Skip to main content
PLOS One logoLink to PLOS One
. 2023 Feb 24;18(2):e0282332. doi: 10.1371/journal.pone.0282332

Droplet digital PCR-based testing for donor-derived cell-free DNA in transplanted patients as noninvasive marker of allograft health: Methodological aspects

Frederik Banch Clausen 1,*, Kristine Mathilde Clara Lund Jørgensen 1,2,#, Lasse Witt Wardil 1,2,#, Leif Kofoed Nielsen 2, Grethe Risum Krog 1
Editor: Benjamin M Liu3
PMCID: PMC9955980  PMID: 36827438

Abstract

In solid organ transplantation, donor-derived cell-free DNA (dd-cfDNA) is a promising universal noninvasive biomarker for allograft health, where high levels of dd-cfDNA indicate organ damage. Using Droplet Digital PCR (ddPCR), we aimed to develop an assay setup for monitoring organ health. We aimed to identify the least distinguishable percentage-point increase in the fraction of minute amounts of cfDNA in a large cfDNA background by using assays targeting single nucleotide polymorphisms (SNPs). We mimicked a clinical sample from a recipient in a number of spike-in experiments, where cfDNA from healthy volunteers were mixed. A total of 40 assays were tested and approved by qPCR and ddPCR. Limit of detection (LOD) was demonstrated to be approximately 3 copies per reaction, observed at a fraction of 0.002%, and which would equal 6 copies per mL plasma. Limit of quantification (LOQ) was 35 copies per reaction, estimated to 0.038%. The lowest detectable increase in percentage point of dd-cfDNA was approximately 0.04%. Our results demonstrated that ddPCR has great sensitivity, high precision, and exceptional ability to quantify low levels of cfDNA. The ability to distinguish small differences in mimicking dd-cfDNA was far beyond the desired capability. While these methodological data are promising, further prospective studies are needed to determine the clinical utility of the proposed method.

Introduction

When patients receive a solid organ transplantation, efficient monitoring of the allograft health is important for organ survival [1]. Therefore, organ recipients must regularly undergo a tissue biopsy to monitor the allograft health. Such current method is an invasive diagnostic procedure that may cause discomfort and rare but serious complications [2, 3]. Some noninvasive markers exist [3], but the predictive value is either limited or unreliable [4, 5]. One promising alternative is donor-derived cell-free DNA (dd-cfDNA) [1, 3, 6].

Transplanted organs release cfDNA into the recipient’s bloodstream, and this dd-cfDNA is detectable in an ordinary blood sample taken from the patient [1, 2, 7]. Analyzing dd-cfDNA has shown great potential as a biomarker for monitoring the allograft health, where an increase of the dd-cfDNA fraction in the recipient’s bloodstream will indicate organ damage [2, 812]. As a noninvasive marker for organ health, dd-cfDNA testing has been applied for various organs [3, 6], including the heart [1322], kidney [5, 2329], liver [11, 29], lung [3032], and pancreas and simultaneously pancreas-kidney transplantation [33].

There are numerous, potential benefits from using dd-cfDNA testing. Monitoring allograft health based on a blood sample would be less invasive and cause the patient less discomfort compared to a regular tissue biopsy [34, 35]. dd-cfDNA-based monitoring may predict early rejection as well as subclinical damage, and continuous dd-cfDNA-based allograft health monitoring may allow for a better adjusted immunosuppressive therapy [36]; the potential effect of treatment may also be monitored by dd-cfDNA testing. dd-cfDNA has repeatedly been shown to provide an early indication of organ damage, thus unmasking pathology long before existing tools. The ultimate clinical benefit would be prolonged organ survival and thus prolonged patient survival.

Methodologically, two overall approaches are used, which are based on either random or targeted differentiation of donor and recipient cfDNA using different methods of either next generation sequencing (NGS), Droplet Digital PCR (ddPCR), or quantitative real-time PCR (qPCR) [1, 8]. Various commercial solutions are available, including TRAC, TheraSure, AlloSure and Prospera [8].

Beck and colleagues developed a ddPCR-based method capable of monitoring dd-cfDNA, first presented in 2013 [9]. Beck et al. use a selection of assays that specifically target biallelic, single nucleotide polymorphisms (SNPs) to differentiate between donor and the recipient cfDNA in a plasma sample. In each assay, two probes are used, each probe detecting each SNP allele. A given biallelic SNP assay can distinguish between donor and recipient when donor and recipient are homozygous for each different SNP allele [9, 10, 37]. Statistically, this situation will occur for 12.5% of the SNPs (assuming an allele frequency of 0.5 for both alleles in a biallelic SNP target).

In ddPCR, each reaction mixture is divided into separate PCR reactions in up to 20,000 droplets. This partitioning of target molecules in droplets allows for a high-precision quantification method (without the use of standard curves)—creating a quantitative precision which is much greater than the precision of qPCR, especially in cases of low levels of DNA [34, 35, 38]. ddPCR-based analysis of dd-cfDNA has been successfully demonstrated for all organs, including kidney [27, 39]; heart [40], lung [31], and liver [11].

When an allograft is in a stable phase, the fraction of dd-cfDNA compared to the recipient’s total cfDNA has been reported to be approximately 10% for liver transplants, 1% for kidney transplants, and 0.5% for heart transplants [9, 10]. Consequently, it is important that the measuring method is highly sensitive as well as capable of providing precise quantification at low DNA levels. Importantly, high precision is necessary to distinguish a small increase or decrease from stochastic or biological variation. In addition, a robust algorithm must be established for when organ damage can be indicated. The specific levels of dd-cfDNA for each organ at steady state, the specific algorithm for predicting subclinical organ damage, as well as the extent of clinical actions needed or taken are all essential elements that are not yet fully established.

In this study, we assessed various key analytical performance parameters of ddPCR. We developed an arsenal of SNP assays, partly based on the design from Beck and colleagues and partly on our own design. We investigated the limit of detection (LOD), the limit of quantification (LOQ), and we aimed to identify the lowest detectable increase in fractions measured in percentage points. This was done by quantifying minute concentrations of cfDNA in experiments using samples spiked with cfDNA.

Materials and methods

Ethics statement

This study was a quality assurance project using blood samples from healthy volunteers. Informed and written consent was obtained from all participating volunteers when blood samples were collected. According to Danish law, no ethical approval was required, because this was a quality assurance project, thus waiving the need for ethics committee approval of the study. No DNA information related to disease was examined, and only SNPs with no known clinical significance were used, thus avoiding the challenges of reporting incidental findings.

Sample material

We sampled blood from a total of 32 healthy volunteers for assay development and for spike-in experiments designed to mimic dd-cfDNA in transplanted patients. No patients with organ transplantations were tested in this study. All blood samples were collected and analyzed from 2020 to 2022 in The Laboratory of Blood Genetics, at The Department of Clinical Immunology, Copenhagen University Hospital, Copenhagen, Denmark.

Sample collection and preparation

Blood samples collected from all included volunteers were genotyped for the selected SNPs. All blood samples were collected in 10 mL Cell-Free DNA BCT tubes (Streck, NE, USA). Within one hour after blood collection, plasma was separated from cells by centrifugation for 10 min at 1990xg at room temperature. cfDNA was extracted from 4 mL plasma using the automated QIAsymphony SP extraction system (Qiagen, Hilden, Germany) using the QIAsymphony DSP Virus/Pathogen-kit (Qiagen). Extracted cfDNA was eluted in 60 μL AVE buffer. Eluted cfDNA was stored at –20°C until further use.

Samples were picked for the spike-in experiments based on their genotype where cfDNA from one individual (homozygous for one SNP allele) would be added to cfDNA from another individual (homozygous for the other SNP allele for a given SNP assay). For the sake of clarity, we will henceforth refer to spike-in material as mimicking dd-cfDNA and the donated background DNA as background cfDNA.

SNP assay selection

Each biallelic SNP assay consisted of a forward and reverse primer, and two probes targeting each of the biallelic SNPs. The two probes were labelled with either a FAM or a HEX fluorescent dye, in conjunction with a Black Hole Quencher 1 (BHQ1) (Eurofins MWG, Edersberg, Germany). SNP assays were adopted from Beck and colleagues [37] and analyzed for their suitability in our laboratory setting. We did in-silico verification and quality assurance of all SNP assays which included checking correct DNA sequences, potential overlap of primers and probes, melting temperatures, and potential secondary structure formations. If sequences overlapped, or did not match blasted sequences, or other criteria was not met, the assay was discarded. Assays which were approved by in silico verification were then subjected to qPCR and ddPCR testing, as described below.

22 out of 40 assays described by Beck et al. did not pass our quality assurance. We therefore designed new assays. In short, we designed assays for non-clinical, biallelic SNP targets with a minor allele frequency of 0.4 to 0.5 and with no additional SNPs of >1% frequency present in the primer or probe sequences, and with a maximum amplicon length of 90 bp. Please see full description of design criteria in S1 Text.

Each SNP assay was thoroughly tested by qPCR to check for the capability of allele discrimination using all 32 control individuals as material to allow assessment of acceptable allele discrimination. qPCR was done using qPCR 7500 Fast Real-Time PCR Systems (Applied Biosystems) and by using the 2x Universal Master Mix with uracil-N-glycosylase (UNG) (Applied BioSystems), primers and probes in the same concentration as used in ddPCR, and 2–10 ng genomic DNA in a total reaction volume of 10 μL. The thermal profile was common to all assays consisting of 1 min at 60°C and 10 min at 95°C, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min with a post-PCR read at 60°C for 1 min. If more than tree clusters were formed in the allelic discrimination plot or allele calling was not automatic with default settings, assays were discarded. Subsequently, discrimination capability was controlled with ddPCR using homozygous DNA for each variation in the biallelic SNP and heterozygous DNA.

A number of SNP assays were selected (at random) for assessing the coefficient of variation (CV%) of measurements of 0.5% fraction at varying concentrations and for a deeper assessment of LOD, LOQ, and minimum distinguishable percentage point difference, as assessed by spike-in experiments.

Preamplification of cfDNA

We used preamplification to make sufficient DNA material for the spike-in experiments. Extracted plasma cfDNA was preamplified with 12 PCR cycles when acting as mimicking dd-cfDNA and 20 PCR cycles when acting as background cfDNA. The expected final concentration was calculated using an equation from Andersson et al. [41]. Subsequently, a ddPCR run was made to measure the exact DNA concentration of the pre-amplified DNA (using 20x dilutions or more if more than 5000 copies/μL was expected), following which dilutions for spike-in experiments were made.

Preamplification was done in a 25 μL reaction volume consisting of 2x ddPCR Supermix for probes (No dUTP) (Bio-Rad), primers used in the specific SNP assay at a final concentration of 40 nM, 10 μL cfDNA, topped up with sterile H2O (sH2O). Amplification was done with a Veriti 96 Well Thermal cycler (Applied Biosystems) using the following PCR conditions: 95°C for 10 min initial denaturation, 12 or 20x (94°C denaturation for 30 s, 60°C annealing and extension for 1 min) then a final extension at 72°C for 10 min. Two no template controls (NTC) were analyzed on par with the amplified cfDNA with every SNP assay.

Droplet digital pcr

We used the QX200 ddPCR system (Bio-Rad, Hercules, California, US) to determine the concentration of cfDNA. Each reaction with a final volume of 20 μL consisted of 2x ddPCR Supermix for probes (No dUTP) (Bio-Rad), primers and probes at a final concentration of 900nM and 250nM respectively, 8 μL cfDNA topped up with sH2O. Droplets were generated using the QX200 Droplet Generator (Bio-Rad) and subjected to DNA amplification on the C1000 Touch Thermal Cycler (Bio-Rad) with the following PCR conditions: 95°C for 10 min initial denaturation, 40x (94°C denaturation for 30 s, 60°C annealing and extension for 1 min), then 98°C for 10 min for enzyme deactivation. The ramp rate was 2°C/s. The ddPCR plate was held at 4°C until further analysis. Droplets were read by the QX200 Droplet Reader (Bio-Rad) and analyzed using QX Manager Software Standard edition version 1.2.345.

We used Direct Quantification (DQ), and a threshold value was set manually for each SNP assay before interpreting the results.

The QX Manager Software displayed all measured DNA concentrations in copies/μL and in copies per 20 μL reaction mix (henceforth referred to as copies/reaction). (A given DNA concentration of 5 copies/μL is thus equivalent to 100 copies/reaction; for a clinical plasma sample, this DNA concentration would further correspond to an initial cfDNA concentration of 750 extractable copies per 4 mL plasma [copies per reaction / template volume * elution volume = 100 / 8 * 60 = 750 copies]).

Limit of detection

In an experiment (using SNP assay S68), we analyzed thirteen different concentrations of mimicking dd-cfDNA from 0.15 to 400 copies per μL spiked into a constant background of approximately 6500 copies per μL of background cfDNA, equivalent to a fraction range of 0.002–6%. The specific DNA concentrations were 400, 200, 100, 50, 25, 15, 10, 5, 2.5, 1.25, 0.63, 0.3, and 0.15 copies per μL reaction mix. Each DNA concentration was analyzed in duplicate.

LOD was defined as the lowest concentration detected. The dynamic range is described as 1–120,000 copies/reaction by the manufacturers. The data from the LOD experiment were subjected to adjustment; the background signal from any unspecific reaction from the opposite allele (false positive signal, FPS) was subtracted from all the measured spike-in concentrations, as recommended by Kokelj et al. [39]. In this experiment, the FPS was 0.13 copies per μL.

Quantitative experiments

To assess quantitative capabilities, five spike-in experiments were performed, henceforth referred to as Spike 1–5. In Spike 1 and 2 (using assay S226), we analyzed a fixed fraction of 0.5% (as a first representative level of dd-cfDNA) using different absolute DNA concentrations. The following solutions were tested: 100 copies/reaction in a background of 20,000 copies/reaction; 200 copies in 40,000 copies, and 300 copies in 60,000 copies.

In Spike 3–5, we further investigated the detection of lower levels of DNA to estimate LOQ and least distinguishable change in fraction. In Spike 3–5 (using SNP assay S67, S68, and S110, respectively), the background cfDNA concentration was held constant while the concentration of the mimicking dd-cfDNA varied in four different concentrations (with varying distances between values), as described below. For Spike 3, the mimicking dd-cfDNA was diluted to concentrations of 12.5, 25, 50, and 100 copies/reaction, tested in a final background cfDNA concentration of 94,000 copies/reaction. For Spike 4, the mimicking dd-cfDNA was diluted to 12.5, 25, 100, and 200 copies/reaction, tested in a background cfDNA concentration of 47,000 copies/reaction. For Spike 5, the mimicking dd-cfDNA was diluted to 34, 68, 137, and 275 copies/reaction, tested in a background cfDNA concentration of 94,000 copies/reaction. The highest mimicking dd-cfDNA concentration was tested in 12 replicates, and the lower concentrations were tested in 18 replicates. A full 96-well ddPCR plate was used per spike-in experiment, with two NTCs per column. In the first column of each ddPCR plate, dilutions of the background cfDNA concentration and the mimicking dd-cfDNA were analyzed in triplicates. The mean concentrations of these measurements were then used to determine the exact, expected concentration of the mimicking dd-cfDNA concentrations in each spike-in experiment, as presented in the results.

FPS from the opposite allele was subtracted from all the measured mimicking dd-cfDNA concentrations. The FPS was 4.2 copies/reaction for Spike 3, 1.0 copies/reaction for Spike 4, and 9.6 copies/reaction for Spike 5. We chose an acceptable CV at <25% as the criterion defining the LOQ.

We calculated a 95% confidence interval of the fractions for each spike-in experiment. To distinguish between two fractions, we defined that the confidence intervals of each fraction should be non-overlapping. For Spike 3–5, we identified the lowest detectable increase in fractions between mean fraction values for each experiment, measured as difference in percentage points. Percentage points were calculated by subtracting the low mean fraction value from the higher mean fraction value where the 95% confidence intervals did not overlap each other.

Statistics

Data were exported from the QX Manager Software to Microsoft Excel 365 where mean concentrations, standard deviation (SD), coefficient of variation (CV), mimicking dd-cfDNA fractions, and 95% confidence intervals for the fractions were calculated. Linear regression was used to evaluate linearity, and Pearson’s r was used to evaluate the precision between the measured and expected concentrations of the mimicking dd-cfDNA. Measurements of 0.5% fractions (for Spike 1 and 2) were evaluated using ANOVA (Tukey’s multiple comparisons test) using Graph Pad Prism 9.

Results

We validated 40 SNP assays for ddPCR-based cfDNA quantification to enable high-precision quantification of dd-cfDNA in transplanted patients. All assays are presented in Table 1. The average amplicon length of each assay was 85.4 bp (range: 66–103 bp). We based our setup on the design from Beck and colleagues [37], of which 18 assays were approved and selected, and 22 were discarded because they did not meet our criteria for inclusion. Therefore, we designed 22 new assays; average amplicon length was 82.3 bp (range: 66–90 bp).

Table 1. Overview of SNP assays.

Assay SNP ID Alleles Chr:position Global MAF Forward Primer Reverse Primer Probe A (5’-FAM/3’-BHQ1) Probe B (5’-HEX/3’-BHQ1) Amplicon (bp)
S43 rs741384 C,G 2:216687231 0.49/0.51 GTCTCTGGGGGTCTGTTGGCC AGAGGAAGGACTCCCAGGGGG TGGAGACGGGTCCGCAGAG TGGCACAGGTGCTCTCCGG 100
S48 rs13333451 C,G 16:87672262 0.48/0.52 GATCAACTCCTGAAGAGACTCCGT AGGGAGGGATGGAGAGGGAC CGGGAGCCCTGCGCTTTG TTTCCATGACAAACCGCAGGG 91
S55 rs3909244 C,G 18:3769560 0.49/0.51 TGGTTAAACTGTAGTACATCCATGGA ACCTTTTGGGACTGGCTTTCT ACTTCTCAGCAACAGCCTGGA CTCTGGAAATTCATCCAGCCTGT 98
S58 rs1317808 C,G 2:47627849 0.54/0.46 GCCACCTTAGCCTCCCAAAG AGGGTGACTGTATTAATTATTGTTCAAACT ATTACAGGCATGAGCCACCG CAAGGCACGGTGCCTCAT 87
S63 rs2312356 C,G 7:153385741 0.47/0.53 GCTGTTGCTGCCTCACAGGT AGGGCAAAGGCAAATGCACCA AACTGGAAGTAACACCTGCACCA CTTGACTCTTGGTGCACGTGT 103
S66 rs1522662 G,C 11:81114448 0.48/0.52 ACCCTGACCCTCAGTTCCTT AAGAGCCCTTATAAGGTGTGAGAAA AGGATATTGCTAGAGTGGAGTCAGAAC ACCACTGTTATTTGTTCTCACTCCACT 98
S67 rs2303754 C,G 19:29606361 0.44/0.56 ATGAAGAGTAAGCGGGGCCG CGGACCCATTTCACCCACCA CCCGACCCTTAACCTCCCC TGGAGAGGGTTGGGGACGTTA 86
S68 rs11779762 C,G 8:104381588 0.53/0.47 GCCTCTGCCATATCCTCAC AGGTCGGATGTTGGAAAGG AGACACTTGTGGGACTCAGAAGG ACAACTGTCTCCTGCTGTCCT 71
S70 rs6436409 C,G 2:223498844 0.46/0.54 TGGCCCAGTTAGAAGGTGTGGA CGGCCACCCATCCTGGAGAT ACCCTCCTGTACTGCGCAC ACAGTGAAGGTGTGCCCAGT 97
S77 rs2072042 T,C 16:986640 0.40/0.60 GGGCCTCAGTTCTAGACGAGT GTTTCCGTGAAGTAGGCGCT ATGCTCAGCACACAGGGGA CACTGCTTCCCCCGTGTG 96
S82 rs10228737 T,C 7:4198445 0.48/0.52 TTTGCACTTGACGCACCAGC CCGAGGCAGAGGAAGGAAGTG TGCAATGAGAGCAGAGGCCT CATCGCAGCCCTCCTGCA 79
S84 rs10164176 T,C 18:47293478 0.54/0.46 CCTAATCACTCGTGAGGAGTG ATCCACCATGATGCTCACAA CCCACGGGAGGAATGTCTTTG CCCATGGGACTTCTGGCC 71
S94 rs7072759 A,G 10:18282286 0.45/0.55 CTGGGGCAGAGTGGAGAGTC ATCCACCTCTGAACCCAGCC AGGACACTGCAGCTGTGG CAGCGTCCTCTGTGCTACCT 83
S96 rs35736520 T,C 15:70362495 0.49/0.51 TCCCAGGCTCCAGGTCAGAT GGATCAATGTGGCTGCTCCCT TCTCCGCCCTTCTGAGATGC AGGGCAGAGACTCTGGAACT 81
S97 rs8092926 A,G 18:8563173 0.48/0.52 AGCCCTGCACACTCACTTACC TGGCATTCAGATCATCAGGCTTCT CCATCAGGTGCTGGCACTC TGCAGGGAAGAGCGCCAG 83
S105 rs1265094 A,G 6:31139116 0.52/0.48 ACCCCAAGAGGCTTTATAGGGG CCTTCCCAACGGGTTTGACC CCACTGGGCTGGCCCCTC AGTGGAGGAGGGACCAGC 96
S108 rs11610836 C,T 12:112765162 0.55/0.45 ACACTCCTGCTGCGTGTCTG TTCCTCCCCACCACTCCCAT GGTCCCAGCTGGTCGTGG ATGCTCCCCACAACCAGCT 96
S110 rs13185616 C,A 5:13702567 0.51/0.49 GGTCCTACCGAGGTGGGTGA CATTGCCAAGGACAGAGGGAGA TTTGGTAGGGAAGGAACTCCCAAT ATCAGTGGCCATTGTGAGTTCC 90
S201 rs2236058 C,G 1:12002304 0.44/0.56 GAACCACATAGACAGCCTGGTG CAACACAGGGAATCGTGCTG TCATCACCCCACCTGGTCTG TCATCACCCGACCTGGTCTG 83
S202 rs7536561 A,G 1:180274389 0.57/0.43 TCCATATCGTCCCTGCCATC CGCAATGATGCCCAAATTAC CCTTTGCTCAATGGGCTGG CCTTTGCTCAGTGGGCTGG 81
S203 rs2224718 T,C 1:3659496 0.52/0.48 GAACGGTGGGAGAAAATTGAAAG AACTGGACGGGTTCCTGATG TTGCAGCCAGATACTGGAGGAA TTGCAGCCAGACACTGGAGGAA 87
S204 rs28401180 C,T 2:20005919 0.48/0.52 AGAGCTCAATACCAGATGCTTGG TAAGGTGGCCATCATTGTTACAG AGCCGCCACCTCATTCACC AGCCGCCACTTCATTCACC 89
S205 rs28598872 G,A 2:20006087 0.48/0.52 CCTGACATGGTGCCTGTTGAC TTCCAACTCCAGGCCTACACAG CGACCCACGGCCTGCTTC CGACCCACAGCCTGCTTC 86
S206 rs1063353 A,G 2:240774229 0.49/0.51 GCGTGCTAAGGGTCTCATCG GGCGGTAACTCAAGGACAGC TGCAGGACTCAAGGCTGCCA TGCAGGACTCAGGGCTGCCA 76
S207 rs2288746 A,G 2:240787229 0.52/0.48 TGCCAGCCACACCAGATTC CCAACGACAACATGTCCTACTCC AGCGGCCAACGGCAG AGCGGCCGACGGCAG 90
S208 rs2340917 T,C 3:14133762 0.54/0.46 GGTGCCCATCTCTGACAGC CCTGCCAATTTGGACAAAGG AGTCATTCATGGCAACAGCC AGTCATTCACGGCAACAGCC 90
S209 rs3213936 A,G 5:13913776 0.47/0.53 CCTGGTATTTAGTGGCCATGTC AACCCTCAAGACGTATTCAGTCC CCAGCCCTTCAATTGTGGAATC CCAGCCCTTCGATTGTGGAATC 74
S210 rs1801193 T,C 5:156344569 0.51/0.49 GGGCCACAGGTATACAAGGTG AAATCATGAGGAGCAGGACAAAG ATTTATGGCTGGCGGAAACG ATTTACGGCTGGCGGAAACG 79
S211 rs2274514 C,T 6:42966762 0.51/0.49 CCCACCCATCTACATCCATTTC GCACCAGGATCAAGAACTCAGG CGCCTTTCCGGTGCCCA CGCCTTTCTGGTGCCCA 79
S212 rs592121 A,G 6:70274733 0.52/0.48 GCAATTAATGCCAGATGGCTAAC TAGGGATTAACAGGACCTGATGG TGTCCCTTTGACCCAATGGAG TGTCCCTTTGGCCCAATGGAG 84
S213 rs2214326 G,A 7:21816533 0.52/0.48 TCCATGTTGACGGATGATGC CATTCTGTCACTGGGCAGTCC CAATTGCCGCCTGGAATAACG CAATTGCCACCTGGAATAACG 66
S214 rs2293979 G,A 8:132625413 0.51/0.49 TTCCAAGTCATCTTCACTGTTGTC CCTCTTTAGAGAGCAAAGACCACC TGTTCCTCTGTGTCTGGTGCCT TGTTCCTCTATGTCTGGTGCCT 89
S217 rs573455 A,G 11:117397168 0.54/0.46 TAGCCCTCCGTAGTGCCAAG ATGCTGCTGGGCAGCTTTC TTCCTTGTGCAGCAGACACGC TTCCTTGTGCGGCAGACACGC 89
S218 rs1044129 A,G 15:33866065 0.46/0.54 GGAGCTGCTCTGTTTAGGTGAATC GACCCTGGAGGTATTGGTACG CCTCAAATACAATGAAGTGCCCA CCTCAAATACAGTGAAGTGCCCA 85
S219 rs16957091 T,G 15:42725228 0.54/0.46 ATCTCCATCCGTCCCATCAG CTCGGTGTGTTTTGCAGTGG CCACCAGCTCCCGTAGCAAG CCACCAGCTCCCGGAGCAAG 82
S220 rs2684788 C,T 15:98961208 0.51/0.49 CAGGGTTTTGTTCTTCCACACTG CCGGTAGGTATGTGCACGAG CCCTTGGAATAACGGCCTCTCC CCCTTGGAATAATGGCCTCTCC 74
S221 rs17715450 C,A 16:68695882 0.53/0.47 ACCAACCATCATCCCGACAC AAGTTGCCGATTTCATCTGG ACCGTCCTCGGCCAGCCA ACCGTCCTAGGCCAGCCA 66
S223 rs2285479 G,A 17:10632701 0.53/0.47 CCTCTTCAGCTGCTCGATCTC CCGAATCCAGCTTGAATTGAC ATCCTTCTCGGCGATCTTTCTATCA ATCCTTCTCGGCAATCTTTCTATCA 88
S226 rs2229080 C,G 18:52906232 0.52/0.48 TCTTGCCCTCTGGAGCATTG TGGCTGGATTTCGAGCTGAG AGATCAGCCGACTCCAACCG AGATCAGCGGACTCCAACCG 84
S227 rs363050 G,A 20:10253609 0.50/0.50 TGGGAGGACTCTACATGCTCAGG TTGCTGAATGGGACCCTTG TGTGAATGAGTGGTCGGGCAG TGTGAATGAGTGATCGGGCAG 89

Assays S43–S110 are taken from Beck et al. [37]; assays S201–S227 are own design. In probes A and B, the SNPs are indicated by bold.

We investigated the LOD using dilutions of cfDNA, and the lowest DNA concentrations studied were easily detected by the ddPCR method. Thus, we demonstrated a LOD of 3 copies/reaction equivalent to a fraction of 0.002%, which would theoretically be equivalent to 6 copies per mL plasma in our setup using DNA extraction from 4mL plasma. Excellent linearity was demonstrated with high correlation between expected and measured absolute values (Pearson’s r = 0.997 [95%CI = 0.989–0.999]), Fig 1A. Similar, excellent linearity was shown for fractions of mimicking dd-cfDNA (Pearson’s r = 0.996 [95%CI = 0.986–0.999]), Fig 1B.

Fig 1. Linearity.

Fig 1

(A) Showing measured absolute values for DNA concentrations ranging from 0.15 to 400 copies/μL (n = 13). (B) Showing measured fraction for the same values (n = 13). Lines represent identical values. For best view of data points, data are shown on log10 scales. Correlation between measured and expected absolute values: Pearson’s r = 0.997 (95%CI = 0.989–0.999). Correlation between measured and expected fractions: Pearson’s r = 0.996 (95%CI = 0.986–0.999).

We then investigated quantitative capabilities in spike-in experiments, designated Spike 1–5. In Spike 1–2, we examined a repeated detection of a 0.5% fraction, Fig 2. A similar detection of 0.5% was observed in all three dilutions with different absolute values ranging from 100–300 copies/reaction (0.52%, 0.50%; and 0.45%, respectively, in Spike 1); there were no statistically significant differences between the different 0.5% measurements, except from the difference between 100 and 300 copies/reaction in Spike 1 (p = 0.0469). In Spike 1, CV was 10.9%, 9.3%, and 9.1% for 100–300 copies/reaction, respectively. In Spike 2, the detection was 0.50%, 0.50%; and 0.51%, respectively; CV was 13.6%, 7.4%, 7.7%, respectively.

Fig 2. Measurement of 0.5% cfDNA.

Fig 2

Measurements shown of 0.5% mimicking dd-cfDNA, as constituted by different absolute values of 100, 200, and 300 copies per reaction spiked into backgrounds of 20,000; 30,000; and 60,000 copies per reaction, respectively. Spike 1 represents experiments with probe A, and Spike 2 represents experiments with probe B. Measurements shown as mean fractions. Error bars represent the 95% confidence interval. Dashed line represents 0.5%.

In Spike 3–5, we then investigated a repeated detection of lower DNA concentrations to determine LOQ, and we studied the different fractions of mimicking dd-cfDNA to determine the lowest detectable percentage-point increase between low levels of mimicking dd-cfDNA. First, we compared the expected concentration of the mimicking dd-cfDNA with the measured concentration to evaluate our dilutions as well as the measurement precision in the lower part of the ddPCR method’s dynamic range. The results demonstrated excellent agreement between expected and measured values over the range of DNA concentrations tested, Fig 3, with Pearson’s r = 0.9987 for Spike 3, r = 0.9998 for Spike 4, and r = 0.9998 for Spike 5.

Fig 3. Linearity of Spike 3–5.

Fig 3

Expected concentration as a function of the measured concentration, both measured in copies/reaction, of three individual experiments, Spike 3–5 (A–C). The diagonal line indicates equal concentrations of expected and measured mimicking dd-cfDNA concentrations. Each dot represents a measured cfDNA concentration. Pearson’s r = 0.9987 (95%CI = 0.938–1) for Spike 3, r = 0.9998 (95%CI = 0.990–1) for Spike 4, and r = 0.9998 (95%CI = 0.992–1) for Spike 5.

The expected and measured DNA concentrations are presented in Table 2, along with CV values and fractions for each experiment. Overall, the measured concentration of the mimicking dd-cfDNA ranged from approximately 10 to 270 copies/reaction in a background ranging from 47,120 to 93,920 copies/reaction. Fractions ranged from 0.02 to 0.37%.

Table 2. Results from spike-in experiments 3–5.

Experiment cfDNA Expected spike-in copies/reactiona Measured copies/reaction [mean] CV% of mean Fraction [%] CV% of fraction
Spike 3 Background 94,000 93,920 2.6 NAb NA
Spike 12.5 19 32.2 0.02 32.7
Spike 25 27 33.8 0.03 33.7
Spike 50 56 16.5 0.06 17.0
Spike 100 106 13.2 0.11 12.4
Spike 4 Background 47,000 47,120 2.0 NA NA
Spike 13 10 34.1 0.02 33.2
Spike 26 24 29.7 0.05 29.0
Spike 104 89 15.3 0.19 15.6
Spike 208 173 8.9 0.37 8.6
Spike 5 Background 94,000 93,540 3.8 NA NA
Spike 36 48 17.8 0.05 17.4
Spike 72 79 14.8 0.09 15.0
Spike 144 146 10.1 0.16 10.4
Spike 287 270 9.3 0.27 9.7

aExpected spike-in copies/reaction are presented according to recalculation based on the estimated mean concentration of the spike-in material on the ddPCR plate per experiment.

bNA = not applicable

Across Spike 3–5, LOQ with CV<25% of the mimicking dd-cfDNA was estimated to be between 24 and 48 copies/reaction (Spike 3: LOQ = 27–56; Spike 4: LOQ = 24–89; and Spike 5: LOQ<48 copies/reaction). Compiling the data from Spike 3–5, we further estimated the LOQ to be 35 copies/reaction, Fig 4, which was equivalent to 66 copies per mL plasma in our setup using DNA extraction from 4mL plasma.

Fig 4. Estimation of LOQ.

Fig 4

Non-linear curve fitting of data points from Table 2 from Spike 3–5. Goodness of fit R2 = 0.935; fit indicated by line and 95% confidence interval indicated by dotted lines. According to curve equation, a CV<25% was reached at 35 copies per reaction, indicated on the figure by dashed lines.

Lastly, we calculated a 95% confidence interval of the fractions for Spike 3–5, Fig 5. This was used to determine the lowest detectable increase in percentage points for each experiment. All three experiments independently showed that a non-detectable increase at 0.03 percentage points (0.03, 0.031, and 0.034, respectively, for Spike 3–5). The lowest detectable increase in percentage points was 0.04 (0.04, 0.14, and 0.07, respectively, for Spike 3–5), varying because different values were tested. In absolute values, no distinction was possible in measurements with a difference of 8–31 copies/reaction (due to overlapping 95%CIs), whereas a distinction was possible with data where the difference between two points was at least 37 copies/reaction (S1 Fig).

Fig 5. Estimation of minimal detectable percentage point for Spike 3–5.

Fig 5

Three independent experiments, Spike 3–5 (A–C). The x-axis of each plot shows the expected cfDNA concentration of the mimicking dd-cfDNA in copies/reaction, while the y-axis shows the calculated fraction of the mimicking dd-cfDNA in percentage. Each dot represents the mean value of the fraction for a measured concentration (data value labeled), while the error bars represent the 95% confidence interval of the mean fraction. Minimal detectable percentage points were estimated between non-overlapping confidence intervals (Spike 1: 0.06%–0.02% = 0.04%; Spike 2: 0.19%–0.05% = 0.14%; Spike 3: 0.16%–0.09% = 0.07%).

The number of copies per reaction required to identify a certain % increase in the dd-cfDNA fraction was identified theoretically and compared with LOD and LOQ (Fig 6).

Fig 6. Percentage increase compared to LOD and LOQ.

Fig 6

Theoretically estimated minimal copy numbers required to detect a certain percentage increase of dd-cfDNA fraction (50%, 100% and 150%), compared to LOD and LOQ (represented by dashed lines).

Discussion

We developed a ddPCR-based setup for analyzing dd-cfDNA as a noninvasive marker of organ damage for monitoring organ health in transplanted patients. We tested 40 SNP assays and investigated different essential methodological performance parameters. The ddPCR-based cfDNA quantification method demonstrated high precision, as assessed by comparing expected and measured DNA concentrations. We demonstrated high analytical sensitivity with a LOD of 3 copies/reaction, observed at a fraction of 0.002%. This was the lowest DNA concentration that we tested, and it is likely that the actual LOD is lower, presumably 1 copy/reaction (according to dynamical range of ddPCR and general experience with PCR detection of low levels of DNA [42]). LOQ was determined to be 35 copies/reaction, as defined by a CV of less than 25%.

In dd-cfDNA testing, low dd-cfDNA levels are anticipated; therefore, we decided to study the analytical performance of the method at low absolute levels and at small fractions of cfDNA. We thus studied the detection of fractions of 0.5% and lower. A clear detection of 0.5% was observed in initial studies with acceptable CVs of 7–14%. When examining lower fractions of 0.02–0.37%, we were able to distinguish a difference of 0.04 percentage points as determined by non-overlapping 95% confidence intervals, and we demonstrated that such distinction was only possible with a difference above 0.03 percentage points. These data translated to a difference between two points of >31 copies/reaction, slightly lower than the LOQ of 35 copies/reaction. Further, the LOQ in percentage fraction was estimated to approximately 0.038%.

We based our ddPCR setup on the setup developed by Beck and colleagues [9, 10, 37]. Our setup had some key differences. First, we applied strict in silico criteria to the SNP assays, which excluded several of the assays adopted from Beck et al. In our own assay design, we aimed for short amplicons, because short amplicons increase the likelihood for successful amplification of the highly fragmented cfDNA, thereby increasing assay sensitivity [8], which is a generally known issue in cfDNA testing [43]. In addition, we used a different preamplification system using a targeted approach rather than a universal approach with whole-genome-amplification [9].

Overall, the methodological performance of our ddPCR setup was acceptable and in line with reports from other validation studies. Beck and colleagues reported a LOD estimated at about 10 copies per mL plasma corresponding to a fraction of 0.15% dd-cfDNA [10]. This is in line with our LOD being equivalent to 6 extractable copies per mL plasma, although our fraction was 0.002%. Beck et al. also showed a repeated testing of samples spiked with 2% DNA yielding CVs of 4–14% [9]. This is also in line with our CVs of 9–11% at a fraction of 0.5%.

Also using ddPCR, Magnussen and colleagues presented highly sensitive and precise measurements of spiked samples mimicking dd-cfDNA from 0.005% to 1% [31]. They reported a LOD of 0.055% [31].

The commercially available NGS-based AlloSure test system reported a LOD of 0.16% and a LOQ of 0.22% in their original validation study (LOQ set at CV<20%) [44]. Later, new performance data were presented for an updated version, AlloSure 3.0, where the LOD now was 0.12%, and with reduced CVs, reported to be well below 10% throughout the range for decision making [45]. Despite higher LODs and LOQ from AlloSure when compared as fractions, the LOD data from AlloSure are comparable to our data when recalculated to estimates of absolute values. The CVs from AlloSure are lower, however, which is likely due to the higher number of SNP targets used in their system. The reportable range is from 0.12% to 16% [45], in which the upper limit is due to the technical and statistical approach for calling SNPs, likely interfering with heterozygosity in the event of high dd-cfDNA levels [8].

Using spike experiments with synthetic DNA (gBlocks), Kokelj et al. analyzed fractions down to 0.1% using ddPCR [39]. Their LOQ was 10–20 copies/reaction (defined by a CV<20%) [39]. In our study we estimated the LOQ to approximately 35 copies/reaction, with a CV<25% (we chose an acceptable CV at <25%, as recommended elsewhere [46, 47]). These different LOQs may reflect the difference in test material, where we used cfDNA from plasma (assumed to be highly similar to dd-cfDNA concerning fragmentation and other characteristics). We did detect a fraction of 0.1% at a CV of 12.4%, and we managed to analyze fractions as low as 0.052% without having a CV>20%.

Importantly, a fraction is determined by two underlying values. Consequently, changes in hidden absolute cfDNA values may impact the dd-cfDNA fraction measurement, so that it is not always representative of the underlying events which can lead to misinterpretations or a less accurate picture of the clinical status of the organ. This was recently demonstrated with ddPCR testing of lung transplantations, where a decrease in dd-cfDNA fraction gave the wrong impression that the level of dd-cfDNA was decreasing whereas absolute cfDNA measurements provided the actual insight into the organ status [31].

The LOQ reflects the certainty of the quantitative measurement. However, for the purpose of identifying a potential increase in dd-cfDNA fraction, absolute certainty of the quantitative measurement is not necessary. The important parameter is the capability of distinction between truly different values versus stochastic or biological variation. With our ddPCR-based method, we found a remarkable capability to identify an increase of only 0.04 percentage points, observed at small fractions. An important aspect, relevant for long-term monitoring of patients, is how a specific increase in percentage relates to the indication of organ damage or risk of later rejection (as opposed to using a threshold). For example, as with a 100% increase, where a fraction would increase, for example, from 1% to 2%. We estimated that an increase of 100% was identifiable around the same value as our absolute LOQ, whereas an increase in 50% was identifiable only when absolute cfDNA copies were close to 100 copies per reaction. An increase of 150% would be easy to identify. Despite that these values are based on theoretical calculations they do indicate sufficient capabilities for such a way forward for an algorithm to judge clinical data. Interestingly, it was recently observed with kidney transplantations that an approximate 150% increase between two subsequent samples was indicative of graft injury [5]. Future clinical studies are needed to identify applicable thresholds or difference between subsequent samples—to confirm the best algorithm for indication of organ damage.

Our study had some study limitations. First, LOD and LOQ was only studied for a selected number of assays and not all assays. However, we believe that the observed data can be viewed as exemplary for all assays. Also, we studied spiked-in samples which may not comprise all the challenges and variation observed in clinical samples. However, it is not uncommon to use such mimicking samples for methodological assessments [39, 44], because the use of spike-in experiments allows for an easily controllable experiment, where cfDNA concentrations and fractions are adjustable [39]. Thus, we used these experiments to assess key analytical performance parameters of ddPCR relevant for using this method for quantitative measurement of dd-cfDNA in transplantation patients. Future studies will look at the clinical application and the clinical value of this method.

In general, the different molecular techniques for testing dd-cfDNA are highly sensitive. ddPCR offers higher precision and better analytical specificity than qPCR [35, 38]. NGS may offer higher precision due to analyzing more SNP targets than with ddPCR [44]. Compared to NGS, ddPCR is often said to have a shorter turnaround time [9, 27, 34], and to be more cost effective [34, 36], which makes ddPCR more practical for routine use [34, 38]. Importantly, ddPCR also allows for quantification of absolute values and not only fractions, which gives additional important information for patient evaluation in a clinical setting. ddPCR offers an excellent monitoring tool, providing a reliable method for repeated testing of a patient over time; once the informative SNPs are identified, any additional analysis is simple, cost efficient, and rapid. We have thus implemented a method which is ready to assist clinicians in the monitoring and management of transplantation patients, providing a noninvasive monitoring marker indicative of organ damage and thus organ health, which may contribute to prolonging organ and thus patient survival. Additional patient groups may benefit from this method. In principle, any chimeric situation may benefit from this method. Also, numerous research activities as well as different types of cellular treatment may benefit from using this method.

Conclusion

The results from this study showed that our ddPCR method is highly sensitive, precise, and allows for quantitative assessment of low levels of cfDNA. This analytical validation of 40 SNP assays showed that the method is applicable for testing and monitoring of dd-cfDNA in all transplantation patients providing a noninvasive marker for organ damage. Future studies will investigate the clinical value of dd-cfDNA testing in transplantation patients.

Supporting information

S1 Text. SNP assay design criteria.

(DOCX)

S1 Fig. Delta copies of mimicking dd-cfDNA versus percentage increase in fraction.

Delta copies of data from Spike 3–5 plotted against percentage increase of fraction shown to mark a difference (dashed line of 37 copies per reaction) between distinguishable and non-distinguishable data.

(TIF)

Acknowledgments

We thank Birgitte Bundgaard and her staff in the Laboratory of Blood Genetics, at the Department of Clinical Immunology, Copenhagen University Hospital.

Data Availability

All relevant data are within the paper and its Supporting information files.

Funding Statement

The authors have no competing or financial interests regarding the submitted manuscript. FBC received funding from The Toyota-Foundation (KJ/BG-9881 H), The Blood Donors’ Research Foundation (J.no. FF 4 2021/01) (www.blodonor.dk/fonde), and Doctor Sofus Carl Emil Friis and Wife Olga Doris Friis’ Foundation (11062020). The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Gielis EM, Ledeganck KJ, De Winter BY, et al. Cell-Free DNA: An Upcoming Biomarker in Transplantation. Am J Transplant. 2015;15:2541–51. doi: 10.1111/ajt.13387 [DOI] [PubMed] [Google Scholar]
  • 2.Snyder T, Khush K, Valantine H, Quake S. Universal noninvasive detection of solid organ transplant rejection. Proceedings of the National Academy of Sciences. 2011;108:6229–34. doi: 10.1073/pnas.1013924108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Knight SR, Thorne A, Lo Faro ML. Donor-specific Cell-free DNA as a Biomarker in Solid Organ Transplantation. A Systematic Review. Transplantation. 2019;103:273–83. doi: 10.1097/TP.0000000000002482 [DOI] [PubMed] [Google Scholar]
  • 4.Eikmans M, Gielis EM, Ledeganck KJ, Yang J, Abramowicz D, Claas FFJ. Non-invasive Biomarkers of Acute Rejection in Kidney Transplantation: Novel Targets and Strategies. Front Med (Lausanne). 2019;5:358. doi: 10.3389/fmed.2018.00358 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bu L, Gupta G, Pai A, et al. Clinical outcomes from the Assessing Donor-derived cell-free DNA Monitoring Insights of kidney Allografts with Longitudinal surveillance (ADMIRAL) study. Kidney Int. 2022;101:793–803. doi: 10.1016/j.kint.2021.11.034 [DOI] [PubMed] [Google Scholar]
  • 6.Kataria A, Kumar D, Gupta G. Donor-derived Cell-free DNA in Solid-organ Transplant Diagnostics: Indications, Limitations, and Future Directions. Transplantation. 2021;105:1203–11. doi: 10.1097/TP.0000000000003651 [DOI] [PubMed] [Google Scholar]
  • 7.Lo YM, Tein MS, Pang CC, Yeung CK, Tong KL, Hjelm NM. Presence of donor-specific DNA in plasma of kidney and liver-transplant recipients. Lancet. 1998;351:1329–30. doi: 10.1016/s0140-6736(05)79055-3 [DOI] [PubMed] [Google Scholar]
  • 8.Oellerich M, Sherwood K, Keown P, et al. Liquid biopsies: donor-derived cell-free DNA for the detection of kidney allograft injury. Nat Rev Nephrol. 2021;17:591–603. doi: 10.1038/s41581-021-00428-0 [DOI] [PubMed] [Google Scholar]
  • 9.Beck J, Bierau S, Balzer S, et al. Digital Droplet PCR for Rapid Quantification of Donor DNA in the Circulation of Transplant Recipients as a Potential Universal Biomarker of Graft Injury. Clinical Chemistry. 2013;59:1732–41. doi: 10.1373/clinchem.2013.210328 [DOI] [PubMed] [Google Scholar]
  • 10.Beck J, Oellerich M, Schulz U, et al. Donor-Derived Cell-Free DNA Is a Novel Universal Biomarker for Allograft Rejection in Solid Organ Transplantation. Transplantation Proceedings. 2015;47:2400–03. doi: 10.1016/j.transproceed.2015.08.035 [DOI] [PubMed] [Google Scholar]
  • 11.Schütz E, Fischer A, Beck J, Harden M, Koch M, Wuensch T, et al. Graft-derived cell-free DNA, a noninvasive early rejection and graft damage marker in liver transplantation: A prospective, observational, multicenter cohort study. PLOS Medicine. 2017;14(4):e1002286. doi: 10.1371/journal.pmed.1002286 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Sherwood K, Weimer E. Characteristics, properties, and potential applications of circulating cell-free DNA in clinical diagnostics: a focus on transplantation. Journal of Immunological Methods. 2018;463:27–38. doi: 10.1016/j.jim.2018.09.011 [DOI] [PubMed] [Google Scholar]
  • 13.De Vlaminck I, Valantine HA, Snyder TM, Strehl C, Cohen G, Luikart H, et al. Circulating cell-free DNA enables noninvasive diagnosis of heart transplant rejection. Sci Transl Med. 2014;6:241ra77:1–8. doi: 10.1126/scitranslmed.3007803 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Hidestrand M, Tomita-Mitchell A, Hidestrand PM, Oliphant A, Goetsch M, Stamm K, et al. Highly sensitive noninvasive cardiac transplant rejection monitoring using targeted quantification of donor-specific cell-free deoxyribonucleic acid. J Am Coll Cardiol. 2014;63:1224–1226. doi: 10.1016/j.jacc.2013.09.029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Agbor-Enoh S, Tunc I, De Vlaminck I, Fideli U, Davis A, Cuttin K, et al. Applying rigor and reproducibility standards to assay donor-derived cell-free DNA as a non-invasive method for detection of acute rejection and graft injury after heart transplantation. J Heart Lung Transplant. 2017;36:1004–1012. doi: 10.1016/j.healun.2017.05.026 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Richmond ME, Zangwill SD, Kindel SJ, Deshpande SR, Schroder JN, Bichell DP, et al. Donor fraction cell-free DNA and rejection in adult and pediatric heart transplantation. J Heart Lung Transplant. 2020;39:454–463. doi: 10.1016/j.healun.2019.11.015 [DOI] [PubMed] [Google Scholar]
  • 17.Khush KK, Patel J, Pinney S, Kao A, Alharethi R, DePasquale E, et al. Noninvasive detection of graft injury after heart transplant using donor-derived cell-free DNA: A prospective multicenter study. Am J Transplant. 2019;19:2889–2899. doi: 10.1111/ajt.15339 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Bieńkowski M, Pęksa R, Popęda M, Kołaczkowska M, Frankiewicz A, Żaczek AJ, et al. Liquid biopsy for minimally invasive heart transplant monitoring: a pilot study. J Clin Pathol. 2020;73:507–510. doi: 10.1136/jclinpath-2019-205926 [DOI] [PubMed] [Google Scholar]
  • 19.Macher HC, García-Fernández N, Adsuar-Gómez A, Porras-López M, González-Calle A, Noval-Padillo J, et al. Donor-specific circulating cell free DNA as a noninvasive biomarker of graft injury in heart transplantation. Clin Chim Acta. 2019;495:590–597. doi: 10.1016/j.cca.2019.06.004 [DOI] [PubMed] [Google Scholar]
  • 20.Sharma D, Subramaniam G, Sharma N, Sharma P. Cell-free DNA in the surveillance of heart transplant rejection. Indian J Thorac Cardiovasc Surg. 2021;37:257–264. doi: 10.1007/s12055-020-01130-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Agbor-Enoh S, Shah P, Tunc I, Hsu S, Russell S, Feller E, et al. Cell-Free DNA to Detect Heart Allograft Acute Rejection. Circulation. 2021;143:1184–1197. doi: 10.1161/CIRCULATIONAHA.120.049098 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Feingold B, Rose-Felker K, West SC, Zinn MD, Berman P, Moninger A, et al. Early findings after integration of donor-derived cell-free DNA into clinical care following pediatric heart transplantation. Pediatr Transplant. 2022;26:e14124:1–8. doi: 10.1111/petr.14124 [DOI] [PubMed] [Google Scholar]
  • 23.García Moreira V, Prieto García B, Baltar Martín JM, Ortega Suárez F, Alvarez FV. Cell-free DNA as a noninvasive acute rejection marker in renal transplantation. Clin Chem. 2009;55:1958–66. doi: 10.1373/clinchem.2009.129072 [DOI] [PubMed] [Google Scholar]
  • 24.Huang E, Sethi S, Peng A, Najjar R, Mirocha J, Haas M, et al. Early clinical experience using donor-derived cell-free DNA to detect rejection in kidney transplant recipients. Am J Transplant. 2019;19:1663–1670. doi: 10.1111/ajt.15289 [DOI] [PubMed] [Google Scholar]
  • 25.Sigdel TK, Archila FA, Constantin T, Prins SA, Liberto J, Damm I, et al. Optimizing Detection of Kidney Transplant Injury by Assessment of Donor-Derived Cell-Free DNA via Massively Multiplex PCR. J Clin Med. 2018;8:19. doi: 10.3390/jcm8010019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Bloom RD, Bromberg JS, Poggio ED, Bunnapradist S, Langone AJ, Sood P, et al. Cell-Free DNA and Active Rejection in Kidney Allografts. J Am Soc Nephrol. 2017;28:2221–2232. doi: 10.1681/ASN.2016091034 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Oellerich M, Shipkova M, Asendorf T, Walson PD, Schauerte V, Mettenmeyer N, et al. Absolute quantification of donor-derived cell-free DNA as a marker of rejection and graft injury in kidney transplantation: results from a prospective observational study. Am J Transplant. 2019;19:3087–99. doi: 10.1111/ajt.15416 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kant S, Brennan DC. Donor Derived Cell Free DNA in Kidney Transplantation: The Circa 2020–2021 Update. Transpl Int. 2022;35:10448. doi: 10.3389/ti.2022.10448 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Levitsky J, Kandpal M, Guo K, Kleiboeker S, Sinha R, Abecassis M. Donor-derived cell-free DNA levels predict graft injury in liver transplant recipients. Am J Transplant. 2022;22:532–540. doi: 10.1111/ajt.16835 [DOI] [PubMed] [Google Scholar]
  • 30.Agbor-Enoh S, Wang Y, Tunc I, Jang MK, Davis A, De Vlaminck I, et al. Donor-derived cell-free DNA predicts allograft failure and mortality after lung transplantation. EBioMedicine. 2019;40:41–553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Magnusson JM, Ricksten A, Dellgren G, Wasslavik C, Nordén R, Westin J, Boehmer J. Cell-free DNA as a biomarker after lung transplantation: A proof-of-concept study. Immun Inflamm Dis. 2022;10:e620:1–10. doi: 10.1002/iid3.620 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Keller M, Agbor-Enoh S. Cell-free DNA in lung transplantation: research tool or clinical workhorse? Curr Opin Organ Transplant. 2022;27:177–183. doi: 10.1097/MOT.0000000000000979 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Ventura-Aguiar P, Ramirez-Bajo MJ, Rovira J, Bañón-Maneus E, Hierro N, Lazo M, et al. Donor-derived Cell-free DNA Shows High Sensitivity for the Diagnosis of Pancreas Graft Rejection in Simultaneous Pancreas-kidney Transplantation. Transplantation. 2022;106:1690–1697. doi: 10.1097/TP.0000000000004088 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.McClure T, Goh S, Cox D, Muralidharan V, Dobrovic A, Testro A. Donor-specific cell-free DNA as a biomarker in liver transplantation: A review. World Journal of Transplantation. 2020;10:307–319. doi: 10.5500/wjt.v10.i11.307 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Stawski R, Stec-Martyna E, Chmielecki A, Nowak D, Perdas E. Current Trends in Cell-Free DNA Applications. Scoping Review of Clinical Trials. Biology (Basel). 2021;10:906. doi: 10.3390/biology10090906 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Martuszewski A, Paluszkiewicz P, Król M, Banasik M, Kepinska M. Donor-Derived Cell-Free DNA in Kidney Transplantation as a Potential Rejection Biomarker: A Systematic Literature Review. J Clin Med. 2021;10:193. doi: 10.3390/jcm10020193 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Beck J, Oellerich M, Schütz E. A Universal Droplet Digital PCR Approach for Monitoring of Graft Health After Transplantation Using a Preselected SNP Set. Methods in Molecular Biology. 2018;1768:335–348. doi: 10.1007/978-1-4939-7778-9_19 [DOI] [PubMed] [Google Scholar]
  • 38.Hindson C, Chevillet J, Briggs H, Gallichotte E, Ruf I, Hindson B et al. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nature Methods. 2013;10:1003–1005. doi: 10.1038/nmeth.2633 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Jerič Kokelj B, Štalekar M, Vencken S, Dobnik D, Kogovšek P, Stanonik M et al. Feasibility of Droplet Digital PCR Analysis of Plasma Cell-Free DNA From Kidney Transplant Patients. Frontiers in Medicine. 2021;8:748668. doi: 10.3389/fmed.2021.748668 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Boehmer J, Ricksten A, Asp J et al. Cell-Free DNA in Different Clinical Scenarios after Heart Transplantation: Shedding Light or Obscuring the Picture? The Journal of Heart and Lung Transplantation 2019;38 No 4S;Abstract 971:S385–S386. [Google Scholar]
  • 41.Andersson D, Akrap N, Svec D, Godfrey T, Kubista M, Landberg G et al. Properties of targeted preamplification in DNA and cDNA quantification. Expert Review of Molecular Diagnostics. 2015;15:1085–1100. doi: 10.1586/14737159.2015.1057124 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Clausen FB, Urhammer E, Rieneck K, Krog GR, Nielsen LK, Dziegiel MH. How to evaluate PCR assays for the detection of low-level DNA. APMIS. 2015;123:731–9. doi: 10.1111/apm.12405 [DOI] [PubMed] [Google Scholar]
  • 43.Rieneck K, Clausen FB, Bergholt T, Nørgaard LN, Dziegiel MH. Non-Invasive Fetal K Status Prediction: 7 Years of Experience. Transfus Med Hemother. 2022;49:240–249. doi: 10.1159/000521604 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Grskovic M, Hiller D, Eubank L, Sninsky J, Christopherson C, Collins J et al. Validation of a Clinical-Grade Assay to Measure Donor-Derived Cell-Free DNA in Solid Organ Transplant Recipients. The Journal of Molecular Diagnostics. 2016;18:890–902. doi: 10.1016/j.jmoldx.2016.07.003 [DOI] [PubMed] [Google Scholar]
  • 45.Wong L, Scott S, Grskovic M, Dholakia S, Woodward RN. The Evolution and Innovation of Donor-Derived Cell-Free DNA Testing in Transplantation. J Med Diagn Meth. 2020;9:302:1–5. [Google Scholar]
  • 46.Milosevic D, Mills J, Campion M, Vidal-Folch N, Voss J, Halling K et al. Applying Standard Clinical Chemistry Assay Validation to Droplet Digital PCR Quantitative Liquid Biopsy Testing. Clin Chem. 2018;64:1732–1742. doi: 10.1373/clinchem.2018.291278 [DOI] [PubMed] [Google Scholar]
  • 47.Vynck M, Vandesompele J, Thas O. Quality control of digital PCR assays and platforms. Analytical and Bioanalytical Chemistry. 2017;409:5919–5931. doi: 10.1007/s00216-017-0538-9 [DOI] [PubMed] [Google Scholar]

Decision Letter 0

Benjamin M Liu

4 Jan 2023

PONE-D-22-34954Droplet Digital PCR-based testing for donor-derived cell-free DNA in transplanted patients as noninvasive marker of allograft health: Methodological aspectsPLOS ONE

Dear Dr. Clausen,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Feb 18 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Benjamin M. Liu, MBBS, PhD, D(ABMM), MB(ASCP)

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at 

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match. 

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

3. Please include your full ethics statement in the ‘Methods’ section of your manuscript file. In your statement, please include the full name of the IRB or ethics committee who approved or waived your study, as well as whether or not you obtained informed written or verbal consent. If consent was waived for your study, please include this information in your statement as well. 

Additional Editor Comments:

Although reviewers suggested this is an technically sound study, the authors did not validate their assay in patients with organ transplantation. While analytical validation is necessary and using mimic samples is considered fine for this, clinical validation using a small number of samples from organ transplantation patients will be expected and encouraged.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors describe the application of digital droplet PCR to address the relevant clinical issue of allograft health. The technique is powerful and the methodological aspects investigated are appropriate and comprehensive. In my opinion, statistical analysis is appropriate and results presentation is clear.

I have no specific comments for the authors.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Maria Lorena Abate

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2023 Feb 24;18(2):e0282332. doi: 10.1371/journal.pone.0282332.r002

Author response to Decision Letter 0


8 Feb 2023

Response to Reviewers

I thank the editor and the reviewer for their work and positive comments regarding our manuscript. It is highly appreciated. A new and revised manuscript has been uploaded, with and without track changes as requested by the editor.

Regarding Journal Requirements:

Ad 1) I have ensured to the best of my knowledge that the manuscript meets the PLOS ONE’s style requirements, which includes a change in the manuscript reference style for supplementary information. The specific reference reading “…in supporting information S1 Text.” was changed to “…in S1 Text.” (Page 7). I hope this is now correct.

Ad 2) I have matched the information provided in the ‘Funding Information’ and ‘Financial Disclosure’. (I understand ‘Financial Disclosure’ as the comment of financial interest which is stated in the Cover Letter). Consequently, this new comment in the new Cover Letter should be viewed as the information also for Funding Disclosure’. In addition, I have provided grant numbers for each grant, as requested.

Ad 3) An ethics statement was added as the first section under Meth-ods (page 5 and 6). It reads as follows:

“This study was a quality assurance project using blood samples from healthy volunteers. Informed and written consent was obtained from all participating volunteers when blood samples were collected. According to Danish law, no ethical approval was required, because this was a quality assurance project, thus waiving the need for ethics committee approval of the study. No DNA information related to disease was examined, and only SNPs with no known clinical significance were used, thus avoiding the challenges of reporting incidental findings.”

Regarding additional Editor Comments:

On the issue of including a small validation of clinical samples, I agree that one would often expect to see an analytical validation accompanied by a clinical validation. And adding a few clinical samples might seem like a good idea and a natural step towards a clinical validation. We did exactly that in our first study on cell-free DNA, almost 20 years ago [PMID: 16231312]. However, this field is far more complicated. Thus, for a number of key reasons, as listed below, adding a small number of clinical samples will not improve our manuscript. And we therefore choose not to.

1. A true clinical validation is much larger than often realized. A clinical validation in the context of transplantation patients is complicated. Importantly, no actual clinical validation has yet been done in this field. Such validation must include a) monitoring several patients over several years just to demonstrate correlation; b) a potential threshold must be identified and tested as the indication for action and medical intervention; c) a threshold-based guidance of medical intervention must then be tested prospectively to demonstrate clinical value. We mention these important issues in our manuscript. A clinical valida-tion is thus unfeasible at this time. Adding a small validation should not be regarded as a clinical validation.

2. A small number of clinical samples is unnecessary. The only reason that you would add a number of clinical samples to a methodological study is when your mimicking material is vastly different from the clinical material. For example, several studies have used artificial DNA samples and then clinical plasma samples to see if the presented assays would work in plasma as well. We used plasma samples obtained and processed under the same clinical conditions as expected for clinical plasma samples. The cfDNA in plasma is similar. Similar in fragmentation and size. We discuss these issues in the manuscript. Thus, adding a small validation would add no real value.

3. Meticulous presentation of the methodological aspects is crucial. In transplantation, cfDNA testing is a young science, and it is difficult to convey important methodologically details to clinicians and medical scientists. Therefore, special attention to methodological aspects is needed and warrants meticulous presentation in the literature. The issue of threshold in kidney testing is a good example of confusion related to methodological aspects and insufficient validation. No precise threshold has been identified to guide medical intervention; however, many clinicians believe that such thresholds exist—even though the most recent paper clearly shows otherwise [PMID: 34953773]. We discuss these issues in the manuscript. Important methodological issues are thus not always sufficiently dealt with. Adding a small clinical validation may only add further confusion about assay readiness. By contrast, a clear separation between analytical and clinical validation is necessary and desirable in my opinion. Focus should be on the methodological aspects at first.

4. Timely publication of method is highly important. As discussed under point 1, a clinical validation requires several steps and monitoring of patients over several years. Therefore, it is important to present the method for other scientists quickly in the literature to help others start similar endeavors to save patient lives. The ddPCR assay we present is an older method (taken from the literature) that we have improved significantly. We could only re-use half of the assays from the old method and thus designed new assays. This is a very important message to get out quickly, so that other scientists will not waste unnecessary resources trying to implement the old setup. As such, the key information in our manuscript is to present reliable SNP assays which can be used for dd-cfDNA testing in plasma.

5. In addition, ethical rules restrict us from ad hoc testing a small number of samples. Ethics committee rules imply that we cannot just add a small group of samples. To test clinical samples, such samples must be part of a clinical project, in which a sufficient sample size must be calculated and accounted for, including an accepted and funded feasibility plan to obtain clinical goals. GDPR rules prevent us from just adding a small group of samples, if tested outside an approved clinical study. So, even if we agreed that this was the correct way forward, we would not be allowed to do so.

Based on these five key arguments, we abstain from adding clinical samples. Rather, we adhere to the rationale of presenting methodologically aspects timely, and then present thorough clinical data in years to come. Thus, we now focus our resources on planning differ-ent clinical projects in which we will apply this method. In the mean-time, it is important to publish this method and our meticulous description.

Thank you for your patience reading our arguments for this position.

I hope the editor will approve of these considerations.

And I thank again the reviewer for the reviewer’s highly positive feedback.

Attachment

Submitted filename: Response to Reviewers.pdf

Decision Letter 1

Benjamin M Liu

9 Feb 2023

PONE-D-22-34954R1Droplet Digital PCR-based testing for donor-derived cell-free DNA in transplanted patients as noninvasive marker of allograft health: Methodological aspectsPLOS ONE

Dear Dr. Clausen,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by March 10, 2023. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Benjamin M. Liu, MBBS, PhD, D(ABMM), MB(ASCP)

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments (if provided):

Please update the format of result section. Fig title should not be subtitle of result section. Sub-section of result should be results from one or more one figures. Please check published PLOS One and use this paper as an example to improve your manuscript: https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0159729

[Note: HTML markup is below. Please do not edit.]

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2023 Feb 24;18(2):e0282332. doi: 10.1371/journal.pone.0282332.r004

Author response to Decision Letter 1


11 Feb 2023

Response to Reviewers

I thank again the editor for the editor’s work on improving our manuscript.

Regarding Journal Requirements

I have reviewed all the references. None of them cite papers that have been retracted.

However, references 40 and 45 do not appear at PubMed.

Reference 40 is an abstract, and it is still available and can be found on google scholar.

Reference 45 is a white paper from a commercial company, and it can also be found on google scholar. As all cited papers are available, I have made no amendments to the reference list.

Regarding Additional Editor Comments

This issue with the format of the result section is based on a simple mistake.

The fig titles are not sub-sections of the result section (the result section has no sub-sections). It is the caption and legend of each figure, inserted into the text after the paragraph where the figure is first mentioned. This has been done according to the guidelines from PLOS ONE. Specifically, the guidelines state: “Figure captions are inserted immediately after the first paragraph in which the figure is cited.” Elsewhere it says: “The caption may also include a legend as needed.” Then, one can download an example (Download sample manuscript body), in which the fig caption and legend is presented exactly as I have done it in the manuscript. Thus, I have followed the journal’s instructions meticulously. I do agree that this insertion may be confusing. To alleviate the confusion, I have added the following sentence on top of each fig paragraph: “[The paragraph below is Fig 1’s caption and legend]” (writing Fig 1’s for Fig 1 and Fig 2’s for Fig 2 and so forth). In this way, one should deduce that the paragraph is not a part of the text of the result section.

I hope this is helpful, although it is a deviation from the guidelines.

Attachment

Submitted filename: Response to Reviewers.docx

Decision Letter 2

Benjamin M Liu

14 Feb 2023

Droplet Digital PCR-based testing for donor-derived cell-free DNA in transplanted patients as noninvasive marker of allograft health: Methodological aspects

PONE-D-22-34954R2

Dear Dr. Clausen,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Benjamin M. Liu, MBBS, PhD, D(ABMM), MB(ASCP)

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Acceptance letter

Benjamin M Liu

16 Feb 2023

PONE-D-22-34954R2

Droplet Digital PCR-based testing for donor-derived cell-free DNA in transplanted patients as noninvasive marker of allograft health: Methodological aspects.

Dear Dr. Clausen:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Benjamin M. Liu

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Text. SNP assay design criteria.

    (DOCX)

    S1 Fig. Delta copies of mimicking dd-cfDNA versus percentage increase in fraction.

    Delta copies of data from Spike 3–5 plotted against percentage increase of fraction shown to mark a difference (dashed line of 37 copies per reaction) between distinguishable and non-distinguishable data.

    (TIF)

    Attachment

    Submitted filename: Response to Reviewers.pdf

    Attachment

    Submitted filename: Response to Reviewers.docx

    Data Availability Statement

    All relevant data are within the paper and its Supporting information files.


    Articles from PLOS ONE are provided here courtesy of PLOS

    RESOURCES