Skip to main content
Brazilian Journal of Microbiology logoLink to Brazilian Journal of Microbiology
. 2022 Nov 18;54(1):293–309. doi: 10.1007/s42770-022-00872-5

In vitro characterization of lactic acid bacterial strains isolated from fermented foods with anti-inflammatory and dipeptidyl peptidase-IV inhibition potential

Ruchika Bhatia 1,2, Shashank Singh 1, Ruchika Maurya 1,3, Sanjay Kumar Bhadada 4, Mahendra Bishnoi 1,2,3, Kanwaljit Chopra 5, Santa Ram Joshi 6, Kanthi Kiran Kondepudi 1,2,3,✉
PMCID: PMC9944167  PMID: 36401067

Abstract

Probiotics are known to stimulate, modulate, and regulate host immune response by regulating specific sets of genes and improve glucose homeostasis through regulating dipeptidyl peptidase (DPP-IV) activity, but the mechanism behind their protective role is not clearly understood. Therefore, the present study was designed to isolate indigenous lactic acid bacterial (LAB) strains from different fermented food samples, vegetables, and human infant feces exhibiting anti-inflammatory, antioxidant, and DPP-IV inhibitory activity. A total of thirty-six Gram-positive, catalase-negative, and rod-shaped bacteria were isolated and screened for their anti-inflammatory activity using lipopolysaccharide (LPS)-induced inflammation on the murine (RAW264.7) macrophages. Among all, sixteen strains exhibited more than 90% reduction in nitric oxide (NO) production by the LPS-treated RAW264.7 cells. Prioritized strains were characterized for their probiotic attributes as per the DBT-ICMR guidelines and showed desirable probiotic attributes in a species and strain-dependent manner. Accordingly, Lacticaseibacillus rhamnosus LAB3, Levilactobacillus brevis LAB20, Lactiplantibacillus plantarum LAB31, Pediococcus acidilactici LAB8, and Lactiplantibacillus plantarum LAB39 were prioritized. Furthermore, these strains when co-supplemented with LPS and treated on RAW264.7 cells inhibited the mitogen-activated protein kinases (MAPKs), i.e., p38 MAPK, ERK1/2, and SAPK/JNK, cyclooxygenase-2 (COX-2), relative to the LPS-alone-treated macrophages. LAB31 and LAB39 also showed 64 and 95% of DPP-IV inhibitory activity relative to the Lacticaseibacillus rhamnosus GG ATCC 53103, which was used as a reference strain in all the studies. Five prioritized strains ameliorated the LPS-induced inflammation by downregulating the JNK/MAPK pathway and could be employed as an alternative bio-therapeutic strategy in mitigating gut-associated inflammatory conditions.

Graphical Abstract

The potential mechanism of action of prioritized LAB strains in preventing the LPS-induced inflammation in RAW 264.7 macrophage cells.

graphic file with name 42770_2022_872_Figa_HTML.jpg

Supplementary Information

The online version contains supplementary material available at 10.1007/s42770-022-00872-5.

Keywords: Probiotics, Lipopolysaccharide, DPP-IV inhibition, Anti-inflammation, Macrophage cell line

Introduction

Inflammation is the basic host protective response to foreign invasion, and it is augmented by the circulating LPS, a pro-inflammatory molecule, present in the outer cell wall of Gram-negative pathogenic bacteria [1]. The absorption of dietary lipids results in a leaky gut causing translocation of lipopolysaccharide (LPS) into the systemic circulation [2]. LPS binding to the toll-like receptor-4 (TLR-4) activates JNK and nuclear factor-kB (NF-kB) pathways that cause a release of inflammatory mediators such as tumor necrosis factor (TNF-α), interleukin IL-6 and IL-1β and low-grade inflammation (endotoxemia), leading to metabolic complications and other clinical conditions [3]. The development of dietary interventions involving the use of natural food products such as polyphenols, dietary fibers [4], and probiotics isolated from different food matrices has shown several advantages in preventing metabolic diseases [5] and their associated complications such as type 2 diabetes mellitus (T2DM) without any adverse effects on the host [6].

The World Health Organization (WHO) defined probiotics as live microorganisms that, when administered in sufficient amounts, confer health benefits to the host [7]. Lactobacillus and Bifidobacterium are the two vital genera of the gut microbiota and are generally recognized as safe (GRAS) and are known to provide several health benefits such as alleviating intestinal disorders, respiratory problems, and gastrointestinal diseases owing to their immunomodulatory potentials. Several studies have described the modulation of type I helper T lymphocytes (Th1)/type II helper T lymphocytes (Th2) in polarization, amelioration of gastrointestinal diseases, and pro-inflammatory cytokine suppression against LPS stimulation by LAB supplementation [8]. In recent years, many in vitro and in vivo reports suggested that probiotic strains can effectively prevent or treat many gut-related complications, autoimmune disorders, necrotizing enterocolitis, obesity, diabetes, and even stress and anxiety-related disorders [9, 10].

Diabetes is a major public health concern all around the globe and recently DPP-IV inhibitors have been suggested to play a vital role in mitigating type 2 diabetes mellitus (T2DM) [11]. DPP-IV inhibits the levels of glucagon-like peptide-1 (GLP-1) and glucose-dependent insulinotropic polypeptide (GIP), whereas DPP-IV inhibitors promote the incretin hormones GIP and GLP-1 through suppression of DPP-IV or T cell antigen CD26, a circulating protein [12]. As a result, glucagon levels decrease, and insulin levels increase which helps in reducing blood glucose levels. Several synthetic inhibitors are currently available in the market including vildagliptin, alogliptin, linagliptin, saxagliptin, and sitagliptin but have certain side effects such as mild illness and headache. Hence, DPP-IV inhibitors obtained from natural sources are safe and desirable as they usually possess minimum or no side effects [13]. DPP-IV inhibitory effect of Lactobacillus strains has recently gained importance, and studies suggested that the supplementation of L. acidophilus KLDS1.0901 with high DPP-IV inhibitory activity could promote glucose homeostasis and ameliorate insulin resistance and oxidative stress in mice with T2DM [14, 15]. Hence, it is expected that the use of probiotic bacterial strains with DPP-IV inhibitory potential in nutrition can improve glucose homeostasis in humans as well [16]. Previous studies have emphasized the protective role of lactic acid bacterial strains; however, reports on the Indian origin of lactic acid bacterial strains exhibiting DPP-IV inhibitory and anti-inflammatory potential are scarce, despite the rich microbial diversity. Hence, there is a need to assess the beneficial effects of every strain isolated from different sources due to the species and strain-specific behavior.

Therefore, in the present study, LAB strains were isolated from different indigenous sources and characterized for evaluating their anti-inflammatory, antioxidant activity, and DPP- IV inhibitory potential in vitro. Furthermore, the molecular mechanism in inhibiting the LPS-induced inflammation in the murine macrophage (RAW264.7) cells and IL-8 production in intestinal epithelial (Caco-2) cells were investigated.

Materials

Quick-DNA Fungal/Bacterial Microprep kit (Cat. No.: D6007, Zymo Research, USA). Water-soluble cholesterol (Cholesterol PEG-600), mucin-type III from porcine stomach, fructooligosaccharides (FOS), inulin from chicory, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay kit, lipopolysaccharide (LPS) from E. coli 055:B5, and carboxy-fluorescein diacetate (CFDA), 5,5-dithiobis-(2-nitrobenzoic acid) (DTNB), hydroxylamine hydrochloride, thiobarbituric acid, protease inhibitor cocktail, Bradford reagent, and phosphoric acid were purchased from Sigma-Aldrich, St Louis, USA. Sulfanilamide and N-(1-Naphthyl)ethylenediamine dihydrochloride), nitro blue tetrazolium, and 2,2-diphenyl-1-picryl-hydrazyl-hydrate DPPH were purchased from CDH (Central Drug House Pvt. ltd.), India. API CHL 50 kit was purchased from BioMérieux, France. Isomaltooligosaccharides (IMOS) was a gift from BioNeutra, Canada. Human TNF-α was purchased from Invitrogen, California, USA. Xylene, chloroform, hexane, and hydrochloric acid were purchased from Merck, USA. Trypticase soy broth; glycerol; hydrogen peroxide (H2O2); sheep blood agar; sample collection vials; De Man, Rogosa, and Sharpe (MRS broth); MRS agar; antibiotic discs; sodium hydroxide (NaOH); sodium chloride (NaCl); potassium chloride (KCl); phenol, bile salt mixture, hexadecane, and other chemicals were purchased from HiMedia Laboratories, Mumbai, India; murine IL-6, IL-1β, and TNF-α ELISA kits were purchased from RayBiotech, Norcross, USA, and human IL-8 ELISA kit was procured from Elabscience, USA, DPP-IV inhibitor screening assay kit was obtained from Cayman Chemicals, ELISA reader (NANOQuant-infinite M200 PRO), Tecan life science, Switzerland) and spectrophotometer (Spectra Max M5e microplate reader, Molecular devices, Minnesota, USA). RAW 264.7 and Caco-2 cell lines were purchased from the National Centre for Cell Science, Pune, India. Glutamine-free Dulbecco’s Modified Eagle’s Medium (DMEM), fetal bovine serum (FBS), and penicillin–streptomycin antibiotics were purchased from Gibco, Life Technologies, Thermo Fisher Scientific, USA. Phosphorylated ERK1/2 and ERK1/2, phosphorylated p38 and p38, phosphorylated SAPK/JNK, SAPK/JNK, COX-2, and GAPDH, and horseradish peroxidase-conjugated anti-rabbit immunoglobulin G were from Cell Signaling Technology, Danvers, MA, USA, Chemiluminescence (ECL) detection system, Amersham Imager 600 Image J software (NIH, Bethesda, Maryland, USA).

Methodology

Isolation of lactic acid bacteria

LAB strains were isolated from soy-based fermented foods, raw vegetables, and infant fecal samples. Fresh infant fecal samples were taken in sterile containers as established by the guidelines of the Post Graduate Institute of Medical Education and Research (PGIMER), Chandigarh, ethical approval number (P-641). Approximately 100 mg of samples from various sources was homogenized in 9 ml of phosphate-buffered saline (PBS, pH 7.4), serially diluted, and spread on de Man Rogosa and Sharpe (MRS) agar plates followed by incubation at 37 °C for 24 h under aerobic conditions. Further, a single colony of each strain was streaked on the MRS agar plate to obtain pure colonies. The source of isolation of the LAB strains is given in Table 1. The stock cultures of these bacterial strains were prepared in trypticase soy broth containing 15% glycerol as a cryoprotectant and stored at − 80 °C. In all the experiments, the frozen stock culture of the bacterial strains were activated on MRS agar plates and incubated at 37 °C for 24 h under aerobic conditions. A single colony of each strain was sub-cultured consecutively three times in MRS broth and incubated at 37 °C for 24 h. During the third transfer, the cultures were cold centrifuged at 6000 × g, and the pellets obtained were washed and resuspended in sterile PBS for further use [17]. In all the experiments, Lacticaseibacillus rhamnosus GG ATCC 53103 was used as a control probiotic strain.

Table 1.

List of lactic acid bacterial strains isolated from various sources and their morphological, culture characteristics, and molecular identification

Strains Sources Culture characteristics Bacterial identification by16S rRNA sequencing GenBank accession number NO production%
RAW + LAB RAW + LAB + LPS
LAB 1 Tungrymbai Small, entire margin, smooth, white, opaque, raised, flat Lacticaseibacillus rhamnosus MW048991 10.4 ± 1.3 16.74 ± 1.8#
LAB 2 Tungrymbai Small, entire margin, smooth, off white, opaque, raised, flat Lacticaseibacillus paracasei MW048889 10.19 ± 0.7 14.78 ± 0.7#
LAB 3 Infant 1 feces Small, entire margin, smooth, round, white, opaque, convex Lacticaseibacillus rhamnosus MW049146 12.88 ± 0.3 16.6 ± 0.3#
LAB 4 Dosa batter Pinpoint, entire margin, smooth, white, opaque, convex Limosilactobacillus fermentum MW051434 09.03 ± 0.2 11.55 ± 1.2#
LAB 5 Infant 2 feces Pinpoint, entire margin, smooth, white, translucent, flat Enterococcus faecalis MW051446 49.44 ± 1.2* 50.21 ± 0.3#
LAB6 Bekang Small, entire margin, smooth, white, translucent, flat Levilactobacillus brevis MW051761 13.56 ± 1.1 16.96 ± 0.6#
LAB 7 Bekang Small, entire margin, smooth, white, opaque, flat Lactiplantibacillus plantarum MW051755 34.23 ± 0.5 36.44 ± 1.3#
LAB 8 Bekang Small, entire margin, smooth, white, translucent, raised Pediococcus acidilactici MW051893 15.24 ± 1.8* 18.78 ± 0.3#
LAB9 Infant 3 feces Small, entire margin, smooth, off-white, transparent, flat Limosilactobacillus mucosae MW052221 18.21 ± 1.1 39.28 ± 1.3#
LAB10 Peruyaan Pinpoint, entire margin, smooth, white, opaque, raised Leuconostoc mesenteroides MW051754 14.56 ± 0.6* 16.9 ± 1.2#
LAB11 Infant 3 feces Small, entire margin, smooth, off-white, transparent, flat Enterococcus faecium MW051759 22.87 ± 0.2* 46.65 ± 1.3#
LAB12 Fermented Food Small, entire margin, smooth, white, translucent, convex Pediococcus pentosaceus MW051886 23.89 ± 0.2* 40.19 ± 0.1.1#
LAB13 Fermented Food Large, entire margin, smooth, white, opaque, convex Bacillus albus MW051482 36.73 ± 2.1 47.34 ± 1.5#
LAB14 Infant 4 feces Pinpoint, entire margin, smooth, off-white, translucent, raised Vagococcus humatus MW051756 14.56 ± 1.3 48.71 ± 0.8#
LAB15 Dosa batter Small, entire margin, smooth, off-white, opaque, flat Enterococcus faecium MW052222 29.21 ± 0.6 46.65 ± 1.3#
LAB16 Jalebi batter Small, entire margin, smooth, white, translucent, convex Pediococcus pentosaceus MW051758 11.51 ± 2.1 15.19 ± 0.1.1#
LAB17 Kodo millet Small, entire margin, smooth, white, opaque, raised Lactiplantibacillus plantarum MW051894 10.33 ± 1.3 17.34 ± 1.5#
LAB18 Infant 4 feces Small, entire margin, smooth, white, translucent, raised Vagococcus humatus MW051895 10.47 ± 0.6 16.9 ± 0.8#
LAB19 Infant 5 feces Small, entire margin, smooth, white, opaque, convex Limosilactobacillus fermentum MW051597 35.7 ± 0.6* 65.12 ± 0.4
LAB20 Infant 5 feces Small, entire margin, smooth, white, translucent, convex Levilactobacillus brevis MW051598 8.72 ± 0.3 14.06 ± 0.4#
LAB21 Infant 6 feces Small, circular, smooth, white, opaque, raised Streptococcus pasteurianus MW055671 57.29 ± 1.3* 64.31 ± 1.3
LAB22 Infant 6 feces Small, entire margin, smooth, off-white, translucent, flat Enterococcus gallinarum MW055660 23.03 ± 1.2* 39.92 ± 1.2#
LAB24 Infant 7 feces Small, circular, smooth, white, translucent, raised Streptococcus pasteurianus MW055678 37.66 ± 0.4* 40.61 ± 0.4#
LAB27 Hawaijaar Small, circular, smooth, white, opaque, flat Lactiplantibacillus plantarum MW055662 13.03 ± 0.4* 20.14 ± 0.6#
LAB29 Bekang Small, circular, smooth, white, translucent, convex Pediococcus pentosaceus MW055682 35.33 ± 1.4* 51.50 ± 0.2#
LAB30 Bekang Small, entire margin, smooth, white, opaque, convex Weissella cibaria MW057762 29.68 ± 0.1* 38.63 ± 0.8#
LAB31 Infant 7 feces Small, circular, smooth, white, opaque, convex Lactiplantibacillus plantarum MW055659 12.56 ± 0.2 21.57 ± 0.6#
LAB32 Peruyaan Small, entire margin, smooth, white, opaque, flat Weissella confuse MW055658 23. 19 ± 1.1* 25.38 ± 0.7#
LAB33 Curd Small, circular, smooth, white, opaque, convex Lactiplantibacillus plantarum MW055661 16.43 ± 1.3 27.72 ± 0.6#
LAB34 Flour Small, entire margin, smooth, white, translucent, flat Pediococcus pentosaceus MW055666 22.39 ± 0.4* 33.56 ± 0.5#
LAB35 Tomato Small, circular, smooth, white, opaque, convex Pediococcus pentosaceus MW055665 17.231 ± 0.5 38.78 ± 0.2#
LAB36 Jalebi Small, circular, smooth, white, translucent, convex Pediococcus pentosaceus MW055663 16.78 ± 1.5 39.45 ± 0.1#
LAB37 Dosa batter Large, circular, smooth, white, opaque, flat Pediococcus pentosaceus MW055664 16.32 ± 1.3 41.96 ± 0.3#
LAB38 Tomato juice Small, circular, smooth, white, translucent, raised Streptococcus sciuri MW055672 17.65 ± 1.4 43.46 ± 0.2#
LAB39 Beetroot Small, circular, smooth, white, opaque, convex Lactiplantibacillus plantarum MW055704 11.44 ± 0.6 19.28 ± 1.3#
LAB40 Turnip Small, entire margin, smooth, white, opaque, convex Limosilactobacillus fermentum MW055673 25.45 ± 0.6* 33.10 ± 0.6#
LGG Control Small, entire margin, smooth, round, white, opaque, flat Lacticaseibacillus rhamnosus ATCC53103  - 10.21 ± 0.6 16.21 ± 0.3#

Nitric oxide production for control RAW 264.7 cells was 0.85 ± 0.01 µm/ml, and for RAW 264.7 cells + LPS was 2.3 ± 0.2 µm/ml. % Nitric oxide production for control was 11 ± 2.1 and LPS treated cells was 100 ± 1.3. Data were analyzed by one-way ANOVA followed by Tukey’s post hoc test (P ≤ 0.05). # significant relative to the LPS treatment; * significant relative to untreated control; N = 10

Biochemical tests

The bacterial isolates were identified based on the characteristics as described in Bergey’s Manual of Determinative Bacteriology [18]. Catalase, oxidase, fermentation of different carbon sources, and antibiotic susceptibility were determined as per the established protocols.

Molecular identification of the isolated LAB strains

Fresh bacterial cell pellets obtained during the logarithmic growth phase in MRS broth were used for the genomic DNA extraction kit following the manufacturer’s instructions [19]. The integrity of the DNA was ascertained using agarose gel electrophoresis, and further, the 16S rRNA gene was amplified using universal primers (UNI 8F-5′ AGAGTTTGATCCTGGCTGAG 3′, UNI 1492R-5′ GGTTACCTTGTTACGACTT 3′). PCR was carried out at 98 °C for 2 min followed by 35 cycles of 98 °C for 20 s, 56 °C for 30 s, and 72 °C for 80 s with a final extension at 72 °C for 5 min. The amplicons obtained were purified using the agarose gel electrophoresis and subjected to sequencing. 16S rRNA gene sequences were subjected to the Basic Local Alignment Search Tool (BLASTn) program at the National Centre for Biotechnology Information database (NCBI) for the identification of the bacterial isolates [20]. Further, the 16S rRNA gene sequences were deposited in the GenBank, and the accession numbers are given in Table 1.

Phylogenetic analysis

The obtined 16S rRNA gene sequences were edited using the BioEdit software application to get the consensus sequences and aligned using CLUSTAL W software (version 1.81) [21]. The sequences from the bacterial isolates were compared to those already available in the GenBank using the BLASTn search tool for nucleotide sequences. At last, MEGA software (version 11.1) was used to create the phylogenetic trees using the maximum likelihood technique based on the Tamura-Nei model [22].

Prevention of LPS-induced nitric oxide (NO) production by the murine (RAW264.7) macrophages

Dulbecco’s Modified Eagle’s Medium (DMEM) containing 10% (v/v) FBS and 1% penicillin–streptomycin were used to culture the RAW264.7 murine macrophage cells at 37 °C under 5% CO2 in a humidified incubator. Media was changed on every alternate day and passaged on the second day.

Induction of inflammation and its prevention with LAB isolates by nitric oxide assay

RAW 264.7 cells were seeded in 48 well microplates at a density of 1 × 105 cells/ml per well and treated with respective LAB strains 1 × 1010 CFU/ml with or without 1 µg/ml LPS for 16 h. Later, the culture supernatants were collected, and the amount of nitrite was determined using Griess reagent (2% sulfanilamide (w/v) in 5% phosphoric acid, 0.2% N-(1-naphthyl) ethylenediamine dihydrochloride in H2O (w/v)) (1:1) as described elsewhere [19]. The results were presented as percent nitric oxide produced.

Cell viability assay

RAW 264.7 cells were seeded in the 96 well microplate at a density of 1.0 × 104 cells/ml per well and treated with 1 × 1010 CFU/ml of respective strains and incubated at 37 °C under 5% CO2 in a humidified incubator. After 16 h, the supernatants were discarded, and 20 µl of MTT solution (5 mg/ml) was added followed by incubation in the dark at 37 °C for 4 h. After incubation, the supernatants were discarded, and 100 µl of MTT solubilization buffer was added and incubated for 10 min. The formazan crystals obtained were dissolved in the solubilization buffer, and the absorbance at 570 nm was measured using a microplate reader. The results obtained were expressed as the % viability of the cells compared to the untreated macrophages as described elsewhere [23].

Quantification of the inflammatory cytokines

RAW 264.7 cells were seeded in 48-well microplates with a density of 1.0 × 105 cells/ml per well and treated with 1 × 1010 CFU/ml of respective strains with or without LPS (1 µg/ml) and incubated at 37 °C in a humidified incubator under 5% CO2 for 16 h. Then, the supernatants were collected, and the levels of IL-6, IL-1β, and TNF-α were quantified using commercially available ELISA kits according to the manufacturer’s instructions.

Probiotic characterization of the selected LAB strains

LAB strains exhibiting anti-inflammatory activity were further evaluated for their probiotic characteristics as per the DBT-ICMR guidelines [24]. Acid and bile tolerance, phenol tolerance, NaCl, prebiotic profiling, antimicrobial assay, cholesterol reduction activity, adhesion assays, mucin-binding assay, and adhesion to Caco-2 cells were determined as in previously published methods [25–27].

Acid and bile tolerance

Artificial gastric juice in MRS broth (7 m M/L KCl, 45 mM/L NaHCO3, 125 mM/L NaCl, and 3 g/L pepsin) was prepared with pH 3.0 and 3.5, respectively. Freshly grown bacterial cells (1 × 1010 CFU/ml) were inoculated into the juice and incubated at 37 °C for 1 h. An aliquot of 100 µl of samples was collected at 0, 30, and 60 min, serially diluted and spread onto the fresh MRS agar plates and incubated at 37 °C for 2 days. The results were expressed as viable counts (log CFU/ml) relative to unstressed cells.

For bile tolerance, the bacterial cultures were inoculated in the modified MRS broth (0.2% and 0.4% (w/v)) of bile salt mixture (HiMedia Laboratories) at pH 7.0 and incubated at 37 °C for 4 h. An aliquot of 100 µl of samples was collected at 0 h and 4 h, respectively, serially diluted, spread on MRS agar plates, and incubated at 37 °C for 2 days. The bile tolerance was expressed as described previously [15].

DPPH radical scavenging activity

The DPPH scavenging effect of LAB strains was determined according to the previously described method [28]. Briefly, 1 ml of the bacterial suspension containing 1 × 1010 CFU was added to the 1 mL of a 0.2 mmol/L DPPH in ethanol and incubated at room temperature in dark for 30 min after vigorous mixing. PBS was used as a control, and the blank contained the ethanol instead of DPPH. The absorbance of the supernatant was measured at 517 nm in triplicates after centrifugation at 6000 g for 10 min. The scavenging ability was calculated as follows:

Scavenging Activity (%) = [1 − (A sample − A blank)/A control] × 100%

where A sample is the sample’s absorbance, A blank is a blank absorbance, and A control is control absorbance.

DPP-IV inhibition activity

The inhibitory activity of the LAB strains was evaluated using a commercially available assay kit following the manufacturer’s instructions. Briefly, a total volume of 30 µl of assay buffer containing 10 µl of DPP-IV and 10 µl of live bacteria (1 × 1010 CFU/ml) or reference inhibitor was added to a 96-well plate, and the reaction was initiated by adding 50 µl of a diluted substrate in all the wells, covered with the plate cover and incubated at 37 °C for 30 min. The fluorescence was measured at excitation and emission wavelengths of 360 and 460 nm using a microplate reader. The results were expressed as % inhibition relative to sitagliptin, which was used as a positive control inhibitor and initial activity with a buffer containing no DPP-IV inhibitor. The inhibitory activity was calculated as follows:

DPP-IV inhibition activity (%) = [(Initial activity − Inhibitor)/Initial activity] × 100% [29].

Protection from TNF-α- and LPS-induced intestinal epithelial cell inflammation

Caco-2 cells were activated and maintained in glutamine-free DMEM supplemented with 10% (v/v) FBS and 1% gentamicin/streptomycin solution at 37 °C under 5% CO2 in a humidified incubator [30]. The intestinal epithelial cells were seeded in 48-well microplates at a density of 1.0 × 105 cells/ml per well and allowed to grow for 14 days with fresh media change on every alternate day until confluent. On the 15th day, cells were pre-treated with TNF-α (100 ng/ml) in serum-free DMEM medium for about 24 h followed by LPS (1 μg/ml) or LPS (1 μg/ml) and 1 × 1010 CFU/ml of test strains or only 1 × 1010 CFU/ml of test strains in DMEM and incubated for another 24 h. The cell-free supernatants were collected and evaluated for the level of IL-8 using a commercially available ELISA kit as per the manufacturer’s instructions [19].

Western blotting

RAW 264.7 cells were seeded in 6-well microplates at a density of 2.0 × 105 cells/ml per well and were allowed to reach confluency until 48 h. Later, the monolayers were treated with 1 × 1010 CFU/ml of the selected LAB strains with or without LPS (1 μg/ml) for 16 h. The supernatants were then removed carefully, and the cells were rinsed with cold PBS twice and lysed with radio-immunoprecipitation assay (RIPA) buffer containing a 1% protease phosphatase inhibitor cocktail. The cell lysates were centrifuged at 13,000 × g at 4 °C for 20 min, and the protein content was determined in the lysates using the Bradford method [31]. Approximately, 15 µg of protein was separated on 10% SDS-PAGE along with a pre-stained protein marker. After electrophoresis, the gel was transferred onto the PVDF membrane in an ice-cold 10 mM Tris–Cl buffer containing 0.5% Tween-20 (TBST) pH 7.4. After the transfer, the membrane was treated with 5% non-fat dry milk at room temperature for 2 h to avoid non-specific binding. The membrane was then washed three times with TBST and was probed with 1:1000 dilution of primary antibody (phosphorylated ERK1/2, ERK1/2, phosphorylated p38, p38, phosphorylated SAPK/JNK, SAPK/JNK, COX-2, GAPDH) at 4 °C for overnight. After probing with primary antibodies, the membranes were washed with TBST twice and further incubated with horseradish peroxidase-conjugated anti-rabbit immunoglobulin G secondary antibody with 1:3000 dilution at room temperature for 2 h, followed by subsequent washing with the TBST buffer. Further, the immunoblots were detected using the enhanced chemiluminescence (ECL) detection system, and the relative densities of each protein band were determined using the Image J software.

Statistical analysis

GraphPad Prism 5.0 software was used to calculate all the significance. All the experiments were carried out in triplicates and repeated thrice. Results were expressed as mean ± SEM. The statistical significance between the different experimental groups was analyzed using a one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test. p ≤ 0.05 was accounted as significant.

Results

Isolation, identification, and molecular characterization of the LAB strains

A total of thirty-six lactic acid bacterial strains were isolated from various sources that include, 20 from soy-based fermented foods such as tungrymbai, hawaijar, bekang, peruyaan, and dosa batter; four strains from tomato and beet root; and 12 strains from infant fecal samples. All the isolates were catalase-negative, oxidase-negative, and γ hemolytic, and their detailed morphological characteristics were listed in Table 1. The 16S rRNA gene sequence analysis suggested 99% sequence homology with the respective species in the NCBI database (Table 1) and the agarose gel image of the amplified products is summarized in Supplementary Fig. S1. Furthermore, the phylogenetic analysis showed that LAB strains with similar sequences were aggregated in the same group and were closely related. The evolutionary history was determined using the method based on the Tamura-Nei model with the highest log-likelihood value (− 7852.48). The percentage of trees in which the associated taxa clustered together was shown next to the branches (Fig. 1).

Fig. 1.

Fig. 1

Phylogenetic analysis of the isolated LAB strains using the maximum likelihood technique based on the Tamura–Nei model

Nitric oxide assay

LPS treatment (1 µg/ml) enhanced the production of NO by the murine macrophages, while co-treatment with LAB + LPS reduced its production. LAB1, LAB2, LAB3, LAB4, LAB6, LAB8, LAB10, LAB16, LAB17, LAB18, LAB20, LAB27, LAB31, LAB32, LAB33, LAB39, and LGG strains showed the highest reduction in NO production ranging from 85 to 90% compared to the macrophages treated with LPS alone (Table 1).

Cell viability by MTT assay

Sixteen shortlisted strains that showed maximum reduction in the NO production by the LPS-treated macrophages were evaluated for their cytotoxicity effect on the RAW264.7 cell line. Treatment with the 1 × 1010 CFU/ml of LAB strains on the macrophages did not affect the viability relative to the untreated macrophages (Supplementary Fig. S2).

Quantification of inflammatory cytokines

Treatment with selected sixteen strains decreased the production of TNF-α, IL-6, and IL-1β in the supernatant of LPS-treated macrophages relative to the LPS-treated cells alone, which showed a higher level of pro-inflammatory cytokines. Interestingly, cells treated with LAB strains and LGG alone did not enhance the production of pro-inflammatory cytokines (Fig. 2a–c).

Fig. 2.

Fig. 2

Effect of LAB strains on pro-inflammatory cytokines production by LPS-treated RAW 264.7 cells. a TNF-α; b IL-6; c IL-1β. Data were analyzed by one-way ANOVA followed by Tukey’s post hoc test (P ≤ 0.05). *Significant relative to untreated control; #significant relative to LPS treatment (N = 4)

Antibiotics sensitivity

The response of the selected sixteen LAB strains to different antibiotics is given in Supplementary Table S1. LAB1 was resistant to cloxacillin, tetracycline, ciprofloxacin, cefotaxime, and augmentin. LAB2 was resistant to vancomycin, chloramphenicol, and sulfate; LAB3 was resistant towards cefuroxime, ciprofloxacin, co-cotrimoxazole, and metronidazole; LAB4 was resistant towards cotrimoxazole and sulphatriad; LAB6 was resistant towards chloramphenicol, ciprofloxacin, co-cotrimoxazole, and levofloxacin; LAB8 was resistant towards cloxacillin, ciprofloxacin, cotrimoxazole, and metronidazole; LAB10, LAB16, and LAB17 were resistant towards ciprofloxacin, cotrimoxazole, sulphatriad, and vancomycin, while LAB20, LAB32, LAB33, and LAB39 were resistant towards cloxacillin, gentamycin, ciprofloxacin, cotrimoxazole, sulphatriad, and augmentin, respectively.

Fermentation of carbohydrates and non-digestible carbohydrates

Strain-dependent differences in carbohydrate utilization were evident from the results of the API CHL 50 assay which are summarized in Supplementary Table S2. LAB1, LAB2, LAB3, LAB4, LAB6, LAB8, LAB10, LAB16, LAB18, and LAB20 ferment L-arabinose, D-ribose, D-xylose, D-galactose, D-glucose, D-fructose, D-mannitol, D-sorbitol, D-maltose, D-lactose, D-melibiose, and D-raffinose, while the rest of the sugars remain unfermented. LAB27, LAB31, LAB32, LAB33, and LAB39 ferment D-galactose, D-glucose, D-fructose, D-mannitol, D-sorbitol, D-maltose, D-lactose, D-melibiose, and D-raffinose and inulin, while the rest of the sugars remain unfermented.

Prebiotic profiling of the selected sixteen LAB strains suggested that among different tested non-digestible carbohydrates, eleven strains LAB1, LAB3, LAB16, LAB17, LAB18, LAB20, LAB27, LAB31, LAB32, LAB33, and LAB39 were able to ferment isomaltooligosaccharides, while seven strains LAB18, LAB20, LAB27, LAB31, LAB32, LAB33, and LAB39 ferment fructooligosaccharide and inulin, while nine strains LAB1, LAB3, LAB18, LAB20, LAB27, LAB31, LAB32, LAB33, and LAB39 ferment starch. LGG did not ferment any tested non-digestible carbohydrates as listed in Supplementary Table S3.

Probioticcharacterization of the LAB strains

Acid and bile tolerance

All the shortlisted LAB strains showed 70–90% survivability in the gastric juice at pH 3.0 and 3.5. The highest survival was observed in the case of LAB1, LAB3, LAB8, LAB10, LAB20, LAB31, LAB39, and LGG, while the least survival percentage was observed in LAB6. In the case of bile tolerance, 60–90% survivability was observed in LAB1, LAB3, LAB8, LAB20, LAB31, LAB39, and LGG isolates at 0.2% of bile, and LAB6 showed the least survivability (Table 2).

Table 2.

Evaluation of probiotic attributes of the selected LAB strains

Strains % Viability Anti-microbial activity
Zone of inhibition (mm)
Cholesterol reduction (%)
Acid tolerance Bile tolerance S. typhi E. coli B. cereus P. aeruginosa
pH 3.0 pH 3.5 0.2% bile 0.4% bile
LAB1 95 ± 0.4 91 ± 0.3 99 ± 0.1 97 ± 0.1 8.0 ± 0.4 9.75 ± 0.6 7.25 ± 0.75 7.25 ± 0.62 33 ± 1.12
LAB2 93 ± 0.2 91 ± 0.1 93 ± 0.3* 89 ± 0.2* 0 5.45 ± 0.7 3.15 ± 0.75 0 15.5 ± 2.72
LAB3 96 ± 0.5 93 ± 0.3 98 ± 0.2 96 ± 0.3 9.0 ± 0.4 7.50 ± 0.5 8.75 ± 0.47 11.25 ± 0.25 43.0 ± 2.51*
LAB4 97 ± 0.3 92 ± 0.2 99 ± 0.3 98 ± 0.1 4.0 ± 1.1 9.75 ± 0.6 0 0 19.92 ± 4.5
LAB6 79 ± 0.2* 59 ± 0.1 73 ± 0.6* 65 ± 0.3 6 ± 0 7.5 ± 0.5 4.5 ± 0.28 10.25 ± 0.2 25.0 ± 2.06
LAB8 97 ± 0.1 94 ± 0.4 98 ± 0.2 95 ± 0.4 11.5 ± 0.5 9.5 ± 0.6 7.75 ± 0.47 8.74 ± 1.37 22.1 ± 2.2
LAB10 98 ± 0.8 94 ± 0.6 97 ± 0.3 94 ± 0.4 0 4.75 ± 0.4 4.75 ± 0.5 5.5 ± 0.5 39.6 ± 2.4*
LAB16 91.4 ± 0.5 88 ± 1.2 97 ± 0.4 92 ± 0.2 10.5 ± 0.2 8.5 ± 1.19 6.50 ± 0.5 10.0 ± 0.42 11.43 ± 1.55
LAB17 94.2 ± 1.3 91 ± 0.5 98 ± 0.2 93 ± 0.1 10.0 ± 0.2 7.50 ± 0.3 5.50 ± 0.5 10.25 ± 0.8 27.9 ± 2.0
LAB18 97.7 ± 0.3 93 ± 0.2 97 ± 0.7 94 ± 0.3 10.0 ± 0.2 9.25 ± 1.1 6.75 ± 0.4 10.0 ± 0.62 30.34 ± 2.2
LAB20 97.5 ± 0.5 92 ± 0.2 96 ± 0.1 95 ± 0.2 12.0 ± 0.2 10 ± 0.8 7.75 ± 0.4 9.75 ± 0.62 45.28 ± 1.6*
LAB27 98.6 ± 0.6 88 ± 0.5 98 ± 0.2 95 ± 0.1 0 8.5 ± 0.5 6.25 ± 1.10 6.0 ± 0.93 19.28 ± 0.79
LAB31 98.3 ± 0.4 97 ± 0.1 100 ± 0.7 96 ± 0.4 6.50 ± 0.5 7.0 ± 0.42 7.25 ± 0.47 9.25 ± 1.1 42.45 ± 2.26*
LAB32 94.6 ± 0.3 88 ± 0.8 96 ± 0.2 92 ± 0.7 0 5.0 ± 1.0 4.75 ± 0.21 7.5 ± 0.5 16.8 ± 1.1
LAB33 95.3 ± 0.2 89 ± 0.3 98 ± 0.1 95 ± 0.1 7.20 ± 0.4 10.0 ± 0.8 6.50 ± 0.86 4.5 ± 0.5 17.1 ± 1.9
LAB39 96.5 ± 0.1 93 ± 0.2 97 ± 0.3 95 ± 0.2 8.50 ± 0.5 7.5 ± 0.5 7.75 ± 0.25 8.25 ± 0.62 43.06 ± 1.5*
LGG 97.9 ± 0.5 95 ± 0.2 97 ± 0.4 93 ± 0.2 6 ± 0 7.25 ± 0.4 7.26 ± 0.47 0 18 ± 3.5

Data were analyzed using one-way ANOVA followed by Tukey’s post hoc test (P ≤ 0.05) for acid, bile tolerance, anti-microbial activity, and reduction in cholesterol assay. *significant relative to LGG (N = 4)

Antimicrobial activity

The cell-free supernatants of the sixteen LAB strains showed antibacterial activity against E. coli with a zone of inhibition ranging from 5 to 10 mm and for S. typhimurium LAB1, LAB3, LAB8, LABB16, LAB17, LAB18, LAB20, and LAB39 showed a zone of inhibition ranging from 4 to 10 mm, whereas LAB2, LAB10, LAB27 and LAB32 did not show any inhibition, respectively. The zone of inhibition against B. cereus ranging from 4 to 8 mm was observed in all the strains except LAB4, while against P. aeruginosa, all the LAB strains showed a zone of inhibition ranging from 5 to 12 mm whereas LAB2, LAB4, and LGG did not show any zone of inhibition (Table 2).

Cholesterol-lowering activity

The LAB strains exhibited variations in the reduction of cholesterol levels with LAB3, LAB20, and LAB39 showing a higher percentage of cholesterol reduction of 43, 45, and 43 percent relative to LAB1, LAB2, LAB4, LAB6, LAB8, LAB10, LAB16, LAB17, LAB27, LAB31, LAB32, and LAB33, while LGG showed 18% of cholesterol reduction (Table 2).

Adhesion to mucin

It was observed that all the selected sixteen strains showed mucin binding ranging from 20 to 40% in a strain-dependent manner. LAB1, LAB3, LAB10, LAB20, and LAB39 showed mucin binding of 35, 37, 36, 35, and 38%, whereas LAB2 and LAB32 showed mucin binding of 16 and 22% relative to LGG, respectively (Fig. 3a).

Fig. 3.

Fig. 3

Adhesion of the LAB strains to a Caco2 cells and b porcine mucin. Data were analyzed by one-way ANOVA followed by Tukey’s post hoc test (P ≤ 0.05). *Significant relative to LGG (N = 4)

Adhesion to Caco-2 cells

LAB strains showed binding ability ranging from 60 to 90%. LAB3, LAB20, LAB31, and LAB39 showed the highest binding of 70,82, 86, and 90% compared to LGG, which showed 65% binding, respectively (Fig. 3b).

Cell surface hydrophobicity auto-aggregation

All the sixteen LAB strains showed auto-aggregation ranging from 20 to 50%, where LAB1, LAB3, LAB10, LAB18, LAB20, LAB31, and LAB39 showed aggregation of 34, 47, 35, 36, 38, 37, and 42%, while LAB2 and LAB6 showed aggregation of 18 and 14.4%, respectively (Supplementary Table S4).

Microbial adhesion to hydrocarbons (MATH)

LAB3, LAB20, and LAB39 showed higher adhesion ability of 38, 43, and 44% in xylene while 36, 44, and 40% in chloroform and 30, 34, and 31% hydrophobicity in hexane, followed by hexadecane that showed adhesion of 34, 43, and 34%. LAB2 and LAB32 showed adhesion of 15 and 22% in xylene, while 17 and 24% adhesion in chloroform followed by hexane which showed 8 and 19% adhesion and also 10 and15% with hexadecane, respectively (Supplementary Table S4).

Congo red binding assay (CRB)

The broth-grown cells of LAB1, LAB3, LAB8, LAB20, LAB31, and LAB39 showed binding of 36, 47, 34, 38, 35, and 42%, while agar-grown cells of LAB3, LAB8, LAB10, LAB20, LAB27, LAB31, and LAB39 showed the binding ability of 26, 40, 30, 31, 35, 13, 28, and 40% compared to the reference LGG strain. Among all the LAB isolates, LAB2 and LAB6 showed the lowest binding ability of 10% and 8% for the agar-grown cells while 16 and 15% for the broth-grown cells (Supplementary Table S4).

Salt aggregation test (SAT)

It was observed that LAB3, LAB20, LAB30, LAB31, and LAB33 showed the highest aggregation at 0.02, 0.4, 0.8, 1.6, 3.2, and 4 M ammonium sulfate both for agar and broth-grown cells, respectively (Supplementary Table S4).

Tolerance to phenol and NaCl

All the sixteen LAB strains showed more than 70% tolerance at 0.2% phenol, while a rapid decrease was observed at 0.4% respectively. LAB3, LAB8, LAB20, LAB31, and LAB39 showed 80, 66, 90, 71, and 82% relative growth at 2.5% NaCl, while relative growth of 67, 48, 67, 54, and 69% was observed at 5% NaCl, respectively (Supplementary Fig. S3).

Further, hierarchical clustering analysis was performed among all the selected sixteen LAB strains based on the probiotic attributes assessed in the study. The heat map of unsupervised clustering showed that among all the strains, LAB3, LAB20, LAB31, and LAB39 showed the best probiotic attributes and are clustered in the same group. LAB 8 also showed better results compared to LAB18, LAB16, and LAB 17 which belong to another cluster (Supplementary Fig. S4). In the PCA biplot analysis, the first two principal components (PC), PC1 and PC2, showed a variance of 57.7% and 20.6%, respectively. From PC1, it was clear that LAB3, LAB20, LAB31, and LAB39 belong to similar groups, while LAB8 belongs to different groups, which is similar to the heat map analysis (Supplementary Fig. S5).

In vitro functional studies

Based on in vitro probiotic characteristics, five LAB strains, namely, LAB3, LAB8, LAB20, LAB31, and LAB39, were prioritized to assess the molecular mechanism behind their anti-inflammatory and DPP-IV inhibitory activity.

Antioxidant DPPH radical scavenging activity

It was observed that the whole cells of LAB3, LAB8, LAB 20, LAB31, and LAB 39 showed DPPH radical scavenging activity of 40, 20, 40, 35, and 45% compared to LGG that showed 20% of scavenging activity (Fig. 4a).

Fig. 4.

Fig. 4

Effect of LAB strains on a antioxidant and b DPP-IV inhibitory activity. Data were analyzed by one-way ANOVA followed by Tukey’s post hoc test (P ≤ 0.05). *Significant relative to LGG (N = 4)

Dipeptidyl peptidase-IV inhibition activity

LAB3, LAB8, LAB20, LAB31, LAB39, and LGG exhibited a DPP-IV inhibitory activity of 35, 32, 46, 64, 95, and 51%, whereas LAB39 exhibits the highest level of 95% of DPP-IV inhibitory activity relative to the LGG (Fig. 4b).

Attenuation of TNF-α- and lipopolysaccharide-induced pro-inflammatory stress in intestinal epithelial cells

No cytotoxic effect was observed when the Caco-2 cells were treated with 1 × 1010 CFU/ml of the five selected LAB strains for 24 h (Fig. 5a). However, Caco-2 cells stimulated with human TNF-α followed by LPS treatment showed higher levels of IL-8 production (450 pg/ml) relative to the unstimulated Caco-2 cells. Decreased IL-8 production was observed, when the epithelial cells were co-supplemented with LAB + LPS relative to LPS-alone-treated cells. Interestingly, treatment of Caco-2 cells with the bacterial strains alone did not increase the production of IL-8 levels relative to the untreated control (Fig. 5b).

Fig. 5.

Fig. 5

Prevention of TNF-α- and LPS-induced inflammation of the intestinal epithelial cells by the LAB strains. a Cell viability assay; b IL-8 cytokine production. Data were analyzed by one-way ANOVA followed by Tukey’s post hoc test (P ≤ 0.05). #Significant relative to LPS treatment; *significant relative to untreated control; #significant relative to LPS; ^ significant relative to LGG + LPS (N = 4)

LAB strains prevented LPS-induced inflammation in macrophages through modulating JNK/MAPK signaling pathway

Co-treatment of LAB3, LAB8, LAB20, LAB31, and LAB39 with LPS inhibited the expression of Cox-2, P-ERK1/2. and P-P38/P-SAPK relative to the LPS-stimulated RAW264.7 cells. Further, LAB20, LAB31, and LAB39 stimulated with LPS suppressed the expression of Cox-2, P-ERK1/2, and P-P38/P-SAPK, while LAB3 and LAB8 suppressed all these markers mentioned above except P-SAPK relative to the LPS-treated cells. It was also observed that per se treatment of macrophages with LAB strains did not elevate the expression of these markers (Fig. 6a–d).

Fig. 6.

Fig. 6

Modulation of LPS-induced JNK/MAPK pathway in RAW 264.7 cells by the LAB strains: a expression of COX-2; b expression of P-ERK 1/2 relative to ERK1/2; c expression of P-P38 relative to P-38; d expression of P-SAPK relative to SAPK. Data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. *P < 0.05 vs control; #P < 0.05 vs LPS (N = 3)

Discussion

Probiotics play a crucial role in beneficially modulating the host physiology, chelate metal ions, generate different metabolites such as lactate, downregulate reactive oxygen species (ROS)-producing enzymes, and upregulate the antioxidant activities [32]. Several research findings  suggested that consumption of Lactobacillus strains (L. paracasei, L. plantarum, L. acidophilus, L. rhamnosus, and L. acidophilus) isolated from fermented foods [33] or fermentation products (Kefir, Kimchi, and Tempeh) has been linked with a reduction in diabetes condition [34]. Therefore, research findings are needed to scientifically evaluate and characterize the potential indigenous probiotic bacteria that could be used as an adjunct to certain medications or could lead to the development of new interventional agents [35, 36]. Thus, the present study was aimed at isolating indigenous lactic acid bacterial strains from different fermented foods, vegetables, and human infants exhibiting anti-inflammatory, antioxidant, and DPP-IV inhibitory activities that can be used in alleviating various inflammatory and metabolic diseases. In the present study, thirty-six LAB strains were isolated and screened, and among them, only sixteen strains showed a reduction in the LPS-induced nitric oxide production by the murine macrophage cells. Previous studies also demonstrated that Lactobacillus, Bifidobacteria, and Weissella strains inhibited the level of nitric oxide in RAW 264.7 cells and human colon adenocarcinoma cell line (HT 29) cells [37, 38]. Furthermore, the co-supplementation with LAB strains in LPS-treated groups prevented the production of IL-6, IL-1β, and TNF-α more profoundly compared to the LGG through downregulation of inducible nitric oxide synthase. This is in agreement with several other studies depicting the anti-inflammatory potential role of Lactobacillus, Bifidobacterium, and Weissella strains [19, 37, 39]. The primary criteria for selecting potential probiotic strains are resistance to the low pH of gastric juice and bile salts in the small intestine [40]. The bile salt in the duodenum and the acid condition of the stomach have been reported to be the biggest hurdle in the survivability of LAB strains in the GI tract of the host. In the present study, the isolated LAB strains are stable and could reach the gut in viable form as they showed strong resistance towards acid and bile stress. LAB strains that showed resilience towards gastrointestinal conditions are known to possess stress response genes such as F1-F0ATPase acid and bile efflux pumps and moonlighting proteins such as DnaK, enolase, and aldolase [41]. Phenol tolerance was also observed in the LAB isolates which is very important for isolates as gut bacteria can deaminate aromatic amino acids from dietary proteins and may lead to phenols formation [10, 42]. In the present study, all the sixteen LAB strains showed more than 70% tolerance at 0.2% phenol, while LAB39 showed 82% relative growth at 2.5% NaCl and 69% at 5% NaCl, respectively. Another important attribute of a candidate probiotic strain is to exert antimicrobial activity, by which they can prevent various infections. In our study, most of the acidic supernatants could inhibit the growth of E. coli, P. aeruginosa, and B. cereus, but no inhibition was observed with S. typhimurium in LAB2, LAB10, LAB27, and LAB32 strains. It might be possible due to organic acids, which were produced during the growth phase of bacterial strains.

Probiotics are known to have mobile and intrinsic genetic components that allow them to evolve antibiotic resistance. It is believed that antibiotic tolerance in these beneficial microorganisms’ helps them to survive antibiotics in the GI system. After receiving antibiotic therapy, the probiotics with endogenous resistance can re-establish the intestinal flora, which is one of the most important key elements in determining the safety of the LAB[43]. In the present study, LAB isolates are also resistant to some of the antibiotics tested. The results of antibiotic susceptibility are similar to previous studies that have also reported the absence of acquired resistance in the LAB strains that were isolated from naturally fermented samples [44]. Many in vitro studies also suggested that probiotics isolated from fermented foods showed lower cholesterol and bile salt conjugation ability [45]. In the present study, sixteen LAB strains exhibited cholesterol-lowering ability with LAB39 showing the highest ability (43%) which is the highest at par with the previously reported studies [46]. This might be due to the bile salt hydrolase deconjugation ability, which is closely correlated with the cholesterol-lowering potential of the LAB strains. Further, the ability of bacteria to adhere to biological surfaces is a key factor in selecting promising probiotic strains, as it partly provides an indication of the colonization and adhesion ability of the strains to epithelial cells in the gastrointestinal tract [47]. Microorganisms of the same species can join self-forming groups through a process known as auto-aggregation, which is typically linked to their adhesion to the intestinal mucosa, whereas co-aggregation is the intercellular adhesion between various strains, linked with the capacity to engage in interaction with pathogens. In the present study, all the strains showed comparable hydrophobicity, while LAB3 and LAB39 showed the highest hydrophobicity and also showed Congo red binding of 47 and 43% which is at par with the previously reported studies [48]. Furthermore, these physical and chemical characteristics are largely dependent on the expression of bacterial cell wall components such as exopolysaccharides, glycoproteins, lipoproteins, lipoteichoic acids, moonlighting proteins, and surface appendages that influence their interaction [49]. Adhesion to mucin and the intestinal epithelial cells are also the key properties required for probiotics to engage with host cells and trigger any specific immune response [44]. In this study, the selected LAB strains showed considerable mucin-binding ability with LAB3 and LAB39 showing the highest binding ability of 38% which is in agreement with the previously reported study [50, 51].

Caco-2 cell binding is also one of the principal criteria for selecting probiotic strains as adherence to intestinal colonic epithelia is an essential feature. All the strains in the present study were able to adhere to Caco-2 cells and the amount of binding is in agreement with the previous reports [26]. Mucin binding and intestinal binding are largely due to the occurrence of mucus-binding proteins, pilli, and other surface proteins like fibronectin-binding proteins (FBPs) and surface-layer proteins (SLPs), which can contribute to the adherence of bacteria to the intestinal mucosa [52]. Metabolic processes in the human body generate reactive oxygen species (ROS) and oxygen-centered free radicals as by-products. An abrupt increase in the abundance of these radicals can cause severe damage to the proteins, DNA, and lipids causing tissue damage and organ malfunction. Hence, the surge to find an effective approach with lesser side effects has increased. One of the most crucial hormones used in the therapy of T2D is glucagon-like peptide (GLP-1). Enteroendocrine L cells in the gut release GLP1 in response to digestion, which further controls glucose levels in the postprandial state. Thus, the use of antioxidants such as probiotics and resveratrol can be helpful in the management and treatment of diabetes. Several in vitro and in vivo studies have shown the beneficial effects of Bifidobacteria and Lactobacillus strains on hyperglycemia, oxidative stress, and inflammation, which helps in maintaining gastrointestinal homeostasis, participates in the synthesis of certain vitamins, and could decrease oxidative stress which are beneficial in combating metabolic diseases [53–55]. In the present study, LAB3 and LAB39 showed 40 and 49% of DPPH scavenging activity, which is at par with the previously reported study that showed 30% of radical scavenging activity [56]. In the intestine, gut bacteria such as Lactobacillus and their secretions come in close proximity with the incretin hormone secretion and, upon absorption into the bloodstream, accompany and protect them from DPP-IV activity. Several studies have demonstrated that bioactive components/metabolites produced by intestinal probiotic bacteria can cross the intestinal membrane and enter the blood circulation [57]. In this study, LAB31 and LAB39 showed higher DPP-IV inhibitory activity (64% and 95%) which is the highest compared to the previously reported studies [57]. This might be due to the bacterial enzyme X-prolyl-dipeptidyl-amino-peptidase (PepX), a proline-specific peptidase, which is similar to DPP-IV along with the associated enzymatic activity [58]. Dysbiosis in the gut microbial composition affects the intestinal integrity, resulting in LPS-induced macrophage activation, NO production, and the activation of the pro-inflammatory cascade [59, 60]. LPS-treated macrophages significantly enhanced the expression of P-SAPK, P-ERK, P-38, and Cox-2 relative to the untreated macrophages. These mediators are involved in the activation of the JNK and NF-κB pathway leading to the production of pro-inflammatory cytokines [59, 60]. Co-supplementation of LAB strains with LPS showed lower levels of these proteins, and the results are in congruence with the previously reported study, where researchers have evaluated the protective role of Lactobacillus strains through modulating TLR2-mediated NF-κB and JNK/MAPK signaling pathways in inflammatory intestinal epithelial cells [61].

Conclusion

In conclusion, this study led to the selection of five strains namely Lacticaseibacillus rhamnosus LAB3, Pediococcus acidilactici LAB8, Levilactobacillus brevis LAB20, Lactiplantibacillus plantarum LAB31, and Lactiplantibacillus plantarum LAB39 with an ability to inhibit TNF-α, IL-6, and IL-1β through suppression of JNK/NF-kB pathway by the LPS-induced inflammation in the murine macrophages. Two strains LAB31 and LAB39 that possess anti-inflammatory and DPP-IV inhibitory activity could benefit in ameliorating chromatic low-grade inflammation associated with lifestyle diseases such as obesity, insulin resistance, and type 2 diabetes mellitus. Present findings could also benefit the functional food or nutraceutical industries in developing products having anti-inflammatory and anti-diabetic properties. More studies are ongoing in our laboratory on evaluating the protective functions of these strains against inflammatory gut conditions and glucose homeostasis and in alleviating endotoxemia.

Supplementary Information

Below is the link to the electronic supplementary material.

Acknowledgements

The authors would like to thank the National Agri-Food Biotechnology Institute, Mohali, Punjab, India, and the Department of Biotechnology, Government of India, for providing the research grants for carrying out this research. RB would also like to thank the Indian Council of Medical Research (ICMR) for providing the Senior Research Fellowship (3/1/2/155/2019-(Nut) and NER-BPMC (BT/PR16088/NE/95/69/2015 NER-DBT) for providing the research grant. We thank DBT-eLibrary Consortium (DeLCON) for providing access to e-resources.

Author contribution

RB performed the isolations and biochemical and probiotic characterization of lactic acid bacterial strains, Caco-2 binding studies, and other in vitro experiments; SS performed antimicrobial activity of isolated strains; RM performed cholesterol-lowering assay; SKB helped in providing the ethical approval for the human infant samples and for the isolation of the strains; KC and SRJ provide the financial support for carrying out the research; MB was responsible for editing and writing the manuscript; KKK conceptualized, designed the experiments, edited the manuscript, and got funding to carry out the study.

Funding

This study was funded by a Core Grant from NABI, Department of Biotechnology, Government of India, and an extramural grant from NER-BPMC.

Data availability

All the data are available on request.

Declarations

Ethical approval

This article does not contain any studies with animals performed by any of the authors.

Consent to participate

All the authors undersigned gave consent for participation of the given research material in this journal.

Consent for publication

All the authors undersigned gave consent for the publication of the given research material in this journal.

Conflict of interest

The authors declare no competing interests.

Footnotes

Responsible Editor: Luis Nero

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Yu HS, Lee NK, Choi AJ, Choe JS, Bae CH, Paik HD. Anti-inflammatory potential of probiotic strain Weissella cibaria JW15 isolated from kimchi through regulation of NF-κB and MAPKs pathways in LPS-induced RAW 264.7 cells. J Microbiol Biotechnol. 2019;29:1022–1032. doi: 10.4014/jmb.1903.03014. [DOI] [PubMed] [Google Scholar]
  • 2.Kostelac D, Gerić M, Gajski G, Markov K, Domijan AM, Čanak I, Jakopović Ž, Svetec IK, Žunar B, Frece J. Lactic acid bacteria isolated from equid milk and their extracellular metabolites show great probiotic properties and anti-inflammatory potential. Int Dairy J. 2021;112:104828. doi: 10.1016/j.idairyj.2020.104828. [DOI] [Google Scholar]
  • 3.Belizário JE, Faintuch J, Garay-Malpartida M. Gut microbiome dysbiosis and immunometabolism: new frontiers for treatment of metabolic diseases. Mediators Inflamm. 2018;2018:1–12. doi: 10.1155/2018/2037838. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Kim KT, Kim JW, Kim SI, Kim S, Nguyen TH, Kang CH (2021) Antioxidant and anti-inflammatory effect and probiotic properties of lactic acid bacteria isolated from canine and feline feces. Microorganisms 9(9):1971. 10.3390/microorganisms9091971 [DOI] [PMC free article] [PubMed]
  • 5.Somashekaraiah R, Shruthi B, Deepthi BV, Sreenivasa MY. Probiotic properties of lactic acid bacteria isolated from neera: a naturally fermenting coconut palm nectar. Front Microbiol. 2019;10:1–11. doi: 10.3389/fmicb.2019.01382. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Baboota RK, Bishnoi M, Ambalam P, Kondepudi KK, Sarma SM, Boparai RK, Podili K. Functional food ingredients for the management of obesity and associated co-morbidities - a review. J Funct Foods. 2013;5:997–1012. doi: 10.1016/j.jff.2013.04.014. [DOI] [Google Scholar]
  • 7.Hill C, Guarner F, Reid G, Gibson GR, Merenstein DJ, Pot B, Morelli L, Canani RB, Flint HJ, Salminen S, Calder PC, Sanders ME. Expert consensus document: the international scientific association for probiotics and prebiotics consensus statement on the scope and appropriate use of the term probiotic. Nat Rev Gastroenterol Hepatol. 2014;11:506–514. doi: 10.1038/nrgastro.2014.66. [DOI] [PubMed] [Google Scholar]
  • 8.Won TJ, Kim B, Song DS, Lim YT, Oh ES, Lee DI, Park ES, Min H, Park SY, Hwang KW. Modulation of Th1/Th2 balance by Lactobacillus strains isolated from kimchi via stimulation of macrophage cell line J774A.1 In Vitro. J Food Sci. 2011;76:55–61. doi: 10.1111/j.1750-3841.2010.02031. [DOI] [PubMed] [Google Scholar]
  • 9.Xavier-santos D, Bedani R, Lima ED, Marta S, Saad I. Impact of probiotics and prebiotics targeting metabolic syndrome. J Funct Foods. 2020;64:103666. doi: 10.1016/j.jff.2019.103666. [DOI] [Google Scholar]
  • 10.Yadav R, Puniya AK, Shukla P. Probiotic properties of Lactobacillus plantarum RYPR1 from an indigenous fermented beverage Raabadi. Front Microbiol. 2016;7:1–9. doi: 10.3389/fmicb.2016.01683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Lacroix IME, Li-Chan ECY. Food-derived dipeptidyl-peptidase IV inhibitors as a potential approach for glycemic regulation - current knowledge and future research considerations. Trends Food Sci Technol. 2016;54:1–16. doi: 10.1016/j.tifs.2016.05.008. [DOI] [Google Scholar]
  • 12.Deacon CF (2019) Physiology and pharmacology of DPP-4 in glucose homeostasis and the treatment of type 2 diabetes. Front Endocrinol 10:80. 10.3389/fendo.2019.00080 [DOI] [PMC free article] [PubMed]
  • 13.Musoev A, Numonov S, You Z, Gao H. Discovery of novel DPP-IV inhibitors as potential candidates for the treatment of type 2 diabetes mellitus predicted by 3D QSAR pharmacophore models, molecular docking and de novo evolution. Molecules. 2019;24:1–13. doi: 10.3390/molecules24162870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Yan F, Li N, Yue Y, Wang C, Zhao L, Evivie SE, Li B, Huo G (2020) Screening for potential novel probiotics with dipeptidyl peptidase IV-inhibiting activity for type 2 diabetes attenuation in vitro and in vivo. Front Microbiol 10:2855. 10.3389/FMICB.2019.02855/FULL [DOI] [PMC free article] [PubMed]
  • 15.Zeng Z, Luo J, Zuo F, Zhang Y, Ma H, Chen S. Screening for potential novel probiotic Lactobacillus strains based on high dipeptidyl peptidase IV and α-glucosidase inhibitory activity. J Funct Foods. 2016;20:486–495. doi: 10.1016/j.jff.2015.11.030. [DOI] [Google Scholar]
  • 16.Sha J, Song J, Huang Y, Zhang Y, Wang H, Zhang Y, Suo H. Inhibitory effect and potential mechanism of Lactobacillus plantarum YE4 against dipeptidyl peptidase-4. Foods. 2022;11:1–15. doi: 10.3390/foods11010080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Singh S, Bhatia R, Khare P, Sharma S, Rajarammohan S, Bishnoi M, Bhadada SK, Sharma SS, Kaur J, Kondepudi KK. Anti-inflammatory Bifidobacterium strains prevent dextran sodium sulfate induced colitis and associated gut microbial dysbiosis in mice. Sci Rep. 2020;10:1–14. doi: 10.1038/s41598-020-75702-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Reque EDF, Pandey A, Franco SG, Soccol CR. Isolation, identification and physiological study of Lactobacillus fermentum LPB for use as probiotic in chickens. Brazilian J Microbiol. 2000;31:303–307. doi: 10.1590/S1517-83822000000400012. [DOI] [Google Scholar]
  • 19.Singh S, Bhatia R, Singh A, Singh P, Kaur R, Khare P, Purama RK, Boparai RK, Rishi P, Ambalam P, Bhadada SK, Bishnoi M, Kaur J, Kondepudi KK. Probiotic attributes and prevention of LPS-induced pro-inflammatory stress in RAW264.7 macrophages and human intestinal epithelial cell line (Caco-2) by newly isolated: Weissella cibaria strains. Food Funct. 2018;9:1254–1264. doi: 10.1039/c7fo00469a. [DOI] [PubMed] [Google Scholar]
  • 20.Zukiewicz-Sobczak W, Wróblewska P, Adamczuk P, Silny W. Probiotic lactic acid bacteria and their potential in the prevention and treatment of allergic diseases. Cent Eur J Immunol. 2014;39:113–117. doi: 10.5114/ceji.2014.42134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Tamura K, Stecher G, Kumar S. MEGA11: molecular evolutionary genetics analysis version 11. Mol Biol Evol. 2021;38:3022–3027. doi: 10.1093/molbev/msab120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Stecher G, Tamura K, Kumar S. Molecular evolutionary genetics analysis (MEGA) for macOS. Mol Biol Evol. 2020;37:1237–1239. doi: 10.1093/molbev/msz312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Chiang SS, Liu CF, Tseng KC, Mau JL, Pan TM. Immunomodulatory effects of dead Lactobacillus on murine splenocytes and macrophages. Food Agric Immunol. 2012;23:183–202. doi: 10.1080/09540105.2011.609246. [DOI] [Google Scholar]
  • 24.Ganguly NK, Bhattacharya SK, Sesikeran B, Nair GB, Ramakrishna BS, Sachdev HPS, Batish VK, Kanagasabapathy AS, Muthuswamy V, Kathuria SC, Katoch VM, Satyanarayana K, Toteja GS, Rahi M, Rao S, Bhan MK, Kapur R, Hemalatha R. ICMR-DBT guidelines for evaluation of probiotics in food. Indian J Med Res. 2011;134:22–25. [PMC free article] [PubMed] [Google Scholar]
  • 25.Georgieva R, Yocheva L, Tserovska L, Zhelezova G, Stefanova N, Atanasova A, Danguleva A, Ivanova G, Karapetkov N, Rumyan N, Karaivanova E. Antimicrobial activity and antibiotic susceptibility of Lactobacillus and Bifidobacterium spp. intended for use as starter and probiotic cultures. Biotechnol Biotechnol Equip. 2015;29:84–91. doi: 10.1080/13102818.2014.987450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Anandharaj M, Sivasankari B, Santhanakaruppu R, Manimaran M, Rani RP, Sivakumar S. Determining the probiotic potential of cholesterol-reducing Lactobacillus and Weissella strains isolated from gherkins (fermented cucumber) and south Indian fermented koozh. Res Microbiol. 2015;166:428–439. doi: 10.1016/j.resmic.2015.03.002. [DOI] [PubMed] [Google Scholar]
  • 27.Ambalam P, Kondepudi KK, Nilsson I, Wadström T, Ljungh Å. Bile stimulates cell surface hydrophobicity, Congo red binding and biofilm formation of Lactobacillus strains. FEMS Microbiol Lett. 2012;333:10–19. doi: 10.1111/j.1574-6968.2012.02590.x. [DOI] [PubMed] [Google Scholar]
  • 28.Mu G, Gao Y, Tuo Y, Li H, Zhang Y, Qian F, Jiang S. Assessing and comparing antioxidant activities of lactobacilli strains by using different chemical and cellular antioxidant methods. J Dairy Sci. 2018;101:10792–10806. doi: 10.3168/jds.2018-14989. [DOI] [PubMed] [Google Scholar]
  • 29.Chalichem NSS, Jupudi S, Yasam VR, Basavan D. Dipeptidyl peptidase-IV inhibitory action of Calebin A: an in silico and in vitro analysis. J Ayurveda Integr Med. 2021;12:663–672. doi: 10.1016/j.jaim.2021.08.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Nishitani Y, Zhang L, Yoshida M, Azuma T, Kanazawa K, Hashimoto T, Mizuno M (2013) Intestinal anti-inflammatory activity of lentinan: influence on IL-8 and TNFR1 expression in intestinal epithelial cells. PLoS One 8(4):e62441. 10.1371/journal.pone.0062441 [DOI] [PMC free article] [PubMed]
  • 31.Wang W, Liu P, Hao C, Wu L, Wan W, Mao X. Neoagaro-oligosaccharide monomers inhibit inflammation in LPS-stimulated macrophages through suppression of MAPK and NF-κB pathways. Sci Rep. 2017;7:1–11. doi: 10.1038/srep44252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Lin X, Chen X, Chen Y, Jiang W, Chen H. The effect of five probiotic lactobacilli strains on the growth and biofilm formation of Streptococcus mutans. Oral Dis. 2015;21:e128–e134. doi: 10.1111/odi.12257. [DOI] [PubMed] [Google Scholar]
  • 33.Lee KW, Shim JM, Park SK, Heo HJ, Kim HJ, Ham KS, Kim JH. Isolation of lactic acid bacteria with probiotic potentials from kimchi, traditional Korean fermented vegetable. Lwt. 2016;71:130–137. doi: 10.1016/j.lwt.2016.03.029. [DOI] [Google Scholar]
  • 34.Cabello-Olmo M, Oneca M, Torre P, Sainz N, Moreno-Aliaga MJ, Guruceaga E, Díaz JV, Encio IJ, Barajas M, Araña M. A fermented food product containing lactic acid bacteria protects ZDF rats from the development of type 2 diabetes. Nutrients. 2019;11:1–23. doi: 10.3390/nu11102530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Dang F, Jiang Y, Pan R, Zhou Y, Wu S, Wang R, Zhuang K, Zhang W, Li T, Man C. Administration of Lactobacillus paracasei ameliorates type 2 diabetes in mice. Food Funct. 2018;9:3630–3639. doi: 10.1039/c8fo00081f. [DOI] [PubMed] [Google Scholar]
  • 36.Li C, Ding Q, Nie SP, Zhang YS, Xiong T, Xie MY. Carrot juice fermented with Lactobacillus plantarum NCU116 ameliorates type 2 diabetes in rats. J Agric Food Chem. 2014;62:11884–11891. doi: 10.1021/jf503681r. [DOI] [PubMed] [Google Scholar]
  • 37.Oh NS, Joung JY, Lee JY, Kim Y. Probiotic and anti-inflammatory potential of Lactobacillus rhamnosus 4B15 and Lactobacillus gasseri 4M13 isolated from infant feces. PLoS ONE. 2018;13:1–15. doi: 10.1371/journal.pone.0192021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Singh S, Bhatia R, Singh A, Singh P, Kaur R, Khare P, Purama RK, Boparai RK, Rishi P, Ambalam P, Bhadada SK, Bishnoi M, Kaur J, Kondepudi KK. Probiotic attributes and prevention of LPS-induced pro-inflammatory stress in RAW264.7 macrophages and human intestinal epithelial cell line (Caco-2) by newly isolated Weissella cibaria strains. Food Funct. 2018;9:1254–1264. doi: 10.1039/C7FO00469A. [DOI] [PubMed] [Google Scholar]
  • 39.Zhao J, Bi W, Xiao S, Lan X, Cheng X, Zhang J, Lu D, Wei W, Wang Y, Li H, Fu Y, Zhu L. Neuroinflammation induced by lipopolysaccharide causes cognitive impairment in mice. Sci Rep. 2019;9:1–12. doi: 10.1038/s41598-019-42286-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.RiazRajoka MS, Zhao H, Mehwish HM, Li N, Lu Y, Lian Z, Shao D, Jin M, Li Q, Zhao L, Shi J. Anti-tumor potential of cell free culture supernatant of Lactobacillus rhamnosus strains isolated from human breast milk. Food Res Int. 2019;123:286–297. doi: 10.1016/j.foodres.2019.05.002. [DOI] [PubMed] [Google Scholar]
  • 41.Kapse NG, Engineer AS, Gowdaman V, Wagh S, Dhakephalkar PK. Functional annotation of the genome unravels probiotic potential of Bacillus coagulans HS243. Genomics. 2019;111:921–929. doi: 10.1016/j.ygeno.2018.05.022. [DOI] [PubMed] [Google Scholar]
  • 42.Divisekera DMWD, Samarasekera JKRR, Hettiarachchi C, Gooneratne J, Choudhary MI, Gopalakrishnan S, Wahab AT. Lactic acid bacteria isolated from fermented flour of finger millet, its probiotic attributes and bioactive properties. Ann Microbiol. 2019;69:79–92. doi: 10.1007/s13213-018-1399-y. [DOI] [Google Scholar]
  • 43.Li M, Wang Y, Cui H, Li Y, Sun Y, Qiu HJ. Characterization of lactic acid bacteria isolated from the gastrointestinal tract of a wild boar as potential probiotics. Front Vet Sci. 2020;7:1–10. doi: 10.3389/fvets.2020.00049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Abriouel H, Lerma LL, del Casado Muñoz MC, Montoro BP, Kabisch J, Pichner R, Cho GS, Neve H, Fusco V, Franz CMAP, Gálvez A, Benomar N. The controversial nature of the Weissella genus: technological and functional aspects versus whole genome analysis-based pathogenic potential for their application in food and health. Front Microbiol. 2015;6:1–14. doi: 10.3389/fmicb.2015.01197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Ma C, Zhang S, Lu J, Zhang C, Pang X, Lv J. Screening for cholesterol-lowering probiotics from lactic acid bacteria isolated from corn silage based on three hypothesized pathways. Int J Mol Sci. 2019;20:1–13. doi: 10.3390/ijms20092073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Shobharani P, Halami PM. In vitro evaluation of the cholesterol-reducing ability of a potential probiotic Bacillus spp. Ann Microbiol. 2016;66:643–651. doi: 10.1007/s13213-015-1146-6. [DOI] [Google Scholar]
  • 47.Krausova G, Hyrslova I, Hynstova I (2019) In vitro evaluation of adhesion capacity, hydrophobicity, and auto-aggregation of newly isolated potential probiotic strains. Fermentation 5(4):100 10.3390/fermentation5040100
  • 48.Monika S, Kumar V, Kumari A, Angmo K, Bhalla TC. Isolation and characterization of lactic acid bacteria from traditional pickles of Himachal Pradesh, India. J Food Sci Technol. 2017;54:1945–1952. doi: 10.1007/s13197-017-2629-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Nishiyama K, Nakazato A, Ueno S, Seto Y, Kakuda T, Takai S, Yamamoto Y, Mukai T. Cell surface-associated aggregation-promoting factor from Lactobacillus gasseriSBT2055 facilitates host colonization and competitive exclusion of Campylobacter jejuni. Mol Microbiol. 2015;98:712–726. doi: 10.1111/mmi.13153. [DOI] [PubMed] [Google Scholar]
  • 50.Singh S, Gaur S. Insilico analysis of mucin-binding proteins in lactic acid bacteria. Curr Trends Biotechnol Pharm. 2021;15:108–113. doi: 10.5530/ctbp.2021.6.19. [DOI] [Google Scholar]
  • 51.Tuo Y, Song X, Song Y, Liu W, Tang Y, Gao Y, Jiang S, Qian F, Mu G. Screening probiotics from Lactobacillus strains according to their abilities to inhibit pathogen adhesion and induction of pro-inflammatory cytokine IL-8. J Dairy Sci. 2018;101:4822–4829. doi: 10.3168/jds.2017-13654. [DOI] [PubMed] [Google Scholar]
  • 52.Monteagudo-Mera A, Rastall RA, Gibson GR, Charalampopoulos D, Chatzifragkou A. Adhesion mechanisms mediated by probiotics and prebiotics and their potential impact on human health. Appl Microbiol Biotechnol. 2019;103:6463–6472. doi: 10.1007/s00253-019-09978-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Wei SH, Chen YP, Chen MJ. Selecting probiotics with the abilities of enhancing GLP-1 to mitigate the progression of type 1 diabetes in vitro and in vivo. J Funct Foods. 2015;18:473–486. doi: 10.1016/j.jff.2015.08.016. [DOI] [Google Scholar]
  • 54.Tomaro-Duchesneau C, LeValley SL, Roeth D, Sun L, Horrigan FT, Kalkum M, Hyser JM, Britton RA. Discovery of a bacterial peptide as a modulator of GLP-1 and metabolic disease. Sci Rep. 2020;10:1–12. doi: 10.1038/s41598-020-61112-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Pegah A, Abbasi-Oshaghi E, Khodadadi I, Mirzaei F, Tayebinia H. Probiotic and resveratrol normalize GLP-1 levels and oxidative stress in the intestine of diabetic rats. Metab Open. 2021;10:100093. doi: 10.1016/j.metop.2021.100093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Lin X, Xia Y, Wang G, Yang Y, Xiong Z, Lv F, Zhou W, Ai L. Lactic acid bacteria with antioxidant activities alleviating oxidized oil induced hepatic injury in mice. Front Microbiol. 2018;9:1–10. doi: 10.3389/fmicb.2018.02684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Panwar H, Calderwood D, Grant IR, Grover S, Green BD. Lactobacilli possess inhibitory activity against dipeptidyl peptidase-4 (DPP-4) Ann Microbiol. 2016;66:505–509. doi: 10.1007/s13213-015-1129-7. [DOI] [Google Scholar]
  • 58.Meyer-Barton EC, Klein JR, Imam M, Plapp R. Cloning and sequence analysis of the X-Prolyl-dipeptidyl-aminopeptidase gene (pepX) from Lactobacillus delbruckii ssp. lactis DSM7290. Appl Microbiol Biotechnol. 1993;40:82–89. doi: 10.1007/BF00170433. [DOI] [PubMed] [Google Scholar]
  • 59.Petrella C, Strimpakos G, Torcinaro A, Middei S, Ricci V, Gargari G, Mora D, De Santa F, Farioli-Vecchioli S. Proneurogenic and neuroprotective effect of a multi strain probiotic mixture in a mouse model of acute inflammation: Involvement of the gut-brain axis. Pharmacol Res. 2021;172:105795. doi: 10.1016/j.phrs.2021.105795. [DOI] [PubMed] [Google Scholar]
  • 60.Oh YC, Cho WK, Oh JH, Im GY, Jeong YH, Yang MC, Ma JY. Fermentation by Lactobacillus enhances anti-inflammatory effect of Oyaksungisan on LPS-stimulated RAW 264.7 mouse macrophage cells. BMC Complement Altern Med. 2012;12:17. doi: 10.1186/1472-6882-12-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Kim MJ, Lee HH, Jeong JW, Seo MJ, Kang BW, Park JU, Kim KS, Cho YS, Il SK, Kim GY, Kim JI, Choi YH, Jeong YK. Anti-inflammatory effects of 5-hydroxy-3,6,7,8,3′,′4- hexamethoxyflavone via NF-κB inactivation in lipopolysaccharide-stimulated RAW 264.7 macrophage. Mol Med Rep. 2014;9:1197–1203. doi: 10.3892/mmr.2014.1922. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

All the data are available on request.


Articles from Brazilian Journal of Microbiology are provided here courtesy of Brazilian Society of Microbiology

RESOURCES