Skip to main content
Research in Pharmaceutical Sciences logoLink to Research in Pharmaceutical Sciences
. 2022 Dec 24;18(1):78–88. doi: 10.4103/1735-5362.363598

Expression analysis elucidates the roles of Nicastrin, Notch4, and Hes1 in prognosis and endocrine-therapy resistance in ER-positive breast cancer patients

Arad Boustan 1, Rosa Jahangiri 1, Asefeh Dahmardeh Ghalehno 2, Mahdieh Khorsandi 2, Fatemeh Mosaffa 3,*, Khadijeh Jamialahmadi 3,*
PMCID: PMC9951784  PMID: 36846736

Abstract

Background and purpose:

Although some proposed mechanisms responsible for tamoxifen resistance have already been present, further study is needed to determine the mechanisms underlying tamoxifen resistance more clearly. The critical role of Notch signaling has been described in promoting resistance in therapeutics, but there is little information about its role in tamoxifen resistance progression.

Experimental approach:

In the present study, the expression of Notch pathway genes, including Notch4, nicastrin and the Notch downstream target Hes1 was evaluated using quantitative RT-PCR in 36 tamoxifen-resistant (TAM-R) and 36 tamoxifen-sensitive (TAM-S) patients. Expression data were correlated with the clinical outcome and survival of patients.

Findings/Results:

mRNA levels of Notch4 (fold change = 2.7), nicastrin (fold change = 6.71), and Hes1 (fold change= 7.07) were significantly higher in TAM-R breast carcinoma patients compared to sensitive cases. We confirmed all these genes were co-expressed. Hence, it seems that Notch signaling is involved in tamoxifen resistance in our TAM-R patients. Obtained results showed that Hes1, nicastrin, and Notch4 mRNA upregulation was correlated with the N stage. The extracapsular nodal extension was associated with nicastrin and Notch4 overexpression. Moreover, nicastrin overexpression was correlated with perineural invasion. Hes1 upregulation was also associated with nipple involvement. Finally, the Cox regression proportional hazard test revealed that overexpression of nicastrin was an independent worse survival factor.

Conclusion and implications:

Presumably, upregulation of the Notch pathway may be involved in tamoxifen resistance in breast cancer patients.

Keywords: Breast cancer, Hes1, Nicastrin, Notch4, Tamoxifen resistance

INTRODUCTION

Breast cancer is the most prevalent heterogeneous and malignant cancer in women(1). Approximately 70% of breast carcinoma are estrogen receptor-positive (ER+), hence, numerous drugs are designed for the treatment of ER+ patients. Tamoxifen (TAM) is the most routine treatment component against ER+ breast tumors(2). TAM is considered a selective ER modulator that competes with estrogen to bind to estrogen receptors and repress carcinogenic and estrogenic effects.

Despite decreasing the relapse rate, about one-third of breast cancer patients experience resistance to this therapy. Multiple molecular mechanisms have been described as responsible for TAM resistance. However, due to the complexity of cellular behaviors in the tumor environment, many aspects of resistance are still unclear(3).

It seems that epithelial-to-mesenchymal transition (EMT) and cancer stem cells (CSCs) have a key role in developing resistance in TAM-treated patients(4,5). EMT reflects the trans-differentiation of epithelial cells to acquire migratory, invasive, metastatic, and fibroblast-like properties. TAM-resistant (TAM-R) cells express mesenchymal-like phenotypes. In these cells, the expression of epithelial markers such as E-cadherin is reduced, and mesenchymal characteristics such as the expression of vimentin and N-cadherin are increased(4,6). CSCs are a subgroup of cancer cells that possess self-renewal and multilineage differentiation features that initiate malignancy, promoting drug resistance, and tumor recurrence. Most chemotherapeutic and radiotherapy approaches could successfully eradicate cancer cells; however, CSCs survive and promote resistance to therapy(5).

Notch signaling is one of the highly conserved signaling pathways in metazoans and makes communication between two neighboring cells feasible. In mammals, Notch consists of four paralogs (Notch1-4) cleaved by either γ-secretase (GS) complex or ADAM metalloproteases to release the Notch intracellular domain (NICD). NICD enters the nucleus and regulates the transcription of sternness genes(7). Several studies have reported the Notch signaling pathway upregulation in cancer therapy(7,8). In particular, the Notch pathway contributes to TAM resistance in ER+ breast carcinoma cells. Notch induces CSCs and promotes the EMT process. Inhibition of Notch sensitized TAM-R cells. Furthermore, Notch receptors stimulate the proliferation of ER+ and ER- via canonical and non-canonical mechanisms(9,10). Single-pass transmembrane protein Notch4 is a fourth member of Notch receptors(11). Notch4 protects the haphazard apoptotic process, increases cellular survival in response to a wide range of anticancer agents, and promotes poor prognosis in breast cancer patients(12,13). Investigation on long-term TAM-treated breast cancer cells showed that these cells underwent resistance through JAG1-Notch4 receptor activity. Conversely, Notch4 inhibition decreased breast CSCs population and cell malignancy(14). In TAM-R MCF-7 cells, and MDA-MB-231 breast cancer cells, inhibition of Notch4 by siRNA increased TAM sensitivity and reduced EMT signaling(15,16).

Type I transmembrane glycoprotein nicastrin is the largest subunit of the GS. Nicastrin protects the GS complex from large proteins from reaching the catalytic center. Moreover, nicastrin increases the steadiness, assembly, and catalytic activity of the GS complex and, with the help of other members, cleaves a variety of sending-signal proteins, including Notch receptors(17). It has been demonstrated that nicastrin 's overexpression led to an enrichment of the CSCs population and enhanced EMT via activation of PI3K/Akt and Notch signaling pathways. Upregulation of nicastrin is important for the development of various cancers, including hepatocellular carcinoma and breast cancer(12,18). In MCF-7 breast cancer cells, nicastrin expression conferred worse overall survival. It also has been shown that Notch signaling is significantly inhibited by nicastrin knockdown in basal-like breast neoplasms(12).

The transcriptional repressor hairy enhancer of split Hes1 is an evolutionarily conserved transcription factor that is the Notch signaling’s final target gene. Hes1 has an autoregulatory expression mechanism that represses its gene. Noteworthy, NICD binds to Hes1 and activates downstream pathways(19).

Although there are many reports about the Notch signaling association in breast cancer, no direct description has investigated the role of nicastrin, Notch4, and Hes1 in ER+ breast cancer patients. Also, little is known about the association of the expression level of these genes with clinicopathological features of breast carcinoma patients. Therefore, in the present study, we studied the role of Notch signaling in promoting TAM resistance by measuring mRNA expression of Notch4, nicastrin and Hes1 in TAM-sensitive and resistant patients. We also evaluated their potential role in patient survival.

MATERIALS AND METHODS

Patients

Our previous publication mentioned a comprehensive approach for tissue selection and patients’ features(6). In brief, Iran National Tumor Bank granted 72 frozen breast cancer tissues from patients who had undergone breast surgery with lymph node dissection and had complete clinicopathological records at Iran’s tumor bank. ER+ breast carcinoma patients undergoing surgery received adjuvant radiotherapy and chemotherapy and eventually acquired TAM for six months to five years or more were entered in this study. Patients still responsive to TAM for at least five years were regarded as TAM sensitive (TAM-S). Patients experiencing tumor recurrence while receiving TAM treatment for at least six months (median time recurrence = 25 months) were considered TAM-R(6). All study patients were followed up for 85 months. Informed written consent was obtained from each participant. The clinicopathological features of the recruited breast cancer patients are summarized in Table 1.

Table 1.

Clinical characteristics of breast cancer patients

Features Categories Number of tissues Tamoxifen sensitive Tamoxifen resistant P-value
Age (average)   72 43.38 ± 4.38 49.21 ± 10.24 0.118
T Stage T1, T2 53 24 (66.66%) 29 (80.5%) 0.494
T3, T4 19 12 (33.33%) 7 (19.5%)
N Stage N0, N1 44 24 (66.66%) 20 (55.5%) 0.021
N2, N3 28 12 (33.33%) 16 (44.5%)
PR status Positive 47 24 (66.67%) 23 (63.9%) > 0.99
Negative 25 12 (33.3%) 13 (36.1%)
HER-2 status Positive 19 11 (30.6%) 8 (22.2%) 0.594
Negative 53 25 (69.4%) 28 (77.8%)
P53 status Positive 23 14 (38.9%) 9 (25.0%) 0.312
Negative 49 22 (61.1%) 27 (75.0%)
Ductal carcinoma in situ Comedo type 9 4 (11.1%) 5 (13.9%) 0.5
Non-Comedo type 63 32 (88.9%) 31 (86.1%)
Nipple involvement Present 13 6 (16.7%) 6 (16.7%) > 0.99
Absent 59 30 (83.3%) 30 (83.3%)
Lymphatic invasion Present 55 25 (69.4%) 30 (83.3%) 0.267
Absent 17 11 (30.6%) 6 (16.7%)
Perineural Invasion Present 30 10 (27.8%) 20 (55.6%) 0.031
Absent 42 26 (72.2%) 16 (44.4%)
Extracapsular nodal extension Present 15 4 (11.1%) 11 (30.6%) 0.079
Absent 57 32 (88.9%) 25 (69.4%)

PR, Progesterone receptor; HER2, human epidermal growth factor receptor 2.

This study was conducted according to the ethical standards of the local ethical committee at Mashhad University of Medical Sciences (MUMS) and obtained the ethical code IR.MUMS.MEDICAL.REC.1398.600.

RNA purification

Total RNA extraction from tumor tissues was performed utilizing RiboEx Total RNA kit (GeneAll, Korea South). Extracted RNAs were eluted in diethylpyrocarbonate-treated water. Concentration and purity (260/280 and 260/230 ratio) were measured in duplicate by the NanoDrop™ 2000c (Thermo Scientific, USA) spectrophotometer. In order to confirm RNA integrity, aliquots of the RNA samples were electrophoresed in agarose gel. Bands of 28s, 18s, and 5s rRNAs were observed, which indicates RNA integrity.

cDNA synthesis

Reverse transcription of total RNA into cDNA was performed using Yekta Tajhiz Azma cDNA synthesis kit (Iran). Following incubation of 2 μg of total RNA and random hexamer primers for 5 min at 70 °C and then replacement on ice, a reaction mixture consisting of 10 mM dNTPs, 40 unit/μL RNase inhibitor, 200 unit/μL reverse transcriptase, and first-strand buffer × 5 was added according to the manufacturer’s instructions (the mixture was incubated for 5 min at 70 °C, followed by 60 min at 37 °C, then 5 min at 70 °C).

Quantitative real-time polymerase chain reaction

By employing specific primers (Table 2), the quantitative real-time polymerase chain reaction (qRT-PCR) was performed on synthesized cDNAs using the SYBR Green protocol. Based on the manufacturer’s instructions (YTA SYBR Green qPCR master mix 2X, Iran), the PCR experiment was conducted under the following condition: 95 °C for 5 min to polymerase activation and initialize denaturation, then 95 °C for 5 s and 60 °C for 30 s for 40 cycles. The melting curves of PCR products were monitored at the end of each reaction to evaluate the specificity of PCR reactions. The outcomes were drawn as the target/reference ratio of the TAM-R specimens divided by the target/reference ratio of the calibrators (TAM-S specimens). β-actin was used as an internal control.

Table 2.

List of primers used in a quantitative real-time polymerase chain reaction.

Genes Forward (5' to 3') Reverse (5' to 3') Reference
β-actin TCATGAAGTGTGACGTGGACATC CAGGAGGAGCAATGATCTTGATCT (6)
Nicastrin GGAGTAAACACCAAACCCA GGAGAACCAGCCGAATTG (19)
Notch4 AACTCCTCCCCAGGAATCTG CCTCCATCCAGCAGAGGTT (20)
Hes1 CCCAACGCAGTGTCACCTTC TACAAAGGCGCAATCCAATATG (21)

Statistical analysis

Data extracted from this research were analyzed by SPSS software version 26 and GraphPad Prism9. Shapiro-Wilk test was used for the normality test. T-test was used to analyze the differences between TAM-R and TAM-S breast carcinoma cases. Spearman’s correlation coefficient was used to analyze the association between genes. Logistic regression was applied to evaluate the correlation between gene expression and clinicopathological features. Kaplan-Meier and Cox regression statistical methods were conducted to determine the association between mRNA expressions of studied genes and the hazard of tumor recurrence or death. Considering the mean levels of expression, patients were divided into two groups: high expression versus low expression. Hence, Cox regression analysis was used for evaluating the effect of the expression of desired genes when added to the base model of other elements. Disease-free survival (DFS) was considered the time interval between the date of primary treatment and the date of first proven tumor recurrence. In this approach, both regional and distant metastasis were regarded as an event. In order to estimate the patient’s prognosis, overall survival (OS) was reported. OS is the period between surgery and death. In OS analysis, death was considered an event. P < 0.05 was considered statistically significant.

RESULTS

Comparison of mRNA expression of nicastrin, Notch4, and Hes1 genes between TAM-S and TAM-R breast cancer patients

Levels of Notch4, nicastrin, and Hes1 mRNA expression were assessed by qRT-PCR conducted on cDNA samples of TAM-S and TAM-R patients. qRT-PCR analysis confirmed that there was a statistically significant upregulation of Notch4, nicastrin, and Hes1 in TAM-R compared to TAM-S tumor samples (Fig. 1). Mean fold changes of Notch4, nicastrin, and Hes1 in TAM-R compared to TAM-S were 2.71, 6.71, and 7.07, respectively.

Fig. 1.

Fig. 1

Expression of nicastrin, Notch4, and Hes1 genes was assessed by quantitative real-time polymerase chain reaction analysis and normalized by β-actin. Data were scrutinized by a t-test Data are delineated as mean ± SD. ***P < 0.001 indicates the significant differences between the two groups regarding each gene.

Association between nicastrin, Notch4, and Hes1 genes expression

Spearman’s correlation coefficient showed a significant association between nicastrin/Notch4 and nicastrin/Hes1 expression (Table 3). We used Sox2, Nanog and Oct4 expression results from our previous study to analyze the correlation between nicastrin, Notch4, and Hes1 expression with mentioned genes. These results demonstrated a notable correlation between stemness factors Sox2 and Oct4 expression with the mRNA level of nicastrin, Notch4, and Hes1. We could not find any conclusive result related to the correlation of Nanog with genes assessed in this study. (Data not shown)(6).

Table 3.

Correlation among mRNA expression of nicastrin, Notch4, and Hes1 genes.

Genes r 95% CI P-value
Nicastrin vs Notch4 0.3704 0.1449 to 0.5593 0.0014
Nicastrin vs Hes1 0.2451 0.007263 to 0.4567 0.0190
Notch4 vs Hes1 0.2695 0.03338 to 0.4771 0.0110

Correlation analysis of nicastrin, Notch4, and Hes1 expression with clinicopathological features of patients

To discover any association between gene expression results and clinicopathological features, various clinicopathological variables were evaluated. Our findings showed that higher expression of nicastrin (Table 4), Notch4 (Table 5), and Hes1 (Table 6) were associated with the N stage. Likewise, nicastrin and Notch4 showed significant association with extracapsular nodal extension (ECE). Moreover, perineural invasion (PNI) was only correlated with nicastrin expression. It was also found that involvement of the nipple was solely associated with Hes1 upregulation.

Table 4.

Association of the mRNA expression level of nicastrin with clinicopathological characteristics of patients.

Variables Expression of nicastrin
  OR 95% CI P-value
Low (%) High (%)
Grade     1.307 0.501-3.406 0.584
    Grade 1 15 (40%) 12 (34%)      
    Grades 2 & 3 22 (60%) 23 (66%)      
N stage     18.00 5.109-63.419 0.0001
    N0 & N1 33 (89%) 11 (31%)      
    N1 & N2 4 (11%) 24 (69%)      
T stage     1.661 0.576-4.792 0.576
    T1 & T2 8(21%) 11(31%)      
    T3 & T4 29(79%) 24(69%)      
Extracapsular nodal extension     0.169 0.43-0.666 0.011
    Yes 34 (92%) 23 (65%)      
    No 3 (8%) 12 (35%)      
DCIS histology     0.422 0.564-3.922 0.422
    Comedo type 15 (40%) 11 (31%)      
    Non comedo 22 (60%) 24 (69%)      
Nipple involvement     1.058 0.858-1.304 0.599
    No 30 (81%) 30 (85%)      
    Yes 7 (11%) 5 (15%)      
Lymphatic invasion     0.754 0.221-2.984 0.754
    No 10 (27%) 7 (20%)      
    Yes 27 (73%) 28 (80%)      
Perineural invasion     7.778 1.623-37.283 0.010
    No 23 (62%) 19 (54%)      
    Yes 14 (38%) 16 (46%)      
PR status     2.007 0.578-6.976 0.273
    Positive 24 (65%) 21 (60%)      
    Negative 13 (35%) 14 (40%)      
HER-2 status     1.220 0.365-4.079 0.747
    Positive 6 (16%) 13 (37%)      
    Negative 31 (84%) 22 (63%)      
P53 status     2.370 0.772-7.280 0.132
    Positive 11 (30%) 12 (34%)      
    Negative 26 (70%) 23 (66%)      

OR, Odd ratio; DSCI, ductal carcinoma in situ; PR, progesterone receptor.

Table 5.

Association of the mRNA expression level of Notch4 with clinicopathological characteristics of patients.

Variables Expression of Notch4
OR 95% CI P-Value
Low (%) High (%)
Grade     0.640    
    Grade 1 12 (34.3%) 20 (57.1%)   0.245-1.672 0.362
    Grades 2 & 3 25 (67%) 15 (42.9%)      
N stage     12.267 3.769-39.634 0.0001
    N0 & N1 32 (86.5%) 12 (34.3%)      
    N1 & N2 5 (13.5%) 23 (65.7%)      
T Stage     2.236 0.760-6.577 0.144
    T1 & T2 30 (81.1%) 23 (65.7%)      
    T3 & T4 7 (18.9%) 12 (34.3%)      
Extracapsular nodal extension     0.264 0.075-0.932 0.038
    Yes 33 (89.2%) 24 (68.6%)      
    No 14 (37.8%) 11 (31.4%)      
DCIS histology     1.167 0.445-3.058 0.754
    Comedo Type 23 (62.2%) 12 (34.3%)      
    Non Comedo 34 (91.9%) 23 (65.7%)      
Nipple involvement     0796 0.630-1.006 0.056
    No 34 (91.9%) 26 (74.3%)      
    Yes 7 (8.1%) 9 (25.7%)      
Lymphatic invasion     0.922 0.310-2.740 0.884
    No 9 (24.3%) 8 (22.9%)      
    Yes 28 (75.7%) 27 (77.1%)      
Perineural invasion     0.723 0.282-1.851 0.499
    Yes 23(62.2%) 19(54.3%)      
    No 14(37.8%) 16(45.7%)      
PR status     1.038 0.39-2.741 0.940
    Positive 24 (64.9%) 23 (65.7%)      
    Negative 13 (35.1%) 12 (34.3%)      
HER-2 status     1.244 0.436-3.555 0.683
    Positive 9 (24.3%) 10 (28.6%)      
    Negative 28 (75.7%) 25 (71.4%)      
P53 status     1.595 0.588-4.329 0.359
    Positive 10 (27%) 13 (37.1%)      
    Negative 27 (73%) 22 (92.9%)      

OR, Odd ratio; DSCI, ductal carcinoma in situ; PR, progesterone receptor.

Table 6.

Association of mRNA expression level of Hes1 with clinicopathological characteristics of patients.

Variables Expression of Hes1
OR 95% CI P-Value
Low (%) High (%)
Grade     1.326 0.683-2.575 0.405
    Grade 1 12 (36.3%) 13 (33.3%)      
    Grade 2 & 3 21 (63.7%) 26 (66.7%)      
N stage     3.289 1.193-9.067 0.021
    NO & N1 25 (75.8%) 19 (48.7%)      
    N1 & N2 8 (24.2%) 20 (51.3%)      
T Stage     0.920 0.322-2.629 0.876
    T1 & T2 24 (72.7%) 29 (74.4%)      
    T3 & T4 9 (27.3%) 10 (25.6%)      
Extracapsular nodal extension     0.518 0.157-1.707 0.518
    Yes 28 (84.8%) 29 (74.4%)      
    No 5 (15.2%) 10 (25.6%)      
DCIS histology     1.020 0.389-2.678 0.967
    Comedo Type 12 (36.4%) 14 (35.9%)      
    Non Comedo 21 (63.6%) 25 (64.1%)      
Nipple involvement     1.285 1.017-1.624 0.036
    No 9 (27.3%) 3 (7.7%)      
    Yes 24 (72.7%) 36 (92.3%)      
Lymphatic invasion     1.281 0.426-3.853 0.660
    No 7 (21.2%) 29 (74.3%)      
    Yes 26 (78.8%) 10 (25.6%)      
Perineural invasion     0.526 0.202-1.372 0.189
    No 22 (66.6%) 20 (51.3%)      
    Yes 11 (33.3%) 19 (48.7%)      
PR status     1.462 0.552-2.876 0.445
    Positive 2O (6O.6%) 27 (69.2%)      
    Negative 13 (39.4%) 12 (30.8%)      
HER-2 status     1.228 0.426-3.538 0.704
    Positive 8 (24.2%) 11 (28.2%)      
    Negative 25 (75.8%) 28 (71.8%)      
P53 status     0.435 0.545-4.090 0.435
    Positive 9 (27.3%) 14 (25.9%)      
    Negative 24 (72.7%) 25 (64.1%)      

OR, Odd ratio; DSCI, ductal carcinoma in situ; PR, progesterone receptor; HER2, human epidermal growth factor receptor 2.

Association of nicastrin, Notch4, and Hes1 expression with clinical outcome

To estimate the survival function of the genes in TAM-treated breast cancer patients, we conducted a Kaplan-Meier statistical test. Results indicated that higher expression of Notch4 (P = 0.001), nicastrin (P < 0.0001), and Hes1 (P = 0.047) were associated with worse prognosis in DSF patients. Furthermore, data analysis showed nicastrin expression was correlated with OS (P = 0.013) (Fig. 2).

Fig. 2.

Fig. 2

Kaplan-Meier cumulative survival curves of tamoxifen-resistant and tamoxifen-sensitive patients have been illustrated in two modes of disease-free survival and overall survival for (A and B) Notch4, (C and D) nicastrin, and (E and F) Hesl.

Univariate and multivariate Cox regression analysis

In order to investigate the association between the time of disease recurrence in TAM-treated patients and one predictor variable, a univariate Cox survival analysis was conducted (Table 7). The results demonstrated that ECE, PNI, and overexpression of nicastrin could be critical predictors for DFS. In addition, co-overexpression of Notch4 and nicastrin could be considered unfavorable factors in OS. Significant data from univariate Cox regression analysis were included in multivariate Cox regression (Table 8). After adjustment, in DFS, i t wa s observed that PNI and nicastrin expression were still significant and they could be contemplated as independent survival factors. In OS, exclusively overexpression of nicastrin indicated a significantly worse predictor of survival in TAM-treated breast cancer patients.

Table 7.

Univariate Cox regression for tamoxifen-treated in estrogen receptor-positive breast carcinoma patients, N = 72.

Factor base model Disease-free survival
Overall survival
HR CI 95% P-value HR CI 95% P-value
Histological grade   0.915-4.530   3.969 1.104-14.261 0.035
    Grade I 20.34   0.081   0.715-14.328 0.128
    Grade II and III 20.16   0.149      
T stage 1.63 0.816-3.270 0.166 1.835 0.720-4.672 0.203
    T1 and T2            
    T3 and T4            
N stage 2.63 1.355-5.128 0.004 2.132 0.850-5.287 0.103
    N0 and N1            
    N0 and N1            
Extracapsular nodal extension 2.17 1.20-4.06 0.012 2.002 0.76-5.274 0.160
    Absent            
    Present            
Ductal carcinoma in situ histology 1.01 0.395-2.620 0.973 1.840 0.609-5.557 0.280
    Comedo            
    Non-Comedo            
Absent of nipple involvement 1.41 0.585-3.434 0.44 1.099 0.317-2.810 0.881
Lymphatic invasion 1.78 0.742-4.296 0.196 1.828 0.531-6.268 0.339
Perineural invasion 2.32 1.99-4.499 0.013 0.787 0.310-1.999 0.614
    Absent            
    Present            
PR status 1.15 0.585-2.283 0.677 2.466 0.997-6.102 0.051
    Positive            
    Negative            
HER2 status 1.14 0.519-2.52 0.739 1.223 0.403-3.706 0.723
    Positive            
    Negative            
Nicastrin expression 4.336 2.027-9.275 < 0.001 3.4 1.222-9.545 0.019
Notch4 expression 1.86 0.733-4.763 0.191 3.122 1.521-6.409 0.002
Hes1 expression 1.98 0.987-3.972 0.054 1.217 0.488-3.032 0.674

HR, Hazard ratio; HER2, Human epidermal growth factor receptor 2; Hes1, hairy enhancer of split, PR, progesterone receptor.

Table 8.

Multivariate Cox regression for tamoxifen response in estrogen receptor-positive breast, N = 72.

Factor base model Disease-free survival
Overall survival
HR CI 95% P-value HR CI 95% P-value
N stage 1.240 0.540-2.849 0.612 - - -
    N0 & N1            
    N2 & N3            
Extracapsular nodal extension 0.843 0.360-1.974 0.694 - - -
Perineural invasion 0.456 0.360-1.974 0.023 - - -
Nicastrin 3.735 1.605-8.692 0.002 3.368 1.050-10.802 0.041
Notch4 - - - 1.018 0.351-2.958 0.973

HR, Hazard ratio.

DISCUSSION

In this study, we demonstrated that Notch4, nicastrin, and Hes1 were overexpressed in TAM-R patients in comparison to those in TAM-S group. It was also highlighted that over-expression of nicastrin, Notch4, and Hes1 were correlated with some of the clinicopathological features such as N stage and ECE. Moreover, it was shown that they could have an essential role in the worse prognosis of our breast carcinoma patients.

Lombardo et al reported that the inhibition of nicastrin mRNA by shRNA in HCC1806 (triple-negative) and MCF10A (non-transformed) breast cancer cell lines were able to disrupt GS complex and consequently the production of ICD from Notch1 and Notch4 significantly reduced. They found that there might be a positive correlation between nicastrin and Notch expression. In addition, they reported that nicastrin promotes the expression of EMT genes such as vimentin, twist1, SIP1, snail, MMP2, and MMP9 in breast carcinoma cells(19). In another study, Filipović et al. blocked nicastrin protein by anti-nicastrin monoclonal antibodies in triple-negative breast cancer cell lines and in vivo as well. Subsequently, the uncontrollable proliferation of cancer cells was reduced, and multiple critical steps emerged: first, the invasive potential was significantly decreased. Second, the ability of diapedesis was impeded. Third, cancer cells were not able to degrade the extracellular matrix via invadopodia extension(22). In their previous research, they found that nicastrin was upregulated in human breast cancer tissues compared to normal tissues and positively correlated with expression levels of Era, progesterone receptor, and cytokeratin 18, and negatively with the expression of cytokeratin 5/6(23). In line with these studies, we also observed overexpression of nicastrin in TAM-R compared to TAM-S patients. Moreover, it was shown that a higher level of nicastrin was associated with N stage, ECE, and PNI, and more importantly, its higher level of expression was correlated with worse survival in OS and DFS.

Zhou and colleagues claimed that Notch4 aberrantly overexpressed in triple-negative breast cancer cells and was correspondent with the decreased OS. They proved that Notch4 could effectively increase CSCs subpopulation and the EMT phenomenon. In the MCF-7 cell line, Notch4 acted as a tumor suppressor which caused cell differentiation and reduced metastasis(24). In a study conducted by wang et al. Notch4 expression and its relation to clinicopathological features, survival, and prognostic value were investigated in different subtypes of breast cancer. Survival analysis showed that Notch4 expression did not reveal prognostic significance in the Her-2 overexpression patients. OS rates were lower in luminal breast cancer patients with elevated expression of Notch4 compared to patients with a low expression level of Notch4. Due to the fact that Notch4 had a worse prognosis value in luminal breast cancer, it was deemed that Notch might cause resistance to hormone therapy. However, their results showed that Notch4 was not an independent prognosis factor in breast cancer patients(25). In agreement with previous studies, our data suggested that in ER+ TAM-R patients similar to triple-negative breast cancer, the mRNA level of Notch4 was significantly increased. In addition, Notch4 was responsible for poor prognosis in DFS and was an independent survival factor in OS.

Hes1, which involves morphological processes, such as cell cycle, apoptosis, and pluripotency, is a downstream target of the Notch signaling pathway. Hes1 expression promotes proliferation, tumor recurrence, and cell survival in different cancer cell lines. In breast cancer, high levels of Hes1 bring about EMT-like features, invasiveness, lymph node metastasis, and advanced TNM(26). Moreover, the upregulation of Hes1 had a crucial role in chemoresistance, higher recurrence rate, and worse survival in colorectal cancer patients. It was demonstrated that Hes1 downregulated the E-cadherin and upregulated N-cadherin and ABC transporters. Hence, Hes1 was able to prompt EMT and was correlated with tumor recurrence(27).

Similar to these findings, our results showed that TAM-R patients exhibited higher Hes1 overexpression compared with TAM-S patients. In addition, in parallel with the previous studies(26,27), it was indicated that Hes1 expression correlated with clinicopathological features and influenced N-stage nipple involvement and also was an unfavorable prognosis factor in TAM-treated breast cancer patients.

Our findings showed that Notch4, nicastrin, and their downstream target Hes1 were concomitantly upregulated in TAM-R patients. In addition, analyzing previous data revealed that overexpression of Notch4, nicastrin, and Hes1 had a significant correlation with stemness factors Oct4 and Sox2(6). Altogether, these genes, all of which are involved in promoting CSCs and EMT, might promote TAM resistance in TAM-treated patients.

CONCLUSION

According to the findings of the current study and considering the results of other related research, the Notch signaling pathway is upregulated in TAM-R patients compared to TAM-S patients, which can lead to CSCs and EMT promotion. Furthermore, evaluating Notch4, nicastrin, and Hes1 concomitant mRNA expression showed that their concomitant expression might have a crucial role in poor prognosis, TAM resistance, and tumor recurrence in ER+ breast cancer patients. However, further studies are needed to elucidate the exact role of these genes in TAM resistance and their potential function in prognostic or even diagnostic applications.

Conflict of interest statements

The authors declared no conflict of interest in this study.

Authors’ contributions

A. Boustan contributed to experimental procedures, statistical analysis, writing, and initial draft preparation of the manuscript; A. Dahmardeh and M. Khorsandi wrote, reviewed, and edited the article; R. Jahangiri contributed to sample preparation and data collection; F. Mosaffa and Kh. Jamialahmadi contributed to resources, conceptualization, and supervision. The finalized article was approved by all authors.

Acknowledgments

This research was part of the M.Sc thesis which was financially supported by the Vice Chancellor of Research, Mashhad University of Medical Sciences, Mashhad, Iran through Grant No. 980621. We thank the staff members of the Cancer Institute of Tehran’s Imam Khomeini Hospital for their generous collaboration. We would also like to extend our deepest gratitude to Dr. Asma Mostafapour, completion of this research would not have been feasible without her help.

REFERENCES

  • 1.Mohamadi A, Aghaei M, Panjehpour M. Estrogen stimulates adenosine receptor expression subtypes in human breast cancer MCF-7 cell line. Res Pharm Sci. 2018;13(1):57–64. doi: 10.4103/1735-5362.220968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.McAndrew NP, Finn RS. Management of ER positive metastatic breast cancer. Semin Oncol. 2020;47(5):270–277. doi: 10.1053/j.seminoncol.2020.07.005. [DOI] [PubMed] [Google Scholar]
  • 3.Brufsky AM, Dickler MN. Estrogen receptor-positive breast cancer: exploiting signaling pathways implicated in endocrine resistance. Oncologist. 2018;23(5):528–539. doi: 10.1634/theoncologist.2017-0423. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Gooding AJ, Schiemann WP. Epithelial-mesenchymal transition programs and cancer stem cell phenotypes: mediators of breast cancer therapy resistance. Mol Cancer Res. 2020;18(9):1257–1270. doi: 10.1158/1541-7786.MCR-20-0067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Rahimmanesh I, Khanahmad H. Chimeric antigen receptor-T cells immunotherapy for targeting breast cancer. Res Pharm Sci. 2021;19;16(5):447–454. doi: 10.4103/1735-5362.323911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Jahangiri R, Mosaffa F, EmamiRazavi A, Gharib M, Jamialahmadi K. Increased expression of gankyrin and stemness factor Oct-4 are associated with unfavorable clinical outcomes and poor benefit of tamoxifen in breast carcinoma patients. Pathol Oncol Res. 2020;26(3):1921–1934. doi: 10.1007/s12253-019-00766-2. [DOI] [PubMed] [Google Scholar]
  • 7.Wang Z, Li Y, Ahmad A, Azmi AS, Banerjee S, Kong D, et al. Targeting Notch signaling pathway to overcome drug resistance for cancer therapy. Biochim Biophys Acta. 2010;1806(2):258–267. doi: 10.1016/j.bbcan.2010.06.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Panda M, Biswal BK. Cell signaling and cancer: a mechanistic insight into drug resistance. Mol Biol Rep. 2019;46(5):5645–5659. doi: 10.1007/s11033-019-04958-6. [DOI] [PubMed] [Google Scholar]
  • 9.Bai JW, Wei M, Li JW, Zhang GJ. Notch signaling pathway and endocrine resistance in breast cancer. Front Pharmacol. 2020;11:924–924. doi: 10.3389/fphar.2020.00924. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Kumar R, Juillerat-Jeanneret L, Golshayan D. Notch antagonists: potential modulators of cancer and inflammatory diseases. J Med Chem. 2016;59(17):7719–7737. doi: 10.1021/acs.jmedchem.5b01516. [DOI] [PubMed] [Google Scholar]
  • 11.Lombardo Y, Faronato M, Filipovic A, Vircillo V, Magnani L, Coombes RC. Nicastrin and Notch4 drive endocrine therapy resistance and epithelial to mesenchymal transition in MCF7 breast cancer cells. Breast Cancer Res. 2014;16(3):1–14. doi: 10.1186/bcr3675. R62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Saini N, Sarin A. Nucleolar localization of the Notch4 intracellular domain underpins its regulation of the cellular response to genotoxic stressors. Cell Death Discov. 2020;6(1):1–11. doi: 10.1038/s41420-020-0242-y. 7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Simões BM, O'Brien CS, Eyre R, Silva A, Yu L, Sarmiento-Castro A, et al. Anti-estrogen resistance in human breast tumors is driven by JAG1-NOTCH4-dependent cancer stem cell activity. Cell Rep. 2015;12(12):1968–1977. doi: 10.1016/j.celrep.2015.08.050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Bui QT, Im JH, Jeong SB, Kim YM, Lim SC, Kim B, et al. Essential role of Notch4/STAT3 signaling in epithelial-mesenchymal transition of tamoxifen-resistant human breast cancer. Cancer Lett. 2017;390:115–125. doi: 10.1016/j.canlet.2017.01.014. [DOI] [PubMed] [Google Scholar]
  • 15.Nagamatsu I, Onishi H, Matsushita S, Kubo M, Kai M, Imaizumi A, et al. NOTCH4 is a potential therapeutic target for triple-negative breast cancer. Anticancer Res. 2014;34(1):69–80. PMID: 24403446. [PubMed] [Google Scholar]
  • 16.Urban S. Nicastrin guards Alzheimer's gate. Proc Natl Acad Sci U S A. 2016;113(5):1112–1114. doi: 10.1073/pnas.1524151113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Wang X, Wang X, Xu Y, Yan M, Li W, Chen J, et al. Effect of nicastrin on hepatocellular carcinoma proliferation and apoptosis through PI3K/AKT signalling pathway modulation. Cancer Cell Int. 2020;20:1–14. doi: 10.1186/s12935-020-01172-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Tyagi A, Sharma AK, Damodaran C. A Review on Notch signaling and colorectal cancer. Cells. 2020;9(6):1–15. doi: 10.3390/cells9061549. 1549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lombardo Y, Filipović A, Molyneux G, Periyasamy M, Giamas G, Huet Y, et al. Nicastrin regulates breast cancer stem cell properties and tumor growth in vitro and in vivo. Proc Natl Acad Sci USA. 2012;109(41):16558–16563. doi: 10.1073/pnas.1206268109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Tsoua PS, Campbell P, Amin MA, Coit P, Miller S, Fox DA, et al. Inhibition of EZH2 prevents fibrosis and restores normal angiogenesis in scleroderma. Proc Natl Acad Sci USA. 2019;116(9):3695–3702. doi: 10.1073/pnas.1813006116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Taleb S, Abbaszadegan MR, Moghbeli M, Hayati Roudbari N, Forghanifard MM. HES1 as an independent prognostic marker in esophageal squamous cell carcinoma. J Gastrointest Cancer. 2014;45(4):466–471. doi: 10.1007/s12029-014-9648-1. [DOI] [PubMed] [Google Scholar]
  • 22.Filipović A, Lombardo Y, Faronato M, Abrahams J, Aboagye E, Nguyen QD, et al. Anti-nicastrin monoclonal antibodies elicit pleiotropic anti-tumour pharmacological effects in invasive breast cancer cells. Breast Cancer Res Treat. 2014;148(2):455–462. doi: 10.1007/s10549-014-3119-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Filipović A, Gronau JH, Green AR, Wang J, Vallath S, Shao D, et al. Biological and clinical implications of nicastrin expression in invasive breast cancer. Breast Cancer Res Treat. 2011;125(1):43–53. doi: 10.1007/s10549-010-0823-1. [DOI] [PubMed] [Google Scholar]
  • 24.Zhou L, Wang D, Sheng D, Xu J, Chen W, Qin Y, et al. NOTCH4 maintains quiescent mesenchymal-like breast cancer stem cells via transcriptionally activating SLUG and GAS1 in triple-negative breast cancer. Theranostics. 2020;10(5):2405–2421. doi: 10.7150/thno.38875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Wang JW, Wei XL, Dou XW, Huang WH, Du CW, Zhang GJ. The association between Notch4 expression, and clinicopathological characteristics and clinical outcomes in patients with breast cancer. Oncology Lett. 2018;15(6):8749–8755. doi: 10.3892/ol.2018.8442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Li X, Cao Y, Li M, Jin F. Upregulation of HES1 promotes cell proliferation and invasion in breast cancer as a prognosis marker and therapy target via the AKT pathway and EMT process. J Cancer. 2018;9(4):757–766. doi: 10.7150/jca.22319. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Sun L, Ke J, He Z, Chen Z, Huang Q, Ai W, et al. HES1 Promotes colorectal cancer cell resistance To 5-Fu by inducing of EMT and ABC transporter proteins. J Cancer. 2017;8(14):2802–2808. doi: 10.7150/jca.19142. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Research in Pharmaceutical Sciences are provided here courtesy of Wolters Kluwer -- Medknow Publications

RESOURCES