Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2023 Jan 19;120(4):e2208749120. doi: 10.1073/pnas.2208749120

Soluble cyclase-mediated nuclear cAMP synthesis is sufficient for cell proliferation

Alejandro Pizzoni a, Xuefeng Zhang a, Nyla Naim a,1, Daniel L Altschuler a,2
PMCID: PMC9942871  PMID: 36656863

Significance

GPCRs are the largest family of mammalian receptors. GsPCRs signaling via cAMP initiates at the plasma membrane (first wave) and continues upon receptor internalization from an intracellular compartment (second wave), whose physiological role is not yet clearly established. Utilizing the TSHR-thyroid system, we show that TSH triggers an internalization-dependent accumulation of nuclear cAMP mediated solely by local soluble cyclase (sAC) activation, rather than cAMP diffusion from the cytosol. We present a new “three-wave model of cAMP signaling” proposing that the role of the sustained cAMP (second wave) is the mobilization of Ca2+ as an intermediate diffusible factor that enters the nucleus and activates sAC. This nuclear sAC-generated cAMP (third wave) is sufficient and rate-limiting for thyroid cell proliferation.

Keywords: GPCR, nuclear calcium, nuclear cAMP, nuclear PKA, proliferation

Abstract

cAMP, a key player in many physiological processes, was classically considered to originate solely from the plasma membrane (PM). This view was recently challenged by observations showing that upon internalization GsPCRs can sustain signaling from endosomes and/or the trans-Golgi network (TGN). In this new view, after the first PM-generated cAMP wave, the internalization of GsPCRs and ACs generates a second wave that was strictly associated with nuclear transcriptional events responsible for triggering specific biological responses. Here, we report that the endogenously expressed TSHR, a canonical GsPCR, triggers an internalization-dependent, calcium-mediated nuclear sAC activation that drives PKA activation and CREB phosphorylation. Both pharmacological and genetic sAC inhibition, which did not affect the cytosolic cAMP levels, blunted nuclear cAMP accumulation, PKA activation, and cell proliferation, while an increase in nuclear sAC expression significantly enhanced cell proliferation. Furthermore, using novel nuclear-targeted optogenetic actuators, we show that light-stimulated nuclear cAMP synthesis can mimic the proliferative action of TSH by activating PKA and CREB. Therefore, based on our results, we propose a novel three-wave model in which the “third” wave of cAMP is generated by nuclear sAC. Despite being downstream of events occurring at the PM (first wave) and endosomes/TGN (second wave), the nuclear sAC-generated cAMP (third wave) is sufficient and rate-limiting for thyroid cell proliferation.


Cyclic adenosine monophosphate (cAMP), the first second messenger described (1, 2), is a key intermediate in signaling pathways controlling many cellular processes including proliferation, differentiation, survival, and metabolism (3). The players involved in its synthesis (adenylyl cyclases, ACs) and degradation (phosphodiesterases, PDEs) are relatively well-defined; however, the mechanisms cells utilize to compute (code/decode) the relay of the cAMP signal (i.e., fidelity, specificity, efficiency) are still not understood.

In the canonical cAMP pathway, an activated GPCR (G-protein coupled receptor) couples to heterotrimeric Gs to stimulate one or more isoforms of the transmembrane adenylyl cyclases (tmAC, AC1-9) at the plasma membrane (PM). The synthesized cAMP directly binds and activates a set of effectors (4–10), including protein kinase A (PKA), whose catalytic subunit (PKA-C) can diffuse to the nucleus, phosphorylate transcription factors and initiate the transcription of cAMP-specific genes (11, 12). An additional intracellular source of cAMP is soluble adenylyl cyclase (sAC, AC10) which, unlike tmACs that are regulated by Gs and forskolin (FK), is activated by bicarbonate, Ca2+, and ATP (13). In addition to the cytosol, sAC was found at discrete cellular locations including the nucleus (14), where it represents the only cAMP-synthesizing activity. These findings showed that cAMP can be synthesized deep in the cell and ruled out the PM as the only cAMP source.

TSHR (thyroid-stimulating hormone receptor) is a class A GPCR activated by TSH, a glycoprotein synthesized by the thyrotrophs in the anterior lobe of the pituitary (adenohypophysis) that is the main regulator of the thyroid gland (15). TSHR activation leads to membrane G-protein activation and stimulation of secondary messenger pathways, mainly Gs-AC-cAMP (16, 17). Downstream activation of cAMP effector pathways, e.g., Epac1 and PKA, works synergistically toward thyrocyte proliferation (18, 19), establishing thyroid/TSHR as a bona fide model to study cAMP signaling.

The spatiotemporal properties of signaling intermediates impart specificity on biological outputs (20–24). According to the classical view, cAMP signaling was considered to originate solely from the PM, with receptor endocytosis mediating signal termination, leading to a transient cAMP response (25). This original view was recently challenged by observations, first reported for TSHR (26), showing that upon internalization GPCRs can sustain cAMP signaling from intracellular membranes. In this novel “two-wave paradigm,” upon the initial transient PM-generated cAMP wave, a sustained second wave is observed following agonist-induced receptor internalization into the endocytic compartment (27–33). This temporal bias might convey informational content if cells are able to discriminate cAMP production from different sources and trigger unique biological outcomes differentially associated with these two phases. In this context, a sustained cAMP elevation was reported to be specifically required in several physiological responses, such as chronic inflammation and pain (34–37), to resume meiosis in the oocyte (38), and several reports indicate its role in cAMP-dependent nuclear transcription (30, 31, 39–44). Similarly, internalization-mediated sustained cAMP elevation can aid in producing stable responses to pulsatile or low-concentration hormones such as PTH. In this respect, fast cytosolic and nuclear cAMP elevations were observed upon the synergistic action of adrenergic and PTHR receptors in an internalization-dependent manner (39). More conclusively, it was recently demonstrated that only a photoactivated bacterial cyclase (bPAC) targeted to the outer mitochondria or endosome but not to the PM can induce a light-dependent CREB phosphorylation and nuclear transcription (42). Thus, it is becoming clear that endocytosis, via altering the subcellular location of cAMP production rather than changing the total amount of cAMP produced, might facilitate the selective activation of distinct PKA pools (40, 43). Furthermore, recent studies suggest the existence of a pool of PKA holoenzyme in the nucleus (39, 45, 46), adding another challenge to the classical cAMP model.

The existence of a buffering capacity (47, 48) and of PDE nanodomains (47, 49) at different cellular locations can explain the “barriers” that prevent cAMP produced at different locations from transducing its full repertoire of downstream effects; for example, it is known that in some cells PM-generated cAMP is unable to reach the nuclear compartment (50), unless PDE activity is inhibited (42). Moreover, the kinetic discrepancies between nuclear cAMP accumulation and nuclear PKA activation also indicated the existence of cAMP nanodomains where AKAP-PKA-PDE complexes constrain cAMP levels and control nuclear PKA activation (45). Thus, despite the controversy of whether cAMP diffusion or PKA-C translocation represents the rate-limiting step, it is becoming increasingly clear that the location, localization, and duration of signals are key factors determining nuclear PKA activation and cAMP-dependent transcription. However, whether cAMP diffuses from the cytosol or is synthesized locally in the nucleus is still unknown.

In the present study, we demonstrate using a combination of pharmacological, genetic, and optogenetic manipulations that local sAC activation is the only source of TSH-mediated nuclear cAMP production/elevation. While sAC inhibition minimally affected the cytosolic cAMP levels, it blunted nuclear cAMP accumulation and PKA activation. Moreover, our results show that sAC-mediated nuclear accumulation is not only necessary but sufficient and rate-limiting for cAMP-dependent proliferation.

Results

TSH increases Nuclear cAMP in an sAC-dependent Manner.

To monitor cAMP dynamics in live cells, we exploited the TSH/PCCL3 thyroid model system we have extensively used in the past (18, 19, 51–54). Real-time cAMP recordings were performed by transfecting PCCL3 thyroid follicular cells with cytosolic and nuclear-targeted FRET-based cAMP sensors, as we reported before (52) (SI Appendix, Fig. S1 A and B). As shown in Fig. 1 A and B, TSH stimulated a sustained cAMP increase in both cytosolic and nuclear compartments. Nuclear events are frequently associated with a sustained elevation of cytosolic cAMP that is dependent on receptor-mediated endocytosis. Accordingly, pharmacological (Dyngo-4a and Dynasore) and genetic (dn K44A) dynamin inhibitors blocked the TSH-mediated sustained phase in a dose-dependent manner and blunted nuclear cAMP accumulation (Fig. 1C and SI Appendix, Fig. S2 A–G). Similarly, barbadin, a novel dynamin-independent endocytosis inhibitor that targets β-arrestin/AP2 (55) only affected the TSH-mediated sustained cytosolic phase and nuclear cAMP accumulation (Fig. 1D and SI Appendix, Fig. S2 F and G). None of the dynamin inhibitors affected the cAMP response to direct activation of sAC using bicarbonate (SI Appendix, Fig. S3 A and B).

Fig. 1.

Fig. 1.

TSH elevates nuclear cAMP in an sAC-dependent manner. Real-time FRET-based measurements of cAMP levels using the NLS-H188 (nuclear) and H188 (cytosolic) sensors in live PCCL3 cells. FRET ratios were normalized to the maximal response to forskolin (20 μM) [cAMP (% of FK)]. Nuclear (A) and cytosolic (B) cAMP measurements of cells stimulated with TSH (1 mIU/mL). Nuclear (Left) and cytosolic (Right) cAMP measurements of cells preincubated for 15 min with Dyngo-4a (D4a, 30 μM) (C), barbadin (Barba, 100 μM) (D), or vehicle (Veh; DMSO). Nuclear (E) and cytosolic (F) cAMP measurements after 30 min of incubation with an sAC inhibitor (LRE1; 100 μM) or vehicle (Veh; DMSO). Quantitative analysis of the same data (E and F) as the % of their respective controls after 15 min of incubation with TSH (G). Concentration-dependent inhibition of the TSH response by LRE1. Measurements shown in this panel were performed with the NLS-H188 (nuclear) sensor and are shown as the % of the maximum response to TSH (H). Cyclase activity and cAMP steady-state measurements (pmol/mL) were performed after labeling the cellular pool of ATP with [3H]-adenine in TSH-stimulated (+) cells or unstimulated (−) cells pretreated either with vehicle (Veh; DMSO), KH7 (100 μM), or LRE1 (100 μM) (I). Data are expressed as mean ± SEM (for n cells/samples and independent experiments, see Statistics). Significance was tested using one-way ANOVA with Tukey multiple comparison tests (*P < 0.05; **P < 0.01; ****P < 0.0001; ns, not significant).

The increase in nuclear cAMP could represent diffusion from the cytosol or local synthesis by nuclear sAC. sAC is expressed in PCCL3 cells, as evaluated by immunoblotting and immunofluorescence (IF), confirming its presence in the nucleus (SI Appendix, Fig. S4A). To evaluate the role of sAC in TSH-mediated nuclear cAMP accumulation, we preincubated cells with LRE1, a selective sAC inhibitor that does not affect the activity of tmACs (56). While LRE1 minimally affected the cytosolic component, it significantly inhibited nuclear cAMP accumulation (Fig. 1 E–G and SI Appendix, Fig. S4C). Dose-response experiments showed that LRE1 inhibits nuclear cAMP signals with an EC50 ~ 18 µM (Fig. 1H and SI Appendix, Fig. S4D). Importantly, LRE1 preincubation did not affect the cAMP response to FK confirming its specificity for sAC (SI Appendix, Fig. S4 E and F) To validate the FRET results, total cAMP was assessed biochemically from cell lysates preincubated with LRE1 and KH7, another sAC selective inhibitor (57), confirming a component of sAC activity in TSH-mediated total cAMP accumulation (Fig. 1I). Thus, these combined results indicate that TSH stimulation triggers a nuclear sAC-mediated cAMP accumulation that is dependent on receptor internalization.

sAC Activity Is Required and Rate-Limiting for Cell Proliferation.

Next, we decided to test whether sAC inhibition has an impact on TSH-mediated cell proliferation. Pharmacological inhibition of sAC by LRE1 or KH7 blocked cell proliferation, assessed by both 3H-thymidine and BrdU incorporation assays (Fig. 2A). To confirm the pharmacological results, we generated an shRNA for rat sAC. sh-sAC-mediated sAC downregulation but not sh-Vector blocked TSH-mediated cell proliferation (Fig. 2B). sAC 1-469 (sACt) is a truncated and highly active soluble cyclase variant (58). Mutations were introduced to generate a sh-resistant sACt (sACtR), and IF staining confirmed both sACtR and sACt are present in cytosol and nucleus (SI Appendix, Fig. S5 A and B); however, only expression of sACtR but not sACt was able to rescue sh-sAC-mediated inhibition (Fig. 2B). Interestingly, expression of sACtR/sACt consistently showed a proliferative response in TSH-stimulated samples (~60% BrdU/tag) above the usual values observed in non-transfected or sh-vector controls (~30 to 40% BrdU/tag). This observation prompted us to study this effect in more detail confirming that expression of sACtR/sACt increased TSH-mediated cell proliferation in a dose-dependent manner without losing the sensitivity to LRE1 (Fig. 2C). Moreover, consistent with the pharmacological inhibition by LRE1, sAC knockdown, and sACt, overexpression affected TSH-mediated nuclear cAMP accumulation without interfering with the cytosolic cAMP response (Fig. 2 D and E and SI Appendix, Fig. S5C). Thus, these results confirmed that sAC activity is required for the TSH-mediated proliferative response and suggest that local sAC-generated cAMP signals in the nucleus could represent a rate-limiting step for cell proliferation.

Fig. 2.

Fig. 2.

sAC activation is necessary and rate-limiting for G1/S progression. (A) Concentration-dependent inhibition of the TSH-triggered (1 mIU/mL) proliferation in PCCL3 cells by KH7, KH7.15, and LRE1 (30 min preincubation). Proliferation was assessed by 3H-thymidine (Left) or BrdU (Right) incorporation in the presence of 5% FBS as a co-mitogen. BrdU data are expressed as % of BrdU+ nuclei among the DAPI+ nuclei. (B) Cells were transfected with pSiren-red-sh-sAC1 (sh-sAC), empty vector (sh-Vec), sACt, or an sh-resistant sACt (sACtR). BrdU data are expressed as % of BrdU+ nuclei in the dsRed+ population. Broken lines represent the average %BrdU/DAPI values of control (~10%) and TSH-stimulated parental cells (~40%). (C) Cells were transfected with increasing doses (25, 50, 100, 200, and 400 ng) of sACt/sACtR plasmids, and proliferation was assessed using BrdU incorporation in the presence of vehicle (Veh; DMSO) / LRE1 (100 μM) (Left), sh-Vec / sh-sAC (Middle), or sh-sAC (Right). (D) Real-time FRET-based measurements of cAMP levels using the NLS-H188 (nuclear; Left) and H188 (cytosolic; Right) sensors in live PCCL3 cells. Cells were transfected with sACt, sh-sAC, or sh-Vec). Quantitative analysis of the same values shown in panel D after 15 min of incubation with TSH (E). FRET ratios were normalized to the maximal response to forskolin (20 μM) [cAMP (% of FK)]. Data are expressed as mean ± SEM (for n cells/samples and independent experiments, see statistics). Significance was tested using one-way ANOVA with Tukey multiple comparison tests (*P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; ns, not significant).

Nuclear sAC Activity Is the Rate-Limiting Step for Cell Proliferation.

To assess whether sAC expression in the nuclear compartment is relevant for cell proliferation, we transfected PCCL3 cells with either nuclear (NLS) or PM (Lyn) targeted versions of a mCherry-tagged sACt (46). Like the non-targeted version of sACt (Fig. 2B), NLS-sACt but not Lyn-sACt showed a dose-dependent effect on TSH-mediated proliferation (Fig. 3A and SI Appendix, Fig. S6A). Like LRE1 and sh-sAC, CRISPR/Cas9-mediated sAC deletion (SI Appendix, Fig. S6 B–D) blocked TSH-mediated proliferation and reduced nuclear but not cytosolic cAMP dynamics (Fig. 3 B and C). Only an sg-resistant NLS-sACt (NLS-sACtR) was able to rescue sg-sAC-mediated inhibition, and like untagged sACtR/sACt (Fig. 2B), NLS-sACtR/NLS-sACt expression consistently showed a high proliferative response in TSH-stimulated cells (Fig. 3B). Thus, these results show that a nuclear-targeted sAC can sustain cell proliferation even in an sAC-knockdown context and indicate that nuclear sAC activation is a limiting factor controlling TSH-mediated proliferation.

Fig. 3.

Fig. 3.

Nuclear-targeted sACt stimulates proliferation in a dose-dependent manner. (A) PCCL3 cells were transfected with increasing doses of the nuclear-targeted NLS-mCherry-sACt (Left) or the membrane-targeted Lyn-mCherry-sACt constructs (Right) and stimulated with TSH (1 mIU/mL). Proliferation is expressed as the % of BrdU+ nuclei in the mCherry+ or GFP+ populations. (B) Proliferation in cells expressing the NLS-mCherry-sACt or Lyn-mCherry-sACt plasmids (Left). CRISPR/Cas9-mediated sAC deletion: cells were transfected TLCV2-sg243 (sAC-KO) or TLCV2-vector. Rescue experiments: cells were transfected with sg-resistant NLS-mCherry-sACtR, sg-sensitive NLS-mCherry-sACt, Lyn-mCherry-sACt, or Lyn-mCherry-sACtR (Right). (C) Real-time FRET-based measurements of cAMP levels using the NLS-H188 (nuclear) and H188 (cytosolic) sensors in live PCCL3 cells. Nuclear (Left) and cytosolic (middle panel) cAMP measurements in TSH-stimulated (1 mIU/mL) cells transfected with TLCV2-vector (TLCV2) or TLCV2-sg243 (sAC-KO). Quantitative analysis of cAMP values after 15 min of TSH stimulation (Right). FRET ratios were normalized to the maximal response to forskolin (20 μM) [cAMP (% of FK)]. Data are expressed as mean ± SEM (for n cells/samples and independent experiments, see statistics). Significance was tested using one-way ANOVA with Tukey multiple comparison tests (**P < 0.01; ***P < 0.001; ****P < 0.0001; ns, not significant).

sAC Inhibition Cannot Be Rescued by a Membrane-Permeable cAMP Analog.

8-Bromoadenosine 3′,5′-cyclic monophosphate (8-Br-cAMP) is a membrane-permeable cAMP analog capable of activating both Epac1 and PKA (59), cAMP effectors involved in the TSH mitogenic response (19). Accordingly, 8-Br-cAMP mimicked TSH effects and was sufficient to trigger proliferation in PCCL3 cells assessed by both 3H-thymidine and BrdU incorporation assays (Fig. 4A). Although we initially reasoned that by mimicking the cyclase reaction product, 8-Br-cAMP should bypass the negative effects of sAC inhibition, preincubation of cells with LRE1 or KH7 consistently reduced cell proliferation (Fig. 4B). Although 8-Br-cAMP incubation was able to raise nuclear cAMP levels, this effect was totally dependent on nuclear sAC; sAC downregulation (sh-sAC) and LRE1-mediated sAC inhibition blocked 8-Br-cAMP action. However, incubation with FK plus 3-isobutyl-1-methylxanthine (IBMX; an inhibitor of most PDE isoforms) generated further increases in nuclear cAMP in an LRE1-resistant manner (Fig. 4 C–E). Next, we took advantage of the rat hepatoma HC-1 cell line that has no detectable tmAC activity and shows very low basal cAMP levels (60). These cells do not respond either to GsPCR ligands or FK unless transfected with a tmAC (SI Appendix, Fig. S7 A and B) (60, 61). However, HC-1 cells endogenously express nuclear sAC as manifested by their LRE1-sensitive cAMP response to bicarbonate (SI Appendix, Fig. S7 C and D), making them a suitable model to dissect the mechanism of action of 8-Br-cAMP. Incubation with 8-Br-cAMP manifests a slow increase in the cytosolic cAMP levels that is almost absent in the nucleus for at least 30 min (SI Appendix, Fig. S7 F and G). However, upon AC9 transfection, which in the absence of stimulation does not increase basal cAMP levels (SI Appendix, Fig. S7E), 8-Br-cAMP incubation dramatically increases the rate of cytosolic cAMP accumulation with a kinetic profile comparable to an agonist-mediated sustained cAMP response (SI Appendix, Fig. S7F). Moreover, 8-Br-cAMP incubation in AC9-transfected cells reveals a nuclear LRE1-sensitive accumulation (SI Appendix, Fig. S7H). Therefore, these combined results show that 8-Br-cAMP itself is unable to reach the nuclear compartment even at concentrations where it effectively stimulates cell proliferation in PCCL3 cells. These results indicate that its effects, like those of TSH, require a sustained cAMP-dependent activation of nuclear sAC, a necessary factor for cell proliferation.

Fig. 4.

Fig. 4.

8-Br-cAMP requires an active sAC to stimulate proliferation. (A) Proliferation assessment of PCCL3 cells by stimulation with increasing doses of 8-Br-cAMP. 3H-thymidine (Left) and BrdU incorporation (Right) measurements. BrdU data are expressed as % of BrdU+ nuclei among the DAPI+ nuclei. (B) Cells were incubated with 3 mM 8-Br-cAMP and increasing doses of LRE1. Proliferation was assessed by 3H-thymidine (Left) or BrdU incorporation (middle panel). Cells were incubated with 8-Br-cAMP (0.3 or 3 mM) and increasing doses of KH7 (Right). (C) Real-time FRET-based measurements of cAMP levels using the NLS-H208 (nuclear) sensor. Traces are the averaged FRET ratios normalized to the resting values (R/R0). cAMP measurements in cells preincubated with vehicle (Veh; DMSO, Left) or LRE1 (100 μM; Right). Cells were stimulated sequentially with 8-Br-cAMP (3 mM) and FK (20 μM) plus IBMX (250 μM). (D) cAMP measurements in cells transfected with pSiren-red-sh-sAC1 (sh-sAC). (E) Quantitative analysis data shown in panels C and D after 8 min of 8-Br-cAMP incubation (shown as % of Vehicle). Data are expressed as mean ± SEM (for n cells/samples and independent experiments, see Statistics). Significance was tested using one-way ANOVA with Tukey multiple comparison tests (****P < 0.0001; ns, not significant).

Nuclear sAC Is Required for Local PKA Activation and CREB Phosphorylation.

PKA and its substrate, and CREB are the immediate downstream players in the cAMP pathway required for cell proliferation of PCCL3 cells (19). To evaluate if sAC is the source of cAMP activating these effectors, we first assessed if nuclear PKA activity increases after TSHR activation. In cells transfected with NLS-AKAR4, a nuclear-targeted FRET-based PKA activity sensor (46), TSH incubation elicited a rapid increase in nuclear PKA activity, with a fast initial peak consistent with the nuclear cAMP kinetics, followed by a slower sustained phase (Fig. 5A and SI Appendix, Fig. S8A). Both pharmacological and downregulation experiments performed with LRE1 and sh-sAC, respectively, showed inhibition of local PKA activity, mainly affecting the fast initial peak (Fig. 5 A–C). To evaluate CREB phosphorylation, cells were starved for 20 h in a TSH-free and reduced FBS (0.5%) medium and then stimulated with TSH at saturating concentrations. pCREB levels were evaluated at different times by IF and immunoblotting, showing a positive signal in most cells (~80%) after 10 min of TSH incubation (Fig. 5D and SI Appendix, Fig. S8 B and C). Pharmacological (LRE1) and genetic (sh-sAC) inhibition of sAC impeded CREB phosphorylation (Fig. 5 D–F and SI Appendix, Fig. S8 B–D). These results show that nuclear sAC activity is essential for the activation of two successive elements of the cAMP pathway, PKA and CREB. In sum, the evidence presented so far strongly suggests that the levels of cAMP in the nuclear compartment determine G1/S progression.

Fig. 5.

Fig. 5.

Nuclear PKA and pCREB are activated in a sAC-sensitive manner. Real-time FRET-based measurements of nuclear PKA activity levels using the NLS-AKAR4 sensor in live PCCL3 cells. Traces are the normalized FRET ratios (R/R0) in cells stimulated with TSH (1 mIU/mL). (A) Nuclear PKA activity measurements in cells preincubated with either vehicle (Veh; DMSO) or LRE1 (100 μM) 30 min before stimulation. (B) PKA activity measurements in cells transfected with either sh-sAC or sh-Vec. (C) Quantitative analysis of either maximum (Max) or sustained (Sust.) R/R0 values in the initial 2 min of stimulation. The sustained cAMP measurements are the R/R0 values after 5 min of stimulation. (D) CREB phosphorylation was assessed by IF at 0, 3, 5, 10, 20, 30, 45, and 60 min after stimulation. Data are the % of pCREB+ nuclei among the DAPI+ nuclei at each time point. Cells were preincubated with vehicle (Veh, DMSO) or LRE (100 μM). (E) CREB phosphorylation in cells transfected with either sh-Vec or sh-sAC. Data are the % of pCREB+ nuclei among the dsRed+ nuclei (F) Quantitative analysis of nuclear CREB phosphorylation after 60 min of TSH stimulation. Data are the % of pCREB+ nuclei among DAPI or dsRed+ nuclei at each time point. Data are expressed as mean ± SEM (for n cells/samples and independent experiments, see Statistics). Significance was tested using one-way ANOVA with Tukey multiple comparison tests (*P < 0.05; **P < 0.01; ****P < 0.0001; ns, not significant).

An Internalization-Dependent Calcium Increase Controls Nuclear sAC Activation.

Compelling evidence shows that sAC activity can be directly stimulated by Ca2+ increases (62, 63). To evaluate if Ca2+ plays a role in nuclear sAC activation, we first assessed if TSH was able to increase Ca2+ levels. Simultaneous measurements of Ca2+ levels in both the nuclear and cytosolic compartments using compatible FRET sensors showed that TSH stimulation generates sustained Ca2+ elevations in both compartments. These elevations were blocked by preincubation with Dyngo-4a, showing their dependence on internalization (Fig. 6A). Preincubation of cells with the membrane-permeable Ca2+ chelator BAPTA-AM blunted not only the nuclear TSH-triggered Ca2+ increase but also the nuclear cAMP elevation (Fig. 6B and SI Appendix, Fig. S9A). Utilizing pharmacological inhibitors, we found that while both the cAMP and the Ca2+ responses were insensitive to JTV-519 fumarate, a ryanodine receptor (RyR) inhibitor (64), they were sensitive to the inhibition of phospholipase C (PLC) and inositol 1,4,5-trisphosphate receptor (InsP3R) [U73122 and Xestospongin C (65), respectively] (Fig. 6 C and D and SI Appendix, Fig. S9 B and C). Importantly, FR-900359, a cyclic depsipeptide that selectively inhibits Gαq (66), did not affect Ca2+ or cAMP responses (Fig. 6E and SI Appendix, Fig. S9D). Thus, we concluded that the nuclear cAMP response depends on the PLC-InsP3-InsP3R pathway, but it is not mediated by the canonical Gαq-PLCβ pathway. Next, to determine the relative involvement of nuclear and/or cytosolic InsP3 elevations, we used InsP3-buffer constructs that contain the binding domain of type I human InsP3 receptor (67–69). Both cAMP and Ca2+ elevations were nearly abolished in cells expressing the untargeted but not the nuclear-targeted InsP3-buffer construct (70) (Fig. 6 F and G and SI Appendix, Fig. S9 E and F). Finally, we measured Ca2+ and cAMP dynamics in cells transfected with nuclear- and cytosolic-targeted constructs of the high-affinity Ca2+-binding protein parvalbumin [PV; PV-dsRed-NLS and PV-dsRed-NES (71)]. Both constructs were able to suppress the TSH-triggered nuclear and cytosolic Ca2+ elevations which in turn, lead to the inhibition of the cAMP response (Fig. 6 H–L and SI Appendix, Fig. S9 G and H). Thus, these combined results indicate that TSH triggers an internalization-dependent Gαq-independent elevation of cytosolic Ca2+. Given that in some cells the nucleus contains all the machinery required for an InsP3R-mediated Ca2+ release (i.e., intranuclear PLC and InsP3R isoforms), experiments with PV and InsP3-buffer constructs strongly suggest that activation of the PLC-InsP3-InsP3R pathway and Ca2+ release events from the endoplasmic reticulum (ER) occur in the cytosol. Contrary to cAMP, Ca2+ can diffuse into the nucleus and mediate the activation of sAC and downstream events.

Fig. 6.

Fig. 6.

TSH triggers Ca2+ signaling using the PLC-InsP3-InsP3R pathway. Simultaneous intensiometric measurements of nuclear (NLS-R-GECO) and cytosolic (GCaMP6f-NES) Ca2+ in live PCCL3 cells. Traces are the normalized fluorescence values (F/F0) in cells stimulated with TSH (1 mIU/mL). Cells were preincubated with vehicle (Veh; DMSO) or Dyngo-4a (D4a; 30 µM). At the end of the experiment, the Ca2+ ionophore ionomycin (Iono, 10 μM) was introduced. Real-time FRET-based measurements of cAMP levels using the NLS-H188 (nuclear) sensor. Cells were preincubated with BAPTA-AM (100 μM; B), U17322 (20 μM; C), Xestospongin C (Xesto C, 20 μM; C), JTV-019 fumarate (10 μM; D), and FR-900359 (1 μM; E), or vehicle (Veh; DMSO except for FR-900359: methanol). Cells were transfected with non-targeted (InsP3-Bf; F) or nuclear-targeted (InsP3-Bf-NLS; G) InsP3-buffer constructs. Cells were also transfected with the high Ca2+ affinity cytosolic-targeted (PV-NES; H) or nuclear-targeted (PV-NLS; I) parvalbumin constructs.

Nuclear but Not Cytosolic cAMP Levels Control G1/S Progression.

To assess whether nuclear cAMP levels alone can control cell cycle progression, we exploited bPAC-nLuc, an optogenetic tool recently developed in our laboratory (52, 72), that combines a blue light-activated (445 nm) adenylyl cyclase (bPAC) and luciferase (nLuc). Stably transfected NLS-bPAC-nLuc cells responded to TSH as well as to Fz-4377 (a degradation-resistant substrate for nLuc derived from Furimazine) and blue light stimulation (see Methods). Compared to TSH, and like our results with the untargeted and NLS-sACt constructs (Figs. 2B and 3B), proliferation rose to 60% in cells stimulated with Fz-4377 or blue light (Fig. 7A). Although preincubation of cells with LRE1 consistently blocked proliferation triggered by NLS-sACt, the sAC inhibitor did not affect NLS-bPAC-nLuc stimulation (Fig. 7B). Consistent with its inhibitory action on nuclear cAMP and Ca2+ dynamics (SI Appendix, Figs. S6 H and I and S9H), PV-NLS also generated a decrease in cell proliferation that could be rescued by NLS-bPAC-nLuc stimulation (Fig. 7E). Moreover, a single blue light pulse (0.5 s) triggered CREB phosphorylation, but, unlike TSH, it was insensitive to LRE1 (SI Appendix, Fig. S10 A and B). These results demonstrated that NLS-bPAC-nLuc-mediated nuclear cAMP generation is sufficient for proliferation in an LRE1-insensitive manner. However, even though we confirmed that NLS-bPAC-nLuc expression is restricted to the nuclear compartment and that it generates cAMP signals in the nucleus, we also found a minor cAMP “leak” toward the cytosol (SI Appendix, Fig. S11 A and B) (72). To rule out that this leak was responsible for activating one or more cytosolic effectors, we utilized ΔRI-PDE8, a PDE8-derived construct with an increased hydrolytic activity (73) that does not bind to AKAPs (SI Appendix, Fig. S10D) (see Methods). We reasoned that targeting ∆RI-PDE8 to the ER membrane facing the cytosol with a P450 sequence (74) will rapidly inactivate any cAMP diffusing out of the nucleus into the cytosol. Both the nuclear (NLS) and the ER-cytosolic (P450) targeted versions of ∆RI-PDE8 were successful in specifically blocking cAMP local elevations without affecting the other compartment response (SI Appendix, Fig. S10C). In addition, to rule out that the cAMP “leak” was not actually cytosolic NLS-bPAC-nLuc expression, cells were photostimulated with a 445 nm laser controlled by a point scanning system that allowed us to stimulate a small area of ~1 μm2 within the cytoplasm (SI Appendix, Fig. S10E) (see Methods). While laser pulses directed to the nuclear area were able to generate cAMP elevations (detected both in the nuclear and cytosolic compartments), pulses directed to the cytosol of the same cells were not (SI Appendix, Fig. S11 A and B). In this context, NLS- and P450-∆RI-PDE8 expression successfully abolished nuclear and cytosolic cAMP elevations generated by nuclear-directed light pulses (SI Appendix, Fig. S11 C–E). Finally, while both ∆RI-PDE8 constructs were able to reduce proliferation in WT-PCCL3 cells, light-stimulated NLS-bPAC-nLuc expressing cells proliferated in the presence of P450-∆RI-PDE8 but not in the presence of NLS-∆RI-PDE8 (Fig. 7 D and E). These results conclusively demonstrate that in thyroid cells nuclear but not cytosolic cAMP is the key factor defining cell cycle progression.

Fig. 7.

Fig. 7.

Nuclear cAMP is sufficient for cell proliferation. (A) PCCL3 cells were stably transfected with NLS-bPAC-nLuc, and proliferation was assessed using BrdU incorporation. In the absence of light stimulation, proliferation was TSH-dependent (1 mIU/mL). In the absence of TSH, cells proliferated when exposed to chemical stimulation (Fz-4377; Fz, 1:1,000) or light (440 nm, 0.5s, 15 min interval) stimulation for 24 h. (B) Cells were transiently transfected with NLS-mCherry-sACt and stimulated with TSH or stably transfected with NLS-bPAC-nLuc and stimulated with light (440 nm, 0.5 s, 15 min interval) in the absence of TSH. Proliferation was assessed in the presence of vehicle (Veh; DMSO) or LRE1 (100 μM). (C) WT-PCCL3 cells were transfected with the NLS-∆RI-PDE8, P450-∆RI-PDE8 or empty vector (Vec), and proliferation was assessed in the presence of TSH. Cells stably transfected with NLS-bPAC-nLuc were transiently transfected with an empty vector (Vec), NLS-∆RI-PDE8, or P450-∆RI-PDE8 constructs and stimulated with light (440 nm, 0.5s, 15 min interval) (D). Experiments were repeated in the presence of the nuclear-targeted (PV-NLS) parvalbumin constructs in cells stimulated with TSH or Light (E). Data are the % of pCREB+ nuclei among DAPI+/myc+/mCh+ nuclei. Data are expressed as mean ± SEM (for n cells/samples and independent experiments, see Statistics). Significance was tested using one-way ANOVA with Tukey multiple comparison tests (****P < 0.0001; ns, not significant).

Discussion

Using a combination of pharmacological, genetic, and optogenetic approaches, we show that agonist-dependent TSHR-Gs-tmAC activation at the PM, in an internalization-dependent manner, results in fast nuclear sAC-mediated cAMP production, PKA activation, and CREB phosphorylation, critical for maintaining cell proliferation. We also show that small variations in the nuclear expression levels of sAC have a large impact on the proliferative response, consistent with nuclear sAC activation representing a rate-limiting step. Furthermore, our findings show that an elevation of cAMP in the nucleus, independent of a cytosolic cAMP component, is sufficient to stimulate cell proliferation.

For many years, PKA-C translocation to the nucleus upon cAMP-mediated activation was thought to represent the rate-limiting step for subsequent nuclear transcriptional events. A diffusive mechanism was proposed (75) and recently estimated to represent ~1 to 2% of total cellular PKA-C (40). However, its slower kinetics compared to nuclear cAMP accumulation and PKA activation rates suggested that cAMP diffusion into the nucleus rather than PKA-C translocation might represent the rate-limiting step, acting instead on a local nuclear-resident PKA pool (39). However, our 8-Br-cAMP results indicate that despite its small molecular weight and diffusivity, cAMP is not itself entering the nucleus, it is most likely restricted in the cytosol by binding and/or PDE activity. Instead, we propose that in PCCL3 cells, intracellularly synthesized cAMP is rather required to mobilize Ca2+ as an intermediate regulator responsible for an LRE1-sensitive nuclear sAC activation. Only upon non-physiological strong stimulation with FK and/or IBMX, cAMP concentration overcomes the buffering capacity and/or PDE nanodomains, allowing it to accumulate in the nucleus in an LRE1-insensitive manner.

Upon activation, nuclear PKA activity is terminated by binding to PKI, resulting in PKA-C inhibition and nuclear export (76). TSH-mediated nuclear PKA activation showed a fast sAC-dependent initial phase, followed by a delayed sAC-independent sustained phase (Fig. 5 A–C). Whether this delayed phase represents the slow PKA-C translocation responsible to replenish the local nuclear PKA pool deserves further investigation.

However, our combined results utilizing sAC inhibition/downregulation and the effects of 8-Br-cAMP clearly indicate that in thyroid cells, neither PKA-C translocation nor cAMP diffusion, but rather a nuclear sAC activation is the rate-limiting step responsible for the fast nuclear cAMP accumulation, PKA activation, and CREB phosphorylation.

Recent works have shown that sAC may be an alternative cAMP source amplifying the GsPCR signaling in many cell types via Ca2+ and/or HCO3−. Prostaglandins via EP1 and EP4 receptors in bronchial cells can activate sAC in a mechanism that depends on Ca2+ but not HCO3− (77, 78). Corticotropin-releasing hormone receptor 1 (CRHR1) in hippocampal neurons can activate sAC in an internalization-dependent manner, generating a sustained cAMP signal; CRH-mediated sAC activation depends on both Ca2+ and HCO3– (79). Follicle-stimulating hormone receptor (FSHR) activation in the granulosa cells in the ovary stimulates sAC in a mechanism that depends on Cystic Fibrosis Transmembrane Regulator (CFTR)-mediated HCO3– influx (80). Similarly, luteinizing hormone receptor (LHR) stimulation in testicular Leydig and Sertoli cells activated sAC, in a mechanism proposed to be dependent on CFTR/HCO3− (81), consistent with the involvement of a CFTR/HCO3−/sAC-dependent cAMP signaling in spermatogenesis (82). Interestingly, Epac-Rap has been linked to both CFTR (77, 83–85) and Ca2+ influx and mobilization from intracellular stores (reviewed in ref. 86). Our studies with TSHR are consistent with Ca2+ as the main intracellular factor regulating nuclear sAC-dependent cAMP accumulation using a Gαq-independent PLC-InsP3-InsP3R pathway. Among the PLC isoforms, a likely candidate is PLCε, a GPCR-activated isoform that is modulated by Rap1-GTP, that binds directly to and allosterically modulates PLCε (87), but not Gαq (88, 89). Furthermore, it was reported that PLCε resides in perinuclear membranes near the nuclear envelope (90, 91) and has previously been shown to mediate Epac1-Rap1 stimulatory effects on InsP3 production and Ca2+ release (92–95).

Finally, in this work, we also demonstrated that cAMP generated in the nucleus is sufficient to trigger cell proliferation. Utilizing novel compartment-specific cAMP actuators to synthesize (NLS-bPAC-nLuc) or hydrolyze (ΔRI-PDE8) cAMP, we show that light-dependent nuclear cAMP synthesis is sufficient for CREB phosphorylation and G1/S entry in a sAC-independent manner. Moreover, while the expression of a cytosolic ΔRI-PDE8 blocked TSH-mediated cell proliferation, it was unable to affect light-dependent proliferation triggered by NLS-bPAC-nLuc, thus ruling out concerns of a putative cAMP “leak” activating cytosolic effectors and stimulating proliferation.

Therefore, we propose that a nuclear PKA pool is rapidly activated downstream of nuclear sAC activation, thanks to local production of cAMP and without any diffusion of cAMP into the nucleus. This sAC-mediated nuclear cAMP production is sufficient to sustain proliferation regardless of upstream events occurring in the membrane or cytosolic compartments.

Based on our results on the TSHR/thyroid system, we propose a new “three-wave model of cAMP signaling” (Fig. 8). Ligand-mediated GsPCR-Gαs-tmAC activation is responsible for the initial canonical cAMP synthesis generated at the PM (first cAMP wave). The internalization of the signaling complex allows the sustained production of cAMP away from the PM. Our combined results suggest that cAMP generated from this endocytic compartment (second cAMP wave) facilitates the mobilization of Ca2+ that, unlike cytosolic cAMP, can reach the nuclear compartment and rapidly activates nuclear sAC. This nuclear sAC-mediated cAMP production (third cAMP wave) quickly activates a local PKA pool which leads to CREB phosphorylation, transcription of cAMP-dependent genes, and finally cell proliferation. Future studies are needed to test whether this three-wave model is present downstream of other GsPCR-activated pathways. Recent findings on the complexity of intracellular GPCR signaling and the therapeutic potential of cAMP production outside the PM highlight the therapeutic importance of seeking new ways to target these signaling pathways for the development of drugs with improved specificity and efficacy (34, 43, 96, 97).

Fig. 8.

Fig. 8.

Soluble cyclase-mediated nuclear cAMP synthesis is required and sufficient for cell proliferation. Ligand-mediated GPCR activation triggers a Gαs-mediated cAMP synthesis by one or more tmACs generating the first cAMP wave in the PM compartment. Ligand binding also triggers the internalization of the signaling complex that drives cAMP production into the endocytic compartment. Our combined results suggest that cAMP generated in the endocytic compartment (second wave) triggers PLC-mediated Ca2+ release from the ER through the InsP3 receptor. Unlike cytosolic cAMP, Ca2+ can reach the nuclear compartment and rapidly activate local sAC. Local cAMP production (third wave) quickly activates a local PKA pool which leads to CREB phosphorylation activating the transcription of cAMP-dependent genes and enhancing cell proliferation. Our results also suggest that proliferation can be sustained solely by the artificial elevation of nuclear cAMP (bPAC-nLuc), independent of the events occurring in the membrane or the cytosolic compartments.

Methods

Materials.

Forskolin (F6886), IBMX (I7018), LRE1 (SML1857), 8-Br-cAMP (B7880), BrdU (B5002), dynasore (D7693), (−)-isoproterenol (I6504), barbadin (SML3127), BAPTA-AM (A1076), ionomycin (I0634), and Dowex–Alumina resins were from Sigma. Dyngo-4a (D4a; ab120689) was from Abcam. [2,8-3H]-Adenine (NET063001MC) was from Perkin Elmer. TSH (TSH-1315B) was from Creative Biomart. U73122 (1268), JTV-519 fumarate (4564), and Xestospongin C (1280) were from Tocris. FR-900359 (33666) was from Cayman Chemical. The Nano-Glo Endurazine Live Cell Substrate prototype (Fz-4377), a degradation-resistant derivative of Furimazine, was from Promega. KH7 and its inactive analog KH7.15 were provided by Drs Buck-Levin (Cornell).

Antibodies.

See SI Appendix, Supporting Methods.

DNA Constructs.

The cAMP FRET sensors H188 and H208 (YFP-EPAC-Q270E-mScarletI) were kindly provided by Dr. Jalink and were reported before (52). NLS-H188 and NLS-H208 were constructed using PCR to subclone an SV40-NLS motif to the N-terminal by using HindIII. pcDNA3-AKAR4-NLS (Addgene plasmid #138217), pcDNA3-sACt-mCherry-NLS (Addgene plasmid #138214), and pcDNA3-Lyn-sACt-mCherry (Addgene plasmid #138216) were gifts from Dr. Jin Zhang. K44A HA-dynamin 1 pcDNA3.1 was a gift from Dr. Sandra Schmid (Addgene plasmid # 34683). CMV-NLS-R-GECO was a gift from Robert Campbell (Addgene plasmid #32462). pcDNA5-TO-PV-NES-DsRed (PV-NES; Addgene plasmid #16339) and pcDNA5-TO-PV-NLS-Dsred (PV-NLS; Addgene plasmid #16341) were a gift from Anton Bennet. The InsP3-buffer constructs were a gift from Dr. Péter Várnai. The GCaMP6f-NES sensor was a gift from Dr Robert Grosse.

The NLS-∆RI-PDE8 and P450-∆RI-PDE8 plasmids contain a deletion of aa1-74 in RI from the original template (73) and were generated by the addition of 3xSV40 NLS-FLAG and P450 2C1 ER (74) targeting-FLAG to their N termini, respectively. Expression was assessed with anti-FLAG antibodies. pcDNA3.0 AC2-HA was a gift from Dr. Cooper (Cambridge University). Flag-hAC9 was kindly provided by Lily Jiang (UT Southwestern). The shRNA-sAC(1 to 2), sh-scramble (sh-Vec), and expression plasmids for sACt and sACtR were described in (98) and provided by Dr. Muller (Northwestern University). sh-Vec and sh-sAC were transferred to pSIREN-DNR-dsRedExpress. sACt and sACtR were transferred to pCMV-myc.

Cell Lines and Transfections.

PCCL3, a normal TSH-dependent rat thyroid follicular cell line, was grown in Coon’s Media: Nutrient Mixture F-12 Ham (Coon’s modification; Sigma-Aldrich, F6636) supplemented with 2.68 g/L sodium bicarbonate, 5% fetal bovine serum (FBS; Corning, MT35011CV), 1% penicillin/streptomycin, 2 mM L-glutamine, insulin (1 μg/mL), apo-transferrin (5 μg/mL), hydrocortisone (1 nM), and thyroid-stimulating hormone (TSH 1 mIU/mL). The rat hepatoma clonal cell line HC1 (kindly provided by Dr. Elliot Ross, University of Texas Southwestern Medical Center) was grown in DMEM (Corning, 10013CV) supplemented with 10% FBS, penicillin (100 IU/L), and streptomycin (100 mg/L), and L-glutamine. Cells were grown to ~90% confluency before passaging every 2 to 4 d at 37 °C in 5% CO2, 95% humidified air. Transient transfections were performed using Lipofectamine 3000 Transfection kit (Invitrogen) for 24 h. NLS-bPAC-nLuc stable cell lines were generated by lentiviral infection with a multiplicity of infection (MOI) of 80 and 5 μg/mL of polybrene and selected with puromycin as described before (52).

Generation of sAC-KO Cells.

sAC-KO PCCL3 cells were generated by CRISPR/Cas9 genome editing system. Several sg sequences were identified with CHOPCHOP (https://chopchop.cbu.uib.no/). sgRNAs were synthesized and subcloned into the BsmBI site of the all-in-one (dox-inducible Cas9-2A-eGFP and constitutive U6 promoter) TLCV2-vector (Addgene #87360). sAC-targeted sgRNAs: sg243 to exon 2 of the C1 domain and sg396 to exon 4 of the C1 domain (SI Appendix, Supporting Methods). For lentivirus production, HEK293T cells were seeded on 10 cm tissue culture dishes and incubated until cells reached ~70% confluence. TLCV2, TLCV2-sg243, or TLCV2-sg396 constructs were mixed with packaging vectors pMD2.G and pCMV-delta-R8.2 and transfected using X-tremeGENE HP (Roche). The virus-containing medium was collected and filtered. Lentivirus was concentrated using the Lenti-X concentrator (TaKaRa). Cells were selected for 6 d in puromycin followed by 3 d of induction with doxycycline. Gene editing efficiency in the puro-resistant clones was assessed by a T7e assay (CRISPR Genomic Cleavage Detection Kit, Abm). The sg243-resistant sACt-mCherry plasmids were made by introducing the following (underlined) mutations (CTATTATATCTCCGCCATCGTC).

FRET and Intensiometric Measurements.

Cells were seeded on 25 mm glass coverslips and transfected with the H188, H208, NLS-H188, NLS-H208, or NLS-AKAR4 FRET-based sensors or the intensiometric GCaMP6f-NES and the NLS-R-GECO sensors. Transfected cells were given fresh media for 48 h and hormone starved for 3 h in Coon’s media with 5% FBS and lacking TSH, insulin, and hydrocortisone before measurements. Cells were washed once in PBS and imaged in OptiMEM media lacking phenol red (Gibco). Two microscope setups were used; Setup A: Olympus IX70 microscope equipped with a Till Polychrome V monochromator, a 60×/1.4 NA oil objective, and a Hamamatsu CCD camera (Photonics Model C4742-80-12AG; 8 × 8 binning). Setup B: Olympus IX83 Motorized two-deck Microscope equipped with a 6-line multi-LED Lumencor Spectra X, a Prior Emission Filter Wheel, Prior Proscan XY stage, an ORCA-Fusion Digital CMOS camera (C14440-20UP; 4 × 4 binning), a 40×/1.4 NA oil objective (UPLXAPO30X). Images were acquired every 5 or 10 s depending on the experiment, using Slidebook 6 software (Intelligent Imaging Innovations Inc.). The NLS-AKAR, H188, and NLS-H188 sensors were excited at 440 nm, and fluorescence was collected using emission filters 470/30 nm and 535/30 nm with a 69008bs dichroic (Chroma Technology Corp.). The H208 and NLS-H208 sensors were excited at 500 nm with emission filters 510/20 and 620/52 nm and two dichroic beam splitters: 468/526/596 (Semrock) or 69008bs (Chroma Technology Corp) for setups A and B, respectively. The GCaMP6f-NES and the NLS-R-GECO sensors were excited at 488 and 550 nm, and fluorescence was collected using emission filters 520/20 and 620/60, respectively, with an 89402 dichroic (Chroma Technology Corp). Changes in background-subtracted FRET ratios (R) were normalized to ratios at resting conditions (R/R0). In most of the cAMP experiments, FRET ratios were normalized to the maximal response of each cell after incubation with forskolin (20 μM). Changes in background-subtracted fluorescence measurements (F) were normalized to values at resting conditions (F/F0). No significant photobleaching was observed during the time lapses.

Optogenetic Stimulation.

Light stimulation was achieved using a custom-built, Arduino-controlled system capable of regulating the duration, frequency, and intensity of light exposure (52, 72). In some experiments, cells were stimulated with a solid-state laser illuminator (445 nm, LDI-7, 89 North) connected to a UGA-42 Geo (Rapp OptoElectronic) point scanning system that allowed us to simulate very small circular areas (~1 μm2) inside the cells (SI Appendix, Supporting Methods).

Adenylyl Cyclase Activity in Cells.

Labeling of the cellular ATP pool was performed by overnight incubation with 1 mCi/mL [3H]-adenine in complete Coon’s medium. The next day cells were washed twice and incubated for 1 h in Coon’s starvation medium. Cells were then stimulated with TSH together with either vehicle or inhibitors. Reactions were stopped in trichloroacetic acid (7.5% w/v). Product [3H]-cAMP was separated from the substrate [3H]-ATP by sequential column chromatography over Dowex and Alumina, as previously described (99).

IF and BrdU Labeling.

Cells were grown to 70% confluency on glass coverslips, incubated with Lipofectamine 3000 Transfection kit (Invitrogen) and the corresponding plasmids for 24 h Then after 24 to 48 h cells were made quiescent by TSH starvation in Coon’s (5% FBS) media for 16 h. Upon agonist stimulation (TSH; 1 mUI/mL) for 8 h, cells were labeled for 16 h with BrdU (Sigma, 100 µM). At the end of the labeling period, incorporated BrdU was detected by indirect IF. Unless otherwise noted, IF protocol started with fixation in 4% paraformaldehyde (10 min, room temperature) and permeabilization with 0.5% Triton X-100 (10 min, room temperature). After washing, cells were stained for 30 min at 37 °C with the primary antibody diluted in PBS/3% BSA/0.05% Tween 20 (see Antibodies section). After washing, samples were incubated for 30 min at 37 °C with the secondary antibody diluted in PBS/3% BSA/0.05% Tween 20 (see Antibodies section) and DAPI (DAPI 0.125 mg/mL, Invitrogen) in PBS/3% BSA/0.05% Tween 20. After extensive washes, samples were mounted in Vectashield Vibrance Mounting Medium (Vector Labs; H-1700-10). For BrdU experiments, a sheep anti-BrdU antibody was used in the presence of RQ1 DNase (Promega, 10 units/mL). and after washing with conjugated anti-sheep antibodies (see Antibodies section). Data are expressed as the % of BrdU+ cells among the total population (DAPI) or a particular population of cells expressing different fluorescent (dsRed, mCherry, GFP) or non-fluorescent (myc, FLAG) tags. The IF images were acquired in setups A or B described above or in an Olympus Fluoview FV1000 confocal imaging system.

3H Thymidine Proliferation Assay.

Thymidine incorporation assay was performed as described before (53). Briefly, cells were plated into 96-well plates (10,000 cells/well). On the next day, cells were made quiescent by serum starvation in Dulbecco’s modified Eagle’s medium, 0.2% BSA for 20 h. Upon agonist stimulation (16 h), cells were labeled with [methyl-3H]-thymidine (Amersham Biosciences; 1 μM, 1 μCi/mL), and 24 h later, samples were collected by using a cell harvester. Filters were dried and analyzed by scintillation counting. 3H-thymidine data are expressed as the averaged counts per minute measured in each well (cpm/well).

Statistics.

Comparisons between multiple samples were made using one-way ANOVA with Tukey's multiple comparison test or an unpaired Student's t test with Welch's correction when comparisons were made only between two samples. The number of cells/samples and independent experiments (n/N, respectively) for each panel is described below. For panels with more than one time point/concentration, we report the one with the fewest number of independent experiments. Statistical analyses and curve fitting were performed using Graph Pad Prism 9 (GraphPad Software Inc.). P values less than 0.05 (P < 0.05) were considered significant.

Fig. 1: A (16/5); B (12/3); C: Nuc Veh (5/4), Nuc D4a (4/3), Cyto Veh, Cyto D4a (5/3); D: Nuc Veh (5/4), Nuc Barba (5/3), Cyto Veh (6/3), Cyto Barba (7/3); E: Nuc Veh (14/4), Nuc LRE1 (5/3), F: Cyto Veh (8/3), Cyto LRE1 (6/4); G: same as E and F; H (5/3); I: Veh− (3/3), Veh+ (3/3), KH7− (3/3), KH7+ (3/3), LRE1− (3/3), LRE1+ (3/3).

Fig. 2:  A: Left and Right Middle panels: KH7 (3/3), KH7.15 (3/3), and LRE1 (3/3); Right panel: no TSH (11/5), sh-Vec (9/5), sACt (7/4), sh-sAC+sACt (12/5), sh-sAC (9/4), sh-Vec+sACtR (15/5), sh-sAC+sACtR (16/6). C: Left: Veh (7/4), LRE1 (7/3), Center: sh-Vec (4/3), sh-sAC (5/3), Right: sACt (3/3), sACtR (3/3); D/E: Nuc sh-Vec (6/4), Nuc sACt (17/6), Nuc sh-sAC (12/5), Cyto sh-Vec (7/5), Cyto sACt (18/6), Cyto sh-sAC (32/6).

Fig. 3: A: Left and Right panels (3/3); B: Left and Right panels (3/3); C: Nuc TLCV2 (7/5), Nuc sAC-KO (9/6), Cyto TLCV2 (7/4), Cyto sAC-KO (14/6).

Fig. 4 : A: Left and Right panels (3/3); B: Left, Center, and Right panels (3/3); C: Veh (26/5), LRE1 (13/4), sh-sAC (6/3).

Fig. 5: A, B, and C: Veh (7/3), LRE1 (8/4), sh-Vec (6/3), sh-sAC (8/3). C, D, and E: Veh (3/3), LRE1 (3/3), sh-Vec (3/3), sh-sAC (3/3).

Fig. 6: A: Nuc Ca2+ (7/3), Cyto Ca2+ (6/3); B: Veh (8/3), BAPTA (9/3); C: Veh (8/4), U73122 (8/3), Xesto c (5/3), D: Veh (8/3), JTV-519 (7/3); E: Veh (6/3), FR-900359 (8/3); F: Vec (7/3), InsP3-Bf (8/3); G: Vec (10/3), InsP3-Bf-NLS (6/3); H: Vec (8/4), PV-NES (9/4); I: Vec (7/3), PV-NLS (8/3).

Fig. 7: A: TSH-/Stim- (22/7), TSH+/Stim− (22/6), TSH-/Fz (25/7), Light (22/5); B: NLS-sACt (18/4), NLS-sACt+LRE1 (17/4), bP-nL (18/5), bP-nL+LRE1 (20/4); C: Vec (25/5), NLS-PDE8 (12/6); P450-PDE8 (16/5); D: Vec (25/4), NLS-PDE8 (18/6); P450-PDE8 (22/4); E: Vec (27/3), PV-NLS + TSH (25/3), PV-NLS + Light (26/3).

SI Appendix, Fig. S2: A: Nuc Veh (5/3), Nuc Dyna 15 μM (14/5), Nuc Dyna 15 μM (6/3); B: Cyto CTRL (5/3), Cyto Dyna 15 μM (6/3), Cyto Dyna 15 μM (5/3), C: (4/3); D: Nuc Vec (5/3), Nuc K44A (4/3); E: Cyto Vec (4/3), Cyto K44A 0.75 μg (4/3), Cyto K44A 1.5 μg (7/3).

SI Appendix, Fig. S3: A: Veh (7/3), Dyna (5/3), D4a (5/3); B: Veh (6/3), Dyna (8/4), D4a (5/3).

SI Appendix, Fig. S4: C: Nuc Veh (6/3), Nuc LRE1 (8/4), Cyto Veh (8/3), Cyto LRE1 (6/4); E and F: same as Fig. 1 E and F.

SI Appendix, Fig. S5: C: sh-Vec (4/3), sACt (13/5).

SI Appendix, Fig. S6: C: TLCV2 (3/3), sg243 (3/3); D: (3/3) for all traces/bars.

SI Appendix, Fig. S7: A (6/3); B (7/3); C (6/4); D: Veh (7/3), LRE1 (8/4); E: Nuc WT (20/5), Nuc AC9 (16/6), Cyto WT (8/4), Cyto AC9 (8/3); F: WT (7/3), AC9 (4/3); G: Veh (7/3), LRE (10/4); H Veh (8/4), LRE (6/3).

SI Appendix, Fig. S8: D: Veh (3/3), LRE1 (3/3).

SI Appendix, Fig. S9: A: Veh (6/3), BAPTA (8/4); B: Veh (5/3), U73122 (7/3), Xesto c (11/4), C: Veh (7/4), JTV-519 (7/3); D: Veh (8/4), FR-900359 (8/3); E: Vec (9/3), InsP3-Bf (7/3); F: Vec (7/3), InsP3-Bf-NLS (7/4); G: Vec (6/3), PV-NES (8/3); H: Vec (7/4), PV-NLS (7/3).

SI Appendix, Fig. S10: A and B: Dark (3/3), Light (3/3), Light + LRE1 (3/3); C: Nuc Vec (13/5), Nuc P450 (12/4); Nuc NLS (19/6); D: Cyto (46/6), Cyto P450 (22/5); Cyto NLS (19/6)

SI Appendix, Fig. S11: C: Left panel (5/3), Right panel (3/3); E: NLS-H208 (6/4), H208 (6/4).

Supplementary Material

Appendix 01 (PDF)

Acknowledgments

We thank Drs. Cooper (Cambridge University) and Lily Jiang (UT Southwestern) for the AC2 and Flag-hAC9 expression plasmids, respectively, Dr. Anand (Pennsylvania State University) for the RI-PDE8 construct, Dr. Muller (Northwestern University) for the shRNA and sh-resistant sAC plasmids, Dr. Várnai (Budapest, Hungary) for InsP3-buffer plasmids, Dr. Grosse (Freiburg, Germany) for the GCaMP6f-NES plasmid, and Dr. Ross (University of Texas Southwestern Medical Center) for the HC1 cells. Funding was provided by the NIH grants R01 GM099775 and GM130612 to D.L.A.

Author contributions

D.L.A. designed research; A.P., X.Z., and D.L.A. performed research; N.N. contributed new reagents/analytic tools; A.P. and D.L.A. analyzed data; and A.P. and D.L.A. wrote the paper.

Competing interest

The authors declare no competing interest.

Footnotes

This article is a PNAS Direct Submission.

Data, Materials, and Software Availability

All study data are included in the article and/or SI Appendix.

Supporting Information

References

  • 1.Rall T. W., Sutherland E. W., Formation of a cyclic adenine ribonucleotide by tissue particles. J. Biol. Chem. 232, 1065–1076 (1958). [PubMed] [Google Scholar]
  • 2.Sutherland E. W., Rall T. W., Fractionation and characterization of a cyclic adenine ribonucleotide formed by tissue particles. J. Biol. Chem. 232, 1077–1091 (1958). [PubMed] [Google Scholar]
  • 3.Zaccolo M., Zerio A., Lobo M. J., Subcellular organization of the cAMP signaling pathway. Pharmacol. Rev. 73, 278–309 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Berman H. M., et al. , The cAMP binding domain: An ancient signaling module. Proc. Natl. Acad. Sci. U.S.A. 102, 45–50 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.de Rooij J., et al. , Epac is a Rap1 guanine-nucleotide-exchange factor directly activated by cyclic AMP. Nature 396, 474–477 (1998). [DOI] [PubMed] [Google Scholar]
  • 6.Kawasaki H., et al. , A family of cAMP-binding proteins that directly activate Rap1. Science 282, 2275–2279 (1998). [DOI] [PubMed] [Google Scholar]
  • 7.Schindler R. F., Brand T., The Popeye domain containing protein family–A novel class of cAMP effectors with important functions in multiple tissues. Prog. Biophys. Mol. Biol. 120, 28–36 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Zufall F., Shepherd G. M., Barnstable C. J., Cyclic nucleotide gated channels as regulators of CNS development and plasticity. Curr. Opin. Neurobiol. 7, 404–412 (1997). [DOI] [PubMed] [Google Scholar]
  • 9.Krahling A. M., et al. , CRIS-a novel cAMP-binding protein controlling spermiogenesis and the development of flagellar bending. PLoS Genet. 9, e1003960 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Taylor S. S., et al. , From structure to the dynamic regulation of a molecular switch: A journey over 3 decades. J. Biol. Chem. 296, 100746 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Sassone-Corsi P., The cyclic AMP pathway. Cold Spring Harb. Perspect. Biol. 4, a011148 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Benchoula K., Parhar I. S., Madhavan P., Hwa W. E., CREB nuclear transcription activity as a targeting factor in the treatment of diabetes and diabetes complications. Biochem. Pharmacol. 188, 114531 (2021). [DOI] [PubMed] [Google Scholar]
  • 13.Rossetti T., Jackvony S., Buck J., Levin L. R., Bicarbonate, carbon dioxide and pH sensing via mammalian bicarbonate-regulated soluble adenylyl cyclase. Interface Focus 11, 20200034 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Zippin J. H., et al. , Bicarbonate-responsive "soluble" adenylyl cyclase defines a nuclear cAMP microdomain. J. Cell Biol. 164, 527–534 (2004). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Dumont J. E., Lamy F., Roger P., Maenhaut C., Physiological and pathological regulation of thyroid cell proliferation and differentiation by thyrotropin and other factors. Physiol. Rev. 72, 667–697 (1992). [DOI] [PubMed] [Google Scholar]
  • 16.Kimura T., et al. , Regulation of thyroid cell proliferation by TSH and other factors: A critical evaluation of in vitro models. Endocr. Rev. 22, 631–656 (2001). [DOI] [PubMed] [Google Scholar]
  • 17.Rivas M., Santisteban P., TSH-activated signaling pathways in thyroid tumorigenesis. Mol. Cell Endocrinol. 213, 31–45 (2003). [DOI] [PubMed] [Google Scholar]
  • 18.Hochbaum D., Barila G., Ribeiro-Neto F., Altschuler D. L., Radixin assembles cAMP effectors Epac and PKA into a functional cAMP compartment: Role in cAMP-dependent cell proliferation. J. Biol. Chem. 286, 859–866 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hochbaum D., Hong K., Barila G., Ribeiro-Neto F., Altschuler D. L., Epac, in synergy with cAMP-dependent protein kinase (PKA), is required for cAMP-mediated mitogenesis. J. Biol. Chem. 283, 4464–4468 (2008). [DOI] [PubMed] [Google Scholar]
  • 20.Balazsi G., van Oudenaarden A., Collins J. J., Cellular decision making and biological noise: From microbes to mammals. Cell 144, 910–925 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ganesan A., Zhang J., How cells process information: Quantification of spatiotemporal signaling dynamics. Protein. Sci. 21, 918–928 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Jeknic S., Kudo T., Covert M. W., Techniques for studying decoding of single cell dynamics. Front. Immunol. 10, 755 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Jiang Y., Hao N., Memorizing environmental signals through feedback and feedforward loops. Curr. Opin. Cell Biol. 69, 96–102 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Micali G., Aquino G., Richards D. M., Endres R. G., Accurate encoding and decoding by single cells: Amplitude versus frequency modulation. PLoS Comput. Biol. 11, e1004222 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Sutkeviciute I., Vilardaga J. P., Structural insights into emergent signaling modes of G protein-coupled receptors. J. Biol. Chem. 295, 11626–11642 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Calebiro D., et al. , Persistent cAMP-signals triggered by internalized G-protein-coupled receptors. PLoS Biol. 7, e1000172 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Ferrandon S., et al. , Sustained cyclic AMP production by parathyroid hormone receptor endocytosis. Nat. Chem. Biol. 5, 734–742 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Irannejad R., et al. , Conformational biosensors reveal GPCR signalling from endosomes. Nature 495, 534–538 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Feinstein T. N., et al. , Noncanonical control of vasopressin receptor type 2 signaling by retromer and arrestin. J. Biol. Chem. 288, 27849–27860 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kuna R. S., et al. , Glucagon-like peptide-1 receptor-mediated endosomal cAMP generation promotes glucose-stimulated insulin secretion in pancreatic beta-cells. Am. J. Physiol. Endocrinol. Metab. 305, E161–E170 (2013). [DOI] [PubMed] [Google Scholar]
  • 31.Godbole A., Lyga S., Lohse M. J., Calebiro D., Internalized TSH receptors en route to the TGN induce local Gs-protein signaling and gene transcription. Nat. Commun. 8, 443 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Merriam L. A., et al. , Pituitary adenylate cyclase 1 receptor internalization and endosomal signaling mediate the pituitary adenylate cyclase activating polypeptide-induced increase in guinea pig cardiac neuron excitability. J. Neurosci. 33, 4614–22 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Kotowski S. J., Hopf F. W., Seif T., Bonci A., von Zastrow M., Endocytosis promotes rapid dopaminergic signaling. Neuron 71, 278–90 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Jensen D. D., et al. , Neurokinin 1 receptor signaling in endosomes mediates sustained nociception and is a viable therapeutic target for prolonged pain relief. Sci. Transl. Med. 9, eaal3447 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Jimenez-Vargas N. N., et al. , Endosomal signaling of delta opioid receptors is an endogenous mechanism and therapeutic target for relief from inflammatory pain. Proc. Natl. Acad. Sci. U.S.A. 117, 15281–15292 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Mai Q. N., et al. , A lipid-anchored neurokinin 1 receptor antagonist prolongs pain relief by a three-pronged mechanism of action targeting the receptor at the plasma membrane and in endosomes. J. Biol. Chem. 296, 100345 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Yarwood R. E., et al. , Endosomal signaling of the receptor for calcitonin gene-related peptide mediates pain transmission. Proc. Natl. Acad. Sci. U.S.A. 114, 12309–12314 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Lyga S., et al. , Persistent cAMP signaling by internalized LH receptors in ovarian follicles. Endocrinology 157, 1613–1621 (2016). [DOI] [PubMed] [Google Scholar]
  • 39.Jean-Alphonse F. G., et al. , beta2-adrenergic receptor control of endosomal PTH receptor signaling via Gbetagamma. Nat. Chem. Biol. 13, 259–261 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Peng G. E., Pessino V., Huang B., von Zastrow M., Spatial decoding of endosomal cAMP signals by a metastable cytoplasmic PKA network. Nat. Chem. Biol. 17, 558–566 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Roberts M. J., et al. , Inhibition of the proliferation of human lung fibroblasts by prostacyclin receptor agonists is linked to a sustained cAMP signal in the nucleus. Front. Pharmacol. 12, 669227 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Tsvetanova N. G., von Zastrow M., Spatial encoding of cyclic AMP signaling specificity by GPCR endocytosis. Nat. Chem. Biol. 10, 1061–1065 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.White A. D., et al. , Spatial bias in cAMP generation determines biological responses to PTH type 1 receptor activation. Sci. Signal 14, eabc5944 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Cajulao J. M. B., Hernandez E., von Zastrow M. E., Sanchez E. L., Glucagon receptor-mediated regulation of gluconeogenic gene transcription is endocytosis-dependent in primary hepatocytes. Mol. Biol. Cell 33, ar90 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Clister T., Greenwald E. C., Baillie G. S., Zhang J., AKAP95 organizes a nuclear microdomain to control local cAMP for regulating nuclear PKA. Cell Chem. Biol. 26, 885–891.e4 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Sample V., et al. , Regulation of nuclear PKA revealed by spatiotemporal manipulation of cyclic AMP. Nat. Chem. Biol. 8, 375–382 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Bock A., et al. , Optical mapping of cAMP signaling at the nanometer scale. Cell 182, 1519–1530.e17 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Zhang J. Z., et al. , Phase separation of a PKA regulatory subunit controls cAMP compartmentation and oncogenic signaling. Cell 182, 1531–1544.e15 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Anton S. E., et al. , Receptor-associated independent cAMP nanodomains mediate spatiotemporal specificity of GPCR signaling. Cell 185, 1130–1142.e11 (2022). [DOI] [PubMed] [Google Scholar]
  • 50.O’Banion C. P., Vickerman B. M., Haar L., Lawrence D. S., Compartmentalized cAMP generation by engineered photoactivated adenylyl cyclases. Cell Chem. Biol. 26, 1393–1406.e7 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Edreira M. M., et al. , Phosphorylation-induced conformational changes in Rap1b: Allosteric effects on switch domains and effector loop. J. Biol. Chem. 284, 27480–27486 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Naim N., et al. , Luminescence-activated nucleotide cyclase regulates spatial and temporal cAMP synthesis. J. Biol. Chem. 294, 1095–1103 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Ribeiro-Neto F., Urbani J., Lemee N., Lou L., Altschuler D. L., On the mitogenic properties of Rap1b: cAMP-induced G(1)/S entry requires activated and phosphorylated Rap1b. Proc. Natl. Acad. Sci. U.S.A. 99, 5418–5423 (2002). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Zhang X., et al. , Cyclase-associated protein 1 (CAP1) is a prenyl-binding partner of Rap1 GTPase. J. Biol. Chem. 293, 7659–7673 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Beautrait A., et al. , A new inhibitor of the beta-arrestin/AP2 endocytic complex reveals interplay between GPCR internalization and signalling. Nat. Commun. 8, 15054 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Ramos-Espiritu L., et al. , Discovery of LRE1 as a specific and allosteric inhibitor of soluble adenylyl cyclase. Nat. Chem. Biol. 12, 838–844 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Hess K. C., et al. , The "soluble" adenylyl cyclase in sperm mediates multiple signaling events required for fertilization. Dev. Cell 9, 249–259 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Jaiswal B. S., Conti M., Identification and functional analysis of splice variants of the germ cell soluble adenylyl cyclase. J. Biol. Chem. 276, 31698–31708 (2001). [DOI] [PubMed] [Google Scholar]
  • 59.Christensen A. E., et al. , cAMP analog mapping of Epac1 and cAMP kinase. Discriminating analogs demonstrate that Epac and cAMP kinase act synergistically to promote PC-12 cell neurite extension. J. Biol. Chem. 278, 35394–35402 (2003). [DOI] [PubMed] [Google Scholar]
  • 60.Ross E. M., Howlett A. C., Ferguson K. M., Gilman A. G., Reconstitution of hormone-sensitive adenylate cyclase activity with resolved components of the enzyme. J. Biol. Chem. 253, 6401–6412 (1978). [PubMed] [Google Scholar]
  • 61.Dessauer C. W., Gilman A. G., Purification and characterization of a soluble form of mammalian adenylyl cyclase. J. Biol. Chem. 271, 16967–16974 (1996). [DOI] [PubMed] [Google Scholar]
  • 62.Jaiswal B. S., Conti M., Calcium regulation of the soluble adenylyl cyclase expressed in mammalian spermatozoa. Proc. Natl. Acad. Sci. U.S.A. 100, 10676–10681 (2003). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Litvin T. N., Kamenetsky M., Zarifyan A., Buck J., Levin L. R., Kinetic properties of "soluble" adenylyl cyclase. Synergism between calcium and bicarbonate. J. Biol. Chem. 278, 15922–15926 (2003). [DOI] [PubMed] [Google Scholar]
  • 64.Wehrens X. H., et al. , Protection from cardiac arrhythmia through ryanodine receptor-stabilizing protein calstabin2. Science 304, 292–296 (2004). [DOI] [PubMed] [Google Scholar]
  • 65.Gafni J., et al. , Xestospongins: Potent membrane permeable blockers of the inositol 1,4,5-trisphosphate receptor. Neuron 19, 723–733 (1997). [DOI] [PubMed] [Google Scholar]
  • 66.Schrage R., et al. , The experimental power of FR900359 to study Gq-regulated biological processes. Nat. Commun. 6, 10156 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Guimaraes E., et al. , Inositol 1, 4, 5-trisphosphate-dependent nuclear calcium signals regulate angiogenesis and cell motility in triple negative breast cancer. PLoS One 12, e0175041 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Gulyas G., et al. , Measurement of inositol 1,4,5-trisphosphate in living cells using an improved set of resonance energy transfer-based biosensors. PLoS One 10, e0125601 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Gomes D. A., et al. , c-Met must translocate to the nucleus to initiate calcium signals. J. Biol. Chem. 283, 4344–4351 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Zima A. V., Bare D. J., Mignery G. A., Blatter L. A., IP3-dependent nuclear Ca2+ signalling in the mammalian heart. J. Physiol. 584, 601–611 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Rodrigues M. A., et al. , Nucleoplasmic calcium is required for cell proliferation. J. Biol. Chem. 282, 17061–17068 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Naim N., Reece J. M., Zhang X., Altschuler D. L., Dual activation of cAMP production through photostimulation or chemical stimulation. Methods Mol. Biol. 2173, 201–216 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Tulsian N. K., Krishnamurthy S., Anand G. S., Channeling of cAMP in PDE-PKA complexes promotes signal adaptation. Biophys. J. 112, 2552–2566 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Ahn K., Szczesna-Skorupa E., Kemper B., The amino-terminal 29 amino acids of cytochrome P450 2C1 are sufficient for retention in the endoplasmic reticulum. J. Biol. Chem. 268, 18726–18733 (1993). [PubMed] [Google Scholar]
  • 75.Harootunian A. T., et al. , Movement of the free catalytic subunit of cAMP-dependent protein kinase into and out of the nucleus can be explained by diffusion. Mol. Biol. Cell 4, 993–1002 (1993). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Liu C., Ke P., Zhang J., Zhang X., Chen X., Protein kinase inhibitor peptide as a tool to specifically inhibit protein kinase A. Front. Physiol. 11, 574030 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Ivonnet P., Salathe M., Conner G. E., Hydrogen peroxide stimulation of CFTR reveals an Epac-mediated, soluble AC-dependent cAMP amplification pathway common to GPCR signalling. Br. J. Pharmacol. 172, 173–184 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Ivonnet P., Unwalla H., Salathe M., Conner G. E., Soluble adenylyl cyclase mediates hydrogen peroxide-induced changes in epithelial barrier function. Respir. Res. 17, 15 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Inda C., et al. , Different cAMP sources are critically involved in G protein-coupled receptor CRHR1 signaling. J. Cell Biol. 214, 181–195 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Chen H., Chan H. C., Amplification of FSH signalling by CFTR and nuclear soluble adenylyl cyclase in the ovary. Clin. Exp. Pharmacol. Physiol. 44, 78–85 (2017). [DOI] [PubMed] [Google Scholar]
  • 81.Nguyen T. M. D., et al. , Effect of soluble adenylyl cyclase (ADCY10) inhibitors on the LH-stimulated cAMP synthesis in Mltc-1 leydig cell line. Int. J. Mol. Sci. 22, 4641 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Xu W. M., et al. , Defective CFTR-dependent CREB activation results in impaired spermatogenesis and azoospermia. PLoS One 6, e19120 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Domingue J. C., Ao M., Sarathy J., Rao M. C., Chenodeoxycholic acid requires activation of EGFR, EPAC, and Ca2+ to stimulate CFTR-dependent Cl- secretion in human colonic T84 cells. Am. J. Physiol. Cell Physiol. 311, C777–C792 (2016). [DOI] [PubMed] [Google Scholar]
  • 84.Lobo M. J., Amaral M. D., Zaccolo M., Farinha C. M., EPAC1 activation by cAMP stabilizes CFTR at the membrane by promoting its interaction with NHERF1. J. Cell Sci. 129, 2599–2612 (2016). [DOI] [PubMed] [Google Scholar]
  • 85.Santos J. D., et al. , Cytoskeleton regulators CAPZA2 and INF2 associate with CFTR to control its plasma membrane levels under EPAC1 activation. Biochem. J. 477, 2561–2580 (2020). [DOI] [PubMed] [Google Scholar]
  • 86.Kosuru R., Chrzanowska M., Integration of Rap1 and calcium signaling. Int. J. Mol. Sci. 21, 1616 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Sieng M., et al. , Functional and structural characterization of allosteric activation of phospholipase Cepsilon by Rap1A. J. Biol. Chem. 295, 16562–16571 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Bunney T. D., Katan M., Phospholipase C epsilon: Linking second messengers and small GTPases. Trends Cell Biol. 16, 640–648 (2006). [DOI] [PubMed] [Google Scholar]
  • 89.Harden T. K., Hicks S. N., Sondek J., Phospholipase C isozymes as effectors of Ras superfamily GTPases. J. Lipid. Res. 50, S243–S248 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Nash C. A., Wei W., Irannejad R., Smrcka A. V., Golgi localized beta1-adrenergic receptors stimulate Golgi PI4P hydrolysis by PLCepsilon to regulate cardiac hypertrophy. Elife 8, e48167 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Song C., et al. , Differential roles of Ras and Rap1 in growth factor-dependent activation of phospholipase C epsilon. Oncogene 21, 8105–8113 (2002). [DOI] [PubMed] [Google Scholar]
  • 92.Dusaban S. S., Brown J. H., PLCepsilon mediated sustained signaling pathways. Adv. Biol. Regul. 57, 17–23 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93.Jin T. G., et al. , Role of the CDC25 homology domain of PLC {epsilon} in amplification of Rap1-dependent signaling. J. Biol. Chem. 6, 30301–30307 (2001). [DOI] [PubMed] [Google Scholar]
  • 94.Kelley G. G., Reks S. E., Smrcka A. V., Hormonal regulation of phospholipase cepsilon through distinct and overlapping pathways involving G12 and Ras family G-proteins. Biochem. J. 378, 129–139 (2004). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95.Oestreich E. A., et al. , Epac-mediated activation of phospholipase C(epsilon) plays a critical role in beta-adrenergic receptor-dependent enhancement of Ca2+ mobilization in cardiac myocytes. J. Biol. Chem. 282, 5488–5495 (2007). [DOI] [PubMed] [Google Scholar]
  • 96.Eiger D. S., et al. , Location bias contributes to functionally selective responses of biased CXCR3 agonists. Nat. Commun. 13, 5846 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97.Shimizu M., et al. , Pharmacodynamic actions of a long-acting PTH analog (LA-PTH) in thyroparathyroidectomized (TPTX) rats and normal monkeys. J. Bone Miner. Res. 31, 1405–1412 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Watson R. L., et al. , Endothelial CD99 signals through soluble adenylyl cyclase and PKA to regulate leukocyte transendothelial migration. J. Exp. Med. 212, 1021–1041 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 99.Zhang X., et al. , CAP1 binds and activates adenylyl cyclase in mammalian cells. Proc. Natl. Acad. Sci. U.S.A. 118, e2024576118 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Appendix 01 (PDF)

Data Availability Statement

All study data are included in the article and/or SI Appendix.


Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES