between fat body (black bars) and ovaries (hatched bars) at 48 and 120 hr PAE for E93, Vg2, MARF1, and prismalin-14. The total RNA which was extracted from pools of fat body and ovaries dissected from 12 females. Mean + SE are shown. Data were analyzed using Student's t test, *indicates the significant differences between treatment and control at p ≤ .05 and **p ≤ .01. HSD, honestly significant difference; mRNA, messenger RNA; PAE, post-adult emergence; SE, standard error

3.6 ∣. E93 knockdown effect on the expression of Vg, MARF1, and prismalin-14 genes

Injection of dsE93 into newly emerged adult female caused a reduction in Vg mRNA levels but an increase in MARF1 and prismalin-14 mRNA levels. These data suggest E93 is required for Vg gene expression. E93 suppresses expression of both MARF1 and prismalin-14 genes (Figure 1a).

3.7 ∣. Effect of E93 knockdown on the formation of lipid droplets in the fat body

Injection of dsE93 into newly emerged adult female beetles reduced the number and size of lipid droplets in the fat body when compared with those in the control beetles injected with dsmalE (Figure 7).

FIGURE 7.

FIGURE 7

Open in a new tab

Whole-mounts of fat body from female adutls dissected at 120 hr PAE. Females were injected with dsmalE or dsE93 on Day 0 PAE and dissected at 120 hr PAE and stained with oil red o stain. The photographs in the top panels are taken using the red filter, and those in the bottom panels are taken under bright-field using a fluorescence microscope. Scale bar = 50 μm. PAE, post-adult emergence

4 ∣. DISCUSSION

Insect reproduction is regulated by neuropeptides, ecdysteroids, and JH (Engelmann, 1983; Hagedorn, 2013; Wigglesworth, 1936). The role of ecdysteroids and JH in regulating the events of reproduction differ among various insect groups and appears to have evolved from JH being the predominant regulator in basal insects to ecdysteroids assuming this role in advanced insects (Belles, 2005; Raikhel, Brown, & Belles, 2005). Insects from hemi-metabolous orders such as Orthoptera (Locusta migratoria; Glinka & Wyatt, 1996; Luo et al., 2017; Song, Wu, Wang, Deng, & Zhou, 2014), and Hemiptera (Cimex lectularius; Gujar & Palli, 2016) JH regulates the reproduction. In T. castaneum, a holometabolous coleopteran insect, JH is the primary regulator of vitellogenesis and ecdysteroids regulate oogenesis (Parthasarathy, Sheng et al., 2010; Parthasarathy, Sun et al., 2010). Ecdysteroids are the main hormones regulating vitellogenesis in dipterans including mosquitoes and flies. However, JH plays a key role in previtellogenesis in preparing fat body for Vg synthesis (Raikhel et al., 2005).

RNAi studies in T. castaneum showed that the nuclear receptors and 20E response genes (E75, HR3, HR4, EcR, USP, and βFTZ-F1) are required for vitellogenesis and oogenesis (Xu, Tan, & Palli, 2010), but there are no studies in T. castaneum on the role of E93, one of the primary ecdysone response genes, in vitellogenesis and oogenesis. Recent studies in the brown planthopper, Nilaparvata lugens showed that E93 silencing affects ovary development and significantly reduced the number of eggs laid (Mao, Li, Gao, & Lin, 2019). The most significant contribution of the current study is uncovering the E93 function in adult females. Our results showed that knocking down the expression of the gene coding for E93 in newly emerged female adults affected egg production as no eggs were produced by dsE93 injected beetles (Figure 4).

Sequencing RNA isolated from beetles injected with dsE93 and dsmalE and differential expression analysis of these data identified 106 genes that require E93 for their expression and 198 genes whose expression is suppressed in its presence. Some of the downregulated genes as revealed by GO enrichment analysis are related to the cellular components which include genes associated with the cellular membrane, other sets of genes are associated with molecular function in the cells including catalytic activity, binding, and transcription regulator activity. Moreover, E93 Knockdown also affected the metabolic and cellular processes in addition to the biological regulation and these all may affect vitellogenesis and oogenesis. Previous studies analyzed microarray data probed with RNA isolated from T. castaneum female ovaries on Day 4 PAE and identified genes involved in, transcription factor activity, protein binding, and nucleic acid binding are required for vitellogenesis and oogenesis (Parthasarathy, Sheng et al., 2010). Current studies showed that genes involved in these pathways are suppressed by E93 suggesting that E93 indirectly affects vitellogenesis and oogenesis by regulating the expression of key genes involved in nutrient metabolism. Similar results were reported from a microarray analysis of D. melanogaster egg development and the differentially expressed genes were classified under biological processes of oogenesis, cell cycle, protein, and DNA catabolism (Baker & Russell, 2009). These studies also showed that 198 genes are suppressed by E93 in adult females. These genes are classified at the cellular component level, as membrane and the membrane part; the molecular function level, the binding and catalytic activity, and at the biological process level, nitrogen compound, primary, and organic substance metabolic process. These data suggest that E93 expressed soon after adult emergence may be involved in suppression of genes involved in metabolic processes during the first 72 hr after adult emergence until reproduction (which is an energy-dependent process) is initiated. Comparison of fat body dissected from 120 hr PAE female beetles injected with dsE93 or dsmalE showed more and larger lipid droplets in control beetles compared with those in E93 knockdown beetles suggesting that accumulation of lipids in the fat body is reduced in these beetles. These results support predictions from DGE analysis of RNA isolated from control and E93 knockdown beetles which showed that E93 suppresses genes involved in metabolic processes.

These studies provided the first evidence for the function of E93 in T. castaneum. E93 appears to regulate female reproduction indirectly by suppressing genes involved in the metabolism of reserved nutrients soon after adult emergence. This might ensure the conservation of reserved nutrients until vitellogenesis is initiated at 72 hr after adult emergence. The mechanisms involved in E93 regulation of nutrient metabolism need further research.

Supplementary Material

Supplementary Info

ACKNOWLEDGMENTS

Supported by grants from the National Institutes of Health (GM070559-14 and 1R21AI131427-01), the National Science Foundation (Industry/University Cooperative Research Centers, the Center for Arthropod Management Technologies under Grant IIP-1821936), National Institute of Food and Agriculture, USDA, HATCH under 2353057000 and Agriculture and Food Research Initiative Competitive Grant no. 2019-67013-29351. DME is supported by the missions sector of the Egyptian Ministry of Higher Education. DME would like to thank Prof. Dr. Afaf Abd El Mguid, Prof. Dr. Hesham Yousef and Dr. Azza Elgendy, and members of Palli lab especially Najla Albishi and Smitha George for their support.

Footnotes

CONFLICT OF INTERESTS

The authors declare that there are no conflict of interests.

SUPPORTING INFORMATION

Additional supporting information may be found online in the Supporting Information section.

REFERENCES

  1. Baehrecke EH, & Thummel CS (1995). The Drosophila E93 gene from the 93F early puff displays stage-and tissue-specific regulation by 20-hydroxyecdysone. Developmental Biology, 171(1), 85–97. [DOI] [PubMed] [Google Scholar]
  2. Baker DA, & Russell S (2009). Gene expression during Drosophila melanogaster egg development before and after reproductive diapause. BMC Genomics, 10(1), 242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Belles X (2005). Vitellogenesis directed by juvenile hormone. Reproductive Biology of Invertebrates, XII, 157–197. [Google Scholar]
  4. Belles X, & Santos CG (2014). The MEKRE93 (methoprene tolerant-Kruppel homolog 1-E93) pathway in the regulation of insect metamorphosis, and the homology of the pupal stage. Insect Biochemistry and Molecular Biology, 52, 60–68. 10.1016/j.ibmb.2014.06.009 [DOI] [PubMed] [Google Scholar]
  5. Berry DL, & Baehrecke EH (2007). Growth arrest and autophagy are required for salivary gland cell degradation in Drosophila. Cell, 131(6), 1137–1148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bownes M (1989). The roles of juvenile hormone, ecdysone and the ovary in the control of Drosophila vitellogenesis. Journal of Insect Physiology, 35(5), 409–413. [Google Scholar]
  7. Bownes M, Ronaldson E, & Mauchline D (1996). 20-Hydroxyecdysone, but not juvenile hormone, regulation of yolk protein gene expression can be mapped tocis-acting DNA sequences. Developmental Biology, 173(2), 475–489. [DOI] [PubMed] [Google Scholar]
  8. Buszczak M, & Segraves WA (2000). Insect metamorphosis: Out with the old, in with the new. Current Biology, 10(22), R830–R833. [DOI] [PubMed] [Google Scholar]
  9. Chafino S, Urena E, Casanova J, Casacuberta E, Franch-Marro X, & Martin D (2019). Upregulation of E93 gene expression acts as the trigger for metamorphosis independently of the threshold size in the beetle Tribolium castaneum. Cell Reports, 27(4), 1039–1049 e1032. 10.1016/j.celrep.2019.03.094 [DOI] [PubMed] [Google Scholar]
  10. Engelmann F (1983). Vitellogenesis controlled by juvenile hormone. In Downer RGH & Laufer H (Eds.), Endocrinology of insects (pp. 259–270). New York, NY: Alan Liss. [Google Scholar]
  11. Glinka A, & Wyatt G (1996). Juvenile hormone activation of gene transcription in locust fat body. Insect Biochemistry and Molecular Biology, 26(1), 13–18. [Google Scholar]
  12. Gujar H, & Palli SR (2016). Kruppel homolog 1 and E93 mediate Juvenile hormone regulation of metamorphosis in the common bed bug, Cimex lectularius. Scienticfic Reports, 6, 26092. 10.1038/srep26092 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hagedorn H (2013). The role of ecdysteroids in reproduction. In Kerkut GA & Gilbert LI (Eds.), Endocrinology II (8, p. 205). Oxford, UK: Pergamon Press. [Google Scholar]
  14. Jindra M, Belles X, & Shinoda T (2015). Molecular basis of juvenile hormone signaling. Current Opinions in Insect Science, 11, 39–46. 10.1016/j.cois.2015.08.004 [DOI] [PubMed] [Google Scholar]
  15. Lee CY, & Baehrecke EH (2001). Steroid regulation of autophagic programmed cell death during development. Development, 128(8), 1443–1455. [DOI] [PubMed] [Google Scholar]
  16. Lee CY, Cooksey BAK, & Baehrecke EH (2002). Steroid regulation of midgut cell death during Drosophila development. Developmental Biology, 250(1), 101–111. [DOI] [PubMed] [Google Scholar]
  17. Lee CY, Simon CR, Woodard CT, & Baehrecke EH (2002). Genetic mechanism for the stage- and tissue-specific regulation of steroid triggered programmed cell death in Drosophila. Developmental Biology, 252(1), 138–148. 10.1006/dbio.2002.0838 [DOI] [PubMed] [Google Scholar]
  18. Lee CY, Wendel DP, Reid P, Lam G, Thummel CS, & Baehrecke EH (2000). E93 Directs steroid-triggered programmed cell death in Drosophila. Molecular Cell, 6(2), 433–443. [DOI] [PubMed] [Google Scholar]
  19. Liu H, Wang J, & Li S (2014). E93 predominantly transduces 20-hydroxyecdysone signaling to induce autophagy and caspase activity in Drosophila fat body. Insect Biochemistry and Molecular Biology, 45, 30–39. 10.1016/j.ibmb.2013.11.005 [DOI] [PubMed] [Google Scholar]
  20. Liu X, Dai F, Guo E, Li K, Ma L, Tian L, … Li S (2015). 20-Hydroxyecdysone (20E) primary response gene e93 modulates 20e signaling to promote bombyx larval-pupal metamorphosis. Journal of Biological Chemistry, 290(45), 27370–27383. 10.1074/jbc.M115.687293 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Luo M, Li D, Wang Z, Guo W, Kang L, & Zhou S (2017). Juvenile hormone differentially regulates two Grp78 genes encoding protein chaperones required for insect fat body cell homeostasis and vitellogenesis. Journal of Biological Chemistry, 292(21), 8823–8834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Mao Y, Li Y, Gao H, & Lin X (2019). The direct interaction between E93 and Kr-h1 mediated their antagonistic effect on ovary development of the brown planthopper. International Journal of Molecular Science, 20(10), 2431. 10.3390/ijms20102431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Mou X, Duncan DM, Baehrecke EH, & Duncan I (2012). Control of target gene specificity during metamorphosis by the steroid response gene E93. Proceedings of National Academy of Sciences United States of America, 109(8), 2949–2954. 10.1073/pnas.1117559109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Parthasarathy R, Sheng Z, Sun Z, & Palli SR (2010). Ecdysteroid regulation of ovarian growth and oocyte maturation in the red flour beetle, Tribolium castaneum. Insect Biochemistry and Molecular Biology, 40(6), 429–439. 10.1016/j.ibmb.2010.04.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Parthasarathy R, Sun Z, Bai H, & Palli SR (2010). Juvenile hormone regulation of vitellogenin synthesis in the red flour beetle, Tribolium castaneum. Insect Biochemistry and Molecular Biology, 40(5), 405–414. 10.1016/j.ibmb.2010.03.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Parthasarathy R, Tan A, Bai H, & Palli SR (2008). Transcription factor broad suppresses precocious development of adult structures during larval-pupal metamorphosis in the red flour beetle, Tribolium castaneum. Mechanisms of Development, 125(3-4). 299–313. 10.1016/j.mod.2007.11.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Raikhel A, Brown M, & Belles X (2005). Hormonal control of reproductive processes. In Gilbert LI, Iatrou K&Gill S (Eds.), Comprehensive molecular insect science (3, pp. 433–491). New York, NY: Elsevier. [Google Scholar]
  28. Ramaswamy SB, Shu S, Park YI, & Zeng F (1997). Dynamics of juvenile hormone-mediated gonadotropism in the Lepidoptera. Archives of Insect Biochemistry and Physiology, 35(4), 539–558. [Google Scholar]
  29. Siegmund T, & Lehmann M (2002). The Drosophila Pipsqueak protein defines a new family of helix-turn-helix DNA-binding proteins. Development Genes and Evolution, 212(3), 152–157. [DOI] [PubMed] [Google Scholar]
  30. Song J, Wu Z, Wang Z, Deng S, & Zhou S (2014). Krüppel-homolog 1 mediates juvenile hormone action to promote vitellogenesis and oocyte maturation in the migratory locust. Insect Biochemistry and Molecular Biology, 52, 94–101. [DOI] [PubMed] [Google Scholar]
  31. Su YQ, Sun F, Handel MA, Schimenti JC, & Eppig JJ (2012). Meiosis arrest female 1 (MARF1) has nuage-like function in mammalian oocytes. Proceedings of National Academy of Sciences United States of America, 109(46), 18653–18660. 10.1073/pnas.1216904109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Suzuki M, Murayama E, Inoue H, Ozaki N, Tohse H, Kogure T, & Nagasawa H (2004). Characterization of Prismalin-14, a novel matrix protein from the prismatic layer of the Japanese pearl oyster (Pinctada fucata). Biochemical Journal, 382(1), 205–213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Telfer WH (1965). The mechanism and control of yolk formation. Annual Review of Entomology, 10(1), 161–184. [Google Scholar]
  34. Telfer WH (2009). Vitellogenesis. In Resh VH & Cardé RT (Eds.), Encyclopedia of insects (2nd ed., pp. 1041–1043). Cambridge, MA: Academic Press. [Google Scholar]
  35. Tian L, Guo E, Diao Y, Zhou S, Peng Q, Cao Y, … Li S (2010). Genome-wide regulation of innate immunity by juvenile hormone and 20-hydroxyecdysone in the Bombyx fat body. BMC Genomics, 11(1), 549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Tian L, Guo E, Wang S, Liu S, Jiang R-J, Cao Y, … Li S (2010). Developmental regulation of glycolysis by 20-hydroxyecdysone and juvenile hormone in fat body tissues of the silkworm, Bombyx mori. Journal of Molecular Cell Biology, 2(5), 255–263. [DOI] [PubMed] [Google Scholar]
  37. Urena E, Manjon C, Franch-Marro X, & Martin D (2014). Transcription factor E93 specifies adult metamorphosis in hemimetabolous and holometabolous insects. Proceedings of National Academy of Sciences United States of America, 111(19), 7024–7029. 10.1073/pnas.1401478111 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Wigglesworth VB (1936). Memoirs: The function of the corpus allatum in the growth and reproduction of Rhodnius Prolixus (Hemiptera). Journal of Cell Science, 2(313), 91–121. [Google Scholar]
  39. Xu J, Tan A, & Palli SR (2010). The function of nuclear receptors in regulation of female reproduction and embryogenesis in the red flour beetle, Tribolium castaneum. Journal of Insect Physiology, 56(10), 1471–1480. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Ye J, Fang L, Zheng H, Zhang Y, Chen J, Zhang Z, … Wang J (2006). WEGO: A web tool for plotting GO annotations. Nucleic Acids Research, 34, W293–W297. 10.1093/nar/gkl031 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Info
NIHMS1870336-supplement-Supplementary_Info.pdf (159.4KB, pdf)

RESOURCES