Hemophagocytic Lymphohistiocytosis Associated With Bartonella Peliosis Hepatis in an HIV-positive Kidney Transplant Patient

Abstract

Bacillary peliosis hepatis is a well-recognized manifestation of disseminated Bartonella infection that can occur in immunocompromised individuals. Hemophagocytic lymphohistiocytosis (HLH) is an immune-mediated condition with features that can overlap with a severe primary infection such as disseminated Bartonella infection. We report a case of bacillary peliosis hepatis and secondary HLH due to disseminated Bartonella infection in a kidney transplant recipient with well-controlled human immunodeficiency virus (HIV) infection. The patient had two weeks of fever and abdominal pain and was found to have hepatomegaly. He recalled exposure to a sick dog but had no recalled cat exposures. Laboratory evaluation was notable for pancytopenia and cholestatic injury. This patient met greater than five of eight clinical criteria for HLH. Pathology review of a bone marrow core biopsy identified hemophagocytosis. A transjugular liver biopsy was performed, and histopathology review identified peliosis hepatis. Warthin-Starry staining of the bone marrow showed pleiomorphic coccobacillary organisms. The Bartonella IgG titer was 1:512 and Bartonella-specific DNA targets were detected by peripheral blood PCR. Treatment with doxycycline, increased prednisone, and holding the mycophenolate component of his transplant immunosuppression regimen resulted in an excellent clinical response. Secondary HLH can be difficult to distinguish from severe systemic infection. A high index of suspicion can support the diagnosis of systemic Bartonella infection in those who present with HLH, especially in patients with hepatomegaly, immunosuppression, and germane animal exposures.

Summary

The authors present the case of a patient with hemophagocytic lymphohistiocytosis (HLH) associated with Bartonella peliosis hepatis in a renal transplant recipient with well-controlled HIV infection. The clinical presentation, diagnostic, and management of Bartonella and HLH are reviewed. Features of HLH and peliosis hepatis due to Bartonella infection may help providers recognize these conditions in patients with fever, abdominal pain, and hepatomegaly.

Introduction

Members of the genus Bartonella are facultative, intracellular gram-negative coccobacilli, and B. henselae is the causative agent of cat-scratch disease (CSD). In immunocompetent hosts, typical symptoms include fever, lymphadenopathy and generalized malaise and usually comprise a self-limiting syndrome. However, the spectrum of Bartonella henselae disease is quite broad and more extreme or severe forms include meningitis/encephalitis, endocarditis, neuroretinitis, and osteomyelitis^1,2. Additional manifestations of bacillary angiomatosis and bacillary peliosis are most frequently seen in immunocompromised hosts^1,2.

Bartonella infection can also trigger hemophagocytic lymphohistiocytosis (HLH), which is a life-threatening immune-mediated disease characterized by a hyperinflammatory state. Features of HLH include uncontrolled activation of antigen presenting cells (APCs), defects in granule-mediated cytotoxicity in natural killer (NK) cells, and defects in cytotoxic T lymphocytes (CTLs). These factors disrupt the timely elimination of APCs by NK cells and CTLs, which impairs the mechanism by which the immune system naturally down-regulates itself^3-7. This leads to an exaggerated immune response that is marked by hypersecretion of proinflammatory cytokines such as interferon γ, tumor necrosis factor α, interleukin (IL)-1, IL-4, IL-6, IL-8, IL-10, and IL-18^4,8. Clinical features include unremitting fever, hepatosplenomegaly, lymphadenopathy, rash, and neurologic symptoms such as seizures, encephalopathy, and ataxia. Diagnosis of HLH is based on a set of parameters that form the HLH-2004 diagnostic criteria and which include fever, splenomegaly, cytopenias, hypertriglyceridemia, hypofibrinogenemia, hyperferritinemia, low or absent NK cell activity, elevated soluble CD25, and hemophagocytosis in the bone marrow, spleen, or lymph nodes⁹.

We present a case of bacillary peliosis hepatis due to Bartonella infection in a renal transplant recipient with well-controlled human immunodeficiency virus (HIV) infection who met criteria for HLH.

Case Description

A 31-year-old man presented with a two-week history of fever and bloating. He had a history of well-controlled HIV and deceased-donor renal transplant (DDRT) (CMV D+/R+, EBV D+/R+, HCV D-/R-, HIV D+/R+) performed eight months prior for HIV-associated nephropathy. His social history was notable for living with a pet dog in poor health. His medications included combination dolutegravir/abacavir/lamivudine and his immunosuppressive (IS) regimen of prednisone 5 mg daily, tacrolimus, and mycophenolate mofetil. A renal biopsy performed per institution protocol six months post-transplant (two months prior to presentation) showed nonspecific glomerular changes, mild interstitial fibrosis, and mild tubular atrophy but no evidence of acute cellular rejection. He had good allograft function with a post-transplant creatinine of 1.1 to 1.3 mg/dL. His IS regimen had been stable, and he had not required any augmentations to this regimen prior to this presentation. On examination, he had a fever (temperature of 38·6°C), tachycardia, scleral icterus, poorly localized tender abdominal distension with hepatomegaly and no skin lesions. The remainder of his exam was normal.

Laboratory studies showed pancytopenia (total leukocyte count of 2·4 x 10⁹/L, hemoglobin of 8·5 g/dL, and platelets of 30 x 10³ cells/microliter), cholestatic injury (alkaline phosphatase 179 IU/L, total bilirubin 4·2 mg/dL, direct bilirubin 3·3 mg/dL), and elevated inflammatory markers (CRP 198·6 mg/L, ESR 101 mm/hr). The patient’s CD4+ T cell count and percentage was 233 cells/mm³ and 36·2%, respectively. His HIV viral load was <20 copies/mL. Multiple cultures of blood, sputum and urine had no growth. Given concern for fastidious or slow-growing organisms, a set of blood cultures was held for a two-week extended incubation period, which also had no growth. Blood and sputum acid fast bacillus (AFB) studies to evaluate for mycobacteria were negative. Serum or plasma PCRs for hepatitis B and C, cytomegalovirus (CMV), Epstein-Barr virus (EBV), adenovirus, parvovirus, human herpes virus (HHV)-6, and HHV-8 were not detectable on initial assessment. When EBV quantitative PCR was repeated, it was positive at 660 IU/mL at 5 days and then undetectable at 16 days after initial assessment. Urine histoplasma antigen was negative. His chest x-ray imaging showed no abnormalities. A CT scan of the abdomen without contrast revealed homogeneous hepatomegaly without contour-deforming lesions (Figure 1).

Figure 1:

Non-contrast CT imaging of the liver demonstrating homogeneous hepatomegaly

He was empirically initiated on vancomycin and piperacillin/tazobactam. He was transferred to the ICU with concern for developing sepsis given persistent fevers and tachycardia. Given lack of clinical improvement, a diagnosis of HLH was suspected. Additional laboratory evaluation revealed a ferritin of 2896 micrograms/L, fasting triglyceride of 298 mg/dL, fibrinogen of 402 mg/dL, and soluble interleukin-2 receptor 20,500 pg/mL. Bone marrow core biopsy showed scattered hemophagocytic macrophages and increased plasma cells. Pathology review of the bone marrow noted approximately 70% cellular marrow, with normal myeloid to erythroid ratio of 2:1, with myeloid cells showing left-shifted maturation. Flow cytometric immunophenotypic did not identify any abnormal hematolymphoid cell populations. There were no abnormalities of cell lineages noted on bone marrow aspiration or biopsy. A HScore (a validated score to estimate the probability of having a hemophagocytic syndrome) was calculated to be 271, yielding an estimated probability of a hemophagocytic syndrome of 99.8%¹⁰. Bone marrow bacterial and fungal cultures were negative. Liver (Figure 2) and bone marrow biopsies showed sinusoidal dilatation filled with blood consistent with peliosis of the liver and bone marrow. Silver stains in both biopsy specimens demonstrated clumps and single coccobacilli (Figure 3) in the dilated vascular spaces.

Figure 2:

Liver biopsy specimen with hematoxylin and eosin staining at 200x magnification showing dilated vascular spaces consistent with peliosis hepatis

Figure 3:

Warthin-Starry stain demonstrating the characteristic pleomorphic bacilli of Bartonella in bone marrow core biopsy

A transjugular liver biopsy showed sinusoidal dilatation and blood-filled lacunar spaces, consistent with peliosis hepatis (Figure 2). There was no noted Kupffer cell hyperplasia or hemophagocytosis on pathology review of the liver biopsy. There was inadequate liver biopsy specimen to perform microbiological cultures. Warthin-Starry stain of bone marrow core biopsy showed clumps and chains of pleomorphic, extra-cellular coccobacilli (Figure 3). Serological testing for B. henselae were reactive, with IgM and IgG titers at 1:16, and 1:512, respectively. Qualitative PCR of the peripheral blood using primers to detect the Heat Shock Protein (htA), which is a Bartonella-specific target (Table 1) was positive. Transthoracic echocardiography did not suggest endocarditis. Fundoscopic exam showed no evidence of neuroretinitis. He was switched to doxycycline 100 mg twice daily and a planned prolonged prednisone taper starting at 20 mg daily and discharged home. His multi-disciplinary care team elected not to treat with additional specific therapy for possible HLH, favoring treatment with corticosteroids instead. His immunosuppressive regimen of prednisone, tacrolimus, and mycophenolate was tailored by discontinuation of mycophenolate until completion of antibiotic therapy. Unfortunately, he was readmitted approximately two weeks later with persistent fevers. Laboratory studies did not reveal a new infectious process, and ferritin was still elevated at 1,015 ng/mL. Evaluation by the Infectious Diseases consult service favored dysregulated inflammation related to burden of Bartonella with possible component of persistent HLH. He was discharged and completed 12 months of doxycycline at which point his mycophenolate was restarted. At two years of post-treatment follow-up, he was doing well without abdominal tenderness, organomegaly, or other evidence of recurrence.

Table 1:

Primer sequences used for PCR amplification for qualitative detection of Bartonella spp.

Target	Heat Shock Protein (htrA)
Primer 1 (Reverse)	TCCGTGATCTAGCAAAGCGTA
Primer 2 (Forward)	TTCCAAACTCCTAAGGTTACTGT

Note: primers may contain modified bases.

Discussion

Herein, we report a case of bartonellosis-related HLH in a DDRT patient with well-controlled HIV. Although the constellation of pathology in this patient is unusual, each component has broad relevance to providers who treat systemic inflammatory diseases. HLH is a severe systemic inflammatory response characterized by overproduction of inflammatory cytokines that can lead to multi-organ failure and was initially described as a disorder of immune regulation in the pediatric population⁹. It is broadly classified as primary or secondary. Primary HLH, which typically occurs in the early years of life, can be associated with several inherited immune deficiencies whereas secondary or reactive HLH is often caused by certain infections, malignancies, or autoimmune diseases and can occur at any age^7,11-13. In a retrospective multicenter study that aimed to identify predisposing features of reactive HLH in adults, approximately half of the patients had known underlying immunosuppression (either from HIV or chronic immunosuppressive therapy), at the time of their HLH diagnosis¹⁴.

The diagnosis of secondary HLH is challenging as its features of fever, cytopenias, hypertriglyceridemia and hypofibrinogenemia can overlap with sepsis. However, this diagnosis should be suspected in patients with unascribable protracted fever and who have evidence of multi-organ involvement. Bone marrow aspiration has been shown to be the test most likely to lead to recognition of HLH^5,15. It should be noted that the presence of histiocytic hemophagocytosis is not necessary to make this diagnosis, and initial bone marrow aspiration may yield false-negative results¹⁶.

Of the infectious etiologies that can be associated with HLH, Bartonella infection remains a rare cause though immunosuppression is likely a risk factor. EBV is also associated with HLH, however this patient’s quantitative PCR trend of undetectable, 660 IU/mL, and undetectable are more consistent with reactivation during acute illness than as the etiology of his HLH. To our knowledge, only three prior cases of Bartonella infection-associated HLH have been reported: in a 14-year-old female renal transplant recipient who met diagnostic criteria for HLH whose bone marrow aspirate had features consistent with HLH and whose Bartonella infection was confirmed serologically¹⁷, a 69-year-old male with HIV who was found to have peliosis hepatis thought to be due to Bartonella and whose liver and bone marrow biopsies showed hemophagocytosis compatible with HLH¹⁸, and a 48-year old female whose only past medical history was that of drug allergies and whose bone marrow biopsy confirmed hemophagocytic activity and metagenomic next generation-sequencing analysis detected the presence of B. henselae in an inguinal lymph node¹⁹. In this third case, the patient had no known immunocompromising condition but was found through genomic sequencing to have a variants of two genes, one of which is implicated in the pathogenesis of a familial HLH subtype and another which is associated with a susceptibility to autoimmune disease¹⁹.

Clinical manifestations of Bartonella infection

More than twenty different Bartonella species have been isolated though only three – B. henselae, B. quintana, and B. bacilliformis – have been thought to cause significant clinically relevant disease in humans. Bartonella henselae was first named Rickettsia ctenocephalidi. Most species in this genus have an identified mammalian reservoir. Most species also have an identified arthropod vector including the sandfly for B. bacilliformis, the body louse for B. quintana, and the cat flea for B. henselae ^20,21. While exposure to cats is the major risk factor for B. henselae infection in immunocompetent persons²², our patient did not have this exposure history and was instead noted to have contact with an ailing pet dog. Wild canids and domestic dogs have been shown to be the primary reservoir of B. vinsonii berkhoffii, and canines can be infected with several Bartonella species²³. Humans usually become infected with B. henselae after inoculation with cat scratches. However, human inoculation also occurs via direct cutaneous inoculation of feces from arthropods that infest and feed on Bartonella-infected companion animals, which have close contact with people. Therefore, exposure to pets should raise the index of suspicion for Bartonella infection. Bartonella species can cause a wide range of disease syndromes such as Carrion's disease, trench fever, CSD, bacillary angiomatosis, bacillary peliosis hepatis, chronic bacteremia, endocarditis, chronic lymphadenopathy, and neurological disorders such as aseptic meningitis, encephalopathy, and neuroretinitis^1,2. Of the members of this genus, B. henselae is associated with the greatest diversity of disease presentation, and the nature and severity of the disease course tends to correlate with the host’s immune status²⁰. The majority of immunocompetent hosts infected with B. henselae develop localized disease in the form of CSD, comprised of regional lymphadenopathy and possibly fevers that typically has a self-limited course²⁴.

Bartonella species have been known to exhibit a tropism towards endothelial cells and can induce angioproliferation via direct and indirect mechanisms ^20,25. B. henselae and B. quintana have been shown to undergo localized replication within the peri-endothelial extracellular matrix. This leads to the secretion of effector proteins BepA and BepA2 which induces an anti-apoptotic state in endothelial cells through a cAMP-mediated signaling pathway²⁶. Indirectly, Bartonella has been implicated in inducing a NF-κβ-mediated proinflammatory state that leads to the paracrine production of vascular endothelial growth factor (VEGF) by recruited macrophages^20,25,26. Both mechanisms ultimately lead to anomalous endothelial cell proliferation and the production of a distinct vasculoproliferative lesion that can affect many different organs and is known as bacillary angiomatosis. A related lesion that is found in the liver, spleen, or bone marrow is termed bacillary peliosis, which is only recognized to be caused by B. henselae²¹. Compromised cell-mediated immunity hinders spontaneous resolution of infection and severely immunocompromised persons, such as those with HIV/AIDS and with CD4 counts <100 cells/μL, are at increased risk for disseminated disease and bacillary angiomatosis-peliosis (BAP) ^20,21,27.

Fevers and cutaneous and subcutaneous bacillary angiomatosis lesions are thought to be the most common manifestation of B. henselae and B. quintana infection in HIV-infected patients^26,28. In a case-control study investigating the clinical characteristics of BAP in HIV-infected patients, cutaneous and subcutaneous lesions were only found in 55% of the case patients. The remainder presented with lymphadenopathy alone or with fever and abdominal pain²⁹. In this same study, HIV patients with BAP disease were more severely immunocompromised (median CD4 count of 21 cells/mm³) compared to controls (median CD4 count of 186 cells/mm³), which could be taken to mean that BAP occurs in the late stages of HIV infection and should be considered an AIDS-defining illness²⁹. However, another case-control study showed no statistically significant difference in the median CD4 counts between case patients with concomitant HIV and Bartonella infection versus the HIV-infected controls, 35 versus 40 cells/mm^{3 28}.

Interestingly, Bartonella infection has not been frequently reported in solid organ transplant (SOT) recipients, and the diagnosis of bartonellosis in this population is not straightforward³⁰. Some of the clinical features of Bartonella infection (e.g. lymphadenopathy and fevers) can be caused by other viral, protozoal, fungal or mycobacterial opportunistic infections, all of which appear to be more common than Bartonella^31,32. In a case series reviewing B. henselae infection in 29 solid organ transplant recipients, fever in the setting of close cat exposure was the common manifestation of infection. Interestingly, in contrast to the angioproliferative characteristics of BAP that are typically observed in the HIV-infected patients, the histopathologic characteristics of Bartonella infection in SOT patients more closely resembled the granulomatous-suppurative inflammation that is seen in CSD³³. Those who did have a BAP pattern developed infection earlier in their post-transplant course. Though it could be surmised that these patients were potentially on more intense IS regimens earlier in their post-transplant course, the authors did not find an association between any particular IS regimen and the development of BAP³³.

Diagnostic considerations for suspected Bartonella infections

Methods used in establishing the diagnosis of Bartonella infection include culture, polymerase chain reaction (PCR) assay, serologic assays, and histopathologic examination. Serologic methods have proven to be useful even in the immunosuppressed transplant population. In a case series of B. henselae-infected SOT recipients, serologies eventually turned positive in all 23 patients in whom serologic studies were performed. Even those patients who developed this infection early in their post-transplant course – when immunosuppressive therapy would be expected to be at its maximal intensity – mounted high antibody titers³³. In this same case series, 23 of 29 patients had tissue specimens that, under histopathologic evaluation, were either compatible with a diagnosis of Bartonella infection or prompted further work-up for it. Silver impregnation stains, such as Warthin-Starry, Steiner and Dieterle staining, are used to reveal the characteristic Bartonella bacilli in tissue specimens^34-36. These special stains should be considered when histologic findings compatible with BAP are present, such as in the case of our patient.

Given its fastidious nature and slow growth rate, isolation of this organism from culture is challenging, and the sensitivity of culture is only approximately 20%^37,38. PCR can be used to establish the Bartonella diagnosis and can be applied to tissue samples and less invasive specimens, such as purulent material from a cutaneous lesion or lymph node, and serum. Depending on the PCR method, sensitivity can vary from approximately 40 to 80%³⁹. Bartonella IgM is not thought to be a useful test in isolation and there are very high rates of serological cross-reactivity between B. quintana and B. henselae. However, the combined detection of Bartonella IgG by immunofluorescent assay (IFA) and real-time PCR has been shown to have clinical utility especially when non-invasive screening is desired or serological results are equivocal ^40,41.

While the presence of Bartonella in our patient’s liver tissue was not confirmed by immunohistochemistry or by PCR due to limited specimen availability, we regard it as the most likely etiology of his secondary HLH given the positive Warthin-Starry staining of the bone marrow, reactive Bartonella serologies, and detection of Bartonella DNA by PCR in the blood. Furthermore, our patient lacked other plausible causes of secondary HLH. His HIV was well-controlled as evidenced by his undetectable viral load. There was no evidence of EBV, CMV or HHV-8 replication, which are the more commonly recognized triggers for HLH. Donor-derived infection was not suspected given the length of time since his DDRT.

Treatment of Bartonella-associated HLH

The complete therapy protocol for HLH, which consists of dexamethasone, etoposide, cyclosporine, and intravenous immunoglobulin (IVIG), has mostly been validated in pediatric cohorts with primary HLH, and its applicability to adults with secondary HLH is less clear^42,43. In critically ill adults, the component drugs are commonly applied in a piecemeal fashion^14,15,44 and to mitigate unnecessary toxicity, dose reductions and individualized tailoring of treatment components and duration have been recommended⁴².

In secondary forms of HLH, treatment is more generally focused on dampening inflammatory responses with immunosuppressive or cytotoxic drugs such as etoposide and removal of the underlying trigger. Azithromyin, doxycycline, and gentamicin are all considered effective against Bartonella but the regimen of azithromycin and/or doxycycline is most commonly used in solid organ recipients. Macrolides also have immunomodulatory effects, which include reducing vascular endothelial growth factor (VEGF) activity, which may have additional benefits for Bartonella vascular lesions⁴⁵. The duration of therapy is not well-defined though given the high risk for morbidity in the immunosuppressed population and the propensity for relapse of Bartonella infections, a prolonged duration of antimicrobial therapy is typically favored⁴⁶.

This strategy was employed for the cases of Bartonella-induced HLH previously mentioned. All three patients made expected recovery following a variety of different regimens: prednisone taper for one month and doxycycline and azithromycin for 12 months¹⁷, single-infusion of etoposide and doxycycline for six months¹⁸, and IVIG and methylprednisolone for five days and minocycline/rifampin for one month¹⁹. Our patient was similarly treated with 12 months of doxycycline and a steroid taper with excellent clinical response and no relapse at approximately two years of follow up.

Conclusions

In conclusion, HLH is a life-threatening condition and identification of its trigger is essential to the initiation of directed therapy. Our case demonstrates that screening for Bartonella should be considered in patients who meet criteria for HLH especially those with risk factors of immunosuppression and appropriate animal exposures.

Search strategy and selection criteria

Data for this Grand Round were identified by searches of Medline and references from relevant articles and textbooks. Search terms were “HLH”, “bartonella”, “HLH, bartonella”, “HLH, solid organ transplant”, “HIV, bartonella” and “peliosis hepatis”. Only English language papers were reviewed. No date restrictions were set in these searches.

Abbreviations

AFB

acid-fast bacilli

BAP

bacillary angiomatosis-peliosis

CSD

cat-scratch disease

CT

computed tomography

cAMP

cyclic adenosine monophosphate

CMV

cytomegalovirus

CTL

cytotoxic T lymphocyte

DDRT

deceased donor renal transplant

EBV

Epstein-Barr virus

HHV

human herpesvirus

HIV

human immunodeficiency virus

HLH

hemophagocytic lymphohistiocytosis

IFA

immunofluorescence assay

IL

interleukin

IS

immunosuppressive

NK

natural killer

PCR

polymerase chain reaction

SOT

solid organ transplant

VEGF

vascular endothelial growth factor