Skip to main content
Journal of Diabetes Investigation logoLink to Journal of Diabetes Investigation
. 2022 Dec 12;14(3):387–403. doi: 10.1111/jdi.13957

Targeted gene panel analysis of Japanese patients with maturity‐onset diabetes of the young‐like diabetes mellitus: Roles of inactivating variants in the ABCC8 and insulin resistance genes

Tohru Yorifuji 1,2,3,4,✉, Yoh Watanabe 1, Kana Kitayama 1, Yuki Yamada 1, Shinji Higuchi 1, Jun Mori 1, Masaru Kato 2, Toru Takahashi 2, Tokuko Okuda 3, Takane Aoyama 3
PMCID: PMC9951579  PMID: 36504295

Abstract

Aims/Introduction

To investigate the genetic background of Japanese patients with suspected maturity‐onset diabetes of the young (MODY).

Materials and Methods

On 340 proband patients referred from across Japan, genomic variants were analyzed using a targeted multigene panel analysis combined with the multiplex ligation probe amplification (MLPA) analysis, mitochondrial m.3243A > G analysis and methylation‐specific polymerase chain reaction of the imprinted 6q24 locus. Pathogenic/likely pathogenic variants were listed according to the 2015 American College of Medical Genetics and Genomics and the Association for Molecular Pathology criteria. Additionally, variants with a population frequency <0.001 and Combined Annotation Dependent Depletion score >20 (CS >20) were listed as rare variants of uncertain significance‐CS >20.

Results

A total of 157 pathogenic/likely pathogenic variants and 44 rare variants of uncertain significance‐CS >20 were identified. In the pathogenic/likely pathogenic variants, alterations in the GCK gene were the most common (82, 52.2%) followed by HNF1A (29, 18.5%), HNF4A (13, 8.3%) and HNF1B (13, 8.3%). One patient was a 29.5% mosaic with a truncating INSR variant. In the rare variants of uncertain significance‐CS >20, 20 (45.5%) were in the genes coding for the adenosine triphosphate‐sensitive potassium channel, KCNJ11 or ABCC8, and four were in the genes of the insulin‐signaling pathway, INSR and PIK3R1. Four variants in ABCC8 were previously reported in patients with congenital hyperinsulinism, suggesting the inactivating nature of these variants, and at least two of our patients had a history of congenital hyperinsulinism evolving into diabetes. In two patients with INSR or PIK3R1 variants, insulin resistance was evident at diagnosis.

Conclusions

Causative genomic variants could be identified in at least 46.2% of clinically suspected MODY patients. ABCC8‐MODY with inactivating variants could represent a distinct category of MODY. Genes of insulin resistance should be included in the sequencing panel for MODY.

Keywords: ABCC8, INSR, Maturity‐onset diabetes of the young


The most comprehensive and one of the largest genomic variant analyses of MODY‐like diabetes in East Asians. Found the importance of inactivating variants in the ABCC8 and insulin resistance genes.

graphic file with name JDI-14-387-g001.jpg

INTRODUCTION

Monogenic diabetes mellitus accounts for 1–4% of pediatric or young adult diabetes cases 1 , and typical clinical presentation includes maturity‐onset diabetes of the young (MODY), neonatal diabetes, insulin resistance syndromes, lipodystrophy or other syndromic diabetes.

Diagnosing and differentiating monogenic diabetes mellitus from the vast majority of type 1/type 2 diabetes is important both for the clinical management and genetic counseling of the patients 2 , 3 , 4 . Particularly, the diagnosis of MODY caused by pathogenic variants in the glucokinase (GCK), hepatic nuclear factor 1A (HNF1A), hepatic nuclear factor 4A (HNF4A) genes or in the KCNJ11, ABCC8 genes coding for the adenosine triphosphate (ATP)‐sensitive potassium channel (KATP channel) could be critical for the management of these patients, with sulfonylureas often being effective for HNF1A‐, HNF4A‐ or KATP channel‐MODY, whereas no medical intervention is generally required for GCK‐MODY 5 , 6 , 7 , 8 . The diagnosis of other types of monogenic diabetes also helps properly manage these patients with the accumulated knowledge of comorbidities and the natural course specific for each causative gene 9 .

Unfortunately, monogenic diabetes is currently extremely underdiagnosed 1 , 10 , 11 , 12 , 13 , especially when the diabetes is not associated with specific clinical features, such as neonatal diabetes, lipodystrophy or syndromic diabetes. Multiple factors make a diagnosis of monogenic diabetes difficult. For example, MODY is generally accepted as diabetes characterized by the early‐onset before 35 years, non‐obesity, dominant inheritance and negative pancreatic autoantibodies. However, not rarely, MODY is diagnosed after middle age, in obese patients, or without any affected family members 14 , 15 , 16 . The diagnosis is particularly difficult for East Asians with inherently diminished insulin secretory capacities. They develop type 2 diabetes at lower body mass index (BMI; >23 for Japanese), as compared with white Europeans 17 , 18 , and often, multiple family members are affected. Therefore, differentiating MODY from early‐onset type 2 diabetes has always been challenging for this population, resulting in lower rates of mutation identification in previous studies 19 , 20 , 21 . Additionally, molecular diagnosis is generally not covered by insurance, making the correct diagnosis even more difficult.

In the present study, we report the results of our comprehensive, multigene mutational analysis on 340 proband patients with early‐onset, MODY‐like diabetes who were referred to us under the diagnosis of suspected MODY. To address the possibility of different monogenic diabetes misdiagnosed as MODY, a broader range of monogenic diabetes genes were sequenced, including those typically presenting with insulin resistance or those associated with progressive endoplasmic reticulum stress.

MATERIALS AND METHODS

Participants

The study participants were 340 proband patients with early‐onset (0–42 years, median 11 years) diabetes who were referred to us between 2005 and 2022 from across Japan under the diagnosis of suspected MODY. All were Japanese, and the age distribution at diagnosis is shown in Figure 1. The diagnoses were made by pediatric or adult diabetologists, and the patients fulfilled at least two of the following criteria of MODY; (i) dominant inheritance of early‐onset diabetes; (ii) non‐obesity with persistently detectable C‐peptide; and (iii) negative pancreatic autoantibodies. Patients with the onset of diabetes before 6 months of age; that is, neonatal diabetes, were excluded. The study protocol was approved by the institutional review board of Osaka City General Hospital (No. 742). Written informed consent was obtained either from the patient or their legal guardians. Molecular and clinical features of a fraction of these patients were previously reported separately 22 , 23 , 24 .

Figure 1.

Figure 1

The distribution of age at diagnosis of the study participants.

Methods

Clinical data

For each patient, clinical data including sex, age at diagnosis, hemoglobin A1c at diagnosis, height and weight at diagnosis, and inheritance of diabetes were obtained from the questionnaire to the referral source. For children aged <18 years, the standard deviation score of BMI (BMI‐SDS) was determined by using the Excel‐based clinical tool for growth evaluation of children available from the Japanese Society for Pediatric Endocrinology (taikakushisu_v3.1, http://jspe.umin.jp/medical/chart_dl.html). For adults, the data from the 2018 National Health and Nutrition Survey by the Ministry of Health, Labor and Welfare were used for the calculation of BMI‐SDS (https://www.e‐stat.go.jp/dbview?sid=0003224178).

Detection of genomic variants

All analyses were carried out using the DNA extracted from peripheral blood using the QIAmp DNA mini kit (QIAGEN, Hilden, Germany). For patients with maternal inheritance, mitochondrial m.3243A > G mutation was first excluded by the polymerase chain reaction restriction fragment length polymorphism analysis as described 25 , then the remaining patients underwent the multiplex ligation‐dependent probe amplification (MLPA) analysis covering the common MODY genes (SALSA MLPA P241 including the GCK, HNF1A, HNF1B, HNF4A genes, MRC Holland, Amsterdam) and targeted multigene panel sequencing using the Ion‐PGM next‐generation sequencer (Thermo Fisher, Waltham, MA, USA). To identify patients with monogenic diabetes other than MODYs, the target genes were set broadly to include all exons of the following genes; ABCC8, APPL1, CISD2, EIF2AK3, FOXP3, GATA4, GCK, GLIS3, HNF1A, HNF1B, HNF4A, INS, INSR, KCNJ11, NEUROD1, NEUROG3, PAX6, PCBD1, PDX1, PIK3R1, RFX6, STAT3, WFS1 and ZFP57. The primer sets were generated using the Ion AmpliSeq Designer (Thermo Fisher), and sequencing was carried out using the Ion PGM next‐generation sequencer (Thermo Fisher) as per the protocol of the manufacturer. The output data were analyzed using the Ion Reporter system (Thermo Fisher). Identified variants were also visualized using the Integrative Genomics Viewer tool 26 (https://software.broadinstitute.org/software/igv/, Broad Institute), and further confirmed by Sanger sequencing when necessary. Patients referred before 2021 mostly underwent the MLPA analysis and Sanger sequencing of exons in the GCK, HNF1A, HNF4A and HNF1B genes taking into consideration the clinical features. Only those without pathogenic (P)/likely pathogenic (LP) variants in these genes underwent the above‐described targeted next‐generation sequencing. Finally, patients without P/LP variants underwent the methylation‐specific polymerase chain reaction of the chromosome 6q24 imprinted region, as described previously 23 .

Variant assessment

The pathogenicity of identified variants was assessed according to the 2015 American College of Medical Genetics and Genomics and the Association for Molecular Pathology (ACMG/AMP) criteria 27 using the InterVar website (https://wintervar.wglab.org/) 28 and the ClinVar database (https://www.ncbi.nlm.nih.gov/clinvar/), then the P/LP variants were listed as the causative variants. For genes of recessively inherited disorders; that is CISD2, EIF2AK3, GLIS3, PAX6, PCBD1 and ZFP57, the P/LP variants were not listed unless they were identified in both alleles. For RFX6, variants were not listed unless the identified variant was a truncating variant 29 , and for WFS1, monoallelic variants were not listed unless the variant was previously reported to cause dominantly inherited diabetes 30 .

In addition, variants classified as variants of uncertain significance (VUS) were separately listed as rare VUS with a Combined Annotation Dependent Depletion (CADD) score >20 (VUS‐CS >20) if they were with a population frequency <0.001 in all ethnic groups in the gnomAD database (https://gnomad.broadinstitute.org/) and the Japanese 14KJPN genomic variants database (https://jmorp.megabank.tohoku.ac.jp/202112/variants), and also if they had a CADD score >20 (https://cadd.gs.washington.edu/) 31 . These cut‐offs were arbitrarily set, because the incidence of pathogenic variants in the most common, known MODY gene, GCK, is approximately one in 1000 32 , and a cut‐off of the CADD score at 10–20 was recommended by the developer 31 .

Finally, the Human Gene Mutation Database professional version (https://digitalinsights.qiagen.com/products‐overview/clinical‐insights‐portfolio/human‐gene‐mutation‐database/; QIAGEN) was used to find previous reports of identified variants in association with the disease phenotype.

RESULTS

Of the 340 proband patients, we could identify 157 P/LP causative variants (46.2%; Figure 2a). In addition, we identified 44 variants in 42 patients with a population frequency <0.001 and with the CADD score >20 as rare VUS‐CS >20 (12.4%; Figure 2b). Tables 1 and 2 show the details of the identified variants, and the demographic data of those with the P/LP variants and rare VUS‐CS >20, respectively. The demographic features of patients without these variants are also shown in Table 3.

Figure 2.

Figure 2

(a). Breakdown of genes with pathogenic/likely pathogenic (P/LP) variants. (b). Breakdown of genes with variants of uncertain significance of a population frequency <0.001 and the Combined Annotation Dependent Depletion score >20.

Table 1.

Summary of the clinical features and the identified pathogenic/likely pathogenic variants for each patient

Patient No. Sex At diagnosis Inheritance Gene cDNA Protein ACMG/AMP classification HGMD (phenotype)
Age HbA1c Height Weight BMI‐SDS
1 F 14 7.2 157.8 50.7 0.06 NO 6q24 pat dup P –
2 F 9 7.8 133.2 27.7 −0.43 NO 6q24 pUPD P –
3 M 12 9.2 149 45 0.65 NO 6q24 pUPD P –
4 F 14 6.7 NA NA NA M ABCC8 c.1819G > A p.Val607Met LP DM
5 M 7 9.5 163 50.5 0.25 P ABCC8 c.716delC p.Thr239Metfs*19 LP –
6 F 6 7.3 108.7 16.3 −1.17 P ABCC8 c.3544C > T p.Arg1182Trp LP DM
7 M 5 6 104 16 −0.44 M GCK c.175C > T p.Pro59Ser LP DM
8 M 2 6.5 NA NA NA P GCK c.1016A > G p.Glu339Gly LP DM
9 M 9 6.4 126.8 24.5 −0.66 P GCK c.1019G > C p.Ser340Thr LP DM
10 M 9 6.5 125 24.7 −0.32 NO GCK c.1019G > C p.Ser340Thr LP DM
11 F 17 5.9 NA NA NA P GCK c.1055 T > G p.Leu352Arg LP DM
12 M 14 6.5 163 54 0.22 P GCK c.1092C > A p.Cys364* P DM
13 F 6 7 NA NA NA P GCK c.1142 T > C p.Met381Thr LP DM
14 M 14 6.6 158.5 50.9 0.2 P GCK c.1142 T > G p.Met381Arg LP DM
15 F 12 6.7 159 53 0.76 P GCK c.1144_1144insTGCTCG p.Cys382_Ser383dup LP DM
16 F 7 6.6 117.5 19 −1.25 P GCK c.1144 T > C p.Cys382Arg LP DM
17 M 8 6.7 132 26.1 −0.6 P GCK c.1183_1209delGAGAGCCGCAGCGAGGACGTAATGCGC p.Glu395_Arg403del P –
18 M 8 7.5 118.6 19.2 −1.67 P GCK c.1183G > T p.Glu395* P –
19 M 4 6.1 NA NA NA M GCK c.118G > A p.Glu40Lys LP DM
20 M 5 7.1 108.7 16.8 −0.93 P GCK c.1249C > A p.Pro417Thr LP –
21 M 6 6.8 118.5 23.8 0.82 M GCK c.1278_1286dupCGTGCGCAG p.Ser426_Arg428dup LP DM
22 M 5 6.6 107.2 19.3 0.93 P GCK c.130G > A p.Gly44Ser LP DM
23 M 17 6.8 175 65 0.09 BI GCK c.130G > A p.Gly44Ser LP DM
24 F 9 6.3 NA NA NA M GCK c.1324 delG p.Glu442Argfs*613 P –
25 F 3 6.4 NA NA NA P GCK c.1340_1368del29 p.Arg447Leufs*2 P –
26 F 10 6.4 144.6 40.4 0.8 NO GCK c.1340G > A p.Arg447Gln LP DM
27 F 8 6.3 NA NA NA M GCK c.146C > T p.Thr49Ile LP DM
28 F 8 6 114.8 19.2 −0.8 M GCK c.182A > G p.Tyr61Cys LP DM
29 M 12 6.3 146.1 40.1 −0.77 M GCK c.234C > G p.Asp78Glu LP DM
30 F 1 6.4 NA NA NA M GCK c.214G > A p.Gly72Arg LP DM
31 F 0 6 39.5 1.542 −5.43 M GCK c.214G > A p.Gly72Arg LP DM
32 F 13 6.2 156.9 41.8 −1.12 NO GCK c.234C > G p.Asp78Glu LP DM
33 F 8 7 131.6 26 −0.58 M GCK c.264G > A p.Ala188Thr LP DM
34 M 5 6.6 100.9 14.5 −0.91 M GCK c.364C > T, p.Leu122Phe LP DM
35 M 12 6.4 146.1 36 −0.67 M GCK c.469G > T p.Glu157* P DM
36 F 5 6.1 98.1 11.9 −2.58 M GCK c.500G > A p.Trp167* P DM
37 M 1 5.7 69 7.2 −1.34 P GCK c.526G > C p.Ala176Pro LP –
38 M 9 6.8 134 27 −0.8 P GCK c.533G > C p.Gly178Ala LP DM
39 M 13 6.6 161.9 45.1 −0.81 NO GCK c.544G > A p.Val182Met LP DM
40 F 13 6.3 149.2 36.6 −1.41 NO GCK c.556C > T p.Arg186* (CGA > TGA P DM
41 F 6 7.1 120 22 −0.11 P GCK c.556C > T p.Arg186* P DM
42 F 9 6.5 127 25 −0.49 P GCK c.556C > T p.Arg186* P DM
43 F 3 6.7 98 15 0.25 M GCK c.563C > T p.Ala188Val LP DM
44 M 11 6.8 144.8 42.8 0.9 M GCK c.571C > T p.Arg191Trp LP DM
45 M 9 6.4 133 32.7 0.8 M GCK c.571C > T p.Arg191Trp LP DM
46 M 3 6.7 100.8 15.2 −0.37 M GCK c.571C > T p.Arg191Trp LP DM
47 M 9 6.5 NA NA NA P GCK c.571C > T p.Arg191Trp LP DM
48 F 12 6.5 NA NA NA M GCK c.571C > T p.Arg191Trp LP DM
49 F 3 6.8 89.2 13.9 1.52 M GCK c.571C > T p.Arg191Trp LP DM
50 F 5 7 103.6 18.1 0.9 M GCK c.571C > T p.Arg191Trp LP DM
51 F 6 6.4 119 18 −2.21 P GCK c.571C > T p.Arg191Trp LP DM
52 M 10 6.9 144.8 32 −0.95 P GCK c.571C > T p.Arg191Trp LP DM
53 F 6 6.7 113.7 16.9 0.74 P GCK c.571C > T p.Arg191Trp LP DM
54 F 10 6.8 132.5 28.6 −0.38 P GCK c.571C > T p.Arg191Trp LP DM
55 M 7 6.8 118.6 20.1 −0.98 M GCK c.572G > A p.Arg191Gln LP DM
56 M 5 6.1 108.7 17 −0.78 P GCK c.572G > A p.Arg191Gln LP DM
57 M 12 6 123.9 22.4 −0.66 P GCK c.577G > T p.Gly193Trp LP DM
58 F 7 6.5 NA NA NA M GCK c.605 T > C p.Met202Thr LP DM
59 F 8 6.2 125.8 26 0.22 P GCK c.617C > G p.Thr206Arg LP DM
60 F 3 6.3 90.5 14.5 1.67 M GCK c.617C > T p.Thr206Met LP DM
61 F 6 6.8 111.4 18 −0.62 NO GCK c.617C > T p.Thr206Met LP DM
62 F 10 6.9 128.4 25.4 −0.85 P GCK c.617C > T p.Thr206Met LP DM
63 F 10 6.5 132 27 −0.8 NO GCK c.635_637delCCT p.S212Cfs P DM
64 M 9 6.2 136.4 26.6 −1.34 P GCK c.671 T > A p.Met224Lys LP DM
65 M 3 6 100.1 16.45 0.82 UN GCK c.706G > A p.Glu236Lys LP DM
66 M 12 10.5 168 45.6 −1.07 NO GCK c.743delA p.Asp248Alafs*47 P –
67 F 9 6.5 142.8 32.7 −0.21 P GCK c.751A > G p.Met251Val LP DM
68 F 14 6.8 155.6 38.05 −2.21 M GCK c.764C > G p.Thr255Ser LP DM
69 F 19 6.4 152 43 −1.04 P GCK c.76C > T p.Gln26* P DM
70 F 9 6.6 129.6 26.2 −0.43 P GCK c.76C > T p.Gln26* P DM
71 M 11 6.1 143.3 31.2 −1 P GCK c.773G > T p.Gly258Val LP –
72 M 6 6 116 22.9 0.86 M GCK c.775G > A p.Ala259Thr LP DM
73 F 4 6.5 89.6 11 −1.29 M GCK c.781G > A p.Gly261Arg LP DM
74 M 10 6.4 140 32 −0.33 M GCK c.781G > A p.Gly261Arg LP DM
75 M 18 7 165 53 −0.61 P GCK c.781G > A p.Gly261Arg LP DM
76 F 11 6.7 141 42 1.07 M GCK c.838_839delAG p.Ser280Leufs*10 P DM
77 F 5 6.7 102 15.7 −0.16 UN GCK c.864‐2A > G LP DM
78 M 12 6.2 144.6 36.5 −0.38 NO GCK c.873G > C p.Lys291Asn LP –
79 M 6 6.5 NA NA NA NO GCK c.895G > A p.Gly299Ser LP DM
80 M 9 6.5 NA NA NA M GCK c.895G > C p.Gly299Arg LP DM
81 M 10 6.2 133.5 28.4 −0.54 NO GCK c.898G > T p.Glu300* P DM
82 M 12 6.7 156 47 0.35 P GCK c.908G > T p.Arg303Leu LP DM
83 M 9 6.3 135.3 36 1.13 NO GCK c.957_984delGGAGGCCTCCGAGCAGCTGCGCACACGC p.Ala321Profs*24 P ー
84 M 10 6.3 127.6 24.4 −1.14 M GCK exon 6 del P DM
85 M 9 6.5 127.4 23.8 −1.06 M GCK exon 4–5 del P DM
86 M 4 6.4 97.4 13 −1.48 M GCK all exon del P DM
87 M 3 6 NA NA NA M GCK c.617C > T p.Thr206Met LP DM
88 M 14 6.5 146.2 32.2 −2.52 NO GCK c.898G > C p.Glu300Gln LP DM
89 F 11 NA 130.1 27.5 −0.74 M HNF1A c.1054delT p.Ser352Profs*12 P DM
90 F 15 10.5 137 40.9 0.38 P HNF1A c.1136delC p.Pro379Leufs*5 P DM
91 F 13 6.5 157.9 44.6 −0.68 UN HNF1A c.1181delC p.Pro394Glnfs*19 P DM
92 F 13 7.4 141.4 32 −1.66 P HNF1A c.1340C > T p.Pro447Leu LP DM
93 F 12 6.7 156.7 47.6 0.25 M HNF1A c.1340C > T p.Pro447Leu LP DM
94 F 14 7 150.2 65 2.08 M HNF1A c.142delG p.Glu48Serfs*107 P DM
95 F 13 6.9 147.4 50.6 1.14 M HNF1A c.1768 + 1G > T P DM
96 M 10 8.3 NA NA NA P HNF1A c.391C > T p.Arg131Trp LP DM
97 M 5 5.7 109.7 19.95 0.8 M HNF1A c.391C > T p.Arg131Trp LP DM
98 F 11 NA NA NA NA P HNF1A c.392G > A p.Arg131Gln LP DM
99 M 15 7.2 150.9 43.1 −0.53 NO HNF1A c.493delT p.Trp165Glyfs*21 P –
100 M 14 5.6 167.2 41.1 −2.82 M HNF1A c.598C > T p.Arg200Trp LP DM
101 F 12 11 142.3 41.2 0.57 P HNF1A c.598C > T p.Arg200Trp LP DM
102 F 14 16.6 NA 40.8 NA M HNF1A c.618G > A p.Trp206* P DM
103 F 11 6.4 143.8 40.1 0.55 NO HNF1A c.618G > A p.Trp206* P DM
104 F 14 13 154.2 42.4 −1 P HNF1A c.685C > T p.Arg229* P DM
105 F 11 8.8 152 52 1.4 P HNF1A c.686G > A p.Arg229Gln LP DM
106 F 12 6.4 152.8 50.1 0.9 P HNF1A c.779C > T p.Thr260Met LP DM
107 M 8 7.2 130 27.3 0.09 M HNF1A c.788G > A p.Arg263His LP DM
108 M 10 7.6 145 35 −0.17 M HNF1A c.811C > T p.Arg271Trp LP DM
109 M 10 6 145.5 40.7 0.8 P HNF1A c.827C > A p.Ala276Asp LP DM
110 F 12 8.5 160.2 43.7 −0.73 M HNF1A c.872dupC p.Gly292Argfs*25 P DM
111 M 6 11.6 NA NA NA P HNF1A c.872dupC p.Gly292Argfs*25 P DM
112 F 13 6.4 141 30 −2.23 P HNF1A c.872dupC p.Gly292Argfs*25 LP DM
113 F 7 NA NA NA NA M HNF1A ex7,8,9 del P DM
114 M 10 7.8 136.8 41.8 1.49 M HNF1A p.Arg229Gln c.686G > A LP DM
115 F 9 8.7 130.8 38 1.7 M HNF1A c.872delC p.Pro291Glnfs*51 P DM
116 F 4 7.7 102.8 16.1 −0.02 NO HNF1A all exon del P DM
117 M 8 6.5 132.2 36.4 1.61 M HNF1A c.872delC p.Pro291Glnfs*51 P DM
118 M 9 NA NA NA NA P HNF1B c.286C > T p.Gln96* P –
119 M 7 NA NA NA NA NO HNF1B c.395A > C p.His132Pro LP DM
120 M 13 12.7 158 36 −2.69 NO HNF1B c.494G > A p.Arg165His LP DM
121 F 12 12.3 155.6 47.3 0.3 M HNF1B c.544 + 1G > A P DM
122 M 0y11m 9.3 75 9.67 0.4 NO HNF1B exon 1–4 del P DM
123 M 9 8 117.8 21.6 −0.46 NO HNF1B exon 3–4 del P DM
124 M 37 10 NA NA NA NO HNF1B all exon del P DM
125 F 12 6.5 151 35.35 −1.55 P HNF1B all exon del P DM
126 M 21 16.7 176 38.9 −2.72 P HNF1B all exon del P DM
127 F 14 16.1 149.9 45.1 −0.05 NO HNF1B all exon del P DM
128 F 15 7.2 161.6 45.4 −1.49 NO HNF1B all exon del P DM
129 F 12 18.1 NA NA NA UN HNF1B exon 3–4 del P DM
130 F 13 NA NA 47.2 NA NO HNF1B all exon del P DM
131 F 8 NA 126.2 26.8 0.39 NO HNF4A c.1079C > T + c.1052 T > C (same allele) p.Ala360Val + p.Met351Thr (same allele) LP –
132 F 23 8.7 167.7 51.9 −0.76 P HNF4A c.146A > C p.His49Pro LP DM
133 M 40 7.1 169 54 −1.51 P HNF4A c.359 + 1G > A P –
134 M 18 6 165 64 0.97 P HNF4A c.427‐2A > G P DM
135 F 13 8.9 158 57.2 1.04 NO HNF4A c.518 T > C p.Leu173Pro LP –
136 F 9 7.5 149 47.9 1.58 M HNF4A c.582 + 2_582 + 10delTGAGGATGG LP –
137 F 9 NA 136.8 34.8 0.81 NO HNF4A c.802C > T (de novo) p.Gln268* P –
138 F 11 6.5 147 39.4 0.14 M HNF4A c.916insT p.Tyr306Leufs*2 P –
139 F 16 9.2 158.5 49.7 −0.46 M HNF4A c.857 T > A p.Ile286Asn LP DM
140 M 12 10.7 148.9 38.1 −0.51 NO HNF4A c.874C > T p.Gln292* P DM
141 F 12 7.9 151.2 40.7 −0.37 P HNF4A c.956_958dupTGC p.Leu319dup LP DM
142 F 13 10.5 147 41.4 −0.15 P HNF4A c.925C > T p.Arg309Cys LP DM
143 F 12 15.6 149.3 39.2 −0.47 M HNF4A c.713A > C p.Glu238Ala LP –
144 M 21 8.2 173 62 −0.4 P INS c.101A > T p.His34Leu LP –
145 F 8 5.8 127 24.4 −0.45 M INS c.163C > T p.Arg55Cys LP DM
146 M 7 6.5 130.1 29.3 0.8 NO INS c.212delG p.Gly71Alafs P –
147 F 1 11.1 73 7.7 −1.07 P INS c.94G > A p.Gly32Ser LP –
148 F 13 14.9 149.8 46.2 0.36 NO INSR c.282_283TG > GT p.TyrGly94_95*Trp P –
149 M 6 8.2 NA NA NA NO KCNJ11 c.685G > A p.Glu229Lys LP DM
150 M 42 NA NA NA NA BI MITO m.3243A > G P
151 F 15 NA NA NA NA M MITO m.3243A > G P
152 F 18 10.5 166.9 60 0.57 M MITO m.3243A > G P
153 F 31 5.6 NA NA NA M MITO m.3243A > G P
154 M 14 NA NA NA NA M MITO m.3243A > G P
155 M 25 11.2 165.9 59.8 −0.11 M MITO m.3243A > G P
156 F 26 8.3 143.5 44.7 0.16 M MITO m.3243A > G P
157 F 28 10.1 149.4 53.6 0.92 M MITO m.3243A > G P

The reference sequences for each gene: NM_000162.3 (GCK), NM_000545.5 (HNF1A), NM_175914.3 (HNF4A), NM_000458.2 (HNF1B), NM_000207.2(INS), NM_000525.3(KCNJ11), NM_000352.3 (ABCC8), NM_000208.2 (INSR).

ACMG/AMP classification, classification of pathogenicity by the criteria of American College of Medical Genetics and Genomics/Association for Molecular Pathology with P (pathogenic) and LP (likely pathogenic); BI (both parents affected); BMI‐SDS, standard deviation score of body mass index; del, deletion; HGMD, listing in the Human Gene Mutation Database professional with “–(minus)” representing absence and diabetes representing diabetes phenotype; Inheritance, P (paternal), M (maternal), NO (no affected parents), MITO, mitochondrial gene; pat dup, duplication of the paternal allele; NA, not available; pUPD, paternal uniparental disomy.

Table 2.

Summary of the clinical features and the identified rare variants of uncertain significance of a population frequency <0.001 and the Combined Annotation Dependent Depletion score >20 for each patient

Patient No. At diagnosis Inheritance Gene cDNA protein ACMG/AMP classification CADD TMMo MAF in gnomAD ALL HGMD (phenotype)
Sex Age HbA1c Height Weight BMI‐SDS
158 M 11 NA NA 52 NA P ABCC8 c.1513G > A p.Gly505Ser VUS 31 – – DM
159 M 14 10 NA NA NA NO ABCC8 c.1596C > G p.Ser532Arg VUS 23.5 – – –
160 M 11 13.5 144.3 31.7 −1.32 NO ABCC8 c.3533A > G p.Gln1178Arg VUS 23.9 – – DM
161 F 11 6 153.2 50.8 1.20 NO ABCC8 c.4259G > A p.Arg1420His VUS 31 0.00014 – HI/DM
162 F 11 5.1 NA 42 NA M ABCC8 c.4457G > A p.Arg1486Lys VUS 28.3 – – HI
163 F 10 7.4 133.7 34.9 0.86 NO ABCC8 c.4132G > A p.Gly1378Ser VUS 24.7 – – HI
164 M 11 6.7 NA NA NA BI ABCC8 c.1432G > T p.Ala478Ser VUS 24 – – –
165 F 10 9.5 150 49 1.44 P ABCC8 c.1673C > T p.Thr558Ile VUS 32 – – –
166 F 22 NA NA NA NA P ABCC8 c.2957C > T p.Ser986Leu VUS 24.8 – 0.00003 –
167 M 28 NA 170 91.4 2.72 NA ABCC8 c.2405 T > C p.Ile802Thr VUS 20.3 – – –
168 F 9 8.5 148.4 52.5 1.98 M ABCC8 c.1337 T > C p.Ile446Thr VUS 23 ー – DM
169 F 15 13.8 172 56 −0.71 M ABCC8 c.359C > G p.Ser120Cys VUS 25 – – –
170 F 9 6.7 133.9 44.45 2.12 BI ABCC8 c.3088G > A p.Asp1030Asn VUS 25.1 – – HI
171 M 11 5.6 129.7 26.8 −0.86 M ABCC8 c.3875A > C p.Asn1292Thr VUS 24.2 – – –
172 F 13 6.5 162.4 46.1 −0.87 M ABCC8 c.2300G > A p.Gly767Asp VUS 23.1 0.00053 – –
ABCC8 c.1753A > G p.Ile585Val VUS 23.4 – – –
173 M 12 6.8 151 50 1.07 P GCK c.1151C > T p.Ala384Val VUS 29.9 0.00004 – DM
174 F 14 6.7 152 40.2 −1.22 M GCK c.1174C > G p.Arg392Gly VUS 31 – – DM
175 F 8 5.7 127.2 26.1 0.08 NO GCK c.1232C > T p.Ser411Phe VUS 31 – – DM
176 M 8 6.9 118.5 19.1 −1.71 NO GCK c.437 T > G p.Leu146Arg VUS 28.7 – – DM
177 M 7 6.3 120.9 22.3 −0.27 P GCK c.538A > C p.Asn180His VUS 25.8 – – DM
178 F 11 6.6 149.7 35.3 −1.01 M GCK c.707A > C p.Glu236Ala VUS 25.1 – – DM
179 F 10 6.5 134.3 27.6 −0.91 M GCK c.1144 T > C p.Cys382Arg VUS 32 – – –
180 M 14 6.8 159.8 44 −1.1 M GCK c.164 T > G p.Val55Gly VUS 26 – – –
181 M 5 6.1 118 19 −1.5 NA HNF1A c.505A > G p.Lys169Glu VUS 23 – – ––
182 F 12 6.5 149 37 −0.19 NO HNF1A c.1544C > A p.Thr515Lys VUS 26.8 0.00011 – DM
183 F 12 8.8 NA NA NA M HNF1A c.1043 T > C p.Leu348Pro VUS 26.3 – – DM
184 M 13 6.2 154 44 −0.19 UNK HNF1A c.397G > T p.Val133Leu VUS 23.7 – – DM
185 M 11 7.3 NA NA NA M HNF1A c.485 T > C p.Leu162Pro VUS 26.3 – – DM
186 F 12 6.4 140.1 30.7 −1.47 P HNF1A c.493 T > C p.Trp165Arg VUS 27.2 – – DM
187 M 10 10.3 NA NA NA NA HNF1A c.494G > C p.Trp165Ser VUS 27.9 – – –
188 F 10 8.7 144.9 45.9 1.46 M HNF1A c.778A > T p.Thr260Ser VUS 23.6 – – DM
189 F 11 9.7 153.3 44 0.32 P HNF1A c.791 T > C p.Val264Ala VUS 26 – – DM
190 M 34 6.2 NA NA NA M HNF1A c.794A > T p.Tyr265Phe VUS 25.4 – – –
191 F 12 10.6 154.2 42.1 −0.42 NO INSR c.3542C > A p.Thr1181Asn VUS 26.8 – – –
PIK3R1 c.248C > T p.Ser83Leu VUS 24.9 0.00004 – –
192 M 33 NA NA NA NA NO INSR c.806C > T p.Pro269Leu VUS 28.4 0.00014 – –
193 M 8 NA 126.2 26.6 0.34 NM INSR c.881A > G p.Lys294Arg VUS 23.1 0.00074 0.0002 –
194 F 8 8.9 136.3 37.4 1.44 M KCNJ11 c.139A > G p.Lys47Glu VUS 23.8 – – –
195 F 9 5.6 138.8 30 −0.45 M KCNJ11 c.1105C > T p.Arg369Cys VUS 26.5 0.00002 – –
196 M 20 8 NA NA NA P KCNJ11 c.10C > T p.Arg4Cys VUS 28.7 – 0.00003 DM
197 F 2 10.1 NA NA NA P KCNJ11 c.968A > G p.Asp323Gly VUS 24.4 – – –
198 M 14 NA NA NA NA M PDX1 c.239C > T p.Ala80Val VUS 23.5 – – –
199 F 8 NA 122 28 1.09 M PDX1 c.119G > A p.Arg40His VUS 29.9 0.00021 – –

Variants classified as variants of unknown significance (VUS) by the 2015 American College of Medical Genetics and Genomics and the Association for Molecular Pathology criteria, but with a population frequency <0.001 and with a scaled C‐score by the Combined Annotation Dependent Depletion (CADD score) >20 are listed. The reference sequences for each gene: NM_000209.3 (PDX1), NM_181523.2 (PIK3R1), NM_000162.3 (GCK), NM_000545.5 (HNF1A), NM_175914.3 (HNF4A), NM_000458.2 (HNF1B), NM_000207.2 (INS), NM_000525.3 (KCNJ11), NM_000352.3 (ABCC8), NM_000208.2 (INSR). ACMG/AMP classification, classification of pathogenicity by the criteria of American College of Medical Genetics and Genomics/Association for Molecular Pathology with P (pathogenic) and LP (likely pathogenic); BI (both parents affected); BMI‐SDS, standard deviation score of body mass index; del, deletion; DM, diabetes; HGMD, listing in the Human Gene Mutation Database professional with “–(minus)” representing absence and diabetes representing diabetes phenotype; HI, hyperinsulinemic hypoglycemia; Inheritance, P (paternal), M (maternal), NO (no affected parents), MITO, mitochondrial gene; pat dup, duplication of the paternal allele; MAF in gnomAD ALL, minor allele frequency in the gnomAD database for all ethnic groups with “–(minus)” representing absence; NA, not available; pUPD, paternal uniparental disomy; TMMo, allele frequency in the Japanese 14 K database (jMorp) with “–(minus)” representing absence.

Table 3.

Summary of the clinical features of patients without pathogenic/likely pathogenic or rare variants of uncertain significance of a population frequency <0.001 and the Combined Annotation Dependent Depletion score >20

Patient No. At diagnosis Inheritance
Sex Age HbA1c Height Weight BMI‐SDS
200 M 6 8.2 NA NA NA NO
201 M 12 NA 153.8 64.6 1.93 NA
202 M 5 5.8 108.1 18.1 0.11 P
203 M 13 10.9 161.4 57.05 0.88 M
204 M 1 5.8 89 11.6 −1.58 NO
205 F 10 7.5 NA NA NA M
206 F 15 8.9 144.8 NA NA P
207 M 10 12.7 147 34 −0.65 NO
208 F 10 7.4 151.2 28.2 −3.24 M
209 M 6 9.3 NA NA NA NO
210 M 14 7.5 165.7 59.4 0.63 NO
211 F 14 9.6 148.2 52.5 1.11 M
212 F 32 NA 160.6 60 0.295 NO
213 F 13 7.4 145.7 54.4 1.66 M
214 F 10 6.4 139 35 0.4 M
215 M 14 5.1 165.5 54 0.01 NO
216 M 15 NA 155 46.2 −0.4 M
217 M 15 15.6 NA 58 NA P
218 F 6 NA 109.1 16.8 −0.92 M
219 F 14 15.8 143.7 33 −2.04 NO
220 M 9 7.14 137.2 31.8 0.21 M
221 F 10 8.7 NA NA NA P
222 F NA NA NA NA NA NA
223 F 5 5.8 105.1 18 0.59 M
224 F 10 11.5 145.1 53.3 2.08 NO
225 F 10 10.5 144.7 43.2 1.17 NO
226 F 11 5.3 151.5 38.3 −0.52 M
227 F 8 10.7 134 23.5 −1.96 NO
228 F 1 NA 80 11 1.12 NO
229 F 9 NA NA NA NA M
230 F 14 14.1 159 70 1.9 NO
231 F NA NA NA NA NA NA
232 M 8 5.1 126.2 26.6 0.35 M
233 M 3 5.4 93.5 13.9 0.43 NO
234 M 1 8.5 72 11.8 3.98 M
235 F 13 11 NA NA NA NO
236 F 2 9.9 NA NA NA P
237 M 14 10.9 171 52 −0.81 M
238 F 9 NA NA NA NA M
239 M 9 10.1 140 44.3 1.69 NO
240 F 11 10.7 143.3 36 −0.14 M
241 F 10 8.7 142 42 1.22 BI
242 F 23 5.9 156.2 44.9 −0.76 BI
243 F 20 6 154.8 45 −0.65 NO
244 F 11 6.8 138.5 34.7 0.09 P
245 M 12 9.1 158.7 51.3 0.68 NO
246 F 20 8 NA NA NA P
247 F 11 10.7 144 41.1 0.69 NO
248 F 10 6 149 58.5 2.22 M
249 M NA NA NA NA NA NA
250 F 12 NA NA NA NA BI
251 F 14 NA 148.1 69.2 2.47 M
252 F 11 12.7 143.6 39.95 0.55 M
253 M 12 5.5 NA NA NA M
254 M 23 9.9 NA NA NA P
255 NA 13 8.3 NA NA NA P
256 NA 19 6.8 NA NA NA NA
257 NA 12 8.1 NA NA NA P
258 NA 11 7.3 NA NA NA M
259 M 12 6 155 58 1.5 M
260 F 14 5.4 148.8 41.3 −0.62 NO
261 F 40 NA NA NA NA M
262 F 13 6.4 153 60.2 1.68 NA
263 F 12 8.2 155.5 70.9 2.42 M
264 F 11 11.4 159.8 81.9 2.8 M
265 F 12 9.3 147.2 42 0.25 M
266 F 10 NA 136.9 32.8 0.16 M
267 F 6 6.7 104 17.7 0.5 P
268 M 13 10.1 171.8 85 2 NO
269 F 11 7.4 149.4 58.2 2.1 M
270 F NA NA NA NA NA NA
271 M 12 11.2 169 70.6 1.59 P
272 F 13 8.8 145.6 52.5 1.48 M
273 F 8 5.4 134.1 43.5 2.17 M
274 M 12 14.8 171 86 2.13 NO
275 F 11 11.3 157 54 1.26 BI
276 M 20 6.6 169 79.5 1.64 M
277 F 13 8.7 151.7 47.1 0.32 BI
278 M 11 NA NA NA NA M
279 F 7 9.5 132.6 33.2 1.3 M
280 M 11 13.5 151 42.4 0.36 M
281 F 12 13.2 149.3 47.9 0.91 NA
282 F NA NA NA NA NA NA
283 F NA NA 144.5 28.2 NA M
284 F 4 13 102.1 14.7 −0.93 P
285 F 10 NA 135.2 42.7 1.76 BI
286 M 14 6.2 157.5 53.1 0.56 NO
287 M 11 9.2 140.5 39.8 0.84 P
288 M 11 12 161 86.5 2.4 P
289 F 11 6.6 125.6 23.1 −1.68 M
290 F 12 10 146.8 39 −0.25 M
291 M 11 12 148.7 45 0.89 M
292 M 11 10.9 142.4 40.8 0.83 P
293 M 11 8 NA NA NA P
294 M 8 5.5 131.6 32.8 1.15 M
295 F 11 9 142 32 −0.94 M
296 M 12 12.4 168.2 113.3 2.71 P
297 F 10 9.8 145.8 42.4 0.98 M
298 M 14 6 NA NA NA M
299 M 14 11.9 157.6 49.1 0.03 M
300 M 12 13.1 152 60 1.77 P
301 M 12 12.8 170 65.4 1.22 NO
302 F 4 13.7 105.1 16.7 −0.11 NO
303 M 14 10.8 164 89 2.41 P
304 F 11 9.6 149.2 43.8 0.65 M
305 F NA NA NA NA NA NA
306 M 12 15.1 149 35 −1.31 P
307 F 7 12 127 24.8 −0.15 P
308 F NA NA NA NA NA NA
309 F 14 16.1 167.5 42 −2.73 NO
310 M 13 14.1 163.5 57.2 0.75 NO
311 F 12 7.6 146.9 44.1 0.6 NO
312 M 14 7.7 168.7 57.8 0.22 P
313 M 12 9 164.2 61.6 1.27 P
314 F NA NA NA NA NA NA
315 F NA NA NA NA NA NA
316 M 9 6.3 135.3 36 1.13 NO
317 M NA NA NA NA NA NA
318 F NA NA NA NA NA NA
319 F 10 9.6 147.9 55.8 2.11 M
320 F 15 12 171.6 55.4 −0.76 P
321 F 14 8.7 160 50.2 −0.22 P
322 F 15 5 158.7 50.6 −0.22 P
323 F 15 10.4 151 55.2 1.07 NP
324 F 1 11.1 77 7.3 −3.03 P
325 F 13 NA NA NA NA NA
326 M 13 6.1 143 32 −1.74 P
327 F 13 NA 159.7 59.6 1.16 M
328 M NA NA NA NA NA NA
329 F 10 10 NA NA NA NO
330 F 14 12.3 158 52 0.22 M
331 F 12 7.6 157.1 55.3 1.15 M
332 F 11 6.8 142.9 72.2 3.07 M
333 M 8 7.5 118.6 19.2 −1.67 P
334 M 8 9.8 127 27.8 0.58 P
335 F 29 9.4 170 NA NA BI
336 F 12 9.5 143.6 36.7 −0.38 M
337 F 13 16.6 156.4 43.5 −0.73 M
338 F 17 NA NA NA NA M
339 F NA NA NA NA NA NA
340 NA 15 11.4 NA NA NA M

These patients were characterized by female dominance with the female (F)/male (M) ratio at 1.70, the mean age of diagnosis at 11.8 years, the mean standard deviation score of body mass index (BMI‐SDS) at 0.55 and the mean hemoglobin A1c (HbA1c) at 9.34%. M, maternal; NA, not available; NO, no affected parents; P, pathogenic.

In the P/LP causative variants, alterations in the GCK gene were the most common (82, 52.2%) followed by HNF1A (29, 18.5%), HNF4A (13, 8.3%) and HNF1B (13, 8.3%). The mitochondrial m.3243A > G variant was found in eight (5.1%), all with maternal inheritance, and variants in the rare MODY genes, INS, KCNJ11 and ABCC8, were found in four (2.5%), one (0.6%) and three (1.9%), respectively. As previously reported, abnormalities in the 6q24 imprinted locus were found in three patients (1.9%), and none of these had a history of transient neonatal diabetes, which was confirmed by chart review (details previously reported 23 ). Additionally, a variant in the INSR gene (c.282_283TG > GT, p.TyrGly94_95*Trp), normally associated with type A insulin resistance, was found in a single patient as a mosaic with the wild type.

The 44 variants in the rare VUS‐CS >20 category did not fulfill the ACMG/AMP criteria to reach the P/LP status. However, they are rare and possibly deleterious, with a population frequency of <0.001 and with the CADD score >20. The CADD is a tool for scoring the deleteriousness of single‐nucleotide variants, which integrates multiple annotations into one metric, and a score of 20 represents the top 1% of the likelihood of pathogenicity 31 . In fact, 21 of these rare VUS‐CS >20 were previously reported in association with the disease phenotype and included in the HGMD professional database. Of these, variants in the ABCC8 gene were the most commonly found in 16 (36.4%), followed by HNF1A (10, 22.7%), GCK (8, 18.2%), KCNJ11 (4, 9.1%) and PDX1 (2, 4.5%) genes. Additionally, three variants in the INSR (p.Thr1181Asn, p.Pro269Leu, p.Lys294Arg) and one in the PIK3RI (p.Ser83Leu) genes, both normally associated with insulin resistance, were found in three patients (patients 191, 192, 193), one of them (patient 191) having variants in both genes.

Compared with the group of patients without these variants, patients with P/LP variants or rare VUS‐CS >20 showed significantly lower BMI‐SDS at diagnosis (P < 0.0001 by the Kruskal–Wallis test; Figure 3a), whereas there were no significant differences in the age at onset (P = 0.16, Figure 3b). These results suggest that those without P/LP variants or rare VUS‐CS >20 are more similar to polygenic type 2 diabetes.

Figure 3.

Figure 3

(a). Comparison of the standard deviation scores of body mass indices (BMI‐SDS) at diagnosis of patients with pathogenic/likely pathogenic (P/LP) variants, with VUS variants of a population frequency <0.001 and A Combined Annotation Dependent Depletion score >20 (rare VUS‐CS > 20), and those without these variants (w/o). For each category, data on BMI‐SDS at diagnosis were available for 127, 30 and 100 patients, respectively. The mean and the standard deviations are shown. (b). Comparison of the ages of patients at diagnosis with pathogenic/likely pathogenic (P/LP) variants, VUS variants of a population frequency <0.001 and the CADD score > 20 (rare VUS‐CS > 20), and those without these variants (w/o). For each category, data on age at diagnosis were available for 156, 43 and 127 patients, respectively. The mean and the standard deviations are shown.

In total, there were four KATP channel variants (3 ABCC8, 1 KCNJ11) in the P/LP group, and 21 (17 ABCC8, 4 KCNJ11) in the rare VUS‐CS >20 group. Of these, 11 were listed in the HGMD database. Interestingly, one of the P/LP variants in the ABCC8 gene was a frameshift, loss‐of‐function variant (patient 5), and thus, was expected to cause hyperinsulinism. This patient was not obese, with a BMI‐SDS of 0.25 and developed diabetes at the age of 7 years. His fasting C‐peptide was not diminished at 1.8 nmol/L, and the homeostatic model assessment for insulin resistance (HOMA‐IR) was 7.1, suggesting the presence of insulin resistance. Additionally, of the ABCC8 variants in the rare VUS‐CS >20, four (p.Arg1420His, patient 161; p.Arg1486Lys, patient 162; p.Gly1378Ser, patient 163; p.Asp1030Asn, patient 170) were listed in the HGMD database in association with congenital hyperinsulinism. The unique clinical course of patient 161 was previously reported by Saito‐Hakoda et al. 33 Briefly, the patient was born large‐for‐gestational‐age (4,244 g after 36 weeks’ gestation), and presented with hyperinsulinemic hypoglycemia requiring diazoxide treatment until the age of 6 years. Then, she gradually began to present with postprandial hyperglycemia and was diagnosed with diabetes at the age of 11 years. After the diagnosis of diabetes, she still experienced reactive postprandial hypoglycemia, which was successfully treated by a combination of glinide and alpha‐glucosidase inhibitor. Patient 162 was also an 11‐year‐old girl who presented with fasting hypoglycemia associated with postprandial hyperglycemia. On the oral glucose tolerance test, her fasting plasma glucose was low at 3.9 mmol/L, with inappropriately elevated insulin at 29.2 pmol/L. After 2 h, however, her plasma glucose was elevated at 15.0 mmol/L. Patient 163 was a non‐obese, 10‐year‐old girl. Her oral glucose tolerance test showed a sign of insulin resistance with the HOMA‐IR index at 4.5. Her insulinogenic index was low at 0.08, and her plasma glucose after 2 h was 16.6 mmol/L. Patient 170 was born large‐for‐gestational‐age, with a birthweight of 4,111 g. She reported a history of hospital admission for neonatal apneic episodes. She was not obese, but an oral glucose tolerance test at the age of 9 years showed a sign of insulin resistance with the HOMA‐IR index at 4.5. Her insulinogenic index was low at 0.34 and her plasma glucose after 2 h was 16.2 mmol/L.

Also, interestingly, there was one INSR variant, p.TyrGly94_95*Trp, in the P/LP group (patient 148), which is expected to cause type A insulin resistance. This patient was a 29.5% mosaic with a truncating variant, and presented with symptoms resembling acute type 1 diabetes at the age of 14 years, with highly elevated plasma glucose at 24.8 mmol/L, hemoglobin A1c at 14.9% in association with diminished serum C‐peptide at 0.2 nmol/L. Pancreatic autoantibodies were negative. Her BMI at presentation was 20.6 (64th centile), and she had a paternal history of diabetes. Three variants in the INSR gene (p.Thr1181Asn, p.Pro269Leu, p.Lys294Arg) were also identified in the rare VUS‐CS >20 group (patients 191, 192, 193). In addition to the INSR variant, patient 191 had an additional variant, p.Ser83Leu, in the PIK3R1 gene, which is responsible for SHORT syndrome characterized by low birthweight and insulin resistance after puberty. This patient was born small‐for‐gestational‐age, with a birthweight of 2,416 g after 39 weeks of pregnancy. She presented with incidentally identified hyperglycemia at the age of 12 years. She had a maternal history of diabetes, and was lean with a BMI‐SDS of −0.42. Retrospectively, her C‐peptide and insulin at presentation were elevated at 3.0 nmol/L and 2413.4 pmol/L in the presence of plasma glucose at 16.1 mmol/L. Patient 192 was diagnosed with diabetes at the age of 33 years. He had a three‐generation paternal inheritance of diabetes. Clinical data at diagnosis was unavailable, but after 30 years of diabetes, his insulin secretion was diminished (increment of C‐peptide after arginine loading at 0.5 nmol/L). The patient was not obese and was negative for pancreatic autoantibodies. Patient 193 developed diabetes at the age of 8 years. His BMI‐SDS at diagnosis was 0.34, and his fasting insulin was not diminished at 241.7 pmol/L when plasma glucose was 5.9 mmol/L.

Finally, there were two patients, patients 198 and 199, with rare VUS‐CS >20 in the PDX1 gene. Detailed clinical data are missing for patient 198, except that the patient had a three‐generation family history of early‐onset diabetes, was not obese, and could be treated with metformin and sulfonylurea for at least 10 years. Patient 199 had a typical history of MODY. She was not obese and had a three‐generation family history of non‐obese diabetes, and with homeostatic model assessment for β‐cell function at 32.0.

DISCUSSION

To the best of our knowledge, this is the most comprehensive analysis of monogenic diabetes in East Asians. Responsible P/LP variants were identified in 46.2% of the patients, and the identification rate could be higher, as at least some of the rare VUS‐CS >20 are apparently pathogenic. These figures are higher than those previously reported for East Asians 19 , 20 , 21 . Possible explanations include: (i) a higher fraction of pediatric patients in the present study; (ii) most referral sources being diabetologists; and (iii) the study design with a broader range of target genes. As the incidence of type 2 diabetes increases with age, in the pediatric age group, the chances of identifying monogenic diabetes would be higher, especially by diabetologists. Also, with a broader range of target genes, the variant identification rate would be higher compared with studies focusing only on common MODY genes.

Limiting to the P/LP variants, GCK‐MODY was the most common, followed by HNF1A‐, HNF4A‐ and HNF1B‐MODY (Figure 2). This is in line with the recent large‐scale studies 21 , 34 , 35 , 36 , and is not surprising considering the high population prevalence (estimated at 1.1 in 1000) of deleterious GCK variants in the general population 32 . When mildly hyperglycemic patients are included as in pediatric studies, GCK variants are likely to be the most common, whereas HNF1A variants tend to be more common in studies leaning toward symptomatic patients 37 . As few pathogenic variants with a strong founder effect have been identified in MODY genes, the true incidence of P/LP variants in MODY genes should be similar across different ethnicities if very large, population‐based studies linking the genotypes and the serial measurements of blood glucose are obtained.

In addition to the P/LP variants, we tried to identify VUS variants that might be pathogenic as rare VUS‐CS >20 by using the population frequency and the CADD score of the variants. For missense variants of rare MODY genes, it is often difficult to reach the P/LP status of the ACMG/AMP guidelines 27 , unless extensive segregation studies or in vitro functional studies are additionally carried out. In this group of variants, nearly half of them were KATP channel genes, ABCC8 or KCNJ11. Combined with the P/LP patients, variants in the KATP channel genes were identified in 25 patients, and 11 of them were listed in the HGMD database and seven were variants of the amino acids for which different alterations have already been reported (patients 159, 164, 172, 179, 186, 190, 195).

Interestingly, of the previously reported KATP channel variants, four are listed in association with hyperinsulinemic hypoglycemia in the HGMD database. Described clinical phenotypes of patients with these variants (p.Arg1486Lys 38 , p.Gly1378Ser 39 , p.Asp1030Asn 40 , p.Arg1420His 33 ) are compatible with the diagnosis of congenital hyperinsulinism, and for p.Gly1378Ser and p.Arg1420His, in vitro evidence of the loss of function has been reported 41 , 42 . These findings could simply be the incidental identification of asymptomatic carriers of loss‐of‐function, hyperinsulinemic variants not related to diabetes. However, at least two of our patients (patients 161, 162) presented with a history of hyperinsulinemic hypoglycemia evolving into diabetes. Neonatal macrosomia with apneic spells found in patient 170 is also typical of congenital hyperinsulinism, although hypoglycemia was not documented for this patient.

Cases of KATP channel congenital hyperinsulinism evolving into diabetes have been reported repeatedly 43 , 44 , 45 , 46 . This is likely to be a different category of KATP channel MODY distinct from the patients with activating variants. As the treatment strategy for this group of patients could be different from that for the patients with activating mutations, recognition of this group of patients might be important for the management of diabetes. For example, Ovsyannikova et al. 47 reported a patient with a p.Ala1457Thr variant in the ABCC8 gene with diabetes. This variant is known to be causative of hyperinsulinemic hypoglycemia 48 , 49 . Unlike neonatal diabetes caused by ABCC8 variants, switching from insulin to sulfonylurea did not work well, with the extensive glucose excursion requiring an add‐on treatment by an sodium–glucose cotransporter 2 inhibitor.

Another interesting finding in the present study was the identification of variants of the INSR gene, typically causing type A insulin resistance, in patients with suspected MODY; one in the P/LP group (patient 148) and three in the patients with rare VUS‐CS >20 group (patients 191–193). Patient 148 was a 29.5% mosaic and presented with acute diabetes with diminished insulin secretion. The role of her insulin variant in the development of diabetes thus remains unknown. On the contrary, two patients with rare VUS‐CS >20 INSR variants showed evidence of insulin resistance. Patient 191 presented with diabetes associated with elevated endogenous insulin and had an additional variant of the PIK3R1 gene. As variants in the INSR and PIK3R1 genes both cause insulin‐resistant diabetes, it is unclear which of these variants is more responsible for her diabetes, although the low birthweight for gestational age is more consistent with the presentation of PIK3R1 abnormality. Patient 193 also presented with mildly elevated fasting serum insulin (241.7 pmol/L) at diagnosis. The fact that he was not obese and had dominantly inherited diabetes made him a candidate for MODY. In our national survey in Japan, fasting serum insulin of genetically confirmed type A resistance could be as low as 243.1 pmol/L 50 . Insulin resistance syndrome, thus, needs to be included in the gene panel.

Finally, we identified two patients (patients 198; 199) with variants in the PDX1 gene. As the pathogenicity of missense variants in this gene is difficult to interpret because of a large number of benign rare variants 51 , the pathogenicity of these variants was not clear at the moment.

We believe the high diagnostic yield and its possible clinical implications support the cost‐effectiveness of including multigene analysis of monogenic diabetes in the national health insurance system. The strength of the present study was in the comprehensiveness of target genes and a large number of patients with suspected MODY. There were, however, several weaknesses in the present study. First, because of a lack of confirmatory studies, many variants remained in the category of VUS. To identify true pathogenic variants more efficiently, we generated a category of rare VUS‐CS >20 in this study, but still, only a fraction of these appears responsible for the patients' diabetes. Second, the number of genes covered in this study might not be large enough. For example, many genes for syndromic diabetes were not included in this panel in the hope that those patients might be clinically diagnosed otherwise. Third, even for the genes included in this study, the detection of variants might not be complete. The MLPA analysis was carried out only for common MODY genes, and deletions/duplications in other genes were not examined. Detection of mitochondrial m.3243A > G might also be incomplete, given the heteroplasmic nature of mitochondrial variants. Larger‐scale panel sequencing, whole‐exome sequencing or even whole‐genome sequencing combined with the more sensitive detection of copy number variation might be required to address these sensitivity problems, although the chances of capturing benign variants would be increased by scaling up the number of target genes.

CONCLUSIONS

By using the comprehensive targeted gene panel analysis, causative variants could be identified in 157 (46.2%) of 340 real‐world Japanese patients with suspected MODY. The identification rate could be higher, as at least some of the 44 rare VUS‐CS >20 appear to be truly causative. In addition to common MODY genes, variants in the KATP‐channel genes were frequently identified, and a proportion of them was with inactivating variants, probably representing a different category of KATP‐channel MODY. An expanded multigene panel including genes of insulin resistance should be used for this population.

DISCLOSURE

The authors declare no conflict of interest.

Approval of the research protocol: The study protocol was approved by the institutional review board of Osaka City General Hospital (No. 742).

Informed consent: Written informed consent was obtained either from the patient or their legal guardians.

Registry and the registration no. of the study/trial: N/A.

Animal studies: N/A.

ACKNOWLEDGMENTS

This work was supported by a grant‐in‐aid for scientific research from the Ministry of Education, Culture, Sports, Science and Technology of Japan (18 K07895).

REFERENCES

  • 1. Pang L, Colclough KC, Shepherd MH, et al. Improvements in awareness and testing have led to a threefold increase over 10 years in the identification of monogenic diabetes in the U.K. Diabetes Care 2022; 45: 642–649. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Hattersley AT, Greeley SAW, Polak M, et al. ISPAD clinical practice consensus guidelines 2018: the diagnosis and management of monogenic diabetes in children and adolescents. Pediatr Diabetes 2018; 10(Suppl 27): 47–63. [DOI] [PubMed] [Google Scholar]
  • 3. Zhang H, Colclough K, Gloyn AL, et al. Monogenic diabetes: a gateway to precision medicine in diabetes. J Clin Invest 2021; 131: e142244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Broome DT, Pantalone KM, Kashyap SR, et al. Approach to the patient with MODY‐monogenic diabetes. J Clin Endocrinol Metab 2021; 106: 237–250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Pearson ER, Starkey BJ, Powell RJ, et al. Genetic cause of hyperglycaemia and response to treatment in diabetes. Lancet 2003; 362: 1275–1281. [DOI] [PubMed] [Google Scholar]
  • 6. Pearson ER, Pruhova S, Tack CJ, et al. Molecular genetics and phenotypic characteristics of MODY caused by hepatocyte nuclear factor 4alpha mutations in a large European collection. Diabetologia 2005; 48: 878–885. [DOI] [PubMed] [Google Scholar]
  • 7. Pearson ER, Flechtner I, Njølstad PR, et al. Switching from insulin to oral sulfonylureas in patients with diabetes due to Kir6.2 mutations. N Engl J Med 2006; 355: 467–477. [DOI] [PubMed] [Google Scholar]
  • 8. Steele AM, Shields BM, Wensley KJ, et al. Prevalence of vascular complications among patients with glucokinase mutations and prolonged, mild hyperglycemia. JAMA 2014; 311: 279–286. [DOI] [PubMed] [Google Scholar]
  • 9. Bonnefond A, Semple RK. Achievements, prospects and challenges in precision care for monogenic insulin‐deficient and insulin‐resistant diabetes. Diabetologia 2022; 65: 1782–1795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Shields BM, Hicks S, Shepherd MH, et al. Maturity‐onset diabetes of the young (MODY): how many cases are we missing? Diabetologia 2010; 53: 2504–2508. [DOI] [PubMed] [Google Scholar]
  • 11. Kropff J, Selwood MP, McCarthy MI, et al. Prevalence of monogenic diabetes in young adults: a community‐based, cross‐sectional study in Oxfordshire. UK Diabetologia 2011; 54: 1261–1263. [DOI] [PubMed] [Google Scholar]
  • 12. Pihoker C, Gilliam LK, Ellard S, et al. Prevalence, characteristics and clinical diagnosis of maturity onset diabetes of the young due to mutations in HNF1A, HNF4A, and glucokinase: results from the SEARCH for diabetes in youth. J Clin Endocrinol Metab 2013; 98: 4055–4062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Kleinberger JW, Pollin TI. Undiagnosed MODY: time for action. Curr Diab Rep 2015; 15: 110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Bansal V, Gassenhuber J, Phillips T, et al. Spectrum of mutations in monogenic diabetes genes identified from high‐throughput DNA sequencing of 6888 individuals. BMC Med 2017; 15: 213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Stanik J, Dusatkova P, Cinek O, et al. De novo mutations of GCK, HNF1A and HNF4A may be more frequent in MODY than previously assumed. Diabetologia 2014; 57: 480–484. [DOI] [PubMed] [Google Scholar]
  • 16. Kleinberger JW, Copeland KC, Gandica RG, et al. Monogenic diabetes in overweight and obese youth diagnosed with type 2 diabetes: the TODAY clinical trial. Genet Med 2018; 20: 583–590. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Ma RC, Chan JC. Type 2 diabetes in east Asians: similarities and differences with populations in Europe and the United States. Ann N Y Acad Sci 2013; 1281: 64–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Okura T, Nakamura R, Fujioka Y, et al. Body mass index ≥23 is a risk factor for insulin resistance and diabetes in Japanese people: a brief report. PLoS One 2018; 13: e0201052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Yang YS, Kwak SH, Park KS. Update on monogenic diabetes in Korea. Diabetes Metab J 2020; 44: 627–639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Liang H, Zhang Y, Li M, et al. Recognition of maturity‐onset diabetes of the young in China. J Diabetes Investig 2021; 12: 501–509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Park SS, Jang SS, Ahn CH, et al. Identifying pathogenic variants of monogenic diabetes using targeted panel sequencing in an east Asian population. J Clin Endocrinol Metab 2019; 104: 4188–4198. [DOI] [PubMed] [Google Scholar]
  • 22. Yorifuji T, Fujimaru R, Hosokawa Y, et al. Comprehensive molecular analysis of Japanese patients with pediatric‐onset MODY‐type diabetes mellitus. Pediatr Diabetes 2012; 13: 26–32. [DOI] [PubMed] [Google Scholar]
  • 23. Yorifuji T, Matsubara K, Sakakibara A, et al. Abnormalities in chromosome 6q24 as a cause of early‐onset, non‐obese, non‐autoimmune diabetes mellitus without history of neonatal diabetes. Diabet Med 2015; 32: 963–967. [DOI] [PubMed] [Google Scholar]
  • 24. Kawakita R, Hosokawa Y, Fujimaru R, et al. Molecular and clinical characterization of glucokinase maturity‐onset diabetes of the young (GCK‐MODY) in Japanese patients. Diabet Med 2014; 31: 1357–1362. [DOI] [PubMed] [Google Scholar]
  • 25. Yorifuji T, Kawai M, Momoi T, et al. Nephropathy and growth hormone deficiency in a patient with mitochondrial tRNA(Leu(UUR)) mutation. J Med Genet 1996; 33: 621–622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Robinson JT, Thorvaldsdóttir H, Winckler W, et al. Integrative genomics viewer. Nat Biotechnol 2011; 29: 24–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Richards S, Aziz N, Bale S, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med 2015; 17: 405–424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Li Q, Wang K. InterVar: Clinical interpretation of genetic variants by the 2015 ACMG‐AMP guidelines. Am J Hum Genet 2017; 100: 267–280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Patel KA, Kettunen J, Laakso M, et al. Heterozygous RFX6 protein truncating variants are associated with MODY with reduced penetrance. Nat Commun 2017; 8: 888. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Bonnycastle LL, Chines PS, Hara T, et al. Autosomal dominant diabetes arising from a Wolfram syndrome 1 mutation. Diabetes 2013; 62: 3943–3950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Kircher M, Witten DM, Jain P, et al. A general framework for estimating the relative pathogenicity of human genetic variants. Nat Genet 2014; 46: 310–315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Chakera AJ, Spyer G, Vincent N, et al. The 0.1% of the population with glucokinase monogenic diabetes can be recognized by clinical characteristics in pregnancy: the Atlantic diabetes in pregnancy cohort. Diabetes Care 2014; 37: 1230–1236. [DOI] [PubMed] [Google Scholar]
  • 33. Saito‐Hakoda A, Yorifuji T, Kanno J, et al. Nateglinide is effective for diabetes mellitus with reactive hypoglycemia in a child with a compound heterozygous ABCC8 mutation. Clin Ped Endocrinol 2012; 21: 45–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Breidbart E, Deng L, Lanzano P, et al. Frequency and characterization of mutations in genes in a large cohort of patients referred to MODY registry. J Pediatr Endocrinol Metab 2021; 34: 633–638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Zmysłowska A, Jakiel P, Gadzalska K, et al. Next‐ generation sequencing is an effective method for diagnosing patients with different forms of monogenic diabetes. Diabetes Res Clin Pract 2022; 183: 109154. [DOI] [PubMed] [Google Scholar]
  • 36. Rafique I, Mir A, Saqib MAN, et al. Causal variants in maturity onset diabetes of the young (MODY) ‐ a systematic review. BMC Endocr Disord 2021; 21: 223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Horikawa Y. Maturity‐onset diabetes of the young as a model for elucidating the multifactorial origin of type 2 diabetes mellitus. J Diabetes Investig 2018; 9: 704–712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Ohkubo K, Nagashima M, Naito Y, et al. Genotypes of the pancreatic beta‐cell K‐ATP channel and clinical phenotypes of Japanese patients with persistent hyperinsulinaemic hypoglycaemia of infancy. Clin Endocrinol (Oxf) 2005; 62: 458–465. [DOI] [PubMed] [Google Scholar]
  • 39. Dung VC, Liem NT, Thao BP, et al. Molecular genetics and phenotype of 26 Vietnamese patients with congenital hyperinsulinism. Int J Pediatr Endocrinol 2013; 2013(Suppl 1): P179. [Google Scholar]
  • 40. Arya VB, Guemes M, Nessa A, et al. Clinical and histological heterogeneity of congenital hyperinsulinism due to paternally inherited heterozygous ABCC8/KCNJ11 mutations. Eur J Endocrinol 2014; 171: 685–695. [DOI] [PubMed] [Google Scholar]
  • 41. Saint‐Martin C, Zhou Q, Martin GM, et al. Monoallelic ABCC8 mutations are a common cause of diazoxide‐unresponsive diffuse form of congenital hyperinsulinism. Clin Genet 2015; 87: 448–454. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Baier LJ, Muller YL, Remedi MS, et al. ABCC8 R1420H loss‐of‐function variant in a southwest American Indian community: association with increased birth weight and doubled risk of type 2 diabetes. Diabetes 2015; 64: 4322–4332. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Huopio H, Reimann F, Ashfield R, et al. Dominantly inherited hyperinsulinism caused by a mutation in the sulfonylurea receptor type 1. J Clin Invest 2000; 106: 897–906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Işık E, Demirbilek H, Houghton JA, et al. Congenital Hyperinsulinism and evolution to sulfonylurea responsive diabetes later in life due to a novel homozygous p.L171F ABCC8 mutation. J Clin Res Pediatr Endocrinol 2019; 11: 82–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Matsutani N, Furuta H, Matsuno S, et al. Identification of a compound heterozygous inactivating ABCC8 gene mutation responsible for young‐onset diabetes with exome sequencing. J Diabetes Investig 2020; 11: 333–336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Karatojima M, Furuta H, Matsutani N, et al. A family in which people with a heterozygous ABCC8 gene mutation (p.Lys1385Gln) have progressed from hyperinsulinemic hypoglycemia to hyperglycemia. J Diabetes 2020; 12: 21–24. [DOI] [PubMed] [Google Scholar]
  • 47. Ovsyannikova AK, Rymar OD, Shakhtshneider EV, et al. Diabetes mellitus associated with the mutation of the ABCC8 gene (MODY 12): features of clinical course and therapy. Diabetes Mellitus 2019; 22: 88–94. [Google Scholar]
  • 48. Huopio H, Jääskeläinen J, Komulainen J, et al. Acute insulin response tests for the differential diagnosis of congenital hyperinsulinism. J Clin Endocrinol Metab 2002; 87: 4502–4507. [DOI] [PubMed] [Google Scholar]
  • 49. Macmullen CM, Zhou Q, Snider KE, et al. Diazoxide‐unresponsive congenital hyperinsulinism in children with dominant mutations of the β‐cell sulfonylurea receptor SUR1. Diabetes 2011; 60: 1797–1804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Takeuchi T, Ishigaki Y, Hirota Y, et al. Clinical characteristics of insulin resistance syndromes: a nationwide survey in Japan. J Diabetes Investig 2020; 11: 603–616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Edghill EL, Khamis A, Weedon MN, et al. Sequencing PDX1 (insulin promoter factor 1) in 1788 UK individuals found 5% had a low‐frequency coding variant, but these variants are not associated with type 2 diabetes. Diabet Med 2011; 28: 681–684. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Diabetes Investigation are provided here courtesy of Wiley

RESOURCES