Molecular detection of Babesia microti in dromedary camels in Egypt

Abstract

Babesia microti (Apicomplexa: Piroplasmida) causes a medically important tick-borne zoonotic protozoan disease. Egyptian camels are susceptible to Babesia infection; however, just a few cases have been documented. This study aimed to identify Babesia species, specifically Babesia microti, and their genetic diversity in dromedary camels in Egypt and associated hard ticks. Blood and hard tick samples were taken from 133 infested dromedary camels slaughtered in Cairo and Giza abattoirs. The study was conducted from February to November 2021. The 18S rRNA gene was amplified by polymerase chain reaction (PCR) to identify Babesia species. Nested PCR targeting the β-tubulin gene was used to identify B. microti. The PCR results were confirmed by DNA sequencing. Phylogenetic analysis based on the ß-tubulin gene was used to detect and genotype B. microti. Three tick genera were identified in infested camels (Hyalomma, Rhipicephalus, and Amblyomma). Babesia species were detected in 3 out of 133 blood samples (2.3%), while Babesia spp. were not detected in hard ticks by using the 18S rRNA gene. B. microti was identified in 9 out of 133 blood samples (6.8%) and isolated from Rhipicephalus annulatus and Amblyomma cohaerens by the β-tubulin gene. The phylogenetic analysis of the β-tubulin gene revealed that USA-type B. microti was prevalent in Egyptian camels. The results of this study suggested that the Egyptian camels may be infected with Babesia spp. and the zoonotic B. microti strains, which pose a potential risk to public health.

Introduction

Hard ticks (Acari: Ixodidae) are hematophagous ectoparasites that can infest almost all vertebrates and transmit various diseases; as a result, ticks are regarded as one of the most important vectors of human and animal infections globally (Li et al. 2020). Tick-borne diseases are spreading globally due to tick population growth, geographic expansion, and human travel and commerce (Gratz 2006; Kim et al. 2021; Randolph and Rogers 2010).

Babesiosis is an emerging tick-borne zoonotic infectious disease of veterinary and medical importance and became a nationally notifiable disease in 2011 in the USA (CDC 2012; Motevalli Haghi et al. 2014). Babesiosis is caused by apicomplexan intraerythrocytic parasites of the genus Babesia; they are transmitted to vertebrates (ruminants, dogs, cats, birds, rodents, and humans) by ticks (Kalani et al. 2012; Mirahmadi et al. 2022). This disease can also be transmitted by blood transfusion, organ donation, and even congenitally (Herwaldt et al. 2011; Vannier and Krause 2012). The main vectors of Babesia spp. are several genera of the Ixodidae family as Rhipicephalus, Ixodes, Haemaphysalis, and Hyalomma. Geographically, Ixodes scapularis transmits Babesia parasites to natural hosts and also humans in the USA, Ixodes ricinus in Europe, and Ixodes persulcatus in Asia (Zamoto-Niikura et al. 2016).

Dromedaries are not resistant to Babesia infection. Babesiosis in camels causes anemia, fever, icterus, hemoglobinuria, and gastrointestinal stasis; pathogenicity varies according to Babesia species (Swelum et al. 2014). Factors that contribute to the increased risk of babesiosis include the importation of camels from areas with high infection rates and the spreading of vector ticks (Mirahmadi et al. 2022). Recent research by Salman et al. (2022) suggests that camels in Egypt are infected with novel Babesia species, where they are able to detect Babesia sp. Mymensingh in one camel in Egypt (Salman et al. 2022). In Egyptian camels, only a few documented about the occurrence of Babesia spp. of zoonotic importance. Babesia microti is one of the most important species of babesiosis infecting humans (Homer et al. 2000). Babesia microti (Apicomplexa: Piroplasmida) is an emerging cause of tick-borne disease with significant public health implications in Asia, Europe, and North America. The main reservoirs of B. microti are rodents and their associated ticks, which are more adaptable and resistant to habitat change (Goethert 2021; Hussain et al. 2021; Westblade et al. 2017). The risk of human babesiosis produced by B. microti is connected with the presence and prevalence of its tick vectors (Rodgers and Mather 2007). Recent researchers have studied the prevalence of B. microti in different tick spp. worldwide. B. microti have been found in Ixodes scapularis, I. ricinus, I. persulcatus, and I. ovatus (Tuvshintulga et al. 2015). B. microti has been recognized as a genetically diverse complex group, generally clarified into the US, Munich, Kobe, and Hobetsu (or Ostu) types (Karnchanabanthoeng et al. 2018; Wei et al. 2020). Only one study in Egypt (Halayeb and Shalateen) detected B. microti in camels (El-Alfy et al. 2022; Rizk 2021). Consequently, it is necessary to research the prevalence of B. microti in Egyptian camels to identify geographic regions where humans are at the highest risk of exposure. So, the aim of this study was to identify Babesia species, specifically Babesia microti, and their genetic diversity in dromedary camels in Egypt and associated hard tick.

Methods

Ethics approval and consent to participate

The study was approved according to the guidelines of the Ethical Committee of the Faculty of Veterinary Medicine, Cairo University (Institutional Animal Care and Use Committee), Vet CU. IACUC (Vet CU28/04/2021/303).

Study area and collection of samples

The study area included 2 Egyptian slaughterhouses in Cairo and Giza. The sample collection was conducted in 2021. A total of 133 one-humped camels of different ages (3–5 years) and sexes (male and females) that appeared healthy were screened for tick infestation. Different hard tick species (n = 1596) were collected and placed in labeled tubes individualized per camel.

About 5 mL of whole blood was taken from the slaughtered camels (n = 133). All blood samples were put into labeled EDTA-coated tubes and delivered to the laboratory on ice packs within 4 h for DNA extraction.

Identification of tick

Adult hard ticks were gathered from camels using tweezers into labeled tubes from predilection sites for ticks (perineum, abdomen, thigh, ear, neck, and dewlap) and transported to the laboratory in a dry ice box. Ticks were first given a two-step cleaning with distilled water, rinsed once with 70% ethanol, and then patted dry with tissue. The tick morphologies were identified to the genus level under a stereomicroscope using taxonomic keys (Estrada-Peña et al. 2004) at the Veterinary Medicine Faculty, Cairo University. The size of mouthparts, the color of the body, leg color, presence or absence of the eye, the shape of the scutum, body, coxae one, festoon, and ventral plates were examined.

Extraction of DNA from tick and blood samples

A single tick that was representative of each species per individual camel was crushed into small pieces in a mortar using liquid nitrogen for DNA extraction. Genomic DNA was isolated according to the manufacturer’s instructions from 200 µL of blood and tick samples with a Thermo Scientific GeneJET Genomic DNA Purification Kit (Thermo Fisher, Darmstadt, Germany). Genomic DNA was stored at − 20 °C until use.

Molecular detection of tick species and Babesia species

Molecular identification of tick species was performed using the COX1 gene and amplified according to the technique described by Abdullah et al. (2016).

To identify Babesia spp. from blood samples and ticks, a conventional PCR was used to amplify the 18S rRNA gene (Casati et al. 2006). The amplification reaction was 12.5 µL of cosmo Taq DNA Polymerase Master Mix (Willowfort, UK) in a total volume of 25 μL, 3 μL of the extracted DNA as a template, and 1 µL of 10 pmol of each primer. The details of primer and PCR conditions are shown in Table 1. Positive controls included the genomic DNA of well-known blood parasites, whereas negative controls included nuclease-free water and both were subjected to the same methods.

Table 1.

Primer sequences and PCR conditions

Target gene	Primer sequences (5′-3)	Thermal cycles	(bp)	References
cox1	CO1-F: GGAACAATATATTTAATTTTTGG CO1-R: ATCTATCCCTACTGTAAATATATG	94 °C, 5 min; 30 cycles (94 °C 1 min; 45 °C, 1 min; 72 °C, 1 min), 72 °C, 10 min	732–820 bp	(Abdullah et al. 2016)
18SrRNA	BJ1: GTC TTG TAA TTG GAA TGATGG BN2: TAG TTT ATG GTT AGG ACT ACG	94 °C, 10 min; 35 cycles (94 °C 1 min; 55 °C, 1 min; 72 °C, 2 min), 72 °C, 5 min	411–452 bp	(Casati et al. 2006)
β-Tubulin	BmTubu93F: GAYAGYCCCTTRCAACTAGAAAGAGC BmTubu897R: CGRTCGAACATTTGTTGHGTCARTTC	95 °C, 10 min; 35 cycles (95 °C, 30 s; 58 °C, 1 min; 72 °C, 1 min 30 s), 72 °C, 10 min	551 bp	(Li et al. 2020)
	BmTubu192F: ACHATGGATTCTGTTAGATCYGGC BmTubu782R: GGGAADGGDATRAGATTCACAGC	94 °C, 10 min; 45 cycles (94 °C 30 s; 61 °C, 30 s; 72 °C, 1 min), 72 °C, 10 min

Babesia microti were identified by nested PCR. Two specific primer sets were used to detect ß-tubulin genes of B. microti (shown in Table 1): BmTubu93F and BmTubu897R for the first round and BmTubu192F and BmTubu783R for the second round (Li et al. 2020, Zamoto-Niikura et al. 2012). The reaction was performed in a total volume of 25 μL consisting of 3 µL of template DNA from each tick and blood genomic DNA, 12.5 µL of cosmo Taq DNA Polymerase Master Mix (Willowfort, UK), and 1 µL of 10 pmol of each primer forward and reverse. The PCR products were electrophoresed on 1.5% agarose gel, and a DNA marker and a BERUS 100 bp DNA ladder (Willowfort, UK) were run simultaneously. Positive results for Babesia were indicated by the detection of bands with the same size of obtained positive controls.

Sequencing and phylogenetic analysis

Random selected PCR positive samples were sequenced unidirectionally using primers BN2 and BmTubu192F to confirm the presence of Babesia spp. and Babesia microti, respectively. The PCR products were purified using a QIAquick PCR Product Purification Kit (Qiagen, Hombrechtikon, Switzerland). Purified PCR products were sequenced using the BigDye Terminator V3.1 sequencing kit (Applied Biosystems, Waltham, MA), and the nucleotide sequences obtained were deposited in GenBank. The acquired nucleotide sequences were compared to those in the public domains using the NCBI-BLAST server and then imported into the BioEdit version 7.0.1.4 program for multiple alignments using the BioEdit Clustal W tool. The MEGA software version X conducted the maximum likelihood method’s phylogenetic analysis based on ß-tubulin genes.

Statistical analysis

Data was analyzed with PASW Statistics, version 18.0. software (SPSS Inc., Chicago, IL, USA). A chi-square (χ²) test was used to test the prevalence of different tick genera. Significance was considered at a P value less than 0.05.

Results

Identification of ticks

Three genera (Hyalomma, Amblyomma, and Rhipicephalus) and twelve hard tick species were identified from (133) Camelus dromedarius by using the COX1 gene, including Hyalomma dromedarii, H. marginatum, Amblyomma hebraeum, H. excavatum, Hyalomma anatolicum, and Rhipicephalus annulatus, and there were few Amblyomma testudinarium, Amblyomma lepidum, Amblyomma variegatum, Rhipicephalus pulchellus, Amblyomma cohaerens, and finally Amblyomma gemma. The prevalence of tick genera collected from camels is shown in Table 2.

Table 2.

The prevalence of tick genera collected from camels

Tick genera	Total genera	P value
Hyalomma	1358 (85.1%)a	< 0.0001
Amblyomma	207 (13.0%)b
Rhipicephalus	31 (1.9%)c
Total no. collected	1596

^a,b,cDifferent superscripts indicate significance (X², P < 0.05)

The accession numbers of COX1 gene sequences of identified ticks were deposited in GenBank as OK484562, OQ154976, OL818342, OK340836, OL908962, OQ154978, OQ154975, OQ154974, OQ154972, and OQ154973.

Molecular detection of Babesia species

In this study, camel blood samples and ticks were screened for the presence of Babesia spp. using the 18S rRNA gene. Babesia spp. were detected in 2.3% (3/133) of blood samples from apparently healthy camels. None of the tick samples tested positive for Babesia spp. by 18S rRNA gene (Table 3).

Table 3.

Molecular detection of Babesia spp. and Babesia microti in ticks and blood DNA

Type of samples	Total examined	Babesia spp.	B. microti
		No. (%)	No. (%)
Blood samples	133	3 (2.3)	9 (6.8)
Tick samples	1596	0 (0)	3 (0.2)

Nested PCR for the detection of Babesia microti in blood and tick samples

After nested PCR targeting the β-tubulin gene, 6.8% (9/133) blood samples and three ticks were positive for B. microti (Table 3). The positive ticks included 2 Rhipicephalus annulatus and 1 Amblyomma cohaerens.

Sequencing and phylogenetic analyses

The amplified PCR products were subject to DNA sequencing. Six PCR products were sequenced, including 2 for positive blood samples targeting the 18 s rRNA gene, 2 for positive blood samples targeting the ß-tubulin gene, and 1 each for Amblyomma cohaerens and Rhipicephalus annulatus. The gene sequences were submitted to GenBank and the accession numbers are OP363092, OL912841, OM144475, OM144476, OM103425, and OM103427.

All strains of B. microti isolated from camel’s blood and ticks (Amblyomma cohaerens and Rhipicephalus annulatus), based on the β-tubulin gene, were closely related to the USA and China strains in human blood (AB872931.1, AY144725.1, and LC314659.1) (Fig. 1).

Fig. 1.

Phylogenetic tree based on the beta-tubulin gene sequences of B. microti. The trees were constructed and analyzed by the maximum likelihood method. A red and blue small triangle indicate the new sequences provided by the present study

Discussion

Tick infestations have a significant impact on the health and productivity of camels, resulting in a high economic loses. The highest prevalent tick genera were the Hyalomma genus (85.1%), followed by the Amblyomma genus (13.0%) and finally the Rhipicephalus genus (1.9%).

The current study detected Babesia infection in 2.3% of the camel blood samples based on the 18S rRNA gene. These findings are different to previous studies that recorded an overall prevalence of Babesia (B. bovis and B. bigemina) being 18.43% in Matrouh Governorate, Egypt (El-Naga and Barghash 2016), and 74.5% in Sudan (Ibrahim et al. 2017). Saudi Arabia showed a 13.2% infection rate in camels, while in Iran, it was 6.56% (Khamesipour et al. 2015, Swelum et al. 2014). Nonetheless, the camels are considered an accidental host infected with Babesia and may act as a maintain host for ticks which can transmit the parasite to another host.

One limitation of our research, the expected specificity of the two sets of PCR primers used (18S rRNA primers) was low because these primers are too general and will pick up most types of Babesia and Theileria. We suggested a more specific set of primers to use for the detection of ß-tubulin genes of B. microti by nested PCR.

The B. microti ß-tubulin gene was detected in 6.8% of camel’s blood by nested PCR, and this result is lower than the estimated prevalence of B. microti in the blood of camels being 11.97% (17/142) in Halayeb and Shalateen in Egypt (Rizk 2021). Only one previous study in Egypt was able to detect B. microti in camels; these results highlight the neglected B. microti transmission cycle in Egypt.

Fragment of the ß-tubulin gene of B. microti was amplified in Rhipicephalus annulatus (n = 2) and Amblyomma cohaerens (n = 1) by nested PCR in this investigation. Babesia microti was found in Ixodes ricinus from small ruminants in Turkey and pets in Belgium (Aydin et al. 2015; Lempereur et al. 2011). It has also been found in China in Ixodes persulcatus, Haematopus longicornis, and Haemaphysalis concinna (Fang et al. 2015, Wei et al. 2020). Whereas ticks of the genus Ixodes are considered the primary vector of B. microti (Yabsley and Shock 2013), more research must be conducted on other tick species to determine the vector competence of B. microti in Egypt.

In the current study, phylogenetic analysis of the ß-tubulin gene of B. microti showed a genetically closer relationship of our isolated sequence with similarly related species in the USA and China that were isolated from human blood. This evidenced that US-type B. microti were prevalent in Egyptian camels. B. microti sensu stricto (or US-type) parasites are probably the most significant parasites due to their impact on global public health as the primary cause of human babesiosis (Goethert 2021). Our study brings light to the presence of B microti in Egypt that pose a threat to human health. Therefore, physicians consider it when making a diagnosis.

Conclusion

B. microti US type was detected in different hard ticks (Rhipicephalus annulatus and Amblyomma cohaerens) and the blood of camels. Further research must be done to clarify the possible role of camels and their parasitic tick species in the enzootic cycle for babesiosis transmission in Egypt.

Author contribution

R.A. performed the collection of samples, and the molecular and sequence analysis of the studied samples. R.A., D.H., M.K., and M.S. performed the analysis and interpretation of the data and the writing of the manuscript. All authors read and approved the final version of the manuscript.

Funding

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).

Data availability

All the data generated or analyzed in this study are included in this published article.

Declarations

Ethics approval and consent to participate

The study was carried out according to the guidelines of the ethical committee of the Faculty of Veterinary Medicine, Cairo University (Institutional Animal Care and Use Committee), Vet CU. IACUC (Vet CU28/04/2021/303).

All experimental protocols were approved by the Institutional Animal Care and Use Committee (IACUC) of the Faculty of Veterinary Medicine, Cairo University, Egypt.

The study was carried out in compliance with the ARRIVE guidelines.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.