Abstract
We analyzed the effects of Glycyrrhiza polysaccharide (GCP) on growth performance, appetite, and hypothalamic inflammation-related indexes in broilers. One-day-old male AA broilers were randomly divided into four groups: Control, L-GCP, M-GCP, and H-GCP (0, 300, 600, and 900 mg GCP/kg feed), with six repetition cages for each treatment and 12 broilers in each repeat for a period of 42 days. From day 1 to day 21, the addition of GCP to the diet significantly improved the ADFI and the ADG of broilers, and the mRNA levels of NPY and AgRP were significantly increased while POMC and CART were decreased in the hypothalamus of broilers; GCP also significantly decreased the mRNA levels of IL-1β, IL-6, TNF-α, TLR-4, MyD88, and NF-κB, and increased the IL-4 and IL-10 in the hypothalamus from day 1 to day 42. The concentrations of appetite-related factors and inflammatory factors in serum were changed in the same fashion. Supplementation with 600 mg/kg GCP had the optimal effect in broilers, and GCP has the potential to be used as a feed additive in the poultry production industry.
Keywords: appetite, Glycyrrhiza polysaccharide, growth performance, inflammatory
Our experiments show that Glycyrrhiza polysaccharide in broiler feed promotes food intake and alleviates inflammation.
Introduction
Chicken is one of the most popular meats in the world and the main source of animal protein for many humans (Dirong et al., 2021). Thus, it is necessary to improve the production efficiency of broilers in order to meet the huge market demand. In the past, antibiotic growth promoters were added to poultry feed to prevent disease and improve growth performance (Long et al., 2021), but, the increase in drug resistance and drug residues in the meat produced by overuse of antibiotics negatively affected livestock and poultry, and endangered the health of consumers (van Hoek et al., 2020). Finding safe and effective antibiotic substitutes is an urgent goal.
Licorice (Glycyrrhiza glabra) is one of the most widely used herbs in the world, with a variety of effects, such as relieving spasm and pain, clearing heat, and detoxification. It is known as the “king of all medicines” in traditional Chinese medicine (Alagawany et al., 2019; Simayi et al., 2021). According to phytochemical analysis, licorice contains multiple active ingredients including triterpenoid saponins, flavonoids, polysaccharides, coumarins, alkaloids, and proteins (Reda et al., 2021). Some of these ingredients, such as glycyrrhizin and liquiritin, are widely used in pharmaceutical and other industries (Selyutina et al., 2021; Wang et al., 2021). But the potential value of its remaining components still needs to be explored. Polysaccharides are natural macromolecules composed of monosaccharides (Yin et al., 2019), and Glycyrrhiza polysaccharide (GCP), can be extracted from the rhizome of licorice (Simayi et al., 2021). Our previous studies found that GCP added to the diet can increase the immunity and antioxidant capacity of quails and broilers and improve the intestinal health of weaned piglets (Zhang et al., 2021a, 2021b; 2022a). In addition, our lab found that GCP played an important role in promoting food intake (Li et al., 2022).
Appetite refers to an animal’s desire for feed and water, which determines its voluntary intake (Te Pas et al., 2020). The hypothalamus, one of the important parts of the central nervous system (CNS), plays a critical role in the integration of various appetite regulatory signals (He et al., 2019). Hypothalamic inflammation may be induced by environmental and other factors during animal, growth and severe inflammatory reactions may lead to anorexia (Rorato et al., 2011; Zhao et al., 2021). To further explore the role of GCP in regulating appetite and controlling inflammation, we analyzed the effects of GCP on growth performance, hypothalamic inflammation, and appetite-related indexes in broilers. Our results provide evidence for the use of GCP as a safe and effective food additive in poultry.
Materials and Methods
All procedures and animal experiment were approved by the Animal Care and Use Committee of Henan University of Science and Technology (approval code: 2021106).
Animals and experimental treatments
A total of 288 one-day-old healthy male Arbor Acres broilers (weight 46 ± 0.5 g) were randomly selected from the hatchery in Luoyang, China. The birds were examined on arrival for signs of disability and early illness. According to the amount of GCP (Luoyang Lansley Technology Co) added to the basal diet, chicks were randomly assigned to four dietary treatment groups: (1) control (Con, 0 mg/kg GCP), (2) low-dose (L-GCP, 300 mg/kg GCP), (3) medium-dose (M-GCP, 600 mg/kg GCP), and (4) high-dose (H-GCP, 900 mg/kg GCP). The experimental groups were fed the basal diet supplemented with GCP at the indicated concentration. There were six repetition cages for each treatment and 12 broilers in each repeat during the 42-day trial period. The composition of the basal diet (Table 1) complied with the required nutrition level for birds as defined by the NRC (Hintz, 1994). Broilers were vaccinated against Newcastle virus and infectious bursal disease at 7 and 14 days of age. The experiment was divided into two stages: days 1 to 21 as the brooding period and days 22 to 42 as the fattening period. The illumination was 24-h light during the first week, followed by 23-h light and 1-h darkness from the second week. The temperature was controlled at 32ºC to 35ºC during brooding. From the first week, the temperature decreased by 1ºC every 2 days, and from the third week, the temperature remained at 24ºC to 26ºC. Humidity was controlled at 60% to 70%. Broilers were housed in four-story, three-dimensional cages, with the freedom to eat and drink ad libitum. Feeding and medical care were in strict accordance with the Guidelines for the Care and Use of Agricultural Animals in Research and Teaching, 3rd edition (2010).
Table 1.
Composition and nutrition levels of the basal diet (air-dried basis)
| Item | Content | |
|---|---|---|
| Starter (days 1–14) | Grower (days 15–80) | |
| Ingredients (%) | ||
| Corn | 57.67 | 60.17 |
| Wheat middlings | 1.00 | 0.00 |
| Soybean meal | 33.21 | 27.85 |
| Cottonseed meal | 2.00 | 2.50 |
| Soybean oil | 2.00 | 4.00 |
| Corn gluten meal | 0.00 | 2.00 |
| Limestone | 1.20 | 1.30 |
| L-Threonine | 0.20 | 0.07 |
| CaHPO4 | 1.40 | 1.10 |
| NaCl | 0.30 | 0.30 |
| L-Lys | 0.50 | 0.28 |
| DL-Met | 0.27 | 0.18 |
| 1Vitamin premix | 0.05 | 0.05 |
| 2Minerals | 0.20 | 0.20 |
1Vitamin premix provided per kg diet: vitamin A, 12,000 IU; vitamin D3, 5,000 IU; vitamin E, 16.7 g; vitamin K, 0.67 g; vitamin B1, 0.67 g; vitamin B2, 2 g; vitamin B6, 0.67 g; vitamin B12, 0.004 g; nicotinic acid, 16.7 g; pantothenic acid, 6.67 g; biotin, 0.07 g; folic acid, 1.67 g; choline chloride, 400 g.
2Mineral premix provided per kg diet: Zn, 23.3 g; Mn, 10 g; Fe, 25 g; Cu, 1.67 g; I, 0.25 g; Se, 0.033 g, and Mg, 133.4 g.
Growth performance
The daily feed consumption of each group was recorded during the test period. On days 7, 14, 21, 28, 35, and 42 of the experiment, the test chickens fasted for 4 h without food or water. Taking the repeated group as the unit, each chicken was weighed on an empty stomach, and the average daily gain (ADG), average daily feed intake (ADFI), and feed conversion ratio (FCR) were calculated. The number of dead chickens was recorded every day after which performance parameters were corrected for mortality.
Serum sample measurements
Two broilers were randomly selected from each replicate on days 21 and 42 for wing-vein blood collection. After clotting, the serum was obtained by centrifugation at 1,579 g for 10 min and stored at -20ºC until used. The levels of appetite factors (NPY, AgRP, POMC, and CART), inflammatory factors (IL-6, TNF-α, IL-1β, IL-4, and IL-10), and inflammatory pathway factors (TLR4, NF-κB, and MyD88) were measured by enzyme-linked immunosorbent assay (ELISA kit 96T, Shanghai YuBo Biotechnology Co.), following manufacturer’s instructions.
Real-time quantitative PCR (RT-qPCR) analysis
One broiler was randomly selected from each replicate on days 21 and 42, and the hypothalamic tissues were dissected on ice, immediately frozen in liquid nitrogen, and stored at -80ºC. Using RT-qPCR, the mRNA expression of appetite-related factors (NPY, AgRP, POMC, and CART), inflammatory factors (IL-6, TNF-α, IL-1β, IL-4, and IL-10), and inflammatory pathways (TLR4, NF-κB, and MyD88) was determined. Total RNA was extracted from hypothalamic tissue samples with TRIzol (Solarbio, Beijing, China), and the total RNA concentration and purity were determined with a NanoDrop 2000 nucleic acid analyzer (Thermo Fisher, Waltham, MA, USA), while RNA integrity was verified by 1% agarose gel electrophoresis. RNA was reverse-transcribed into cDNA using a kit (Vazyme Biotech Co, Nanjing, China). Primers were designed based on GenBank chicken sequences (Table 2) and synthesized by Shenggong Biological Company (Shanghai, China). The stable reference gene, β-actin was used for normalization. RT-qPCR was performed using a standard SYBR green PCR kit (Takara Biotechnology, Dalian, China) on a CFX96 real-time PCR detection system (Bio-Rad). Relative gene expression levels were calculated using the 2-△△CT method.
Table 2.
Primers used for RT-qPCR analysis
| Gene | Accession number | Primer sequence (5’→3’) | Length (bp) |
|---|---|---|---|
| β-actin | NM_205518.1 | F: 5’ CTCTGACTGACCGCGTTACT 3’ R: 5’ TACCAACCATCACACCCTGAT 3’ |
172 bp |
| NPY | NM_205473.1 | F: 5’ CGGCTCTGAGGCACTACATC 3’ R: 5’ GGGTCTTCAAACCGGGATCT 3’ |
133 bp |
| AgRP | NM_001031457.1 | F: 5’ CGGTTGTGCACGTTGCC 3’ R: 5’ TGGGAAGAGCTCCAGCAAG 3’ |
212 bp |
| POMC | XM_015285103.2 | F: 5’ CAGCTCCTCCACAGTTTGGG 3’ R: 5’ CTTGGCACACGCCAAAACAC 3’ |
182 bp |
| CART | XM_003643097.4 | F: 5’ CCGAGAGAAGGAGCTGATCG 3’ R: 5’ CGCTCACAGGCACTTGAGAA 3’ |
211 bp |
| IL-6 | NM_204628.1 | F: 5’ CGGCTTCGACGAGGAGAAAT 3’ R: 5’ CTCGACGTTCTGCTTTTCGC 3’ |
112 bp |
| TNF-α | AY765397.1 | F: 5’ TGTGGGGCGTGCAGTG 3’ R: 5’ GGCACAAAAGAGCTGATGGC 3’ |
127 bp |
| IL-1β | NM_204524.1 | F: 5’ TGCCTGCAGAAGAAGCCTCG 3’ R: 5’ GGTGACGGGCTCAAAAACCT 3’ |
207 bp |
| IL-4 | NM_001007079.1 | F: 5’ ACATCCAGGGAGAGGTTTCCT 3’ R: 5’ CGTGTTGAGGAAGAGACCCTG 3’ |
158 bp |
| IL-10 | NM_001004414.2 | F: 5’ TCTGTGTCAGAGATGCTGCG 3’ R: 5’ CAGGTGAAGAAGCGGTGACAG 3’ |
152 bp |
| TLR4 | KP410249.1 | F: 5’ GGCAGCTGACATCAGTCCTT 3’ R: 5’ CCAGCTTCCAAGCACCAAAC 3’ |
136 bp |
| NF-κB | XM_040694220.1 | F: 5’ CGTCCGGCGATGCGAA 3’ R: 5’ GGTGCAGCGCTGTGTCG 3’ |
216 bp |
| MyD88 | NM_001030962.4 | F: 5’ TCCGTATGGGCATGGAACAG 3’ R: 5’ CTGGCAAGACATCCCGATCA 3’ |
146 bp |
Statistical analysis
Data were analyzed by SPSS 19. Multiple comparisons of differences between groups were performed by one-way analysis of variance and Duncan’s post-test. Orthogonal polynomials were used to assess the linear and quadratic effects of increasing dietary GCP concentration. Results were expressed as mean ± standard error of the mean. P < 0.05 indicates a significant difference.
Results
Broiler growth performance
The data in Table 3 show the effects on the growth performance of feeding broiler chicks with different concentrations of GCP. From day 1 to 21, the ADFI of the M-GCP group was significantly higher than the control group, and the ADG of the M-GCP and H-GCP groups was significantly higher than the control group (P > 0.05); however, treatment with GCP had no significant effect on ADFI, ADG, and FCR from day 21 to 42 (P > 0.05).
Table 3.
Effect of dietary Glycyrrhiza polysaccharide (GCP) supplementation on growth performance in broilers
| Item | Level of dietary GCP (mg/kg) | SEM | P value | ||||
|---|---|---|---|---|---|---|---|
| Control | Low | Medium | High | Linear | Quadratic | ||
| Days 1–21 | |||||||
| ADG (g/day) | 34.89b | 35.93ab | 37.47a | 36.21ab | 0.33 | 0.095 | 0.053 |
| ADFI (g/day) | 51.45b | 52.69ab | 54.68a | 54.10a | 0.43 | 0.010 | 0.020 |
| FCR (g:g) | 1.48 | 1.47 | 1.46 | 1.49 | 0.07 | 0.687 | 0.756 |
| Days 22–42 | |||||||
| ADG (g/day) | 93.02 | 95.40 | 92.42 | 96.60 | 1.06 | 0.476 | 0.731 |
| ADFI (g/day) | 150.32 | 155.24 | 161.27 | 162.76 | 2.62 | 0.079 | 0.211 |
| FCR (g:g) | 1.62 | 1.63 | 1.74 | 1.69 | 0.03 | 0.247 | 0.457 |
| Days 1–42 | |||||||
| ADG (g/d) | 63.95 | 65.67 | 64.94 | 66.41 | 0.59 | 0.265 | 0.542 |
| ADFI (g/d) | 100.89 | 103.97 | 107.97 | 108.43 | 1.37 | 0.036 | 0.105 |
| FCR (g:g) | 1.55 | 1.55 | 1.60 | 1.59 | 0.02 | 0.179 | 0.369 |
a,b,cMeans with different superscripts within the same row differ significantly (P < 0.05).
Abbreviations: ADG, average daily gain; ADFI, average daily feed intake; FCR, feed conversion ratio.
Serum concentrations of appetite-related factors
The data in Table 4 show the effects of supplementing broilers with different concentrations of GCP on serum concentrations of appetite-related factors. At 21 days, the concentrations of NPY and AgRP were increased in the L-GCP, M-GCP, and H-GCP groups, and the concentrations of POMC and CART were significantly decreased compared to the control group (P < 0.05). The changes in serum concentrations of the appetite-related factors at 42 days failed to reach statistical significance, however (P > 0.05).
Table 4.
Effect of dietary Glycyrrhiza polysaccharide (GCP) supplementation on serum levels of appetite-related factors
| Item | Levels of dietary GCP | SEM | P value | ||||
|---|---|---|---|---|---|---|---|
| Control | Low | Medium | High | Linear | Quadratic | ||
| Day 21 | |||||||
| NPY (ng/L) | 61.71c | 68.03b | 73.27a | 69.69ab | 1.14 | 0.002 | <0.001 |
| AgRP (pg/mL) | 27.36c | 31.28b | 36.25a | 32.72b | 0.74 | <0.001 | <0.001 |
| POMC (pg/mL) | 85.29a | 75.33b | 67.48c | 72.30b | 1.56 | 0.001 | <0.001 |
| CART (pg/mL) | 68.44a | 63.00b | 55.34c | 60.48b | 1.21 | 0.002 | 0.001 |
| Day 42 | |||||||
| NPY (ng/L) | 80.17 | 82.15 | 85.30 | 84.96 | 0.93 | 0.033 | 0.087 |
| AgRP (pg/mL) | 67.14 | 69.63 | 70.05 | 71.31 | 0.96 | 0.134 | 0.316 |
| POMC (pg/mL) | 146.44 | 144.89 | 139.99 | 137.04 | 1.69 | 0.025 | 0.084 |
| CART (pg/mL) | 41.54 | 39.33 | 36.96 | 38.05 | 0.95 | 0.132 | 0.222 |
a,b,c Means with different superscripts within the same row differ significantly (P<0.05).
Abbreviations: NPY, neuropeptide Y; AgRP, agouti gene-related protein; POMC, proopiomelanocortin; CART, cocaine- and amphetamine-regulated transcript.
Expression of appetite-related genes in hypothalamus
Figure 1 shows the effects of feeding broiler chicks with different concentrations of GCP on the expression of appetite-related genes in the hypothalamus. At 21 days, the expression of NPY and AgRP mRNA in hypothalamus was up-regulated in the L-GCP, M-GCP, and H-GCP groups while the expression of POMC and CART mRNA was significantly downregulated compared to the control group (P < 0.05). The appetite-related gene expression showed no significant change at 42 days (P > 0.05).
Figure 1.
Expression of NPY, AgRP, POMC, and CART genes in the control, L-GCP, M-GCP and H-GCP groups on (A) day 21 and (B) day 42. *Each bar represents the mean and standard error. Mean values with different letters differed significantly (P < 0.05). GCP, Glycyrrhiza polysaccharide.
Serum concentrations of inflammation-related factors
Table 5 shows the effects of supplementing broiler chick diets with different concentrations of GCP on the serum concentrations of inflammation-related factors. On days 21 and 42, compared to control, the major pro-inflammatory factors, IL-1β, IL-6, and TNF-α and the inflammatory pathway factors, TLR4, MyD88, and NF-κB were significantly decreased, while the anti-inflammatory factors, IL-4 and IL-10, were significantly increased in the L-GCP, M-GCP, and H-GCP groups (P < 0.05). The greatest effect was seen in the M-GCP group.
Table 5.
Effect of dietary Glycyrrhiza polysaccharide (GCP) supplementation on the serum level of inflammation-related factors.
| Item | Levels of dietary GCP (mg/kg) | SEM | P value | ||||
|---|---|---|---|---|---|---|---|
| Control | Low | Medium | High | Linear | Quadratic | ||
| Day 21 | |||||||
| IL-1β (ng/L) | 71.94a | 66.67b | 61.81c | 66.01bc | 1.04 | 0.011 | 0.001 |
| IL-6 (pg/mL) | 9.50a | 7.53b | 6.31c | 7.25b | 0.25 | <0.001 | <0.001 |
| TNF-α (pg/mL) | 36.50a | 28.03b | 24.73c | 30.16b | 0.99 | 0.009 | <0.001 |
| IL-4 (ng/L) | 51.49c | 56.67b | 64.48a | 58.82b | 1.16 | 0.002 | <0.001 |
| IL-10 (ng/L) | 10.91c | 13.79b | 18.69a | 14.68b | 0.61 | 0.001 | <0.001 |
| TLR4 (pg/mL) | 12.18a | 8.19b | 5.82c | 7.63b | 0.50 | <0.001 | <0.001 |
| MyD88 (pg/mL) | 1.84a | 1.76b | 1.65c | 1.74b | 0.019 | 0.012 | 0.002 |
| NF-κB (ng/L) | 564.72a | 410.00b | 308.89c | 396.94b | 19.35 | <0.001 | <0.001 |
| Day 42 | |||||||
| IL-1β (ng/L) | 94.51a | 87.60b | 79.90c | 86.46b | 1.47 | 0.012 | 0.001 |
| IL-6 (pg/mL) | 15.40a | 12.33b | 9.70c | 12.89b | 0.44 | 0.007 | <0.001 |
| TNF-α (pg/mL) | 26.22a | 22.88b | 17.16c | 21.60b | 0.73 | 0.001 | <0.001 |
| IL-4 (ng/L) | 86.11c | 94.44b | 103.89a | 91.70b | 1.48 | 0.044 | <0.001 |
| IL-10 (ng/L) | 15.36c | 23.41b | 28.95a | 22.93b | 1.03 | 0.001 | <0.001 |
| TLR4 (pg/mL) | 24.80a | 18.10b | 15.16c | 19.30b | 0.76 | 0.002 | <0.001 |
| MyD88 (pg/mL) | 2.95a | 2.84b | 2.76c | 2.87b | 0.02 | 0.041 | <0.001 |
| NF-κB (ng/L) | 752.50a | 690.00b | 635.56c | 699.36b | 8.88 | 0.004 | <0.001 |
a,b,c Means with different superscripts within the same row differ significantly (P < 0.05).
Abbreviations: IL-1β, interleukin-1beta; IL-6, interleukin-6; TNF-α, tumor necrosis factor-alpha; IL-4, interleukin-4; IL-10, interleukin-10; TLR4, toll-like receptor 4; MyD88, myeloid differentiation factor 88; NF-κB, nuclear factor-kappa B.
Expression of inflammation-related genes in hypothalamus
Figure 2 shows the effects of feeding different concentrations of GCP to broiler chicks on the expression of inflammation-related genes in the hypothalamus. On days 21 and 42, the mRNA expression of the major pro-inflammatory genes, IL-1β, IL-6, and TNF-α, and the inflammatory pathway genes, TLR4, MyD88, and NF-κB, were down-regulated in the hypothalamus in the L-GCP, M-GCP, and H-GCP groups, whereas the mRNA expression of the anti-inflammatory genes, IL-4 and IL-10, was significantly up-regulated compared to the control group (P < 0.05). The effect was greatest in the M-GCP group.
Figure 2.
Expression of IL-1β, IL-6, TNF-α, IL-4, and IL-10 genes in the control, L-GCP, M-GCP, and H-GCP groups on (A) day 21 and (B) day 42; and expression of TLR4, MyD88, and NF-κB genes in control, L-GCP, M-GCP, and H-GCP groups on (C) day 21 and (D) day 42. *Each bar represents the mean and standard error. Mean values with different letters differed significantly (P < 0.05). GCP, Glycyrrhiza polysaccharide.
Discussion
In animal husbandry, growth performance is an important index for measuring the production efficiency of livestock and poultry, because improving the growth performance should increase production (Copping et al., 2021). A number of plant polysaccharides have been proven to have growth-promoting effects in animals. For example, Wu et al. (2018) confirmed that adding astragalus polysaccharide (APS) at 1 g/kg to the diet could act as an immune stimulant to improve the growth performance of juvenile broilers. Wang et al. (2020) reported that adding 800 mg/kg ginseng polysaccharide (GPS) to the basic diet effectively improved the growth performance and feed utilization rate in weaned piglets. Previous research by our team found that dietary supplementation with GCP significantly improved feed intake and reduced diarrhea in weaned piglets (Li et al., 2022). In this study, based on relevant research on the effects of plant polysaccharides in broilers, we formulated GCP for experiments at three concentrations: 300, 600, and 900 mg/kg (Li et al., 2019). Compared to the control group, adding GCP to the diet significantly improved the ADFI and ADG of broilers from day 1 to day 21, and the most effective GCP concentration was 600 mg/kg. However, in our previous study, the optimal concentration of GCP for enhancing the immunological response of broilers was 1,000 mg/kg (Zhang et al., 2021b), which differed from our findings here. This inconsistency may be related to the dietary composition, the mode of GCP addition, or the individual gender differences of broilers. Similar results have been described in previous studies. For example, Soumeh et al. (2021) reported that when feeding probiotics, the growth performance of broilers was only improved when the probiotic was administered in drinking water, but not in feed. Cygan-Szczegielniak et al. (2021) found that male broilers had better growth performance than female broilers. Therefore, additional research is necessary to optimize the mode of administration and dosage of GCP under different conditions.
Food intake is regulated by the hypothalamus in the CNS and depends on the body’s energy stores. Hypothalamic control of food intake and metabolism involves two factors. The first is the type of orexigenic neuropeptides in the hypothalamic arcuate nucleus (ARC), neuropeptide Y (NPY), or agouti-related peptide (AgRP). The second factor involves the activity of proopiomelanocortin (POMC) and amphetamine-regulated transcript (CART) neurons that inhibit animal feeding (Jones & Bloom, 2015; Boswell & Dunn, 2017). NPY was considered to be the most potent appetite-stimulating factor and exerted its actions on food intake regulation via NPY, Y2, and Y5 receptor subtypes. The study confirmed the orexigenic effect of NPY in neonatal broiler chicks (Furuse et al., 1997; Tran et al., 2019). In a separate study, the researchers reported that chronic heat stress reduced the expression of NPY in the hypothalamus of broilers resulting in decreased feed intake (He et al., 2019). Further research found that a dynamic balance of POMC and CART in the hypothalamus and the gastrointestinal tract affected the feeding status of corticosterone-exposed laying hens (Liu et al., 2012). In the present study, we found that dietary supplementation with GCP increased mRNA expression of NPY and AgRP in the hypothalamus, while POMC and CART were decreased on day 21; the serum concentrations of appetite-related factors changed in the same way. A concentration of 600 mg/kg of GCP had the optimum effect. Thus, we inferred that dietary GCP promoted food intake by stimulating the expression of orexigenic neuropeptides and inhibiting the expression of anorexigenic neuropeptides. We also noted that orexin only changed significantly at day 21, and not at day 42. It is speculated that this phenomenon is due to the fact that chickens in the rapid growth and development stage (20 to 35 days of age) are more sensitive to GCP, and this has been confirmed in other studies (Guo et al., 2014; Sedgh-Gooya et al., 2022).
The hypothalamic inflammatory response can be mediated by microglia and the classical TLR-4/MyD88/NF-κB inflammatory pathways (Yi et al., 2012; van de Wouw et al., 2017). When a potential trigger of inflammation accumulates in the hypothalamus, it will activate the hypothalamic microglia, which mediate the hypothalamic inflammatory response. TLR4 signals are primarily transmitted through the MyD88-dependent signaling pathway. The interaction between TLR4 and MyD88 in the structural domain of TIR triggers a cascade of downstream signals, eventually activating NF-κB and inducing the release of inflammatory cytokines (Zhang et al., 2008, 2022b; Wang et al., 2022). Severe inflammatory reactions often lead to loss of appetite, mental depression, increased metabolism, elevated body temperature, and weight loss (Rorato et al., 2011). Previous studies confirmed that polysaccharides alleviated inflammatory responses in animals. For example, Luo et al. (2021) found that astragalus polysaccharides could reduce intestinal inflammatory damage in young geese, and Venardou et al. (2021) reported that adding laminaria polysaccharide to the diet reduced intestinal inflammation. In the present study, we found that treatment with GCP reduced the expression of TLR4, MyD88, NF-κB, TNF-α, IL-1β, and IL-6 mRNA in the hypothalamus, while the expression of IL4 and IL-10 was increased on days 21 and 42, especially in the groups supplemented with 600 mg/kg, and consistent with dynamic changes in concentration of inflammatory factors in serum. This suggests that when inflammation occurs, the hypothalamus and blood have the same inflammatory reaction; thus, GCP may inhibit TLR4/MyD88/NF-κB signaling and regulate the levels of downstream inflammatory factors, thereby ameliorating inflammation.
Conclusions
Overall, dietary GCP supplementation can increase food intake by increasing the levels of orexigenic neuropeptides and decreasing the levels of anorexigenic neuropeptides in serum and the hypothalamus, and alleviating hypothalamus and serum inflammatory responses. Supplementation in broiler production with 600 mg/kg GCP was optimally effective. Taken together, our results provide a rationale for the application of GCP as a feed additive in broilers.
Acknowledgments
The study was supported by the National Key R&D Program of China (2017YFE0129900), the National Natural Science Foundation of China (31872537), and the Natural Science Foundation of Henan Province (182300410087).
Glossary
Abbreviations
- GCP
Glycyrrhiza polysaccharide
- CNS
central nervous system
- ADG
average daily gain
- ADFI
average daily feed intake
- FCR
feed conversion ratio
- APS
astragalus polysaccharide
- GPS
ginseng polysaccharide
- NPY
neuropeptide Y
- AgRP
agouti gene-related protein
- POMC
proopiomelanocortin
- CART
cocaine- and amphetamine-regulated transcript
- IL-1β
interleukin-1beta
- IL-6
interleukin-6
- TNF-α
tumor necrosis factor-alpha
- IL-4
interleukin-4
- IL-10
interleukin-10
- TLR4
Toll-like receptor 4
- MyD88
myeloid differentiation factor 88
- NF-κB
nuclear factor-kappa B
Contributor Information
Yiyi Zhao, Henan International Joint Laboratory of Animal Welfare and Health Breeding, Henan University of Science and Technology, Luoyang, PR China.
Chenxu Li, Henan International Joint Laboratory of Animal Welfare and Health Breeding, Henan University of Science and Technology, Luoyang, PR China.
Xueying Wang, Henan International Joint Laboratory of Animal Welfare and Health Breeding, Henan University of Science and Technology, Luoyang, PR China.
Zhaojun Wang, Henan International Joint Laboratory of Animal Welfare and Health Breeding, Henan University of Science and Technology, Luoyang, PR China.
Jicang Wang, Henan International Joint Laboratory of Animal Welfare and Health Breeding, Henan University of Science and Technology, Luoyang, PR China.
Wenrui Zhen, Henan International Joint Laboratory of Animal Welfare and Health Breeding, Henan University of Science and Technology, Luoyang, PR China.
Shucheng Huang, College of Animal Science and Veterinary Medicine, Henan Agricultural University, Zhengzhou, PR China.
Tianshuai Li, Henan International Joint Laboratory of Animal Welfare and Health Breeding, Henan University of Science and Technology, Luoyang, PR China.
Hengyu Fan, Henan International Joint Laboratory of Animal Welfare and Health Breeding, Henan University of Science and Technology, Luoyang, PR China.
Yanbo Ma, Henan International Joint Laboratory of Animal Welfare and Health Breeding, Henan University of Science and Technology, Luoyang, PR China.
Cai Zhang, Henan International Joint Laboratory of Animal Welfare and Health Breeding, Henan University of Science and Technology, Luoyang, PR China.
Conflict of Interest Statement
In this study, the authors asserted that they had no conflict of interest.
Literature Cited
- Alagawany, M., Elnesr S. S., Farag M. R., Abd El-Hack M. E., Khafaga A. F., Taha A. E., Tiwari R., Yatoo M. I., Bhatt P., Marappan G., . et al. 2019. Use of licorice (Glycyrrhiza glabra) herb as a feed additive in poultry: current knowledge and prospects. Animals (Basel). 9:8. doi: 10.3390/ani9080536. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Boswell, T., and Dunn I. C.. . 2017. Regulation of agouti-related protein and pro-opiomelanocortin gene expression in the avian arcuate nucleus. Front. Endocrinol. 8:75. doi: 10.3389/fendo.2017.00075. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Copping, K. J., Callaghan M. J., Geesink G. H., Gugusheff J. R., McMillen I. C., Rodgers R. J., Muhlhausler B. S., Vithayathil M. A., and Perry V. E. A.. . 2021. Periconception and first trimester diet modifies appetite, hypothalamic gene expression, and carcass traits in bulls. Front. Genet. 12:720242. doi: 10.3389/fgene.2021.720242. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cygan-Szczegielniak, D., and Bogucka J.. . 2021. Growth performance, carcass characteristics and meat quality of organically reared broiler chickens depending on sex. Animals (Basel). 11:3274. doi: 10.3390/ani11113274. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dirong, G., Nematbakhsh S., Selamat J., Chong P. P., Idris L. H., Nordin N., Fatchiyah F., and Abdull Razis A. F.. . 2021. Omics-based analytical approaches for assessing chicken species and breeds in food authentication. Molecules. 26:6502. doi: 10.3390/molecules26216502. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Furuse, M., Matsumoto M., Mori R., Sugahara K., Kano K., and Hasegawa S.. . 1997. Influence of fasting and neuropeptide Y on the suppressive food intake induced by intracerebroventricular injection of glucagon-like peptide-1 in the neonatal chick. Brain Res. 764:289–292. doi: 10.1016/s0006-8993(97)00623-9. [DOI] [PubMed] [Google Scholar]
- Guo, Z. Y., Li J. L., Zhang L., Jiang Y., Gao F., and Zhou G. H.. . 2014. Effects of alpha-lipoic acid supplementation in different stages on growth performance, antioxidant capacity and meat quality in broiler chickens. Br. Poult. Sci. 55:635–643. doi: 10.1080/00071668.2014.958057. [DOI] [PubMed] [Google Scholar]
- He, X., Lu Z., Ma B., Zhang L., Li J., Jiang Y., Zhou G., and Gao F.. . 2019. Chronic heat stress alters hypothalamus integrity, the serum indexes and attenuates expressions of hypothalamic appetite genes in broilers. J. Therm. Biol. 81:110–117. doi: 10.1016/j.jtherbio.2019.02.025. [DOI] [PubMed] [Google Scholar]
- Hintz, H. F. 1994. Nutrition and equine performance. J. Nutr. 124:2723s–2729s. doi: 10.1093/jn/124.suppl_12.2723S. [DOI] [PubMed] [Google Scholar]
- van Hoek, A., Dierikx C., Bosch T., Schouls L., van Duijkeren E., and Visser M.. . 2020. Transmission of ESBL-producing Escherichia coli between broilers and humans on broiler farms. J. Antimicrob. Chemother. 75:543–549. doi: 10.1093/jac/dkz507. [DOI] [PubMed] [Google Scholar]
- Jones, B. J., and Bloom S. R.. . 2015. The new era of drug therapy for obesity: the evidence and the expectations. Drugs. 75:935–945. doi: 10.1007/s40265-015-0410-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li, S., Ren L., Zhu X., Li J., Zhang L., Wang X., Gao F., and Zhou G.. . 2019. Immunomodulatory effect of γ-irradiated astragalus polysaccharides on immunosuppressed broilers. Anim. Sci. J. 90:117–127. doi: 10.1111/ASJ.13133. [DOI] [PubMed] [Google Scholar]
- Li, C., Zhao P., Shao Q., Ma Y., Bai D., Liao C., He L., Huang S., and Wang X.. . 2022. Effects of dietary Glycyrrhiza polysaccharide on growth performance, blood parameters and immunity in weaned piglets. J. Anim. Physiol. Anim. Nutr. 107:136–146. doi: 10.1111/jpn.13692. [DOI] [PubMed] [Google Scholar]
- Liu, L., Song Z., Sheikhahmadi A., Jiao H., and Lin H.. . 2012. Effect of corticosterone on gene expression of feed intake regulatory peptides in laying hens. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 162:81–87. doi: 10.1016/j.cbpb.2012.04.005. [DOI] [PubMed] [Google Scholar]
- Long, L. N., Zhang H. H., Wang F., Yin Y. X., Yang L. Y., and Chen J. S.. . 2021. Research note: effects of polysaccharide-enriched acanthopanax senticosus extract on growth performance, immune function, antioxidation, and ileal microbial populations in broiler chickens. Poult. Sci. 100:101028. doi: 10.1016/j.psj.2021.101028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Luo, D., Yang N., Liu Z., Li T., Wang H., Ge M., and Zhang R.. . 2021. Effects of astragalus polysaccharide on intestinal inflammatory damage in goslings infected with gosling plague. Br. Poult. Sci. 62:353–360. doi: 10.1080/00071668.2020.1859094. [DOI] [PubMed] [Google Scholar]
- Reda, F. M., El-Saadony M. T., El-Rayes T. K., Farahat M., Attia G., and Alagawany M.. . 2021. Dietary effect of licorice (Glycyrrhiza glabra) on quail performance, carcass, blood metabolites and intestinal microbiota. Poult. Sci. 100:101266. doi: 10.1016/j.psj.2021.101266. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rorato, R., Reis W. L., Antunes-Rodrigues J., and Elias L. L.. . 2011. Cholecystokinin and hypothalamic corticotrophin-releasing factor participate in endotoxin-induced hypophagia. Exp. Physiol. 96:439–450. doi: 10.1113/expphysiol.2010.056465. [DOI] [PubMed] [Google Scholar]
- Sedgh-Gooya, S., Torki M., Darbemamieh M., Khamisabadi H., and Abdolmohamadi A.. . 2022. Growth performance and intestinal morphometric features of broiler chickens fed on dietary inclusion of yellow mealworm (Tenebrio molitor) larvae powder. Vet Med Sci. 8:2050–2058. doi: 10.1002/vms3.881. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Selyutina, O. Y., Mastova A. V., Shelepova E. A., and Polyakov N. E.. . 2021. pH-sensitive Glycyrrhizin based vesicles for nifedipine delivery. Molecules. 26:12705. doi: 10.3390/molecules26051270. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Simayi, Z., Rozi P., Yang X., Ababaikeri G., Maimaitituoheti W., Bao X., Ma S., Askar G., and Yadikar N.. . 2021. Isolation, structural characterization, biological activity, and application of Glycyrrhiza polysaccharides: systematic review. Int. J. Biol. Macromol. 183:387–398. doi: 10.1016/j.ijbiomac.2021.04.099. [DOI] [PubMed] [Google Scholar]
- Soumeh, E. A., A.Cedeno.,Niknafs S., Bromfield J.Hoffman L. C.. . 2021. The efficiency of probiotics administrated via different routes and doses in enhancing production performance, meat quality, gut morphology, and microbial profile of broiler chickens. Animals (Basel). 11:3607. doi: 10.3390/ani11123607. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Te Pas, M. F. W., Borg R., Buddiger N. J. H., Wood B. J., Rebel J. M. J., van Krimpen M. M., Calus M. P. L., Park J. E., and Schokker D.. . 2020. Regulating appetite in broilers for improving body and muscle development—a review. J. Anim. Physiol. Anim. Nutr. 104:1819–1834. doi: 10.1111/jpn.13407. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tran, P. V., Chowdhury V. S., and Furuse M.. . 2019. Central regulation of feeding behavior through neuropeptides and amino acids in neonatal chicks. Amino Acids 51:1129–1152. doi: 10.1007/s00726-019-02762-x. [DOI] [PubMed] [Google Scholar]
- Venardou, B., O’Doherty J. V., Vigors S., O’Shea C. J., Burton E. J., Ryan M. T., and Sweeney T.. . 2021. Effects of dietary supplementation with a laminarin-rich extract on the growth performance and gastrointestinal health in broilers. Poult. Sci. 100:101179. doi: 10.1016/j.psj.2021.101179. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang, K., Zhang H., Han Q., Lan J., Chen G., Cao G., and Yang C.. . 2020. Effects of astragalus and ginseng polysaccharides on growth performance, immune function and intestinal barrier in weaned piglets challenged with lipopolysaccharide. J. Anim. Physiol. Anim. Nutr. 104:1096–1105. doi: 10.1111/jpn.13244. [DOI] [PubMed] [Google Scholar]
- Wang, Y., Li Y., Zhang H., Zhu L., Zhong J., Zeng J., Meng C., Wu J., Wang T., Shi R., Yuan W., Jiang J., Liu P., and Ma Y.. . 2021. Pharmacokinetics-based comprehensive strategy to identify multiple effective components in Huangqi decoction against liver fibrosis. Phytomedicine. 84:153513. doi: 10.1016/j.phymed.2021.153513. [DOI] [PubMed] [Google Scholar]
- Wang, M. Y., Y.Zhang.,Y. X.Tong.,P. T.Guo.,J.Zhang.,C. K.Wang., and Gao Y. Y.. . 2022. Effects of lutein on jejunal mucosal barrier function and inflammatory responses in lipopolysaccharide-challenged yellow-feather broilers. Poult Sci. 101:102191. doi: 10.1016/j.psj.2022.102191 [DOI] [PMC free article] [PubMed] [Google Scholar]
- van de Wouw, M., Schellekens H., Dinan T. G., and Cryan J. F.. . 2017. Microbiota-gut-brain axis: modulator of host metabolism and appetite. J. Nutr. 147:727–745. doi: 10.3945/jn.116.240481. [DOI] [PubMed] [Google Scholar]
- Wu, S. 2018. Effect of dietary Astragalus membranaceus polysaccharide on the growth performance and immunity of juvenile broilers. Poult. Sci. 97:3489–3493. doi: 10.3382/ps/pey220. [DOI] [PubMed] [Google Scholar]
- Yi, C. X., Tschöp M. H., Woods S. C., and Hofmann S. M.. . 2012. High-fat-diet exposure induces IgG accumulation in hypothalamic microglia. Dis Model Mech. 5:686–690. doi: 10.1242/dmm.009464. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yin, M., Zhang Y., and Li H.. . 2019. Advances in research on immunoregulation of macrophages by plant polysaccharides. Front. Immunol. 10:145. doi: 10.3389/fimmu.2019.00145. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang, X., Zhang G., Zhang H., Karin M., Bai H., and Cai D.. . 2008. Hypothalamic IKKbeta/NF-kappaB and ER stress link overnutrition to energy imbalance and obesity. Cell 135:61–73. doi: 10.1016/j.cell.2008.07.043. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang, C., Li C., Shao Q., Wang X., Chen W., Li Y., Huang S., and Ma Y.. . 2021a. Effects of dietary Glycyrrhiza polysaccharide on growth, serum biochemistry, immunity, and egg laying in quail. Anim. Biotechnol. 1–9. doi: 10.1080/10495398.2021.1979024. [DOI] [PubMed] [Google Scholar]
- Zhang, C., Li C. X., Shao Q., Chen W. B., Ma L., Xu W. H., Li Y. X., Huang S. C., and Ma Y. B.. . 2021b. Effects of Glycyrrhiza polysaccharide in diet on growth performance, serum antioxidant capacity, and biochemistry of broilers. Poult. Sci. 100:100927. doi: 10.1016/j.psj.2020.12.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang, C., Li C., Zhao P., Shao Q., Ma Y., Bai D., Liao C., He L., Huang S., and Wang X.. . 2022a. Effects of dietary Glycyrrhiza polysaccharide supplementation on growth performance, intestinal antioxidants, immunity and microbiota in weaned piglets. Anim. Biotechnol. 1–12. doi: 10.1080/10495398.2022.2086878. [DOI] [PubMed] [Google Scholar]
- Zhang, X., Akhtar M., Chen Y., Ma Z., Liang Y., Shi D., Cheng R., Cui L., Hu Y., Nafady A. A., . et al. 2022b. Chicken jejunal microbiota improves growth performance by mitigating intestinal inflammation. Microbiome. 10:107. doi: 10.1186/s40168-022-01299-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhao, Y., Zhuang Y., Shi Y., Xu Z., Zhou C., Guo L., Liu P., Wu C., Hu R., Hu G., Guo X., and Xu L.. . 2021. Effects of N-acetyl-l-cysteine on heat stress-induced oxidative stress and inflammation in the hypothalamus of hens. J. Therm. Biol. 98:102927. doi: 10.1016/j.jtherbio.2021.102927. [DOI] [PubMed] [Google Scholar]