Skip to main content
Poultry Science logoLink to Poultry Science
. 2022 Dec 19;102(4):102438. doi: 10.1016/j.psj.2022.102438

Serum bone remodeling parameters and transcriptome profiling reveal abnormal bone metabolism associated with keel bone fractures in laying hens

Haidong Wei *, Yanju Bi †, Yulai Wang †, Qian Zhao †, Runxiang Zhang †,‡, Jianhong Li *, Jun Bao †,‡,1
PMCID: PMC9947423  PMID: 36780704

Abstract

Keel bone fractures affect welfare, health, and production performance in laying hens. A total of one hundred and twenty 35-wk-old Hy-line Brown laying hens with normal keel (NK) bone were housed in furnished cages and studied for ten weeks to investigate the underlying mechanism of keel bone fractures. At 45 wk of age, the keel bone state of birds was assessed by palpation and X-ray, and laying hens were recognized as NK and fractured keel (FK) birds according to the presence or absence of fractures in keel bone. The serum samples of 10 NK and 10 FK birds were collected to determine bone metabolism-related indexes and slaughtered to collect keel bones for RNA-sequencing (RNA-seq), Micro-CT, and histopathological staining analyses. The results showed that the concentrations of Ca, phosphorus, calcitonin, 25-hydroxyvitamin D3, and osteocalcin and activities of alkaline phosphatase and tartrate-resistant acid phosphatase (TRAP) in serum samples of FK birds were lower than those of NK birds (P < 0.05), but the concentrations of parathyroid hormone, osteoprotegerin, and corticosterone in serum samples of FK birds were higher than those of NK birds (P < 0.05). TRAP staining displayed that FK bone increased the number of osteoclasts (P < 0.05). Micro-CT analysis indicated that FK bone decreased bone mineral density (P < 0.05). Transcriptome sequencing analysis of NK and FK bones identified 214 differentially expressed genes (DEGs) (|log2FoldChange| > 1, P < 0.05), among which 88 were upregulated and 126 downregulated. Kyoto Encyclopedia of Genes and Genomes pathway (KEGG) analysis indicated that 14 DEGs related to skeletal muscle movement and bone Ca transport (COL6A1, COL6A2, COL6A3, PDGFA, MYLK2, EGF, CAV3, ADRA1D, BDKRB1, CACNA1S, TNN, TNNC1, TNNC2, and RYR3) were enriched in focal adhesion and Ca signaling pathway, regulating bone quality. This study suggests that abnormal bone metabolism related to keel bone fractures is possibly responded to fracture healing in laying hens.

Key words: keel bone fracture, bone metabolism, bone health, RNA-seq, laying hen

INTRODUCTION

Keel bone damage, including deviations and fractures, is a severe welfare and health issue in laying hens. In particular, keel bone fractures (KBFs) have been reported to alter behavior, affect physiology, and reduce production performance and egg quality of laying hens housed in alternative housing systems, such as enriched cages, aviary and cage-free systems (Hardin et al., 2019). The genetic background and age of birds, housing systems, nutrition, and perches affect the occurrence of KBFs (Hardin et al., 2019; Rufener and Makagon, 2020). There is a significant difference in the incidence of KBFs between brown- and white-feathered laying hens, and white birds had a higher incidence of KBFs than brown birds (Stratmann et al., 2015a). The incidence of KBFs in brown-feathered hens is higher than white-feathered hens (Candelotto et al., 2017). These inconsistent results are related to body weight and egg production of laying hens. In general, brown hens have heavier body weight and lower egg production than white hens. A recent study demonstrated that KBFs were strongly associated with egg production, and laying hens with a high egg laying rate had an elevated incidence of KBFs (Eusemann et al., 2020). In addition, studies found that the incidence of KBFs increased with the age of laying hens, and the highest KBFs occurred at the peak period of laying and gradually decreased after 45 weeks of age (Gebhardt-Henrich et al., 2015; Wei et al., 2020). Therefore, KBFs could be associated with egg production because higher egg laying rate requires more Ca for eggshell formation, which affects bone metabolism and quality in laying hens.

With the rapid development of genomics, RNA sequencing (RNA-seq) has become the most common method of genomics research at the transcriptional level and has been wisely applied to study growth and development, disease screening, genetic diversity, and skeletal development in poultry and other animals. In recent years, transcriptome sequence analysis has been used to explore growth traits, meat quality characteristics, regulation of production performance, and mechanism of nutrient digestion and absorption in chickens (Teng et al., 2019; Ma et al., 2021). A few studies have examined the relationship between bone growth, development and metabolism, and bone health in laying hens through genomics methods. Guo et al. (2017) and Raymond et al. (2018) identified several strong candidate genes related to the genetic architecture of bone quality variation in laying hens using a genome-wide association study, and these genes could regulate bone strength and bone mass, affecting bone fractures. A study investigated pathophysiological characteristics of bone in laying hens fed a low Ca diet through RNA-seq and identified some osteoporosis-related differentially expressed genes (DEGs), indicating that dietary Ca deficiency induced bone damage via modulating the abnormal expression of bone quality-related genes (Jiang et al., 2019). The above studies have demonstrated that transcriptome sequencing analysis is a reliable and effective method to identify candidate genes related to bone quality and health in chickens.

As an important structural bone, the keel plays a supporting and protective role in the flapping wings and respiration of birds. Keel bone damage, especially fracture, reduces egg production, eggshell quality, and welfare, causes physiological stress, alters behaviors, and induces negative emotions in laying hens (Candelotto et al., 2017; Wei et al., 2020). Thus, KBFs are a challenging health problem for laying hen production farming. At present, the potential solutions to reduce KBFs in laying hens include dietary omega-3 polyunsaturated fatty acids or 25-hydroxyvitamin D3 (25-OHD3) supplementation (Tarlton et al., 2013), providing soft perches or ramps between perches in cage and aviary systems (Stratmann et al., 2015a, b), providing exercise space and enriched environment during pullet rearing (Casey-Trott et al., 2017a, b) and optimizing perch positioning and enriched resources (Rufener et al., 2020; Norman et al., 2021).

Although several studies have focused on the solutions to reduce the risk of KBFs and explored its causative factors in laying hens, the underlying mechanism of bone fragility remains unclear. Therefore, this study aimed to identify some candidates related to keel bone quality of laying hens housed in furnished cages through RNA-seq analysis. Our study suggests that these candidate genes (DEGs) from RNA-seq related to bone structure and metabolism that affect keel bone health in laying hens by regulating their abnormal expression at the transcription level.

MATERIALS AND METHODS

Ethics Statement

All experiments were approved by and conducted according to the guidelines of the Institutional Animal Care and Use Committee of Northeast Agriculture University (NEAU-[2011]-9).

Animals and Experimental Design

A total of 120 healthy 35-wk-old Hy-line Brown laying hens with normal keel (NK) bone and similar body weight (2.11 ± 0.03 kg) were used in this study. All laying hens were housed in 12 furnished cages with 10 birds per page, and the experiment lasted for 10 weeks from 35 to 45 weeks of age. The size of each cage was 150 cm × 70 cm × 70 cm (length × width × height), and enriched with two wooden square perches, one elevated closed red nesting box, a piece of plastic mesh, one rectangular feeder, and one waterline with four nipple drinkers. The detailed information on the layout of these resources in the furnished cage was consistent with our previous study (Wei et al., 2022). These furnished cages were placed in a semi-enclosed hen house with natural ventilation. The hen house had a combination program of natural and artificial lights. Artificial light was provided daily for 16 h of light (5:30–21:30 h) and 8 h of darkness, and light intensity was 18 to 22 lux. The ambient temperature range of the hen house was 21°C to 24°C, and relative humidity was 50% to 65%. All birds were given free access to food and water during the entire experiment period from 35 to 45 wk of age. A commercial corn-soybean meal layer diet (Wellhope Animal Husbandry Co., Ltd., Harbin, China) with 2,800 kcal/kg metabolic energy and 16.08% crude protein was provided to feed laying hens.

Assessment of Keel Bone Fractures

At the start (35-wk-old) and the end (45-wk-old) of the experiment, the keel bone status of each laying hen was assessed using palpation and a portable X-ray machine (WAT-LES100D, Shenzhen, China) according to our previous report (Wei et al., 2022). Palpation mainly assessed whether keel bone deviation was present, while X-ray primarily checked whether keel bone fractures were present. Briefly, the palpation was performed by a worker on the spinal or ventral and lateral surfaces of keel bone by running the thumb and forefinger and feeling weather keel deformities were present, such as S-deviations, sharp bends, callus, and others. If a keel with S-deviations, bending, and bumps was recognized as NK bone, and the keel with sharp bends, fragmented sections, callus materials, and shearing was considered as FK bone (Casey-Trott et al., 2015). After the palpation, X-ray was used to verify the reliability of palpated results, and fractures were recognized as keel bone with thickened bone or with black lines in the image. In this study, laying hens were classified into NK and fractured keel (FK) birds based on the absence or presence of fractures in each keel bone. A NK bone that means that it is neither deviated nor fractured. Based on the assessment result of keel bone fractures, there were 15 FK laying hens, 16 deviated keel bone laying hens, and 89 NK laying hens at 45 wk of age. These NK and FK laying hens were individually marked with different leg-tags for sample collection.

Sample Collection

After assessing keel bone fractures, 10 FK with similar locations and severity of fractures and 10 NK laying hens were selected as focal animals for collecting samples. First, the blood of these focal animals was separately collected from the wing vein by venipuncture and centrifugated at 3,000 rpm for 15 min at 4°C. Serum samples were stored at −20°C to determine bone metabolism-related indexes. Finally, all focal animals were slaughtered by cervical dislocation, and keel bone was excised from the body. Muscle and other soft tissues attached to the surface of keel bone were removed by scissors and scalpel, and keel bone samples were fast-frozen in liquid nitrogen and stored at −80°C for bone mineral density (BMD, n = 3 each group), histopathological staining (n = 3 each group), and RNA-seq analyses (n = 4 each group). These assays were performed on different keel samples. The fracture is mainly located in the caudal part of each keel bone, and the visual pictures of NK and FK bones are shown in Figure 1.

Figure 1.

Figure 1

Visual images of normal keel (NK) and fractured keel (FK) bones used in this study. The red and black dotted rectangle represents the sampling location for different assays.

Measurement of Serum Bone Metabolism-Related Indexes

The indexes related to Ca and P metabolism and bone remodeling in serum samples of NK and FK laying hens were measured. The concentrations of serum Ca and P were measured by Ca and P detection kit assay (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The concentrations of serum 25-OHD3, 1,25-hydroxyvitamin D3 (1,25-(OH)2D3), calcitonin (CT) (Shanghai Jinma Laboratory Equipment Corporation Ltd., Shanghai, China), and parathyroid hormone (PTH, Shanghai enzyme-linked Biotechnology Corporation Ltd., Shanghai, China) were measured by the enzyme-linked immunosorbent assay (ELISA) method according to the kit's instructions.

The levels of bone remodeling-related indexes include osteocalcin (OC), alkaline phosphatase (ALP), tartrate-resistant acid phosphatase (TRAP), and osteoprotegerin (OPG) in serum samples of NK and FK laying hens were measured by the corresponding ELISA kits (Shanghai Jinma Laboratory Equipment Corporation Ltd., Shanghai, China) following the kit's instructions. The activity of serum corticosterone (CORT) was detected with an ELISA kit according to the manufacturer's instructions (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). Briefly, 50 μL of serum sample containing 10 μL of serum and 40 μL of sample dilution from per focal animal was added into the micropore to measure the level of each physiological index. The measurement of each sample was performed in triplicate for each index, and their mean value was calculated as a final value. Optical density (OD) values were then measured at the corresponding wavelength of each index using a microplate reader (Biotek Instrument Inc., Winooski, VT). Finally, the level of each sample per index was calculated by the corresponding standard curve and OD values.

Keel Bone TRAP Staining

A piece of 0.5 cm long keel sample at fracture position of FK bone and a piece located at a similar position in NK bone were cut, and the transverse plane of the cut piece was subjected to histopathological observation according to previous report (Wei et al., 2021a). The cut keel bone samples were first fixed with 4% paraformaldehyde for one week and then decalcified with 10% ethylene diamine tetraacetic acid for 5 min. The bone sample was embedded into the paraffin and sliced at a thickness of 5 μm. The paraffin-embedded sections of NK and FK bone samples were dewaxed with xylene solution and ethyl alcohol and incubated in distilled water. The sections were hatched using the filtered TRAP staining solution and counterstained with hematoxylin. The sections were dehydrated with xylene and sealed with neutral balsam, and the sealed sections were observed and examined using an orthostatic light microscope (Nikon Eclipse E100, Nikon, Tokyo, Japan). Finally, the image was taken under a 400 × optical microscope, and the number of osteoclasts was counted using image analysis software for microscope (Image-Pro Plus 6.0, Media Cybernetics, MD).

Keel BMD Measurement by Micro-CT

About a 1.3 cm long keel sample from fracture position towards keel cranial side in FK bone and the corresponding location in NK bone were cut and the transverse plane of the cut samples was used to measure keel BMD. The keel bone samples were soaked in 4% paraformaldehyde solution for one week and used to measure BMD by a Micro-CT scanner (µCT 50; Scanco Medical AG., Zürich, Switzerland). The condition of the Micro-CT scanner was set at 16 µm voxel size, 70 kV source potential, 200 µA current, 300 ms integration time, and 0.5 mm aluminum filter. After the scanning, screened image was restructured by software Mimics 19.0. The threshold was set at 200 mg HA/ccm (grayscale) for keel bone samples. Finally, three-dimensional model was analyzed by the Magics 19.01 and advanced bone analysis software (Healthcare Locus SP, Connecticut, USA) to determine keel BMD.

Total RNA Extraction and Complementary DNA (cDNA) Library Construction

Total RNA was extracted from 4 NK and 4 FK bone (fractured part) samples using TRIzol reagent (Invitrogen, Carlsbad, CA), and the concentration, purity, and integrity of total RNA were determined by ultraviolet spectrophotometer (NanoDrop, Thermo Scientific, Waltham, MA) and agarose gel electrophoresis. cDNA library was constructed following the instructions of the Illumina Kit (TruSeq RNA Sample Preparation Kit V2, Illumina, San Diego, CA). Before sequencing analysis, messenger RNA (mRNA) was purified from total RNA by magnetic beads containing poly A oligos, and mRNA was fragmented by ion interruption to form short fragments of 200 to 300 bp. First-strand cDNA was synthesized by random oligonucleotides and SuperScript II using these fragments as templates. Second-strand cDNA was synthesized using DNA polymerase I and RNase H. A paired-end library was built using synthesized cDNA by a Genomic Sample Prep Kit (Illumina, San Diego, CA). To get cDNA fragments (380 bp), library fragments were purified using the AMPure XP system (Beckman Coulter, Beverly, CA), and DNA fragments with ligated adaptor molecules on both ends were enriched using Illumina PCR Primer Cocktail in a 15-cycle polymerase chain reaction (PCR). Products were purified by the AMPure XP system and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system (Agilent, Santa Clara, CA). The sequencing library was sequenced on a NovaSeq 6000 platform (Illumina, San Diego, CA) by Shanghai Personal Biotechnology Cp. Ltd., Shanghai, China.

Transcriptome Sequencing and Bioinformatics Analysis

The raw reads from RNA-seq were filtered using Cutadapt software, and the reads with adaptor contamination and low quality were removed. The remaining (clean) reads were mapped to the Gallus genome (ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF_000002315.3_Gallus_gallus4.0/GCF_000002315.3_Gallus_gallus-4.0_genomic.gff.gz) using HISAT2 software (http://ccb.jhu.edu/software/hisat2/index.shtml). In the process of mapping, mismatches of no more than two bases were allowed. Transcript expression of genes was normalized by fragments per kilobase of exon model per million mapped reads (FPKM). DEGs between groups were identified based on genes with |log2(FoldChange)| > 1 and P < 0.05 using the DEGseq R package. The functional enrichment analysis of DEGs was performed by the Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG). GO database was used for GO term analysis, and the KEGG database was used for pathway analysis and functional annotation of DEGs.

Real-time Quantitative PCR (qRT-PCR) Validation of DEGs

To validate the accuracy of RNA-seq results, a total of 14 DEGs enriched in focal adhesion (collagen type VI alpha 2 chain (COL6A2), tenascin N (TNN), platelet-derived growth factor subunit A (PDGFA), collagen type VI alpha 3 chain (COL6A3), collagen type VI alpha 1 chain (COL6A1), myosin light chain kinase 2 (MYLK2), epidermal growth factor (EGF), and caveolin 3 (CAV3)) and Ca signaling pathway (adrenoceptor alpha 1D (ADRA1D), bradykinin receptor B1 (BDKRB1), myosin light chain kinase 2 (MYLK2), troponin C2 (TNNC2), troponin C1 (TNNC1), calcium voltage-gated channel subunit alpha1 S (CACNA1S), and ryanodine receptor 3 (RYR3)) related to skeletal muscle movement and bone Ca transport were selected and validated by qRT-PCR. The special primer sequences of target genes are listed in Table 1. Total RNA was extracted from NK and FK bones using TRIzol reagent (Invitrogen, Carlsbad, CA), and cDNA was synthesized from 1 μg of total RNA using Superscript II reverse transcriptase and PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Dalian, China). cDNA of each sample was five-fold diluted with sterile water and stored at −80°C. qRT-PCR was performed on Light Cycler 96 qPCR system (Roche, Rotkreuz, Switzerland). The reaction mixture of qRT-PCR contained 10 μL, including 5 μL of 2X Roche Fast Universal SYBR Green Master kit (Roche, Mannheim, Germany), 3.4 μL of PCR water, 1 μL of diluted cDNA sample, 0.3 μL of forward and reverse primers. The conditions of qRT-PCR were set as follows: 95°C for 10 min, 40 cycles of 95°C for 15s, and 60°C for 1 min. 18S was used as an internal reference gene, and then 2−∆∆Ct method was applied to quantify the relative expression of DEGs.

Table 1.

Specific primer sequences of target genes for qRT-PCR in this study.

Gene Reference number Primer sequence (5’→3’)
18S AF173612 Forward: CGAAAGCATTTGCCAAGAAT
Reverse: GGCATCGTTTATGGTCGG
CACNA1S NM_001305147.1 Forward: CCGCCATCACCTTCCTCATTCAAG
Reverse: TCTCCACTTCGTCCATCTCCATCTG
TNN XM_040677518.1 Forward: GCTGGAAGGACTGGAACAAGGAAC
Reverse: CCGCAGGGTATGGGTAGAGGAAG
TNNC1 NM_205133.1 Forward: TGCCTTCGACATCTTCGTGCTG
Reverse: GCCATCCTCATCCACCTCATCAATC
TNNC2 NM_205450.2 Forward: GGGACATCAGCACCAAGGAGTTG
Reverse: CGCACCATCATCACCAGGAACTC
MYLK2 NM_205392.1 Forward: GAACCACCGCAACCTCATCCAG
Reverse: CGAACACCATGCAGTCCACCTC
RYR3 NM_206874.2 Forward: GCAAGAAGCCATACGGATCTCAGAG
Reverse: AATCTCCTCCTCCTCCTCCTCCTC
ADRA1D MK138998.1 Forward: GGTCATCCTGGTGGTGGTCTGG
Reverse: TGGCTCCTCGGTGATGCTACAG
BDKRB1 NM_001080720.1 Forward: TTCCCTTCTCAAACCAGACCAACAC
Reverse: ACACAGATGGCGTCGATACACTTG
CAV3 NM_204370.2 Forward: CACCACCTTCACCGTCAGCAAG
Reverse: AAGGAGATGAGGGCGAAGAGGAAG
EGF NM_001001292.1 Forward: GCCGCCTATTGCTCCAGAAGTC
Reverse: CACTGCTACACTCCTTGACAACCG
PDGFA NM_204306.1 Forward: TGGCTACCTGTCCTTTACCTCCTG
Reverse: GGATGCTGTGGATCTCGCTGTG
COL6A1 NM_205107.1 Forward: GTACTTCCGCTGTGACCGCTTC
Reverse: TGATGGCTGACACGCTGTTCTTC
COL6A2 NM_205348.3 Forward: TCTTCCCACTGACCTACAACCTGAC
Reverse: TTGATGGCGTGTATGATGGCTGAC
COL6A3 NM_205534.2 Forward: CAAGCGGCAGGAGAAGACAAGG
Reverse: GAGTGGTCGTGTGCTAAGGTGATG

Statistical Analysis

All data were analyzed by software SPSS 22.0 (SPSS Inc., Chicago, IL). Before analysis, the data were tested for normality by a Kolmogorov–Smirnov test, and an independent sample t-test was performed to compare the differences in serum Ca-P metabolism and bone remodeling indexes, bone mineral density, and validated results of DEGs between NK and FK laying hens. The results were expressed as mean ± standard error of the mean (SEM), and the difference was considered statistically significant at P < 0.05.

Results

Determination of Serum Ca and P Metabolism-Related Indexes

The results of serum Ca and P metabolism-related indexes in laying hens are shown in Table 2. Compared to NK laying hens, the concentrations of Ca, P, CT, and 25-OHD3 were significantly increased (P < 0.05), and those of PTH were significantly decreased (P < 0.05) in serum samples of FK laying hens. However, there was no significant difference in the concentration of serum 1,25-(OH)2D3 between NK and FK laying hens (P > 0.05).

Table 2.

Determination of serum Ca and P metabolism-related indexes in NK and FK laying hens.

Index (unit) NK group FK group P-value
Ca (mmol/L) 1.99 ± 0.12 1.64 ± 0.04 0.020
P (mmol/L) 2.16 ± 0.07 1.89 ± 0.08 0.025
1,25-(OH)2D3 (pg/mL) 113.94 ± 1.25 112.82 ± 2.06 0.649
25-OHD3 (ng/mL) 7.57 ± 0.07 7.13 ± 0.15 0.026
PTH (ng/L) 37.40 ± 0.25 42.34 ± 0.17 < 0.001
CT (ng/L) 85.11 ± 0.73 80.89 ± 1.06 0.005

Abbreviations: Ca, calcium; CT, calcitonin; FK, fractured keel bone; NK, normal keel bone; P, phosphorus; 1,25-(OH)2D3, 1,25-hydroxyvitamin D3; 25-OHD3, 25-hydroxyvitamin D3; PTH, parathyroid hormone.

Determination of Serum Bone Remodeling-Related Indexes

The results of serum osteoblasts and osteoclasts activity-related indexes in laying hens are shown in Table 3. The activities of serum ALP and TRAP and concentration of serum OC in FK laying hens were significantly lower than those in NK laying hens (P < 0.01). However, the levels of OPG and CORT in serum samples of FK laying hens were significantly higher than those in NK laying hens (P < 0.01).

Table 3.

Determination of serum bone remodeling-related indexes in laying hens.

Index (unit) NK group FK group P-value
ALP (U/L) 2111.08 ± 27.78 1872.68 ± 19.35 < 0.001
TRAP (U/L) 185.29 ± 1.89 160.48 ± 1.31 < 0.001
OPG (ng/L) 460.74 ± 8.96 512.01 ± 4.16 < 0.001
OC (ng/L) 8.61 ± 0.04 8.11 ± 0.08 < 0.001
CORT (ng/L) 385.12 ± 3.02 404.57 ± 4.91 0.005

Abbreviations: ALP, alkaline phosphatase; CORT, corticosterone; FK, fractured keel bone; NK, normal keel bone; OC, osteocalcin; OPG, osteoprotegerin; TRAP, tartrate-resistant acid phosphatase.

Bone Histopathological Examination

The results of the keel bone histopathological examination are shown in Figure 2. Figure 2A represents TRAP staining of keel bone samples, and the results showed that FK bone had significantly elevated (P < 0.05) number of osteoclasts than NK bone (Figure 2B).

Figure 2.

Figure 2

Results of tartrate-resistant acid phosphatase (TRAP) staining of normal keel (NK) and fractured keel (FK) bones in laying hens. (A) The images of NK and FK bone TRAP staining, and (B) the number of osteoclasts in NK and FK bones. Red arrow points to osteoclasts.

Determination of Keel BMD

The results of keel BMD measurement by Micro-CT are presented in Figure 3. Figure 3A represents the analyzed region of interest in NK and FK bones using a Micro-CT scanner. As shown in Figure 3B, the BMD of FK bone was significantly lower than NK bone (P < 0.05).

Figure 3.

Figure 3

Analysis of BMD of normal and fractured keel bones by Micro-CT. (A) The area surrounded by red line represents the scanned region (transverse plane) of cut keel bone samples for Micro-CT analysis, and (B) BMD difference in normal (NK) and fractured keel (FK) bones in laying hens.

Transcriptome Data

The results of RNA-seq and mapping of NK and FK bones are displayed in Table 4. The raw and clean reads of each library were more than 36 million and 33 million, respectively, and the average rate of clean reads was beyond 93.13%. The clean reads were mapped to the Gallus genome with a mapping rate ranging from 91.32% to 92.59%. The average percentage of Q30 bases was 92.34% in all samples. Figure 4A represents the result of correlation analysis among samples, which showed that the correlation coefficient was above 0.92, indicating the reliability of the mapping data. Figure 4B represents a principal component analysis (PCA) result of samples between groups, which displayed that inter-group samples had a significant difference in the principal components.

Table 4.

Reads quality statistics after filtering sequencing data in normal keel (NK) and fractured keel (FK) bones.

Sample Raw reads Clean reads Clean reads (%) Q30 (%) Mapped reads Mapped reads (%)
NK1 41,775,692 38,912,544 93.14 92.95 35,943,105 92.37
NK2 36,352,878 33,951,292 93.39 92.38 31,277,562 92.12
NK3 39,340,382 36,964,610 93.96 91.78 33,757,817 91.32
NK4 39,683,608 36,959,450 93.13 91.26 33,879,654 91.67
FK1 40,909,132 38,341,178 93.72 92.61 35,224,457 91.87
FK2 36,080,296 33,658,470 93.28 92.28 31,125,509 92.47
FK3 42,837,796 39,971,388 93.30 92.55 36,868,701 92.24
FK4 40,711,558 38,127,104 93.65 92.90 35,303,765 92.59

Figure 4.

Figure 4

Results of (A) correlation analysis and (B) principal component analysis (PCA) of normal keel (NK) and fractured keel (FK) bone samples by RNA-seq analysis in laying hens.

Identification of DEGs

A total of 214 DEGs were identified (|log2Fold Change| > 1, P < 0.05) in NK and FK bones by DESeq analysis, which included 88 upregulated and 126 downregulated DEGs (Figure 5A, Table S1). The clustering analysis of DEGs showed that eight samples from two groups had obvious clustering and high and low expression gene distribution between groups (Figure 5B).

Figure 5.

Figure 5

Results of (A) volcano plot and (B) clustering map of differentially expressed genes (DEGs) between normal keel (NK) and fractured keel (FK) bones by RNA-seq analysis in laying hens.

GO and KEGG Pathway Enrichment Analyses of DEGs

To analyze the function of DEGs, GO and KEGG pathway enrichment analyses were performed. In this study, 214 DEGs were enriched in 20 GO terms consisting of 11 cellular components (CC), 7 biological processes (BP), and 2 molecular functions (MF) (Figure 6A). According to the abundance of DEGs-enriched GO terms, the most abundant GO terms were in myofibril, contractile fiber, sarcomere, and contractile fiber part of cellular components and skeletal muscle contraction of biological processes, in which there were 19, 19, 17, 17, and 7 DEGs-involved, respectively. Additionally, 214 DEGs were enriched in 53 KEGG pathways in this study. The top 20 of KEGG pathways are displayed in Figure 6B. Of these pathways, DEGs were mainly enriched in focal adhesion and Ca signaling pathways, which played pivotal roles in controlling skeletal muscle contraction and bone Ca transport. According to the GO and KEGG pathway analyses of DEGs, a total of 14 DEGs (Table 5) related to bone health were selected and verified by qRT-PCR.

Figure 6.

Figure 6

Results of (A) GO and (B) KEGG enrichment analysis of differentially expressed genes (DEGs) between normal keel (NK) and fractured keel (FK) bones by RNA-seq analysis in laying hens.

Table 5.

Differentially expressed genes (DEGs) between normal and fractured keel bones enriched in KEGG pathway.

KEGG pathway Number of DEGs Pathway P-value Gene ID Gene name (abbreviation) DEGs log2(foldchange) DEGs P-value
Focal adhesion 8 0.00099 ENSGALG00000039216 Collagen type VI alpha 2 chain (COL6A2) 1.221 0.011
ENSGALG00000004538 Tenascin N (TNN) 1.156 0.048
ENSGALG00000003642 Platelet derived growth factor subunit A (PDGFA) 1.090 0.015
ENSGALG00000003923 Collagen type VI alpha 3 chain (COL6A3) 1.081 0.038
ENSGALG00000005974 Collagen type VI alpha 1 chain (COL6A1) 1.045 0.021
ENSGALG00000006273 Myosin light chain kinase 2 (MYLK2) −4.432 0.030
ENSGALG00000012155 Epidermal growth factor (EGF) −2.946 0.006
ENSGALG00000008351 Caveolin 3 (CAV3) −1.881 0.038
Calcium signaling pathway 7 0.00292 ENSGALG00000038787 Adrenoceptor alpha 1D (ADRA1D) 1.836 0.037
ENSGALG00000020386 Bradykinin receptor B1 (BDKRB1) 1.240 0.011
ENSGALG00000006273 Myosin light chain kinase 2 (MYLK2) −4.432 0.030
ENSGALG00000006835 Troponin C2 (TNNC2) −4.196 0.017
ENSGALG00000001459 Troponin C1 (TNNC1) −2.984 0.033
ENSGALG00000037744 Calcium voltage-gated channel subunit alpha1 S (CACNA1S) −1.550 0.041
ENSGALG00000009705 Ryanodine receptor 3 (RYR3) −1.276 0.016

Validation of DEGs by qRT-PCR

To validate the RNA-seq results, 14 DEGs containing 7 upregulated genes (COL6A2, TNN, PDGFA, COL6A3, COL6A1, ADRA1D, and BDKRB1) and 7 downregulated genes (MYLK2, EGF, CAV3, TNNC2, TNNC1, CACNA1S, and RYR3) were quantified using qRT-PCR. The mRNA expression level results of DEGs were normalized with reference gene 18S, and RNA-seq results were consistent (Figure 7A). The mRNA expression levels of these DEGs in NK and FK bones showed consistency with RNA-seq results (Figure 7B).

Figure 7.

Figure 7

qRT-PCR validated the expression patterns of candidate genes involved in bone health in laying hens. (A) Comparison of expression levels of candidate genes as per RNA-seq and RT-qPCR analysis. (B) Relative mRNA expression of 14 screened genes in normal keel (NK) and fractured keel (FK) bones was detected by qRT-PCR.

DISCUSSION

KBFs are severe welfare and health problem in laying hens. KBFs cause physiological stress, leading to elevated blood and feather CORT levels in laying hens (Rokavec and Šemrov, 2020; Wei et al., 2022). Similarly, the concentration of serum CORT in FK laying hens was higher than NK laying hens in this study, which demonstrated that KBFs induced stress.

Ca and P are essential nutrients regulating the bone quality and eggshell formation in poultry. Blood Ca and P levels can reflect the metabolic balance of Ca and P in the body, and their concentration in a normal range is important to maintain the calcification and remodeling of bone (Proszkowiec-Weglarz and Angel, 2013). Previous studies found that dietary Ca deficiency induced bone metabolism disorder and altered blood Ca and P levels in chickens (Jiang et al., 2013; Dijkslag et al., 2021), reducing bone quality and causing bone damage (Xu et al., 2020). Furthermore, 25-OHD3 and 1,25-(OH)2D3, two important metabolites of vitamin D3, play significant roles in modulating Ca and P absorption and metabolism in the intestinal tract and improving bone health and growth performance of animals (Kakhki et al., 2019). In laying hens and broilers, the supplementation of dietary 25-OHD3 or 1,25-(OH)2D3 as a nutritional component can enhance bone strength and eggshell quality (Kakhki et al., 2019; Wu et al., 2022). This study showed that FK birds decreased Ca, P, and 25-OHD3 concentrations in serum samples compared to NK layers, suggesting that reduced Ca, P, and 25-OHD3 levels in the blood circulation might be associated with decreased keel bone mass and quality by inhibiting the mineralization of keel bone and increasing the fragility of keel bone in laying hens. PTH and CT play key regulatory roles in bone development and metabolism (Naot and Cornish, 2008; Wang et al., 2020). In general, hypocalcaemia during the eggshell mineralization caused by insufficient Ca stimulates the synthesis of PTH to increase the concentration of 1,25-(OH)2D3 and Ca and promote bone absorption (Singh et al., 1986). In this study, FK laying hens had high serum PTH levels, but 1,25-(OH)2D3 was similar in NK and FK hens, indicating that the lack of Ca could stimulate PTH in FK birds, which alleviates the loss of bone mass caused by Ca deficiency and maintains normal bone metabolism. CT can inhibit osteoclast activity and bone resorption by reducing the level of blood Ca (Naot and Cornish, 2008). In the present study, the concentration of serum CT and Ca in FK laying hens was lower than in NK laying hens, which suggested that reduced CT in FK birds might mitigate the adverse effect of low Ca level on bone remodeling. Because insufficient Ca content reduced bone mineralization and even lead to osteoporosis (Proszkowiec-Weglarz and Angel, 2013).

The balance between bone formation regulated by osteoblasts and bone resorption maintained by osteoclasts during the bone remodeling process plays a vital function in normal bone metabolism. ALP and OC are two typical indicators reflecting osteoblast activity, and their levels are related to osteoblast-regulated bone formation (Seibel, 2006). Previous studies showed that the levels of serum ALP and OC were significantly increased after bone injury, reflecting increased osteoblast activity (Hatayama et al., 2012; Kubo et al., 2012). TRAP is a common index used to evaluate the activity of osteoclasts and macrophages during bone remodeling. Angel et al. (2000) reported that reduced TRAP activity could inhibit the ossification of cartilage tissue, while increased levels accelerated bone metabolism, leading to osteoporosis. This study found that the activities of ALP and TRAP and concentration of OC in serum samples of FK laying hens were reduced compared to NK laying hens, indicating that keel bone turnover of FK birds was lower than NK birds. TRAP staining displayed an increased number of osteoclasts in fractured keel bones, which suggested that abnormal bone metabolism was associated with keel bone fractures in laying hens. OPG is also a regulator of bone metabolism. In bone, OPG is mainly produced by osteoblast cell line cells and has a strong inhibitory effect on osteoclast formation (Bae and Kim, 2010). Blood OPG levels can reflect bone OPG activity, and people with the bone disease have an elevated level of blood OPG (Martini et al., 2007). In this study, the concentration of serum OPG in FK hens was significantly increased compared to NK hens, which could indicate that keel OPG level in FK birds was higher than that in NK birds. Elevated OPG levels in FK bone might be to inhibit osteoclast activity and reduce bone absorption, promoting bone formation and maintaining normal bone remodeling.

Micro-CT is applied to assess the bone health state of birds and other small animals, and it can provide various parameters related to bone strength and mass, such as cortical and trabecular bone parameters, and BMD (Bouxsein et al., 2010). BMD can detect the gain and loss changes of bone mass and can reflect bone mineralization, thereby it is a reliable predictor of bone health status in animals and humans (Barreiro et al., 2009). Some studies found the individuals with improved bone quality had elevated BMD (Wen et al., 2019), but bone with diseases or low quality had a reduced BMD (Teng et al., 2020). In laying hens, our previous study found that dietary soybean oil supplementation-induced bone fractures were related to reduced BMD (Wei et al., 2021b). Study also reported that BMD elevated during fracture healing process (Gao et al., 2013). In this study, FK bones reduced BMD in laying hens, which indicated that keel bone fractures were likely related to BMD variations.

In the present study, RNA-seq was performed to identify potential DEGs in NK and FK bones, which regulated bone health and metabolism in laying hens. Fourteen DEGs between NK and FK bones enriched in focal adhesion and Ca signaling pathway were identified by KEGG pathway analysis (Table 5). These analyses identified DEGs, including 7 upregulated genes (COL6A2, TNN, PDGFA, COL6A3, COL6A1, ADRA1D, and BDKRB1) and 7 downregulated genes (MYLK2, EGF, CAV3, TNNC2, TNNC1, CACNA1S, and RYR3), that play essential roles in keel bone health and quality, were verified by qRT-PCR. The results of qRT-PCR verification were consistent with the RNA-seq results, demonstrating the reliability of RNA-seq results.

In the identified 14 DEGs, COL6A1, COL6A2, COL6A3, TNN, PDGFA, EGF, MYLK2, and CAV3 were enriched in the focal adhesion pathway. Type VI collagen is non-fibrous collagen that is the major structural component of microfibrils in most tissues (Lampe and Bushby, 2005) and is associated with the collagen-binding domain of cartilage matrix proteins (Koller et al., 1989). COL6A1, COL6A2, and COL6A3 are three basic structural subunits of type VI collagen, which play a key regulatory role in muscle tissue development (skeletal and pectoral muscles) (Listrat et al., 1999), and these genes dysfunction induces muscle diseases (Braghetta et al., 2008). CAV3 is an animal muscle-specific protein marker stably expressed in cardiac, skeletal, and smooth muscles, and its expression disorder could impair muscle function (Shang et al., 2017). At the transcriptional level, the expression levels of COL6A1, COL6A2, and COL6A3 were upregulated, and CAV3 was downregulated in FK bones, which suggested that abnormal expression of these genes related to muscle function reflected the association between muscle function and keel bone health. KBFs impair the mobility of laying hens (Rentsch et al., 2019), thereby reducing muscle contraction and triggering abnormal expression of associated genes, which might also be conducive to fracture healing. TNN is a glycoprotein secreted into the extracellular matrix of developing bones, and it can effectively promote the formation of new bone and has a positive regulatory effect on osteoblasts (Meloty-Kapella et al., 2008). In chickens, TNN is mainly located in the developing skeleton, and its expression is relatively conserved, implying that it plays a crucial role in osteogenesis (Meloty-Kapella et al., 2008). The expression of TNN in FK bones was significantly higher than in NK bones in this study, which might suggest that upregulated TNN in FK bones could be to improve the activity of osteoblasts in fractured keels, accelerating bone formation and promoting the repair of damaged bone in laying hens. EGF is an important intestinal epithelial growth repair factor that regulates cell metabolism, growth, and differentiation and repairs damaged intestinal mucosa (Hodges et al., 2012). In this study, EGF expression was significantly downregulated in FK bones, which implied that keel bone fractures might impair intestinal mucosa of laying hens.

The remaining seven DEGs, including ADRA1D, BDKRB1, TNNC2, TNNC1, CACNA1S, MYLK2, and RYR3, were enriched in the Ca signaling pathway. Ca signaling plays an essential role in the development, regulation, and regeneration of bone and skeletal muscle because of the key role of Ca2+ (Tu et al., 2016). Troponin in the Ca signaling pathway regulates bone development, which is composed of three subunits, namely troponin C (TNNC, Ca2+-binding subunit), troponin I (TNNI, inhibitory subunit), and troponin T (TNNT, tropomyosin-binding subunit). A study has reported that TNNC (e.g., TNNC2) plays an important biological function in the regulation of healthy development and regeneration of the skeletal system, and the expression of TNNC at the transcript level in individuals with ankylosing spondylitis was significantly lower than normal individuals (Yu et al., 2020). This result was similar to our finding that the expression of TNNC (e.g., TNNC1 and TNNC2) in FK bones was reduced compared to NK bones, indicating that TNNC also modulated keel bone health in laying hens. Furthermore, ADRA1D and MYLK2 can maintain smooth muscle and skeletal muscle contraction (Lee et al., 1992; Docherty, 2010). This study showed that FK bones upregulated ADRA1D and downregulated MYLK2 expression, which might imply that the disorder of skeletal muscle contraction was likely related to KBFs in laying hens. RYR is an intracellular protein found in intracellular calcium release channels and is present in muscle and non-muscle tissues (Fill and Copello, 2002). Since Ca2+ is released from the sarcoplasmic reticulum or endoplasmic reticulum, the intracellular Ca2+ storage is mediated by RYR and inositol triphosphate receptors. RYR has three subtypes include RYR1, RYR2, and RYR3. RYR1 and RYR2 are subtypes of ryanodine receptors mainly located in skeletal muscle and myocardium and are involved in regulating Ca2+ conduction. RYR3 is distributed in various tissues and is co-expressed with RYR1 and RYR2. Besides, RYR3 is similar to RYR2 in that it can be activated by Ca2+ (Ogawa et al., 2000). RYR3 may participate in the transmission of Ca2+ signaling in smooth muscle and other non-muscle cells through the Ca2+-induced Ca2+ release pathway. In this study, the expression of the RYR3 gene at the transcriptional level in FK bones was significantly lower than that in NK bones, which indicated that bone fractures could affect Ca2+ signaling in keels and lead to the imbalance of intracellular ion homeostasis.

On the other hand, bone repair after fractures is a special process in which a series of cellular and molecular events occur to generate new bone, and various proteins and growth factors regulate the formation, ossification and function of new bone in this process (Arvidson et al., 2011). Previous studies reported that the expression of bone collagen (collagen type III, VI, etc.), tenascin N, troponin, growth factors released from platelets, osteonectin, and EGF promoted bone matrix synthesis, bone formation and biomineralization during fracture healing (Meloty-Kapella et al., 2008; Arvidson et al., 2011; Yu et al., 2020). In this study, the expression of COL6A1, COL6A2, COL6A3, PDGFA, and TNN was upregulated and that of TNNC1, TNNC2, and EGF was downregulated in FK bones in comparison to NK bones, which might indicate that these DEGs enriched in focal adhesion and Ca signaling pathway identified by RNA-seq were also involved in regulating keel fracture healing in laying hens.

CONCLUSION

This study showed that the levels of serum Ca/P metabolism- and bone remodeling-related indexes in laying hens with keel bone fractures were significantly altered, and fractured keel bones reduced bone mineral density. Besides, RNA-seq revealed that the DEGs associated with muscle contraction and Ca2+ transport enriched in focal adhesion and Ca signaling pathway could modulate keel bone health and quality. Therefore, the results of this study suggest that the changes in bone structure and metabolism are likely related to keel bone fractures and fracture healing in laying hens.

ACKNOWLEDGMENTS

The authors thank the members of animal behavior and welfare laboratory at College of Animal Science and Technology in Northeast Agricultural University. This work was supported by the National Natural Science Foundation of China (grant number 31972608).

DISCLOSURES

The authors confirm that there are no conflicts of interest.

Footnotes

Supplementary material associated with this article can be found in the online version at doi:10.1016/j.psj.2022.102438.

Appendix. Supplementary materials

mmc1.docx (46.1KB, docx)

REFERENCES

  1. Angel N.Z., Walsh N., Forwood M.R., Ostrowski M.C., Cassady A.I., Hume D.A. Transgenic mice overexpressing tartrate-resistant acid phosphatase exhibit an increased rate of bone turnover. J. Bone Miner. Res. 2000;15:103–110. doi: 10.1359/jbmr.2000.15.1.103. [DOI] [PubMed] [Google Scholar]
  2. Arvidson K., Abdallah B.M., Applegate L.A., Baldini N., Cenni E., Gomez-Barrena E., Granchi D., Kassem M., Konttinen Y.T., Mustafa K., Pioletti D.P., Sillat T., Finne-Wistrand A. Bone regeneration and stem cells. J. Cell. Mol. Med. 2011;15:718–746. doi: 10.1111/j.1582-4934.2010.01224.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bae Y.J., Kim M.H. Calcium and magnesium supplementation improves serum OPG/RANKL in calcium-deficient ovariectomized rats. Calcif. Tissue Int. 2010;87:365–372. doi: 10.1007/s00223-010-9410-z. [DOI] [PubMed] [Google Scholar]
  4. Barreiro F.R., Sagula A.L., Junqueira O.M., Pereira G.T., Baraldi-Artoni S.M. Densitometric and biochemical values of broiler tibias at different ages. Poult. Sci. 2009;88:2644–2648. doi: 10.3382/ps.2008-00079. [DOI] [PubMed] [Google Scholar]
  5. Bouxsein M.L., Boyd S.K., Christiansen B.A., Guldberg R.E., Jepsen K.J., Müller R. Guidelines for assessment of bone microstructure in rodents using micro–computed tomography. J. Bone Miner. Res. 2010;25:1468–1486. doi: 10.1002/jbmr.141. [DOI] [PubMed] [Google Scholar]
  6. Braghetta P., Ferrari A., Fabbro C., Bizzotto D., Volpin D., Bonaldo P., Bressan G.M. An enhancer required for transcription of the Col6a1 gene in muscle connective tissue is induced by signals released from muscle cells. Exp. Cell Res. 2008;314:3508–3518. doi: 10.1016/j.yexcr.2008.08.006. [DOI] [PubMed] [Google Scholar]
  7. Candelotto L., Stratmann A., Gebhardt-Henrich S.G., Rufener C., van de Braak T., Toscano M.J. Susceptibility to keel bone fractures in laying hens and the role of genetic variation. Poult. Sci. 2017;96:3517–3528. doi: 10.3382/ps/pex146. [DOI] [PubMed] [Google Scholar]
  8. Casey-Trott T.M., Guerin M.T., Sandilands V., Torrey S., Widowski T.M. Rearing system affects prevalence of keel-bone damage in laying hens: a longitudinal study of four consecutive flocks. Poult. Sci. 2017;96:2029–2039. doi: 10.3382/ps/pex026. [DOI] [PubMed] [Google Scholar]
  9. Casey-Trott T., Heerkens J.L.T., Petrik M., Regmi P., Schrader L., Toscano M.J. Methods for assessment of keel bone damage in poultry. Poult. Sci. 2015;94:2339–2350. doi: 10.3382/ps/pev223. [DOI] [PubMed] [Google Scholar]
  10. Casey-Trott T.M., Korver D.R., Guerin M.T., Sandilands V., Torrey S., Widowski T.M. Opportunities for exercise during pullet rearing, Part II: Long-term effects on bone characteristics of adult laying hens at the end-of-lay. Poult. Sci. 2017;96:2518–2527. doi: 10.3382/ps/pex060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dijkslag M.A., Kwakkel R.P., Martin-Chaves E., Alfonso-Carrillo C., Walvoort C., Navarro-Villa A. The effects of dietary calcium and phosphorus level, and feed form during rearing on growth performance, bone traits and egg production in brown egg-type pullets from 0 to 32 weeks of age. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Docherty J.R. Subtypes of functional α1-adrenoceptor. Cell. Mol. Life Sci. 2010;67:405–417. doi: 10.1007/s00018-009-0174-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Eusemann B.K., Patt A., Schrader L., Weigend S., Thöne-Reineke C., Petow S. The role of egg production in the etiology of keel bone damage in laying hens. Front. Vet. Sci. 2020;7:81. doi: 10.3389/fvets.2020.00081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fill M., Copello J.A. Ryanodine receptor calcium release channels. Physiol. Rev. 2002;82:893–922. doi: 10.1152/physrev.00013.2002. [DOI] [PubMed] [Google Scholar]
  15. Gao J., Gong H., Huang X., Fang J., Zhu D., Fan Y. Relationship between microstructure, material distribution, and mechanical properties of sheep tibia during fracture healing process. Int. J. Med. Sci. 2013;10:1560–1569. doi: 10.7150/ijms.6611. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gebhardt-Henrich S.G., Fröhlich E.K. Early onset of laying and bumblefoot favor keel bone fractures. Animals. 2015;5:1192–1206. doi: 10.3390/ani5040406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Guo J., Sun C., Qu L., Shen M., Dou T., Ma M., Wang K., Yang N. Genetic architecture of bone quality variation in layer chickens revealed by a genome-wide association study. Sci. Rep. 2017;7:45317. doi: 10.1038/srep45317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hardin E., Castro F.L.S., Kim W.K. Keel bone injury in laying hens: the prevalence of injuries in relation to different housing systems, implications, and potential solutions. Worlds Poult. Sci. J. 2019;75:285–292. [Google Scholar]
  19. Hatayama K., Ichikawa Y., Nishihara Y., Goto K., Nakamura D., Wakita A., Kobayashi J. Serum alkaline phosphatase isoenzymes in SD rats detected by polyacrylamide-gel disk electrophoresis. Toxicol. Mech. Methods. 2012;22:289–295. doi: 10.3109/15376516.2011.654005. [DOI] [PubMed] [Google Scholar]
  20. Hodges R.R., Bair J.A., Carozza R.B., Li D., Shatos M.A., Dartt D.A. Signaling pathways used by EGF to stimulate conjunctival goblet cell secretion. Exp. Eye Res. 2012;103:99–113. doi: 10.1016/j.exer.2012.08.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Jiang S., Cui L., Shi C., Ke X., Luo J., Hou J. Effects of dietary energy and calcium levels on performance, egg shell quality and bone metabolism in hens. Vet. J. 2013;198:252–258. doi: 10.1016/j.tvjl.2013.07.017. [DOI] [PubMed] [Google Scholar]
  22. Jiang S., Wu X.L., Jin M.L., Wang X.Z., Tang Q., Sun Y.X., Cheng H.W. Pathophysiological characteristics and gene transcriptional profiling of bone microstructure in a low calcium diet fed laying hens. Poult. Sci. 2019;98:4359–4368. doi: 10.3382/ps/pez271. [DOI] [PubMed] [Google Scholar]
  23. Kakhki R.A.M., Heuthorst T., Mills A., Neijat M., Kiarie E. Interactive effects of calcium and top-dressed 25-hydroxy vitamin D3 on egg production, egg shell quality, and bones attributes in aged Lohmann LSL-lite layers. Poult. Sci. 2019;98:1254–1262. doi: 10.3382/ps/pey446. [DOI] [PubMed] [Google Scholar]
  24. Koller E., Winterhalter K.H., Trueb B. The globular domains of type VI collagen are related to the collagen-binding domains of cartilage matrix protein and von Willebrand factor. EMBO J. 1989;8:1073–1077. doi: 10.1002/j.1460-2075.1989.tb03475.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kubo K., Yuki K., Ikebukuro T. Changes in bone alkaline phosphatase and procollagen type-1 C-peptide after static and dynamic exercises. Res. Q. Exerc. Sport. 2012;83:49–54. doi: 10.1080/02701367.2012.10599824. [DOI] [PubMed] [Google Scholar]
  26. Lampe A.K., Bushby K.M.D. Collagen VI related muscle disorders. J. Med. Genet. 2005;42:673–685. doi: 10.1136/jmg.2002.002311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lee K.J., Ross R.S., Rockman H.A., Harris A.N., O'Brien T.X., van Bilsen M., Shubeita H.E., Kandolf R., Brem G., Price J. Myosin light chain-2 luciferase transgenic mice reveal distinct regulatory programs for cardiac and skeletal muscle-specific expression of a single contractile protein gene. J. Biol. Chem. 1992;267:15875–15885. [PubMed] [Google Scholar]
  28. Listrat A., Picard B., Geay Y. Age-related changes and location of type I, III, IV, V and VI collagens during development of four foetal skeletal muscles of double-muscled and normal bovine animals. Tissue Cell. 1999;31:17–27. doi: 10.1054/tice.1998.0015. [DOI] [PubMed] [Google Scholar]
  29. Ma Z., Jiang K., Wang D., Wang Z., Gu Z., Li G., Jiang R., Tian Y., Kang X., Li H., Liu X. Comparative analysis of hypothalamus transcriptome between laying hens with different egg-laying rates. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Martini G., Gennari L., Merlotti D., Salvadori S., Franci M.B., Campagna S., Avanzati A., De Paola V., Valleggi F., Nuti R. Serum OPG and RANKL levels before and after intravenous bisphosphonate treatment in Paget's disease of bone. Bone. 2007;40:457–463. doi: 10.1016/j.bone.2006.08.003. [DOI] [PubMed] [Google Scholar]
  31. Meloty-Kapella C.V., Degen M., Chiquet-Ehrismann R., Tucker R.P. Effects of tenascin-W on osteoblasts in vitro. Cell Tissue Res. 2008;334:445–455. doi: 10.1007/s00441-008-0715-4. [DOI] [PubMed] [Google Scholar]
  32. Naot D., Cornish J. The role of peptides and receptors of the calcitonin family in the regulation of bone metabolism. Bone. 2008;43:813–818. doi: 10.1016/j.bone.2008.07.003. [DOI] [PubMed] [Google Scholar]
  33. Norman K.I., Weeks C.A., Tarlton J.F., Nicol C.J. Rearing experience with ramps improves specific learning and behaviour and welfare on a commercial laying farm. Sci. Res. 2021;11:8860. doi: 10.1038/s41598-021-88347-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Ogawa Y., Kurebayashi N., Murayama T. Putative roles of type 3 ryanodine receptor isoforms (RyR3) Trends Cardiovasc. Med. 2000;10:65–70. doi: 10.1016/s1050-1738(00)00050-5. [DOI] [PubMed] [Google Scholar]
  35. Proszkowiec-Weglarz M., Angel R. Calcium and phosphorus metabolism in broilers: effect of homeostatic mechanism on calcium and phosphorus digestibility. J. Appl. Poult. Res. 2013;22:609–627. [Google Scholar]
  36. Raymond B., Johansson A.M., McCormack H.A., Fleming R.H., Schmutz M., Dunn I.C., de Koning D.J. Genome-wide association study for bone strength in laying hens. J Anim. Sci. 2018;96:2525–2535. doi: 10.1093/jas/sky157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Rentsch A.K., Rufener C.B., Spadavecchia C., Stratmann A., Toscano M.J. Laying hen's mobility is impaired by keel bone fractures and does not improve with paracetamol treatment. Appl. Anim. Behav. Sci. 2019;216:19–25. [Google Scholar]
  38. Rokavec N., Šemrov M.Z. Psychological and physiological stress in hens with bone damage. Front. Vet. Sci. 2020;7 doi: 10.3389/fvets.2020.589274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Rufener C., Makagon M.M. Keel bone fractures in laying hens: a systematic review of prevalence across age, housing systems, and strains. J Anim. Sci. 2020;98:S36–S51. doi: 10.1093/jas/skaa145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Rufener C., Rentsch A.K., Stratmann A., Toscano M.J. Perch positioning affects both laying hen locomotion and forces experienced at the keel. Animals. 2020;10:1223. doi: 10.3390/ani10071223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Seibel M.J. Biochemical markers of bone turnover part II: clinical applications in the management of osteoporosis. Clin. Biochem. Rev. 2006;27:123–138. [PMC free article] [PubMed] [Google Scholar]
  42. Shang L., Chen T., Deng Y., Huang Y.Y., Huang Y.H., Xian J., Lu W., Yang L., Huang Q. Caveolin-3 promotes glycometabolism, growth and proliferation in muscle cells. PLoS ONE. 2017;12 doi: 10.1371/journal.pone.0189004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Singh R., Joyner C.J., Peddie M.J., Taylor T.G. Changes in the concentrations of parathyroid hormone and ionic calcium in the plasma of laying hens during the egg cycle in relation to dietary deficiencies of calcium and vitamin D. Gen. Comp. Endocrinol. 1986;61:20–28. doi: 10.1016/0016-6480(86)90245-5. [DOI] [PubMed] [Google Scholar]
  44. Stratmann A., Fröhlich E.K.F., Gebhardt-Henrich S.G., Harlander-Matauschek A., Würbel H., Toscano M.J. Modification of aviary design reduces incidence of falls, collisions and keel bone damage in laying hens. Appl. Anim. Behav. Sci. 2015;165:112–123. [Google Scholar]
  45. Stratmann A., Fröhlich E.K., Harlander-Matauschek A., Schrader L., Toscano M.J., Würbel H., Gebhardt-Henrich S.G. Soft perches in an aviary system reduce incidence of keel bone damage in laying hens. PLoS One. 2015;10 doi: 10.1371/journal.pone.0122568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Tarlton J.F., Wilkins L.J., Toscano M.J., Avery N.C., Knott L. Reduced bone breakage and increased bone strength in free range laying hens fed omega-3 polyunsaturated fatty acid supplemented diets. Bone. 2013;52:578–586. doi: 10.1016/j.bone.2012.11.003. [DOI] [PubMed] [Google Scholar]
  47. Teng J., Gao N., Zhang H., Li X., Li J., Zhang H., Zhang X., Zhang Z. Performance of whole genome prediction for growth traits in a crossbred chicken population. Poult. Sci. 2019;98:1968–1975. doi: 10.3382/ps/pey604. [DOI] [PubMed] [Google Scholar]
  48. Teng X., Zhang W., Xu D., Liu Z., Yang N., Luo D., Wang H., Ge M., Zhang R. Effects of low dietary phosphorus on tibia quality and metabolism in caged laying hens. Prev. Vet. Med. 2020;181 doi: 10.1016/j.prevetmed.2020.105049. [DOI] [PubMed] [Google Scholar]
  49. Tu M.K., Levin J.B., Hamilton A.M., Borodinsky L.N. Calcium signaling in skeletal muscle development, maintenance and regeneration. Cell Calcium. 2016;59:91–97. doi: 10.1016/j.ceca.2016.02.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Wang J., Qiu L., Gong H., Celi P., Yan L., Ding X., Bai S., Zeng Q., Mao X., Xu S., Wu C., Zhang K. Effect of dietary 25-hydroxycholecalciferol supplementation and high stocking density on performance, egg quality, and tibia quality in laying hens. Poult. Sci. 2020;99:2608–2615. doi: 10.1016/j.psj.2019.12.054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Wei H.D, Bi Y.J., Xin H.W., Pan L., Liu R.Z., Li X., Li J.H., Zhang R.X., Bao J. Keel fracture changed the behavior and reduced the welfare, production performance, and egg quality in laying hens housed individually in furnished cages. Poult. Sci. 2020;99:3334–3342. doi: 10.1016/j.psj.2020.04.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Wei H.D, Feng Y.R., Ding S.S., Nian H.Y., Yu H.L., Zhao Q., Bao J., Zhang R.X. Keel bone damage affects behavioral and physiological responses related to stress and fear in two strains of laying hens. J. Anim. Sci. 2022;100:1–10. doi: 10.1093/jas/skac076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Wei H.D, Pan L., Li C., Zhao P., Li J.H., Zhang R.X., Bao J. Dietary soybean oil supplementation affects keel bone characters and daily feed intake but not egg production and quality in laying hens housed in furnished cages. Front. Vet. Sci. 2021;8 doi: 10.3389/fvets.2021.657585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Wei H.D., Chen Y.Q., Nian H.Y., Wang J., Liu Y.L., Wang J.X., Yang K.Q., Zhao Q., Zhang R.X., Bao J. Abnormal bone metabolism may be a primary causative factor of keel bone fractures in laying hens. Animals. 2021;11:3133. doi: 10.3390/ani11113133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Wen J., Livingston K.A., Persia M.E. Effect of high concentrations of dietary vitamin D3 on pullet and laying hen performance, skeleton health, eggshell quality, and yolk vitamin D3 content when fed to W36 laying hens from day of hatch until 68 wk of age. Poult. Sci. 2019;98:6713–6720. doi: 10.3382/ps/pez386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Wu L., Wang X., Lv X., He L., Qu H., Shi C., Zhang L., Zhang J., Wang Z., Han J. 1,25-Dihydroxycholecalciferol improved the growth performance and upregulated the calcium transporter gene expression levels in the small intestine of broiler chickens. J. Poult. Sci. 2022;59:129–136. doi: 10.2141/jpsa.0210019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Xu D., Teng X., Guo R., Shen X., Wan M., Li G., Zhang R., Ge M. Metabonomic analysis of hypophosphatemic laying fatigue syndrome in laying hens. Theriogenology. 2020;156:222–235. doi: 10.1016/j.theriogenology.2020.06.032. [DOI] [PubMed] [Google Scholar]
  58. Yu C., Zhan X., Liu C., Zhang Z., Jiang J., Xu G., Xue J. A mechanism underlying sex-associated differences in ankylosing spondylitis: Troponin C2, Fast Skeletal Type (TNNC2) and Calcium signaling pathway. Med. Sci. Monit. 2020;26 doi: 10.12659/MSM.925179. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

mmc1.docx (46.1KB, docx)

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES