Abstract
It is difficult to produce chitin oligosaccharides by hydrolyzing untreated natural chitinous waste directly. In this study, two fungi Talaromyces allahabadensis Hi-4 and Talaromyces funiculosus Hi-5 from rotten black soldier fly were isolated and identified through multigene phylogenetic and morphological analyses. The chitinolytic enzymes were produced by solid state fermentation, and the growth conditions were optimized by combining single-factor and central composite design. The best carbon sources were powder of molting of mealworms (MMP) and there was no need for additional nitrogen sources in two fungi, then the maximum chitinolytic enzyme production of 46.80 ± 3.30 (Hi-4) and 55.07 ± 2.48 (Hi-5) U/gds were achieved after analyzing the 3D response surface plots. Pure chitin (colloidal chitin) and natural chitinous substrates (represented by MMP) were used to optimize degradation abilities by crude enzymes obtained from the two fungi. The optimum temperature for hydrolyzing MMP (40 °C both in two fungi) were lower and closer to room temperature than colloidal chitin (55 °C for Hi-4 and 45 °C for Hi-5). Then colloidal chitin, MMP and the powder of shrimp shells (SSP) were used for analyzing the products after 5-day degradation. The amounts of chitin oligosaccharides from SSP and MMP were about 1/6 (Hi-4), 1/17 (Hi-5) and 1/8 (Hi-4), 1/10 (Hi-5), respectively, in comparison to colloidal chitin. The main components of the products were GlcNAc for colloidal chitin, (GlcNAc)2 for MMP, and oligosaccharides with higher degree of polymerization (4–6) were obtained when hydrolyzing SSP, which is significant for applications in medicine and health products.
Supplementary information
The online version contains supplementary material available at 10.1007/s42770-022-00882-3.
Keywords: Natural chitinous wastes, Fungi, Degradation, Enzymes, Oligosaccharides
Introduction
Chitin is widely present in nature, mainly found in shells of crustaceans, exoskeletons of arthropods, peritrophic matrix of insects, cell walls of fungus, and some algas, protozoan cysts [1]. It is the second most abundant polysaccharide after cellulose. About 6 to 8 million tons of crustacean wastes are reported to be produced in the ocean worldwide annually [2, 3]; in addition, there are no clear statistics on insects and fungi. In the natural state, chitin is limited in its application because it is insoluble. So, in recent years, the water-soluble chitin oligosaccharides have attracted much attention because of their anti-tumor, antioxidant, immune enhancement and antibacterial activity [4]. Chitin oligosaccharides, also known as N-acetyl chitooligosaccharides (NAc-COS) are generally obtained by degradation from chitin with physical pretreatment, followed with acid or enzyme hydrolysis [5, 6].
Chitinase is a class of glycosyl hydrolases that can specifically act on β-1,4 glycoside bonds of chitin. Up to now, it has been found in bacteria, fungi, insects, plants, and vertebrates. Among them, the chitinase from microorganisms are more abundant and varied. Currently, the separation and screening of the chitin-degrading bacteria and fungi are mostly from the marine and soil environments, such as bacterial genera Aeromonas [7], Bacillus [8, 9], Chitiniphilus [10], Paenibacillus [11, 12], Serratia [13], Stenotrophomonas [14], Vibrio [15], and fungal genera Acremonium [16], Humicola [17], Trichoderma [18], Saccharomyces, and Ustilago [19]. In addition to the large environments of soil and ocean, there are also scholars who turn their attention to some small special environments, for example, Le and Yang [20] have screened the Salinivibrio from salted shrimp, Zhang et al. [21] identified a strain of Pedobacter chitinilyticus from wheat leaf tissue, Moon et al. [22] and Tu et al. [23] screened the Serratia marcescens from the cockroaches and gut of Chinese bees, respectively. It is worth noting that compared to bacteria, chitinase secreted by fungi are more abundant in terms of species, quantity and function. In general, there are 10 to 25 different chitinase coding genes in a filamentous fungus [24]. Therefore, the search for new fungi with chitin-degrading activity from some special environments is of great importance to the study of chitinase.
Solid state fermentation (SSF) refers to a method of fermentation that the microorganisms grow on solid substrates that have absence of free water [25]. Compared with submerged fermentation, the growing conditions of SSF are closer to natural habitat for filamentous fungi [26], which leads to the microbes easier to grow and produce abundant enzymes. Moreover, SSF is cost effective because of the use of cheaper substrates [27]. Since the yield and activities of enzymes are affected by the compositions of medium and fermentation conditions, it is necessary to select an effective medium formulation and to optimize the culture conditions [28].
Because the main components of insect cuticle and peritrophic matrix are chitin, it is speculated that there may be chitin-degradation strains in dead and rotten insects. In this study, the dead and rotten black soldier fly (Hermetia illucens) was used to find strain with chitin-degradation activities. After selecting, two fungi with high chitinolytic activities were identified. Then, they were investigated for optimal medium components and growth conditions in solid state fermentation. In addition, in order to verify the degradation abilities to chitin-substances, the crude enzymes of the two fungi were obtained and the activities of them to pure chitin and chitin-containing substances were further studied.
Materials and methods
Materials
Colloidal chitin
A little (10–20 mL) deionized water was added to 5 g of chitin powder from shrimp shells (Sigma-Aldrich, 100 mesh sieves after grinding), then slowly adding 125 mL 85% precooled phosphoric acid to dissolve it at 4 °C. Adding some distilled water, the precipitate was collected by centrifugation at 4000 rpm (5975 × g) for 20 min at 25 °C, and repeatedly washed with distilled water until the pH reached 7. Then, distilled water was added to adjust a constant volume of 500 mL, stored it at 4 °C [29].
Medium matrix (substrates)
Wheat bran (WB), shrimp shells (SS), crab shells (CS), molting of mealworms (MM), puparium of black soldier fly (PB) were washed with flowing tap water to remove soluble nutrients, and dried them at 60 °C. A portion of them were powdered and passed through an 80-mesh sieve, the other parts were cut into small pieces (2–4 mm in diameter).
Isolation of chitinolytic fungi
Collecting dead and rotten black soldier flies cultured in laboratory. The tissues were picked out and inoculated in enrichment media composed by (g/L): 6.0 Na2HPO4, 3.0 KH2PO4, 1.0 NH4Cl, 0.5 NaCl, 0.5 yeast extract, pH 6. Incubated at 30 °C, 150 rpm, for 5–7 days. The enriched microbic solution was diluted and coated at colloidal chitin medium plates, composed by (g/L): 6.0 Na2HPO4, 3.0 KH2PO4, 0.5 NH4Cl, 0.5 NaCl, 0.05 yeast extract, 0.5% (W/V) colloidal chitin, 15 agars, incubated at 30 °C for 5 days, selecting the colonies with hydrolytic circles to continue being inoculated on colloidal chitin medium plate. Trichoderma viride (ACCC 30,552) and sterile water were used as positive and negative controls, respectively. The screened fungi (number them as Hi-4 and Hi-5, respectively) were obtained through repeatedly streaking, suspending the two fungal spores in 30% glycerol (v/v) and stored them at − 80 °C.
Identification of fungi: DNA sequencing, phylogenetic analysis, and morphology observation
Fungal spores were inoculated in Potato Dextrose Broth and cultured at 30 °C, 150 rpm for 3–5 days. DNA extractions were made using the E.Z.N.A.® Fungal DNA Mini Kit (Omega Bio-tek, USA).
For phylogenetic analysis, four nuclear loci were sequenced. The ribosomal internal transcribed spacer (ITS) and Calmodulin (CaM) were amplified using primer pair ITS1/ITS4 (TCCGTAGGTGAACCTGCGC/ TCCTCCGCTTATTGATATGC) and cmd5/cmd6 (CCGAGTACAAGGAGGCCTTC/ CCGATAGAGGTCATAACGTGG), respectively, with a standard thermal cycle that ran 35 cycles and had a 55 °C annealing temperature. For β-tubulin (BenA), primer-pair Bt2a (GGTAACCAAATCGGTGCTGCTTTC) and Bt2b (ACCCTCAGTGTAGTGACCCTTGGC) was used with a 58 °C annealing temperature [30]. For the DNA-dependent RNA polymerase II second largest subunit (RPB2), primer-pair 5F (GAYGAYMGWGATCAYTTYGG) and 7Cr (CCCATRGCTTGYTTRCCCAT) was used with a step-up PCR that started with 5 cycles and annealing temperature of 51 °C, followed by 5 cycles at 49 °C and a final 30 cycles at 47 °C [31].
Macroscopic characters were studied on the plates of Malt Extract Agar media. Plates were incubated for 5 days at 30 °C. Morphologies and colors of the colonies were observed according to the method of Yilmaz et al. [32]. The microstructures were captured using a Leica inverted microscope DMi1, and the images were processed using LAS V4.12 software.
SSF and extraction of fermentation products
SSF were conducted in 250 mL Erlenmeyer flasks containing 4.5 g substrates, 0.5 g carbon source, and 10 mL salt solutions. The composition of salt solution was (g/L): KH2PO4 (3.0), MgSO4 · 7H2O (2.0), NaCl (2.0), and 0.1 (v/v) trace element solution containing (%, w/v) 0.2 FeSO4 · 7H2O, 0.2 ZnSO4, and 0.2 MnSO4, pH 4.0. One milliliter of spore inoculum (1*107 cfu/mL) was inoculated. The solutions of extracellular proteins were obtained according to Liu et al. [25]. Briefly, 70 mL of deionized water containing 0.1% (w/v) Tween-80 was added to dissolve proteins at 4 °C with shaking (180 rpm) for 2 h. The clear supernatants were filtered through a 0.22 μm filter.
Determination of chitinolytic activity
The reaction mixtures contain 0.8 mL of 1% colloidal chitin dissolved in 50 mM phosphate buffer (PBS) (pH 6.0) and 0.8 mL of fermented supernatant. The mixture was incubated for 1 h at 55 °C. The released reducing sugar was quantitated using 3,5-dinitro-salicylic acid (DNS) assays [33], in which, N-Acetyl-D-glucosamine was used for standard curve. One unit of chitinolytic activity was defined as the amount of enzyme that catalyzed the release of 1 μmoL of reducing sugar per hour and was expressed according to the dry weight of the substrate (U/gds) [34].
Optimization of nutrient and culture conditions by single-factor design
Flakes of WB, SS, CS, MM, PB were chosen to obtain suitable substrates. Different carbon sources, namely, the powder of chitin (CP), shrimp shells (SSP), crab shells (CSP), molting of mealworms (MMP), puparium of black soldier fly (PBP), and nitrogen sources (including (NH4)2SO4, urea, yeast extract, tryptone, and without any additive) were selected to improve the production of chitinolytic enzymes. The impacts of culture conditions were also optimized, including carbon source concentrations (10–90%), initial moisture contents (5–25 mL), temperature (15–55 °C), initial pH (2–8), inoculation amount (1*104–1*108), and incubation period (2–10 days). Three biological replicates were performed.
Further optimization of culture conditions by central composite design (CCD) and statistical analysis
After the single-factor experiment, carbon source concentrations (X1), initial moisture contents (X2), temperature (X3), and incubation period (X4) were screened to carry on a CCD for finer optimization. Each of them was considered at five levels (− 1.68, − 1, 0, + 1, + 1.68) (Table 1 and Table 2).
Table 1.
The levels of the independent variables for Hi-4
| Variables | Code | Units | Levels | ||||
|---|---|---|---|---|---|---|---|
| − 1.68 | − 1 | 0 | + 1 | + 1.68 | |||
| Carbon source concentrations | X1 | % | 6.36 | 20.00 | 40.00 | 60.00 | 73.64 |
| Initial moisture contents | X2 | mL | 1.59 | 5.00 | 10.00 | 15.00 | 18.41 |
| Temperature | X3 | °C | 18.18 | 25.00 | 35.00 | 45.00 | 51.82 |
| Incubation period | X4 | Days | 4.64 | 6.00 | 8.00 | 10.00 | 11.36 |
Table 2.
The levels of the independent variables for Hi-5
| Variables | Code | Units | Levels | ||||
|---|---|---|---|---|---|---|---|
| − 1.68 | − 1 | 0 | + 1 | + 1.68 | |||
| Carbon source concentrations | X1 | % | 26.36 | 40.00 | 60.00 | 80.00 | 93.64 |
| Initial moisture contents | X2 | mL | 1.59 | 5.00 | 10.00 | 15.00 | 18.41 |
| Temperature | X3 | °C | 8.18 | 15.00 | 25.00 | 35.00 | 41.82 |
| Incubation period | X4 | Days | 0.64 | 2.00 | 4.00 | 6.00 | 7.36 |
The above four variables were coded by the following formula (1):
| 1 |
where Xi is the coded value of variable, Zi is the actual value, Z0 is the actual value of the corresponding variable at the center point and ΔZ represents the variable step change.
The details of CCD were given in Table 3 and Table 4.
Table 3.
Central composite designs and results of the parameters in real units for Hi-4
| Run | Experimental values | Chitinolytic activity (U/gds) | ||||
|---|---|---|---|---|---|---|
| X1 (%) | X2 (mL) | X3 (℃) | X4 (Days) | Observed | Predicted | |
| 1 | 20.00 | 5.00 | 25.00 | 6.00 | 28.55 ± 0.45 | 27.94 |
| 2 | 40.00 | 18.41 | 35.00 | 8.00 | 26.85 ± 0.60 | 25.60 |
| 3 | 40.00 | 10.00 | 51.82 | 8.00 | 0.005 ± 0.002 | -4.80 |
| 4 | 20.00 | 15.00 | 45.00 | 10.00 | 0.44 ± 0.09 | 2.82 |
| 5 | 73.64 | 10.00 | 35.00 | 8.00 | 30.72 ± 1.69 | 29.47 |
| 6 | 40.00 | 10.00 | 18.18 | 8.00 | 20.18 ± 0.78 | 22.48 |
| 7 | 40.00 | 10.00 | 35.00 | 8.00 | 37.34 ± 0.21 | 41.16 |
| 8 | 40.00 | 10.00 | 35.00 | 8.00 | 37.42 ± 0.83 | 41.16 |
| 9 | 60.00 | 5.00 | 45.00 | 10.00 | 0.02 ± 0.01 | 2.40 |
| 10 | 40.00 | 10.00 | 35.00 | 8.00 | 42.70 ± 0.35 | 41.16 |
| 11 | 20.00 | 5.00 | 45.00 | 6.00 | 0.88 ± 0.47 | 3.26 |
| 12 | 60.00 | 5.00 | 25.00 | 10.00 | 14.05 ± 1.02 | 13.44 |
| 13 | 60.00 | 15.00 | 25.00 | 6.00 | 14.21 ± 0.59 | 13.60 |
| 14 | 6.36 | 10.00 | 35.00 | 8.00 | 27.44 ± 0.43 | 26.19 |
| 15 | 40.00 | 10.00 | 35.00 | 4.64 | 25.46 ± 1.80 | 24.21 |
| 16 | 40.00 | 1.59 | 35.00 | 8.00 | 10.29 ± 0.20 | 9.04 |
| 17 | 60.00 | 15.00 | 45.00 | 6.00 | 0.92 ± 0.26 | 3.30 |
| 18 | 40.00 | 10.00 | 35.00 | 8.00 | 41.03 ± 0.94 | 41.16 |
| 19 | 20.00 | 15.00 | 25.00 | 10.00 | 22.28 ± 1.11 | 21.67 |
| 20 | 40.00 | 10.00 | 35.00 | 8.00 | 44.39 ± 1.47 | 41.16 |
| 21 | 40.00 | 10.00 | 35.00 | 11.36 | 28.09 ± 0.40 | 26.84 |
Data are mean ± SD, n = 3
Table 4.
Central composite designs and results of the parameters in real units for Hi-5
| Run | Experimental values | Chitinolytic activity (U/gds) | ||||
|---|---|---|---|---|---|---|
| X1 (%) | X2 (mL) | X3 (℃) | X4 (Days) | Observed | Predicted | |
| 1 | 80.00 | 5.00 | 15.00 | 6.00 | 9.62 ± 0.33 | 10.51 |
| 2 | 60.00 | 10.00 | 25.00 | 0.64 | 4.76 ± 0.14 | 4.71 |
| 3 | 40.00 | 15.00 | 35.00 | 6.00 | 34.65 ± 0.95 | 33.84 |
| 4 | 60.00 | 10.00 | 25.00 | 7.36 | 42.47 ± 0.31 | 42.42 |
| 5 | 40.00 | 5.00 | 15.00 | 2.00 | 6.20 ± 0.09 | 7.09 |
| 6 | 60.00 | 1.59 | 25.00 | 4.00 | 13.26 ± 0.38 | 13.21 |
| 7 | 40.00 | 5.00 | 35.00 | 2.00 | 4.55 ± 0.49 | 3.74 |
| 8 | 60.00 | 10.00 | 25.00 | 4.00 | 49.33 ± 0.32 | 50.21 |
| 9 | 60.00 | 10.00 | 25.00 | 4.00 | 47.64 ± 0.55 | 50.21 |
| 10 | 60.00 | 10.00 | 25.00 | 4.00 | 50.76 ± 1.72 | 50.21 |
| 11 | 60.00 | 10.00 | 25.00 | 4.00 | 51.03 ± 0.45 | 50.21 |
| 12 | 60.00 | 10.00 | 8.18 | 4.00 | 0.007 ± 0.003 | -2.07 |
| 13 | 60.00 | 10.00 | 25.00 | 4.00 | 52.19 ± 0.57 | 50.21 |
| 14 | 40.00 | 15.00 | 15.00 | 6.00 | 11.89 ± 0.08 | 12.78 |
| 15 | 80.00 | 15.00 | 15.00 | 2.00 | 7.60 ± 0.15 | 8.49 |
| 16 | 80.00 | 15.00 | 35.00 | 2.00 | 7.02 ± 0.65 | 6.21 |
| 17 | 93.64 | 10.00 | 25.00 | 4.00 | 42.47 ± 0.82 | 42.42 |
| 18 | 60.00 | 10.00 | 41.82 | 4.00 | 11.73 ± 0.17 | 13.70 |
| 19 | 60.00 | 18.41 | 25.00 | 4.00 | 39.95 ± 1.60 | 39.90 |
| 20 | 80.00 | 5.00 | 35.00 | 6.00 | 33.38 ± 0.70 | 32.57 |
| 21 | 26.36 | 10.00 | 25.00 | 4.00 | 44.89 ± 0.65 | 44.84 |
Data are mean ± SD, n = 3
The relationship of the response (Enzyme activity) and the four variables was fitted by using the second-order polynomial model, formula (2):
| 2 |
where Y is the predicted response, βo represents the intercept, βi, βii and βij are the linear, quadratic and interaction coefficients, respectively. Xi and Xj are the variables that were coded [35, 36].
Data were analyzed by using Design-Expert 12, then fermentations were carried out under optimal conditions to obtain optimal enzyme production as suggested.
Effects of the pH, temperature and substrate on chitin-degradation by crude enzyme
The crude enzymes were precipitated using 83% ammonium sulfate for 12 h at 4 °C, dissolved in PBS (50 mM, pH 6.0) after centrifugation (20,913 × g for 10 min at 4 °C), then the enzymatic fluids were concentrated and buffer-exchanged with 50 mM PBS by ultrafiltration centrifuge tubes (Millipore, the molecular weight cutoff was 3.5 kDa). The concentrations of the crude enzymes were quantified by using BCA Protein Assay Kit (Solarbio), and were analyzed by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Before discussing the chitin-degradation of crude enzyme, the protein concentrations were adjusted to 2 μg/μL using 50 mM PBS (pH 6.0).
To study the effects of pH on chitin-degradation, 2% colloidal chitin (pure) or MMP (chitin-containing), 250 μL crude enzymes, and 750 μL 50 mM PBS (the pH range from 1.0 to 8.0) were mixed together and incubated at 40 °C for 1 h (colloidal chitin) or 10 h (MMP). The effects of temperature were observed varied from 25 to 65 °C (colloidal chitin) or 30 to 55 °C (MMP). After the optimum pH and temperature were determined, different substrates including colloidal chitin, CP, SSP, CSP, PBP, MMP and the residue powder after the fermentation of Hi-5 (MMFP) were degraded, the schematic diagram of the experimental process was shown in Fig. 1.
Fig. 1.
Schematic diagram of degrading natural chitinous by chitinolytic enzymes from two Talaromyces sp. MM, PB, SS and CS represent raw materials of molting of mealworms, puparium of black soldier fly, shrimp shells and crab shells, respectively. And MMP, PBP, SSP, CSP respectively represent the powder state of the corresponding materials mentioned above
For the tested, 500 μL of the supernatant was collected and the released reducing sugar was quantitated using DNS assay. The degradation efficiency of chitin substrates was shown by the amount of reducing sugar obtained per hour (μmoL/h).
Hydrolysis products of colloidal chitin, SSP and MMP by crude enzyme
To obtain enough hydrolysis products from different substrates, the reactions were carried out in a twofold system (500 mL crude enzymes (2 μg/μL), 1500 mL buffer and 2% substrates), clear supernatants were obtained through a 0.22 μm filter, then removing proteins and macromolecules by an ultrafiltration centrifuge tube (3.5 kDa), collecting filtrate and freezing-dry.
The degradation products of colloidal chitin, SSP and MMP were analyzed through High-performance liquid chromatography (HPLC) on a CoMetro 6000 System (CoMetro Technology Ltd, USA) equipped with an NH2 Column (5 µm, 4.6 mm × 250 mm; GL Sciences, Japan) and an UV-detector set at 195 nm. The injection was 20 µL, the mobile phase consisted of acetonitrile and water (7:3, v/v) and the flow rate was set at 0.5 mL/min. The products were identified and quantified by comparing with the standard NAc-COS samples with the degrees of polymerization (DP) 1–6 (TCI, Tokyo, Japan) [37].
Results and discussion
Plate screening of strains with chitinolytic activity
On the colloidal chitin plate, two fungi with abilities of chitin degradation were selected and numbered as Hi-4 and Hi-5. As shown in Fig. 2, the negative control (sterile water) was no strain growth, for Trichoderma viride (positive control), light colonies can be seen, while the color was white and the hyphae were sparse. The sieved strains Hi-4 and Hi-5 grew well on chitin agar with diameters of 155.6 ± 7.87 mm and 222.4 ± 7.85 mm, respectively, and there were light transparent zones that appeared on the edge of the colonies.
Fig. 2.
Plate screening fungi with chitinolytic activity. A and B represent the reverse and obverse sides of the plate, respectively
Identification of Hi-4 and Hi-5
In this study, three combined loci of the BenA, CaM, RPB2 for Hi-4 and ITS, BenA, CaM for Hi-5 were sequenced and blasted on the NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Sequences of 22 related species containing the above loci (shown in Online Resource ESM_1.pdf) were downloaded and used to determine the relationship of Hi-4 and Hi-5.
The length of the BenA, CaM and RPB2 partitions (GenBank accession nos. MZ286327, MZ286328 and MZ286329) were 426, 526 and 1105 base pairs, respectively. In Maximum likelihood analyses (ML), the most optimal models were TRNEF + G (loci BenA, CaM) and K80 + G (RPB2), and the method of p-distance was used in the analysis of Neighbor-Joining (NJ). The phylogenetic trees shown in Fig. 3A (1,2) confirmed that Hi-4 strain was closely related to Talaromyces allahabadensis (T. allahabadensis). Figure 3A (3) showed the colony morphology and micromorphology of Hi-4. The colonies were raised slightly at center, with velvety texture, white and yellow mycelia, and dull green conidia. The stipes were smooth and walled (1.7–2.6 μm in width), the conidia showed a shape of ellipsoid to fusiform (1.7–2.7 μm in width × 2.6–3.9 μm in length). Phenotypes described above were similar to the morphology of T. allahabadensis reported by Yilmaz et al. [32]. Accordingly, combined the phylogenetic and morphological analyses, Hi-4 was identified as T. allahabadensis.
Fig. 3.
Phylogenetic trees of (A1) ML, (A2) NJ for Hi-4 and (B1) ML, (B2) NJ for Hi-5. The macroscopic and microscopic characters of (A3) Hi-4 and (B3) Hi-5, scale bars in the conidiophores are 20 μm
The lengths of the ITS, BenA, and CaM partitions (GenBank accession nos. MZ284958, MZ286330 and MZ286331) were 558, 458 and 512 base pairs, respectively. The best-fit models of ML were TIM + G for loci ITS and TRNEF + G for BenA and CaM. And the method of p-distance was used in NJ analyses. The phylogenetic trees indicated the strain of Hi-5 closed to Talaromyces funiculosus (T. funiculosus) (Fig. 3B (1,2)). The colonies with funiculus texture, white mycelia, and greyish green to dull green conidia. The stipes were smooth and walled (2.3–4.6 μm in width), conidia were smooth, ellipsoidal to spherical (1.2–1.4 μm in width × 1.2–2.3 μm in length) (Fig. 3B (3)), which were similar to the characterizations of Talaromyces funiculosus reported by Yilmaz et al. [32]. Ultimately, Hi-5 was identified as T. funiculosus.
Optimization of parameters in SSF for improving chitinolytic enzyme production
Analysis of single factor experiment
As shown in Fig. 4a, WB and MM were the most suitable substrates for T. allahabadensis Hi-4 and T. funiculosus Hi-5, respectively. As an excellent substrate, WB was used worldwide in many SSF processes because of its rich active ingredients [38], therefore, it can be speculated that the nutrients contained in MM (including protein, fiber, fat and a variety of bioactive substances) were sufficient for chitin-degrading fungi. While significantly, few people have used MM (natural waste) as substrate in SSF, which obviously decrease the cost. Strains Hi-4 and Hi-5 produced enzyme quite well on the carbon source of MMP (Fig. 4b), and unlike other researches [33, 39], the two fungi had highest chitinolytic activities without any additional nitrogen sources (Fig. 4c), thus the nutritional value of MM was further confirmed.
Fig. 4.
Effects of medium composition (a, Medium Matrix; b, Carbon sources; c, Nitrogen sources; d, Carbon source concentrations) and culture conditions (e, Initial moisture contents; f, Temperature; g, Initial pH; h, Inoculation amount; i, Time) on chitinolytic enzyme production by T. allahabadensis Hi-4 and T. funiculosus Hi-5 strains. Data are mean ± SD, n = 3
The optimal contents of MMP (carbon source) were also explored, and the solutions were 40% (2 g MMP + 3 g WB) for Hi-4, and 60% (3 g MMP + 2 g MM) for Hi-5 (Fig. 4d). Moreover, the moisture content is a critical factor which can determine the growth and enzyme production of microbes [33, 40]. In this study, when the initial moisture added was 10 mL, both Hi-4 and Hi-5 produced chitinolytic enzyme better than the other contents (Fig. 4e). Besides nutritional parameters, the temperature, initial pH, inoculation amount and fermentation time would affect the production of chitinolytic enzyme. As shown in Fig. 4f/g, Hi-4 and Hi-5 had maximal chitinolytic activity in the temperature of 35 °C and 25 °C, respectively, and pH both 2.0. The chitinolytic activity of Hi-4 enhanced with the increase of inoculation amount, and then the trend slowed down (Fig. 4h), therefore, the inoculation amount was set at 1*107 in this study after a comprehensive consideration. Chitinolytic enzyme productions increased until they reached maximum at the cultivation of 8 and 4 days (Fig. 4i), and the production decreased afterwards, probably due to the lack of nutrients in the media and chitinolytic enzymes were hydrolyzed by some proteases secreted by the fungi.
Analysis of central composite design (CCD)
Response surface methodology was a widely used method to optimize parameters in the technology of fermentation [41–43]. In this study, four variables (X1, X2, X3, and X4) were optimized based on CCD, and the results were shown in Table 3 and Table 4.
The second-order empirical models used to fit the experimental model and the regression formulas were shown in Eqs. (3), (4):
| 3 |
| 4 |
Tables 5 and 6 showed the analysis of ANOVA for chitinolytic activity obtained from Tables 3 and 4, the analyses were performed at the levels of 5% significance. For T. allahabadensis Hi-4 and T. funiculosus Hi-5 (Tables 5 and 6). The F-value of 18.51/124.56 implied that the two models were significant, there were only 0.09% and 0.01% chance that an F-value this large could occur, implying that the reliability of the model was high. The coefficient of determination (R2) and the Adjusted R2 of the equation were 0.9774/ 0.9966 and 0.9246/ 0.9886, which indicated that the models fit well with the practices. The Lack of Fit is not significant relative to the pure error implied that the model can simulate the fermentation condition well.
Table 5.
ANOVA analysis of variance for chitinolytic activity (T. allahabadensis Hi-4)
| Source | Sum of squares | Df | Mean square | F-value | p-value | Status |
|---|---|---|---|---|---|---|
| Model | 4465.67 | 14 | 318.98 | 18.51 | 0.0009 | Significant** |
| X1-X1 | 5.38 | 1 | 5.38 | 0.3121 | 0.5966 | - |
| X2- X2 | 137.12 | 1 | 137.12 | 7.96 | 0.0303 | * |
| X3- X3 | 898.29 | 1 | 898.29 | 52.12 | 0.0004 | ** |
| X4- X4 | 3.46 | 1 | 3.46 | 0.2007 | 0.6699 | - |
| X1 X2 | 10.18 | 1 | 10.18 | 0.5910 | 0.4712 | - |
| X1 X3 | 61.55 | 1 | 61.55 | 3.57 | 0.1077 | - |
| X1 X4 | 105.02 | 1 | 105.02 | 6.09 | 0.0486 | * |
| X2 X3 | 5.40 | 1 | 5.40 | 0.3131 | 0.5960 | - |
| X2 X4 | 48.96 | 1 | 48.96 | 2.84 | 0.1429 | - |
| X3 X4 | 3.24 | 1 | 3.24 | 0.1879 | 0.6798 | - |
| X12 | 332.37 | 1 | 332.37 | 19.29 | 0.0046 | ** |
| X22 | 1062.47 | 1 | 1062.47 | 61.65 | 0.0002 | ** |
| X32 | 1952.07 | 1 | 1952.07 | 113.27 | < 0.0001 | ** |
| X42 | 457.16 | 1 | 457.16 | 26.53 | 0.0021 | ** |
| Residual | 103.40 | 6 | 17.23 | |||
| Lack of Fit | 63.71 | 2 | 31.85 | 3.21 | 0.1474 | Not significant |
| Pure Error | 39.70 | 4 | 9.92 | |||
| Cor Total | 4569.07 | 20 |
R2 = 0.9774, Adjusted R2 = 0.9246
− Represents no significant differences, * Significant values at p < 0.05, ** Significant values at p < 0.005
Table 6.
ANOVA analysis of variance for chitinolytic activity (T. funiculosus Hi-5)
| Source | Sum of squares | df | Mean square | F-value | p-value | Status |
|---|---|---|---|---|---|---|
| Model | 7628.19 | 14 | 544.87 | 124.56 | < 0.0001 | Significant** |
| X1-X1 | 2.93 | 1 | 2.93 | 0.6694 | 0.4445 | - |
| X2- X2 | 356.18 | 1 | 356.18 | 81.42 | 0.0001 | ** |
| X3- X3 | 299.98 | 1 | 299.98 | 68.57 | 0.0002 | ** |
| X4- X4 | 711.02 | 1 | 711.02 | 162.54 | < 0.0001 | ** |
| X1 X2 | 33.72 | 1 | 33.72 | 7.71 | 0.0321 | * |
| X1 X3 | 0.5356 | 1 | 0.5356 | 0.1224 | 0.7384 | - |
| X1 X4 | 162.78 | 1 | 162.78 | 37.21 | 0.0009 | ** |
| X2 X3 | 0.0006 | 1 | 0.0006 | 0.0001 | 0.9909 | - |
| X2 X4 | 1.92 | 1 | 1.92 | 0.4384 | 0.5325 | - |
| X3 X4 | 297.07 | 1 | 297.07 | 67.91 | 0.0002 | ** |
| X12 | 81.03 | 1 | 81.03 | 18.52 | 0.0051 | * |
| X22 | 1045.82 | 1 | 1045.82 | 239.07 | < 0.0001 | ** |
| X32 | 3682.16 | 1 | 3682.16 | 841.73 | < 0.0001 | ** |
| X42 | 1326.84 | 1 | 1326.84 | 303.31 | < 0.0001 | ** |
| Residual | 26.25 | 6 | 4.37 | |||
| Lack of Fit | 13.97 | 2 | 6.99 | 2.28 | 0.2186 | Not significant |
| Pure Error | 12.27 | 4 | 3.07 | |||
| Cor Total | 7654.43 | 20 |
R2 = 0.9966, Adjusted R2 = 0.9886
− Represents no significant differences, * Significant values at p < 0.05, ** Significant values at p < 0.005
P-values less than 0.05 indicate model terms were significant, in this case, for strain Hi-4 (Table 5), the interaction effects between X1 and X4 was significant, and the linear effect of X3 the second order effects of X12, X22, X32, X42 were most significant (P-value < 0.005). The order of factors on chitinolytic activity was temperature (X3), initial moisture contents (X2), carbon source concentrations (X1), and incubation period (X4). And for strain Hi-5 (Table 6), the linear effects of X2, X3 and X4, the interactive effects of X1X4 and X3X4, the second order effects of X22, X32, X42 were most significant (P-value < 0.005). The effects of four factors on chitinolytic activity were ordered as follow: X4, X2, X3, and X1.
The 3D response surface plots shown in Fig. 5 and Fig. 6 provided information about the interaction between two variables, and the other two remained at their respective center levels. Analysis of the model equation showed that the model had the optimal solution [26]. For T. allahabadensis Hi-4 (Fig. 5), the maximum chitinolytic enzyme production predicted (43.58 U/gds) would be achieved when the carbon source concentration was 45.72%, initial moisture content was 11.91 mL, temperature was 32.03 °C, and incubation period was 8.66 days. And for T. funiculosus Hi-5 (Fig. 6), the best combination of each factor was shown as follow: carbon source concentration (65.28%), initial moisture content (9.86 mL), temperature (28.28 °C), and incubation period (5.77 Days), the maximum predicted enzyme activity was 55.45 U/gds. In order to prove the accuracy of the model, three repeated experiments under optimal conditions were carried out. The results were 46.80 ± 3.30 and 55.07 ± 2.48 U/gds, it was basically consistent with the prediction results, which showed that the model equation was feasible, and could predict the actual fermentation results well.
Fig. 5.
3D response surface plots showing the interaction impact between two variables on chitinolytic enzyme production by T. allahabadensis Hi-4
Fig. 6.
3D response surface plots showing the interaction impact between two variables on chitinolytic enzyme production by T. funiculosus Hi-5
Overall, the effects of temperature and initial moisture contents were significant. While unlike other studies where moisture contents are generally low (< 100%) [33, 36, 44], the results in this test showed that the enzyme yields were optimum with the moisture contents of 11.91 mL (238.2%) and 9.86 mL (197.2%), respectively, which were higher than 100%; this may be related to the characteristics of the MM or the metabolic activities of fungi.
Effects of the pH, temperature and substrates on chitin-degradation efficiency
Different optimizations were made according to different substrates, one was colloidal chitin (pure chitin), another were the natural substances represented by MMP (containing chitin, protein, mineral salt, etc.). As shown in Fig. 7A and 7, for colloidal chitin (Y-axis on the left), the optimum pH of enzymatic hydrolysis was 3.0 both from Hi-4 and Hi-5 strains, and the optimum temperatures were 55 °C (Hi-4) and 45 °C (Hi-5). While for MMP (Y-axis on the right), the optimal pH were 3.0 (Hi-4) and 2.0 (Hi-5), and optimal temperatures were 40 °C both in two fungi, lower than that of the pure chitin substrate, this may be due to the composite effect of enzymes, like protease, cellulase, xylanase, lytic polysaccharide monooxygenases and so on [45, 46]. Analyses of the molecular weight of the crude enzymes were shown in Fig. 7D, the systems of two crude enzymes were complicated. The molecular weights of the proteins were concentrated at 30–60 kDa.
Fig. 7.
Effect of (A) pH, (B) temperature, (C) substrates on chitin-degradation efficiency, and (D) SDS-PAGE analysis of crude enzymes obtained from T. allahabadensis Hi-4 and T. funiculosus Hi-5 strains (M, molecular weight marker). Data are mean ± SD, n = 3
Then, different substrates were degraded at their optimal conditions, the amounts of reducing sugar obtained per hour were 3.67 ± 0.013 μmoL (Hi-4) and 3.93 ± 0.042 μmoL (Hi-5) from colloidal chitin, 0.45 ± 0.010 μmoL (Hi-4) and 0.76 ± 0.013 μmoL (Hi-5) from CP, 0.065 ± 0.001 μmoL (Hi-4) and 0.123 ± 0.001 μmoL (Hi-5) from MMP, 0.064 ± 0.001 μmoL (Hi-4) and 0.076 ± 0.001 μmoL (Hi-5) from SSP. While, the degradation abilities of crude enzymes to MMFP, CSP and PBP were quite low (Fig. 7C). The degradation abilities of the crude enzymes from Hi-4 and Hi-5 strains to colloidal chitin were both higher than untreated CP and natural chitin-substances (including MMP, SSP, MMFP, CSP and PBP). This may be because lots of strong acids used have destroyed the hydrogen bonds during the preparation of colloidal chitin. While chitin in natural substances, bound tightly with proteins, inorganic salts, pigments, etc., increasing the difficulties of degradation [47, 48]. Colloidal chitin underwent acid hydrolysis and continuous washing making the whole process costly, time-consuming and environment-contaminating [49, 50], on the contrary, the natural wastes were zero cost and environment-friendly.
Hydrolysis products after treatment with crude enzymes from Hi-4 and Hi-5
In order to understand the differences of the products after degrading different chitinous substrates by crude enzymes, colloidal chitin, SSP and MMP were selected as substrates in an expanded reaction system for 5 days under their optimum conditions. The reducing sugar contents were shown in Table 7, and the HPLC analyses of the chitin oligosaccharides were shown in Fig. 8.
Table 7.
The reducing sugar contents after degrading different chitinous substrates by crude enzymes from Hi-4 and Hi-5 strains (mg/L)
| Chitinous substrates | Crude enzyme from Hi-4 | Crude enzyme from Hi-5 |
|---|---|---|
| Colloidal chitin | 2592.01 ± 75.05 | 4109.90 ± 30.95 |
| SSP | 403.84 ± 28.95 | 236.79 ± 15.41 |
| MMP | 300.44 ± 30.93 | 419.46 ± 20.64 |
Data are mean ± SD, n = 3
Fig. 8.
HPLC analyses of the chitin oligosaccharides after hydrolyzing (A) colloidal chitin, (B) SSP, (C) MMP, and (D) the production of each degree of polymerization
For colloidal chitin, the proportions of GlcNAc were largest both after treatment with crude enzymes from Hi-4 and Hi-5 (Fig. 8A), with contents of 2574.12 ± 74.53 and 3954.54 ± 29.78 mg/L, respectively, followed by (GlcNAc)2 (17.88 ± 0.52 mg/L) treated with Hi-4, and (GlcNAc)4 (68.64 ± 0.52 mg/L), (GlcNAc)2 (49.32 ± 0.37 mg/L), (GlcNAc)3 (37.81 ± 0.28 mg/L) treated with Hi-5 (Fig. 8D). While, when the substrates became natural chitinous wastes, the products changed greatly in DP and yields. The chitin oligosaccharides both containing GlcNAc (344.80 ± 24.72 and 12.27 ± 0.80 mg/L), (GlcNAc)2 (3.72 ± 0.27 and 33.67 ± 2.19 mg/L), (GlcNAc)3 (0.81 ± 0.006 and 3.39 ± 0.22 mg/L), and (GlcNAc)4 (54.52 ± 3.91 and 4.97 ± 0.32 mg/L) after hydrolyzing SSP by enzymes from Hi-4 and Hi-5, and importantly, there were extra (GlcNAc)5 (88.21 ± 5.74 mg/L) and (GlcNAc)6 (94.31 ± 6.14 mg/L) existed after hydrolyzed by enzymes from Hi-5 (Fig. 8B and 8D). In addition, it is noteworthy that the (GlcNAc)2 were the major products after hydrolyzing MMP by enzymes from Hi-4 and Hi-5, with contents of 259.85 ± 26.75 and 418.11 ± 20.57 mg/L, respectively, followed by GlcNAc and a small amount of (GlcNAc)4 (Fig. 8C and D).
Overall, the pretreated colloidal chitin was more easily degraded by crude enzymes than natural chitinous materials, and the yield of its degradation products (chitin oligosaccharides) was the highest, this further confirmed the importance of acid in the degradation, which was consistent with the study by Suresh and Anil Kumar [51]. The DP of chitin oligosaccharides produced by hydrolysis of enzymes from Hi-5 were more abundant than that of from Hi-4, including (GlcNAc)3 and (GlcNAc)4, it can be speculated that when pure chitin substrates were hydrolyzed, they were first randomly cut off by enzymes, similar to the function of endochitinase, and then the polymers were decomposed into monomers by exochitinases [52]. At present, lots of researches have turned to the pretreatments of chitin by physical or chemical methods, and then degrading them to oligosaccharides by known chitinases, for example, Villa-Lerma et al. [53] studied on using partially purified chitinases from L. lecanii ATCC 26,854 to hydrolyze chitin pretreated by ultrasonication and steam-explosion; Wei, Zhang et al. [54] have obtained the GlcNAc as production through hydrolyzing crayfish shell wastes pretreated via high pressure homogenization. Our study focused on degrading natural chitinous substrates (including SSP and MMP) without any pretreated by crude enzyme mixtures. And interestingly, the DP of the products were not limited to monosaccharides, but also had disaccharide to hexasaccharide existed. The whole process was more environmentally friendly (no use of strong acid and alkali), low-cost (substrate were natural wastes, and do not need the assistance of special instruments), and easier to obtain oligosaccharides with higher degree of polymerization.
Conclusion
In this study, two fungi with high chitinolytic potential were isolated from the rotten black soldier fly and identified as T. allahabadensis Hi-4 and T. funiculosus Hi-5. Then, it has been proved that two fungi can use untreated natural chitinous waste (MMF) through solid state fermentation, which was environmentally friendly and low-cost. And the zymotic fluid (it was further concentrated into crude enzymes) containing chitinolytic enzymes was obtained after the optimization of medium composition and conditions. The degradation abilities of the crude enzymes from two fungi to MMP were 0.065 ± 0.001 μmoL/h (Hi-4) and 0.123 ± 0.001 μmoL/h (Hi-5), proving the possibilities of degrading natural chitinous substrates to oligosaccharides without any excess treatment, and the DP of NAc-COS obtained by degrading natural chitinous substrates (SSP and MMP) were more abundant than colloidal chitin, which have unlimited potential in health foods and medicine industry.
Then, the next research will focus on the analysis of the main components of the crude enzyme solution to obtain the key enzymes, and at the same time, make efforts for screening and obtaining chitin oligosaccharides with single DP.
Supplementary information
Below is the link to the electronic supplementary material.
Funding
This work was supported by the National Natural Science Foundation of China (nos. 31830084, 31970440, and 31672336), and also supported by the construction funds for the “Double First-Class” initiative for Nankai University (nos. 96172158, 96173250, and 91822294).
Declarations
Conflict of interests
The authors declare no competing interests.
Footnotes
Responsible Editor: Luis Nero
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Jinhua Xiao, Email: xiaojh@nankai.edu.cn.
Dawei Huang, Email: huangdw@nankai.edu.cn.
References
- 1.Jeon Y-J, Shahidi F, Kim S-K. Preparation of chitin and chitosan oligomers and their applications in physiological functional foods. Food Rev Int. 2000;16(2):159–176. doi: 10.1081/FRI-100100286. [DOI] [Google Scholar]
- 2.Li J, Huang WC, Gao L, Sun J, Liu Z, Mao X. Efficient enzymatic hydrolysis of ionic liquid pretreated chitin and its dissolution mechanism. Carbohydr Polym. 2019;211:329–335. doi: 10.1016/j.carbpol.2019.02.027. [DOI] [PubMed] [Google Scholar]
- 3.Wang J, Qian W, He Y, Xiong Y, Song P, Wang R-M. Reutilization of discarded biomass for preparing functional polymer materials. Waste Manage. 2017;65:11–21. doi: 10.1016/j.wasman.2017.04.025. [DOI] [PubMed] [Google Scholar]
- 4.Ngo D-N, Lee S-H, Kim M-M, Kim S-K. Production of chitin oligosaccharides with different molecular weights and their antioxidant effect in RAW 264.7 cells. J Funct Foods. 2009;1(2):188–198. doi: 10.1016/j.jff.2009.01.008. [DOI] [Google Scholar]
- 5.Laribi-Habchi H, Bouanane-Darenfed A, Drouiche N, Pauss A, Mameri N. Purification, characterization, and molecular cloning of an extracellular chitinase from Bacillus licheniformis stain LHH100 isolated from wastewater samples in Algeria. Int J Biol Macromol. 2015;72:1117–1128. doi: 10.1016/j.ijbiomac.2014.10.035. [DOI] [PubMed] [Google Scholar]
- 6.Benhabiles MS, Salah R, Lounici H, Drouiche N, Goosen MFA, Mameri N. Antibacterial activity of chitin, chitosan and its oligomers prepared from shrimp shell waste. Food Hydrocoll. 2012;29(1):48–56. doi: 10.1016/j.foodhyd.2012.02.013. [DOI] [Google Scholar]
- 7.Stumpf AK, Vortmann M, Dirks-Hofmeister ME, Moerschbacher BM, Philipp B. Identification of a novel chitinase from Aeromonas hydrophila AH-1N for the degradation of chitin within fungal mycelium. FEMS Microbiol Lett. 2018 doi: 10.1093/femsle/fny294. [DOI] [PubMed] [Google Scholar]
- 8.Liang TW, Hsieh JL, Wang SL. Production and purification of a protease, a chitosanase, and chitin oligosaccharides by Bacillus cereus TKU022 fermentation. Carbohydr Res. 2012;362:38–46. doi: 10.1016/j.carres.2012.08.004. [DOI] [PubMed] [Google Scholar]
- 9.Slimene IB, Tabbene O, Gharbi D, Mnasri B, Schmitter JM, Urdaci MC, Limam F. Isolation of a chitinolytic Bacillus licheniformis S213 strain exerting a biological control against Phoma medicaginis infection. Appl Biochem Biotechnol. 2015;175(7):3494–3506. doi: 10.1007/s12010-015-1520-7. [DOI] [PubMed] [Google Scholar]
- 10.Yang Z, Zhou X, Ji L, Du X, Sang Q, Fang C. Enzymatic single-step preparation and antioxidant activity of hetero-chitooligosaccharides using non-pretreated housefly larvae powder. Carbohydr Polym. 2017;172:113–119. doi: 10.1016/j.carbpol.2017.05.037. [DOI] [PubMed] [Google Scholar]
- 11.Doan CT, Tran TN, Nguyen VB, Nguyen AD, Wang SL (2019) Production of a thermostable chitosanase from shrimp heads via Paenibacillus mucilaginosus TKU032 conversion and its application in the preparation of bioactive chitosan oligosaccharides. Mar Drugs 17(4):217. 10.3390/md17040217 [DOI] [PMC free article] [PubMed]
- 12.Han KI, Patnaik BB, Kim YH, Kwon HJ, Han YS, Han MD. Isolation and characterization of chitinase-producing Bacillus and Paenibacillus strains from salted and fermented shrimp, Acetes japonicus. J Food Sci. 2014;79(4):M665–674. doi: 10.1111/1750-3841.12387. [DOI] [PubMed] [Google Scholar]
- 13.Vaaje-Kolstad G, Horn SJ, Sorlie M, Eijsink VG. The chitinolytic machinery of Serratia marcescens–a model system for enzymatic degradation of recalcitrant polysaccharides. FEBS J. 2013;280(13):3028–3049. doi: 10.1111/febs.12181. [DOI] [PubMed] [Google Scholar]
- 14.Salas-Ovilla R, Galvez-Lopez D, Vazquez-Ovando A, Salvador-Figueroa M, Rosas-Quijano R. Isolation and identification of marine strains of Stenotrophomona maltophilia with high chitinolytic activity. PeerJ. 2019;7:e6102. doi: 10.7717/peerj.6102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Hayes CA, Dalia TN, Dalia AB. Systematic genetic dissection of chitin degradation and uptake in Vibrio cholerae. Environ Microbiol. 2017;19(10):4154–4163. doi: 10.1111/1462-2920.13866. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Chung D, Baek K, Bae SS, Jung J (2019) Identification and characterization of a marine-derived chitinolytic fungus, Acremonium sp. YS2–2. J Microbiol 57(5):372–380. 10.1007/s12275-019-8469-0 [DOI] [PubMed]
- 17.Kumar M, Brar A, Vivekanand V, Pareek N. Production of chitinase from thermophilic Humicola grisea and its application in production of bioactive chitooligosaccharides. Int J Biol Macromol. 2017;104:1641–1647. doi: 10.1016/j.ijbiomac.2017.04.100. [DOI] [PubMed] [Google Scholar]
- 18.Sandhya C, Adapa LK, Nampoothiri KM, Binod P, Szakacs G, Pandey A. Extracellular chitinase production by Trichoderma harzianum in submerged fermentation. J Basic Microbiol. 2004;44(1):49–58. doi: 10.1002/jobm.200310284. [DOI] [PubMed] [Google Scholar]
- 19.Le B, Yang SH. Microbial chitinases: properties, current state and biotechnological applications. World J Microbiol Biotechnol. 2019;35(9):144. doi: 10.1007/s11274-019-2721-y. [DOI] [PubMed] [Google Scholar]
- 20.Le B, Yang SH. Characterization of a chitinase from Salinivibrio sp. BAO-1801 as an antifungal activity and a biocatalyst for producing chitobiose. J Basic Microbiol. 2018;58(10):848–856. doi: 10.1002/jobm.201800256. [DOI] [PubMed] [Google Scholar]
- 21.Zhang LL, Gan LZ, Xu ZB, Yang F, Li Y, Fan XL, Liu XF, Tian YQ, Dai YM (2018) Pedobacter chitinilyticus sp. nov., a chitin-degrading bacterium isolated from wheat leaf tissue. Int J Syst Evol Microbiol 68(12):3713–3719. 10.1099/ijsem.0.003017 [DOI] [PubMed]
- 22.Moon C, Seo DJ, Song YS, Hong SH, Choi SH, Jung WJ. Antifungal activity and patterns of N-acetyl-chitooligosaccharide degradation via chitinase produced from Serratia marcescens PRNK-1. Microb Pathog. 2017;113:218–224. doi: 10.1016/j.micpath.2017.10.039. [DOI] [PubMed] [Google Scholar]
- 23.Tu S, Qiu XH, Cao L, Han RC, Zhang Y, Liu XJ. Expression and characterization of the chitinases from Serratia marcescens GEI strain for the control of Varroa destructor, a honey bee parasite. J Invertebr Pathol. 2010;104(2):75–82. doi: 10.1016/j.jip.2010.02.002. [DOI] [PubMed] [Google Scholar]
- 24.Seidl V. Chitinases of filamentous fungi: a large group of diverse proteins with multiple physiological functions. Fungal Biol Rev. 2008;22(1):36–42. doi: 10.1016/j.fbr.2008.03.002. [DOI] [Google Scholar]
- 25.Liu J, Yang J, Wang R, Liu L, Zhang Y, Bao H, Jang JM, Wang E, Yuan H. Comparative characterization of extracellular enzymes secreted by Phanerochaete chrysosporium during solid-state and submerged fermentation. Int J Biol Macromol. 2020;152:288–294. doi: 10.1016/j.ijbiomac.2020.02.256. [DOI] [PubMed] [Google Scholar]
- 26.Baldoni DB, Antoniolli ZI, Mazutti MA, Jacques RJS, Dotto AC, de Oliveira SA, Ferraz RC, Soares VB, de Souza ARC. Chitinase production by Trichoderma koningiopsis UFSMQ40 using solid state fermentation. Braz J Microbiol. 2020 doi: 10.1007/s42770-020-00334-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Singhania RR, Sukumaran RK, Pandey A. Improved cellulase production by Trichoderma reesei RUT C30 under SSF through process optimization. Appl Biochem Biotechnol. 2007;142(1):60–70. doi: 10.1007/s12010-007-0019-2. [DOI] [PubMed] [Google Scholar]
- 28.Riyadi FA, Alam MZ, Salleh MN, Salleh HM. Optimization of thermostable organic solvent-tolerant lipase production by thermotolerant Rhizopus sp. using solid-state fermentation of palm kernel cake. 3 Biotech. 2017;7(5):300. doi: 10.1007/s13205-017-0932-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Liu C-L, Lan C-Y, Fu C-C, Juang R-S. Production of hexaoligochitin from colloidal chitin using a chitinase from Aeromonas schubertii. Int J Biol Macromol. 2014;69:59–63. doi: 10.1016/j.ijbiomac.2014.05.028. [DOI] [PubMed] [Google Scholar]
- 30.Lee S, Yamamoto N. Accuracy of the high-throughput amplicon sequencing to identify species within the genus Aspergillus. Fungal Biol. 2015;119(12):1311–1321. doi: 10.1016/j.funbio.2015.10.006. [DOI] [PubMed] [Google Scholar]
- 31.Houbraken J, Samson RA. Phylogeny of Penicillium and the segregation of Trichocomaceae into three families. Stud Mycol. 2011;70(1):1–51. doi: 10.3114/sim.2011.70.01. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Yilmaz N, Visagie CM, Houbraken J, Frisvad JC, Samson RA. Polyphasic taxonomy of the genus Talaromyces. Stud Mycol. 2014;78:175–341. doi: 10.1016/j.simyco.2014.08.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Binod P, Sandhya C, Suma P, Szakacs G, Pandey A. Fungal biosynthesis of endochitinase and chitobiase in solid state fermentation and their application for the production of N-acetyl-D-glucosamine from colloidal chitin. Bioresour Technol. 2007;98(14):2742–2748. doi: 10.1016/j.biortech.2006.09.030. [DOI] [PubMed] [Google Scholar]
- 34.Waghmare SR, Kulkarni SS, Ghosh JS. Chitinase production in solid-state fermentation from Oerskovia xanthineolytica NCIM 2839 and its application in fungal protoplasts formation. Curr Microbiol. 2011;63(3):295–299. doi: 10.1007/s00284-011-9978-1. [DOI] [PubMed] [Google Scholar]
- 35.Pasqualetti M, Barghini P, Giovannini V, Fenice M (2019) High production of chitinolytic activity in halophilic conditions by a new marine strain of Clonostachys rosea. Molecules 24(10):1880. 10.3390/molecules24101880 [DOI] [PMC free article] [PubMed]
- 36.Shabbiri K, Adnan A, Jamil S, Ahmad W, Noor B, Rafique HM. Medium optimization of protease production by Brevibacterium linens DSM 20158, using statistical approach. Braz J Microbiol. 2012;43(3):1051–1061. doi: 10.1590/s1517-838220120003000031. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Wang S, Fu G, Li J, Wei X, Fang H, Huang D, Lin J, Zhang D (2020) High-efficiency secretion and directed evolution of chitinase BcChiA1 in Bacillus subtilis for the conversion of chitinaceous wastes into chitooligosaccharides. Front Bioeng Biotechnol 8:432. 10.3389/fbioe.2020.00432 [DOI] [PMC free article] [PubMed]
- 38.Tu J, Zhao J, Liu G, Tang C, Han Y, Cao X, Jia J, Ji G, Xiao H. Solid state fermentation by Fomitopsis pinicola improves physicochemical and functional properties of wheat bran and the bran-containing products. Food Chem. 2020;328:127046. doi: 10.1016/j.foodchem.2020.127046. [DOI] [PubMed] [Google Scholar]
- 39.Philip NV, Koteshwara A, Kiran GA, Raja S, Subrahmanyam VM, Chandrashekar HR. Statistical optimization for coproduction of chitinase and beta 1, 4-endoglucanase by chitinolytic Paenibacillus elgii PB1 having antifungal activity. Appl Biochem Biotech. 2020;191(1):135–150. doi: 10.1007/s12010-020-03235-8. [DOI] [PubMed] [Google Scholar]
- 40.Nagel F-JJI, Tramper J, Bakker MSN, Rinzema A. Model for on-line moisture-content control during solid-state fermentation. Biotechnol Bioeng. 2001;72(2):231–243. doi: 10.1002/1097-0290(20000120)72:2<231::AID-BIT11>3.0.CO;2-S. [DOI] [PubMed] [Google Scholar]
- 41.Barghini P, Moscatelli D, Garzillo AMV, Crognale S, Fenice M. High production of cold-tolerant chitinases on shrimp wastes in bench-top bioreactor by the Antarctic fungus Lecanicillium muscarium CCFEE 5003: bioprocess optimization and characterization of two main enzymes. Enzyme Microb Tech. 2013;53(5):331–338. doi: 10.1016/j.enzmictec.2013.07.005. [DOI] [PubMed] [Google Scholar]
- 42.Kunamneni A, Permaul K, Singh S (2005) Amylase production in solid state fermentation by the thermophilic fungus Thermomyces lanuginosus. J Biosci Bioeng 100(2):168–171 [DOI] [PubMed]
- 43.Massimiliano, Fenice, Paolo, Barghini, Laura, SelbmannFederico, Federici (2012) Combined effects of agitation and aeration on the chitinolytic enzymes production by the Antarctic fungus Lecanicillium muscarium CCFEE 5003. Microb Cell Fact 11:12 [DOI] [PMC free article] [PubMed]
- 44.Rashid JI, Samat N, Mohtar W, Yusoff W. Optimization of temperature, moisture content and inoculum size in solid state fermentation to enhance mannanase production by Aspergillus terreus SUK-1 using RSM. Pak J Biol Sci. 2011;14(9):533–539. doi: 10.3923/pjbs.2011.533.539. [DOI] [PubMed] [Google Scholar]
- 45.Hori C, Song R, Matsumoto K, Matsumoto R, Minkoff BB, Oita S, Hara H, Takasuka TE (2020) Proteomic characterization of lignocellulolytic enzymes secreted by the insect-associated fungus Daldinia decipiens oita, isolated from a forest in Northern Japan. Appl Environ Microbiol 86(8):e02350–19. 10.1128/aem.02350-19 [DOI] [PMC free article] [PubMed]
- 46.Nakagawa YS, Kudo M, Onodera R, Ang LZP, Watanabe T, Totani K, Eijsink VGH, Vaaje-Kolstad G. Analysis of four chitin-active lytic polysaccharide monooxygenases from Streptomyces griseus reveals functional variation. J Agric Food Chem. 2020;68(47):13641–13650. doi: 10.1021/acs.jafc.0c05319. [DOI] [PubMed] [Google Scholar]
- 47.Aida TM, Oshima K, Abe C, Maruta R, Iguchi M, Watanabe M, Smith RL. Dissolution of mechanically milled chitin in high temperature water. Carbohydr Polym. 2014;106:172–178. doi: 10.1016/j.carbpol.2014.02.009. [DOI] [PubMed] [Google Scholar]
- 48.Han X, Heinonen M. Development of ultra-high performance liquid chromatographic and fluorescent method for the analysis of insect chitin. Food Chem. 2020;334:127577. doi: 10.1016/j.foodchem.2020.127577. [DOI] [PubMed] [Google Scholar]
- 49.Dziril M, Grib H, Laribi-Habchi H, Drouiche N, Abdi N, Lounici H, Pauss A, Mameri N. Chitin oligomers and monomers production by coupling γ radiation and enzymatic hydrolysis. J Ind Eng Chem. 2015;26:396–401. doi: 10.1016/j.jiec.2014.12.015. [DOI] [Google Scholar]
- 50.Tømmeraas K, Vårum KM, Christensen BE, Smidsrød O. Preparation and characterisation of oligosaccharides produced by nitrous acid depolymerisation of chitosans. Carbohyd Res. 2001;333(2):137–144. doi: 10.1016/S0008-6215(01)00130-6. [DOI] [PubMed] [Google Scholar]
- 51.Suresh PV, Anil Kumar PK. Enhanced degradation of α-chitin materials prepared from shrimp processing byproduct and production of N-acetyl-D-glucosamine by thermoactive chitinases from soil mesophilic fungi. Biodegradation. 2012;23(4):597–607. doi: 10.1007/s10532-012-9536-y. [DOI] [PubMed] [Google Scholar]
- 52.Karthik N, Binod P, Pandey A (2017) 15 - Chitinases. In: Pandey A, Negi S, Soccol CR (eds) Current developments in biotechnology and bioengineering. Elsevier, pp 335–368. 10.1016/B978-0-444-63662-1.00015-4
- 53.Villa-Lerma G, Gonzalez-Marquez H, Gimeno M, Lopez-Luna A, Barzana E, Shirai K. Ultrasonication and steam-explosion as chitin pretreatments for chitin oligosaccharide production by chitinases of Lecanicillium lecanii. Bioresour Technol. 2013;146:794–798. doi: 10.1016/j.biortech.2013.08.003. [DOI] [PubMed] [Google Scholar]
- 54.Wei G, Zhang A, Chen K, Ouyang P. Enzymatic production of N-acetyl-d-glucosamine from crayfish shell wastes pretreated via high pressure homogenization. Carbohydr polym. 2017;171:236–241. doi: 10.1016/j.carbpol.2017.05.028. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.








