The effects of antibiotics and illness on gut microbial composition in the fawn-footed mosaic-tailed rat (Melomys cervinipes)

Tasmin L Rymer; Neville Pillay

doi:10.1371/journal.pone.0281533

. 2023 Feb 24;18(2):e0281533. doi: 10.1371/journal.pone.0281533

The effects of antibiotics and illness on gut microbial composition in the fawn-footed mosaic-tailed rat (Melomys cervinipes)

Tasmin L Rymer ^1,^2,^3,^*, Neville Pillay ³

Editor: Mohammad Tauqeer Alam⁴

PMCID: PMC9956021 PMID: 36827295

Abstract

The gut microbiota are critical for maintaining the health and physiological function of individuals. However, illness and treatment with antibiotics can disrupt bacterial community composition, the consequences of which are largely unknown in wild animals. In this study, we described and quantified the changes in bacterial community composition in response to illness and treatment with antibiotics in a native Australian rodent, the fawn-footed mosaic-tailed rat (Melomys cervinipes). We collected faecal samples during an undiagnosed illness outbreak in a captive colony of animals, and again at least one year later, and quantified the microbiome at each time point using 16s ribosomal rRNA gene sequencing. Gut bacterial composition was quantified at different taxonomic levels, up to family. Gut bacterial composition changed between time periods, indicating that illness, treatment with antibiotics, or a combination affects bacterial communities. While some bacterial groups increased in abundance, others decreased, suggesting differential effects and possible co-adapted and synergistic interactions. Our findings provide a greater understanding of the dynamic nature of the gut microbiome of a native Australian rodent species and provides insights into the management and ethical well-being of animals kept under captive conditions.

Introduction

The mammalian intestinal tract houses an immense diversity of microbial organisms (upwards of 100 trillion [1, 2]). These organisms, collectively known as the gut microbiota, help to maintain a balance between the microecological environment and host physiological functioning, including immunity [3–5], digestion [6], nutrition [7], metabolic function [8] and defence against pathogens [9]. Thus, they are critical for the overall health [10, 11] and growth [6] of the host. Importantly, the gut microbiome is strongly influenced by multiple external factors, including diet [12], conspecifics [13] and pharmacological drugs, such as antibiotics [14].

Antibiotics can have both positive and negative effects on gut microbial composition due to direct differential species responses (e.g., Gram-positive bacteria have a permeable cell wall that generally does not restrict the penetration of antibiotics [15]) and indirect effects (e.g., interacting effects, where a reduction or elimination of one species may allow another species to thrive due to a reduction in competition for space and nutrients [16]). Consequently, changes in microbial composition impact host biological functioning. For example, the bacterial family Muribaculaceae is known to decrease in abundance with antibiotic treatment [11], and decreased abundance of Muribaculaceae is associated with anxiety and depressive-like behaviours in C57BL/6 laboratory mice [17]. In contrast, the bacterial family Akkermansiacae increases in abundance with antibiotic treatment [11]. These bacteria provide protection from intestinal inflammation [18–20] and gut barrier impairment [21], and increase in response to physiological stress to help rebalance the gut microbiota [17].

While the effects of antibiotics on the gut microbiome have principally focused on humans and laboratory animals, understanding how antibiotics impact the gut microbiome also has relevance for wildlife. Trevelline et al. [22] suggested that an understanding of the gut microbiome could have significant relevance for understanding host-microbe coevolution in wild animals, while Chong et al. [23] suggested that it could also offer important insights for conservation. There are two considerations. Firstly, increasing anthropogenic impacts place direct pressure on species through increased risk of extinction, resulting in threatened species often being confined to captivity for management purposes [23]. The captive management of animals could result in the direct administration of antibiotics in response to illness [23]. While antibiotics are essential in this context, improving the lives and health of animals [24], they would have a corresponding effect on the gut microbiome, which could be positive or negative. Secondly, antibiotic usage by humans can have collateral effects on wildlife [24]. Anthropogenic impacts may have an indirect effect on species through environmental contamination, where antibiotics enter ecosystems via waterways [25] and these effects can further be carried up food chains [26]. Investigation of the effects of antibiotics on the gut microbiome of wild species thus provide valuable information that could be useful for their management and conservation.

Fawn-footed mosaic-tailed rats (Melomys cervinipes) are medium-sized nocturnal murid rodents endemic to Australia [27]. In 2018, individuals in a captive colony of mosaic-tailed rats presented with an undiagnosed illness (results from blood tests, nasal swabs, stool samples and x-rays provided no definitive diagnosis as to the cause), giving us an opportunity to explore the effects of antibiotic treatment and illness on the gut microbiota. Symptoms included diarrhoea, lethargy, inappetence and weight loss. Consultation with a local veterinarian saw affected animals treated with Bactrim (a combination of two antibiotics: sulfamethoxazole and trimethoprim). Animals responded favourably and recovered to full health on this treatment. Healthy animals have a vigorous appetite (including active begging behaviours), bright, wide-open eyes, maintenance of a good weight (70–80 g [27]), a well-groomed pelage and demonstrate species-typical behaviours, including climbing [27].

The aim of the study was therefore to describe and quantify the changes in bacterial community composition in response to illness and treatment with antibiotics. As this was an opportunistic study, we made no a priori predictions on the direction of the effects of antibiotics on the gut microbial composition of mosaic-tailed rats; however, we did expect to observe differences in gut microbial composition because of either illness, treatment with antibiotics, or both.

Materials and methods

Ethical note

The research complied with the Australian Code for the Care and Use of Animals for Scientific Purposes [28] and the ABS/ASAB guidelines for the ethical treatment of animals [29]. The Animal Ethics Screening Committee of James Cook University approved housing and husbandry of animals (clearance number: A2539). The wild-caught individuals used in this study were originally trapped with permission from the Department of Science (permit numbers: WISP14530814 and WITK14530914). Individuals were observed daily and received behavioural enrichment (scattered seeds to stimulate foraging, platforms and sticks for climbing, and cardboard rolls and wooden blocks for chewing). Individuals were weighed every two weeks to monitor health. The onset of the illness was sudden and without obvious cause. When the first four individuals started showing symptoms, they were immediately transported to a veterinarian for assessment. Unfortunately, these four individuals died prior to receiving treatment. Twenty-three individuals that were treated with antibiotics recovered completely. No further illnesses have occurred in this colony since. No animals were euthanised for the purposes of this study. All deaths were natural and a consequence of the undiagnosed illness.

Subjects

Mosaic-tailed rats used in this study originated from a combination of wild-caught and F1 captive-born individuals (wild-caught: n = 15; captive-born: n = 14). All individuals were sexually mature and had been kept in captive conditions for at least 12 months before the study. For details on the general husbandry of mosaic-tailed rats, see Rowell & Rymer [30]. Briefly, mosaic-tailed rats were housed individually in wire-frame cages with wood shavings for bedding, and a cylindrical plastic nest box, hay, and paper towel for nesting material. Environmental enrichment items were provided. Each individual was fed ± 5 g of mixed seeds and rodent chow (Vetafarm Origins), and ± 5 g of fruits or vegetables (e.g., apple, cucumber) daily. Water was available ad libitum.

Sample collection and preparation

While 23 individuals were treated with antibiotics, faecal samples were only collected from 14 individuals (6 males and 8 females; individuals randomly selected for each sex from the available infected individuals) due to financial limitations associated with sequencing (designated TREATMENT). NP was blind to the group allocation. Faecal samples were collected fresh during routine husbandry during the period of antibiotic treatment, with the intention of collecting at least 1 g of faecal samples per individual. We also collected faecal samples from the same treated individuals (designated POST-TREATMENT) over 1 year later. Because this study was opportunistic, there were no incidences of sick individuals not receiving antibiotics and later recovering, nor were there incidences of healthy animals receiving antibiotics (i.e., no controls). Faeces were initially frozen at -20°C and later sent to the Australian Centre for Ecogenomics (ACE; https://ecogenomic.org/) sequencing laboratory for DNA extraction and sequencing.

DNA extraction protocol

DNA was extracted by ACE using the following protocols. The DNA was first extracted from 40–200 mg of the sample. The sample was bead beaten using 0.1–0.15 mm Zirconia/silica beads (BioSpec Products #11079101z) on a Powerlyser 24 homogenizer (Mo-Bio #13155) as per the manufacturer’s instructions. Thereafter, 1.2 ml of Lysis buffer (Perkin Elmer Cat No #CMG-1076) was added to each tube, and tubes were then vortexed. Thereafter, 30 μl of Proteinase K (Perkin Elmer Cat No #CMG-820) was added to each sample, samples were vortexed, and were then incubated at 70°C for 10 mins. Samples were incubated at 95°C for a further 5 mins and then processed on a MoBio Powerlyzer for 5 mins at 2000 rpm. Samples were then centrifuged for 1 min at 10000g. For each sample, 800 μl of supernatant was transferred to a deep well on a 96 well plate. DNA extraction was performed using a Chemagic™ 360 instrument (#2024–0020) following the manufacturer’s protocol for Purification for Human Faeces using 75 μl specially washed magnetic beads (Perkin Elmer Cat No #CMG-1076) and eluted into 50 μl of buffer. The DNA concentration was measured using a Qubit high sensitivity assay (ThermoFisher Scientific; Qubit 3.0 and #Q32854). This was then adjusted to a concentration of 5 ng/ul. The extracted DNA was of sufficient quality to proceed without requiring further dilution or clean up.

PCR amplification and amplicon sequencing protocols

The 16s rRNA gene encompassing the V6 to V8 regions was targeted using the 926F (5’-AAACTYAAAKGAATTGRCGG -3’) and 1392wR (5’-ACGGGCGGTGWGTRC-3’) primers [31]. These were modified to contain Illumina specific adapter sequences (926F:5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAACTYAAAKGAATTGRCGG3’ and 1392wR: 5’GTCTCGTGGGCTCGGGTCTCGTGGGCTCGGAGATGTGTAT AAGAGACAGACGGGCGGTGWGTRC3’). The small subunit ribosomal RNA of eukaryotes (18s) and prokaryotes (16s), specifically the V6, V7 and V8 regions, were amplified by the universal primer pair Univ_SSU_926F-1392wR.

The 16s library was prepared using the workflow outlined by Illumina (#15044223 Rev.B). PCR productions of ~466bp were first amplified according to the defined workflow, with an alteration in polymerase used to substitute NEBNext® Ultra™ II Q5® Mastermix (New England Biolabs #M0544) in standard PCR conditions. Agencourt AMPure XP beads (Beckman Coulter) were used to purify the resulting PCR amplicons. The Illumina Nextera XT 384 sample Index Kit A-D (Illumina FC-131-1002) was then used to index the purified DNA with unique 8 bp barcodes in standard PCR conditions with NEBNext® Ultra™ II Q5® Mastermix. Following the manufacturer’s protocol, the indexed amplicons were then pooled in equimolar concentrations and sequenced on the MiSeq Sequencing System (Illumina) using paired end sequencing with V3 300 bp chemistry.

The following control reactions were included in the amplicon library construction and sequencing: 1) Positive amplification control to monitor bias in the amplicon library construction. This was performed from a known mock community. 2) Negative amplification control to monitor contamination in library construction. This was performed from a like processed reagent control; 3) Single well empty chamber controls to monitor cross contamination within the library preparation. This was performed within processing plates; and 4) Negative index positions between runs, designated as in line controls, to monitor for run-to-run bleed through.

The passing quality control of the resulting sequences was determined as 10,000 raw reads per sample prior to data processing and passing quality control metrics in line with Illumina supplied reagent metrics of overall Q30 for 600bp reads of > 70%.

Sample analysis

ACE provides the relative abundance of different bacterial groups from the taxonomic domain through to species, where possible. We calculated the relative abundance of different bacterial taxa within each taxonomic rank (where there was sufficient data to allow statistical analyses) as a percentage of the overall abundance.

Statistical analysis

Statistical analyses were performed using RStudio (version 2022.02.3; https://www.rproject.org; R version 4.2.1, https://cran.rstudio.com). Data from all animals were used. No data points were excluded from any analyses. Thus, data in all models included all individuals (n = 14). While the total number of reads was different between time periods (during antibiotic treatment and after), a comparison of the proportions at the Domain level for Archaea and Eukarya showed no significant difference (Wilcoxon rank sum test with continuity correction: Archaea: W = 382, p = 0.192; Eukarya: W = 382, p = 0.160), suggesting that normalizing the data using proportions is appropriate [32]. The model-level significance for all models was set at α = 0.05.

Due to the extensive size of the microbiome generally, we do not report all patterns at all taxonomic levels. Rather, we systematically worked from the level of Domain, exploring only those groups accounting for more than 1% (in either the TREATMENT or the POST-TREATMENT group) of the bacterial diversity at each taxonomic level. Only significant statistics are reported in text. All remaining results are reported in S1 Table.

We first used separate principal components analyses (PCA; corrplot package [33]) at each taxonomic level (i.e., phylum, class, etc.), except Domain, incorporating the groups accounting for more than 1% of the diversity, to reduce the number of predictors, and to discern potential ecological relationships between different bacterial groups in relation to treatment. We only included a principal component (PC) in later analyses if the eigen value was above 1. We report the variance (alone and combined) for included PCs.

Thereafter, for each taxonomic level (except Domain), we tested for treatment (TREATMENT vs POST-TREATMENT), sex (male or female) and birth origin (captive-born or wild-caught) effects on the magnitude of the PCs using separate rank-based non-parametric analyses for longitudinal data (F2-LD-F1 design, nparLD package [34]). We included the random effect of individual identity as a subject in these models. These analyses offer a robust framework for non-continuous variables, small sample sizes and skewed data [34]. Only significant effects are noted in the text, but all results are presented in S1 Table. Cohen’s d effect sizes were calculated for the main effects only using the effectsize package [35] and are presented with confidence intervals in brackets.

We then ran individual rank-based non-parametric analyses for longitudinal data (F2-LD-F1 design) to determine which bacterial groups might be the main contributors of patterns of variation within each PC. We only report statistical information for bacterial groups where the factor under scrutiny was significant (e.g., when analysing phyla, if there was a treatment effect for PC1, we systematically ran models for each bacterial phylum contributing the most to that PC, and report only those models that showed a treatment effect; main text and S1 Table).

We used the phyloseq package [36] to graphically display the alpha diversity of the gut bacterial community from each time period. We also compared overall bacterial community abundance for each time period using paired t-tests. Finally, we identified species of particular pathogenic interest unique to each time period, and then used the KEGG database (Kyoto Encyclopedia of Genes and Genomes; (https://www.kegg.jp/kegg/) to explore potential functional pathways. We used FunGene (the functional gene pipeline & repository; http://fungene.cme.msu.edu/) to briefly explore some relationships with known antibiotic resistance genes [37].

Results

Domain

There was a significant effect of treatment on the abundance of Bacteria (ATS = 41.17, df = 1; p < 0.001; d = 1.52 [0.66, 2.35]). The period of antibiotic treatment resulted in a significantly lower abundance of Bacteria (mean ± SE: TREATMENT: 84.31 ± 3.05%; POST-TREATMENT: 97.82 ± 1.41%; Fig 1). There were no other significant effects or interactions on the abundance of Bacteria in the microbiome (S1 Table).

Fig 1 — For rats treated with antibiotics (TREATMENT) and more than one year later (POST-TREATMENT).

Phylum

12 bacterial phyla were common in both time periods. Of these, six phyla collectively accounted for more than 99% of the bacterial diversity, regardless of the period of time (TREATMENT: Bacteroidota: 42.23 ± 5.06%; Cyanobacteria: 2.53 ± 1.01%; Bacillota: 35.32 ± 1.72%; Fusobacteria: 1.60 ± 1.25%; Pseudomonadota: 9.13 ± 3.39%; Verrucomicrobiota: 8.52 ± 2.78%; POST-TREATMENT: Bacteroidota: 48.39 ± 2.41%; Cyanobacteria: 0.68 ± 0.16%; Bacillota: 44.68 ± 3.38%; Fusobacteriota: 0.12 ± 0.12%; Pseudomonadota: 1.94 ± 0.50%; Verrucomicrobiota: 3.54 ± 1.23%).

For bacterial phyla, the first and second PCs collectively explained 66.29% of the variance (S2 Table). For PC1 (hereafter PC_Phylum1), Verrucomicrobiota contributed the most to the variance (31%), followed by Bacteroidota (25%), Fusobacteriota (23%) and Pseudomonadota (17%). Verrucomicrobiota, Fusobacteriota and Pseudomonadota were all positively correlated with each other, and all were negatively correlated with Bacteroidota (S3 Table). For PC2 (hereafter PC_Phylum2), Bacillota contributed the most to the variance (55%), followed by the Cyanobacteria (28%). However, there was no significant correlation between these two bacterial phyla., and the abundance of Cyanobacteria was not correlated with any other phylum. The Bacillota was significantly negatively correlated with all PC_Phylum1 phyla (S3 Table).

While there was no significant treatment effect for PC_Phylum1 (ATS = 0.13; df = 1; p = 0.715; d = 0.61 [-0.15, 1.37]; Fig 2A), there was a significant treatment effect for Pseudomonadota (ATS = 18.62; df = 1; p < 0.001; d = -0.79 [-1.56, -0.02]), which showed a significantly higher abundance during the period of antibiotic treatment (Fig 2B). There was also a significant birth * treatment effect on the abundance of Pseudomonadota (ATS = 14.60; df = 1; p < 0.001), with captive-born individuals showing a significantly lower abundance of Pseudomonadota during the period following treatment with antibiotics and illness. Furthermore, there was a significant treatment effect for PC_Phylum2 (ATS = 9.51; df = 1; p = 0.002; d = -0.85 [-1.62, -0.06]; Fig 2A), which was likely associated with the abundance of Bacillota (ATS = 10.04; df = 1; p = 0.002; d = 0.93 [0.14, 1.71]). There was a significantly lower abundance of Bacillota during the period of antibiotic treatment (Fig 2B). There were no other significant effects (S1 Table).

Class

14 bacterial classes were common in both time periods. Of these, eight accounted for more than 93% of the bacterial diversity, regardless of the period of time (TREATMENT: Alphaproteobacteria: 2.05 ± 0.89%; Bacilli: 6.03 ± 1.66%; Bacteroidia: 42.23 ± 5.06%; Clostridia: 24.43 ± 1.56%; Fusobacteriia: 1.60 ± 1.25%; Gammaproteobacteria: 7.09 ± 3.44%; Negativicutes: 1.21 ± 0.35%; Verrucomicrobiae: 8.52 ± 2.78%; POST-TREATMENT: Alphaproteobacteria: 0.68 ± 0.36%; Bacilli: 11.97 ± 1.60%; Bacteroidia: 48.39 ± 2.41%; Clostridia: 32.49 ± 2.80%; Fusobacteriia: 0.12 ± 0.12%; Gammaproteobacteria: 1.26 ± 0.29%; Negativicutes: 0.18 ± 0.17%; Verrucomicrobiae: 3.54 ± 1.23%).

For bacterial classes, the first and second PCs collectively explained 60.37% of the variance (S2 Table). For PC1 (hereafter PC_Class1), Verrucomicrobiae contributed the most to the variance (31%), followed by Bacteroidia (23%), Fusobacteriia (21%) and Gammaproteobacteria (16%). Verrucomicrobiae, Fusobacteriia and Gammaproteobacteria were all positively correlated with each other, and all were negatively correlated with Bacteroidia, although the relationship was only significant between Bacteroidia and Verrucomicrobiae (S3 Table). For PC2 (hereafter PC_Class2), Negativicutes contributed the most to the variance (26%), followed by the Clostridia (20%), Alphaproteobacteria (19%) and the Bacilli (18%). The Negativicutes were significantly negatively correlated with both the Bacilli and Clostridia, which were positively correlated with each other (S3 Table). There were no other significant correlations observed (S3 Table).

There was no significant treatment effect for PC_Class1 (ATS = 0.11; df = 1; p = 0.744; Fig 3A; d = 0.55 [-0.21, 1.30]). However, there was a significant treatment effect for PC_Class2 (ATS = 10.26; df = 1; p = 0.001; d = 0.97 [0.18, 1.75]; Fig 3A), which was likely associated with the abundance of Bacilli (ATS = 6.96; df = 1; p = 0.008; d = -1.05 [-1.83, -0.25]), Clostridia (ATS = 8.49; df = 1; p = 0.004; d = 0.95 [0.16, 1.73]) and Negativicutes (ATS = 9.68; df = 1; p = 0.002; d = -1.00 [-1.78, -0.21]). There was a significantly lower abundance of Bacilli and Clostridia during the period of antibiotic treatment, whereas there was a significantly higher abundance of Negativicutes during this period (Fig 3B). There were no other significant effects (S1 Table).

Order

27 bacterial orders were common across both time periods. Of these, 10 accounted for more than 63% of the bacterial diversity, regardless of the period of time (TREATMENT: Bacteroidales: 42.22 ± 5.06%; Enterobacterales: 4.46 ± 3.36%; Erysipelotrichales: 3.65 ± 0.70%; Eubacteriales: 24.42 ± 1.56%; Fusobacteriales: 1.60 ± 1.25%; Gastranaerophilales: 2.50 ± 1.02%; Lactobacillales: 5.97 ± 1.67%; Rhodospirillales: 2.02 ± 0.89%; Selenomonadales: 1.21 ± 0.35%; Verrucomicrobiales: 8.52 ± 2.78%; POST-TREATMENT: Bacteroidales: 48.26 ± 2.42%; Enterobacterales: 0.12 ± 0.12%; Erysipelotrichales: 8.58 ± 1.49%; Eubacteriales: 0.00 ± 0.00%; Fusobacteriales: 0.12 ± 0.12%; Gastranaerophilales: 0.54 ± 0.14%; Lactobacillales: 1.62 ± 0.27%; Rhodospirillales: 0.66 ± 0.36%; Selenomonadales: 0.18 ± 0.17%; Verrucomicrobiales: 3.53 ± 1.23%).

For bacterial orders, the first four PCs collectively explained 73.40% of the variance (S2 Table). For PC1 (hereafter PC_Order1), Verrucomicrobiales contributed the most to the variance (24%), followed by Bacteroidales (20%), Fusobacteriales (19%) and Enterobacterales (14%). Verrucomicrobiales, Fusobacteriales and Enterobacterales were all positively correlated with each other, and all were negatively correlated with Bacteroidales, although the relationship was only significant between Bacteroidales and Verrucomicrobiales (S3 Table). For PC2 (hereafter PC_Order2), Selenomonadales contributed the most to the variance (24%), followed by Eubacteriales (16%), and these two bacterial orders were significantly positively correlated (S3 Table). For PC3 (hereafter PC_Order3), Gastranaerophilales contributed the most to the variance (47%), followed by Rhodospirillales (24%) and Erysipelotrichales (15%). The Gastranaerophilales were significantly positively correlated with the Erysipelotrichales, but there were no other significant correlations (S3 Table). Finally, for PC4 (hereafter PC_Order4), Lactobacillales contributed the most to the variance (63%). Interestingly, the Lactobacillales were only significantly negatively correlated with Eubacteriales (S3 Table).

There was a significant treatment effect for PC_Order1 (ATS = 21.90; df = 1; p < 0.001; Fig 4A; d = 1.09 [0.28, 1.87]), which was likely associated with the abundance of Fusobacteriales (ATS = 5.62; df = 1; p = 0.018; d = -0.45 [-1.19, 0.31]) and Enterobacterales (ATS = 5.20; df = 1; p = 0.023; d = -0.49 [-1.24, 0.27]), with both groups showing significantly higher abundance during the period of antibiotic treatment and illness (Fig 4B). There was also a significant treatment effect for PC_Order2 (ATS = 46.05; df = 1; p < 0.001; Fig 4A; d = 2.80 [1.73, 3.85]), which was likely associated with the abundance of both Eubacteriales (ATS = 210.55; df = 1; p < 0.001; d = -1.00 [-1.78, -0.21]) and Selenomonadales (ATS = 9.68; df = 1; p = 0.002; d = -1.00 [-1.78, -0.21]). There was a significantly higher abundance of both bacterial orders during the period of antibiotic treatment and illness (Fig 4B). There was also a significant sex * birth * treatment interaction for PC_Order3 (ATS = 5.84; df = 1; p = 0.016; Fig 4A), which was likely associated with a treatment effect (ATS = 10.27; df = 1; p = 0.001; d = 1.14 [0.32, 1.93]) and a birth * treatment effect (ATS = 4.70; df = 1; p = 0.030) on the abundance of Erysipelotrichales and, to a lesser extent, by a near significant sex * birth * treatment effect on the abundance of Rhodospirillales (ATS = 3.06; df = 1; p = 0.080). There was a significantly lower abundance of Erysipelotrichales during the period of antibiotic treatment and illness (Fig 4B), but captive-born individuals showed a greater shift in abundance from the period of antibiotic treatment and illness to the period post-treatment from 3.5% to 10.2% compared to wild-caught individuals, which increased from 3.8% to only 6.5%. In addition, male captive-born individuals had significantly higher abundances of Rhodospirillales during the period of treatment than following treatment, and had significantly higher abundances of Rhodospirillales than male wild-caught individuals at both time periods, and female captive-born individuals in the period following treatment. There were no other significant effects (S1 Table).

Family

49 bacterial families were common in both time periods. Of these, 17 accounted for more than 88% of the bacterial diversity, regardless of the period of time (TREATMENT: Akkermansiaceae: 8.52 ± 2.78%; Bacteroidaceae: 10.29 ± 2.59%; Clostridiales vadin BB60 group: 0.36 ± 0.34%; Enterobacteriaceae: 4.46 ± 3.36%; Erysipelotrichaceae: 3.65 ± 0.70%; Eubacteriaceae: 0.01 ± 0.00%; Fusobacteriaceae: 1.60 ± 1.25%; Lachnospiraceae: 19.42 ± 1.40%; Lactobacillaceae: 5.90 ± 1.67%; Muribaculaceae: 13.75 ± 3.55%; Peptostreptococcaceae: 2.36 ± 0.34%; Prevotellaceae: 0.37 ± 0.37%; Rhodospirillales (uncultured): 2.02 ± 0.89%; Rikenellaceae: 4.27 ± 1.49%; Oscillospiraceae: 1.85 ± 0.19%; Tannerellaceae: 13.42 ± 2.64%; Veillonellaceae: 1.21 ± 0.35%; POST-TREATMENT: Akkermansiaceae: 3.53 ± 1.23%; Bacteroidaceae: 2.24 ± 1.47%; Clostridiales vadin BB60 group: 1.31 ± 0.29%; Enterobacteriaceae: 0.12 ± 0.12%; Erysipelotrichaceae: 8.52 ± 1.51%; Eubacteriaceae: 2.43 ± 0.68%; Fusobacteriaceae: 0.12 ± 0.12%; Lachnospiraceae: 19.87 ± 1.89%; Lactobacillaceae: 1.30 ± 0.16%; Muribaculaceae: 42.00 ± 3.05%; Peptostreptococcaceae: 0.14 ± 0.12%; Prevotellaceae: 0.58 ± 0.36%; Rhodospirillales (uncultured): 0.66 ± 0.36%; Rikenellaceae: 1.08 ± 0.59%; Oscillospiraceae: 3.09 ± 0.51%; Tannerellaceae: 1.95 ± 0.86%; Veillonellaceae: 0.00 ± 0.00%).

For bacterial families, the first six PCs collectively explained 76.10% of the variance (S2 Table). For PC1 (hereafter PC_Family1), Peptostreptococcaceae contributed the most to the variance (16%), followed by Muribaculaceae (14%), Tannerellaceae (12%), Rikenellaceae (8%) and Eubacteriaceae (8%). Peptostreptococcaceae, Tannerellaceae and Rikenellaceae were all significantly positively correlated with each other, and all were negatively correlated with Muribaculaceae and Eubacteriaceae, while Muribaculaceae and Eubacteriaceae were positively correlated with each other (S3 Table). For PC2 (hereafter PC_Family2), Fusobacteriaceae contributed the most to the variance (27%), followed by Akkermansiaceae (24%) and Clostridiales vadin BB60 group (13%). Fusobacteriaceae was significantly positively correlated with Akkermansiaceae, and neither were correlated with Clostridiales vadin BB60 group (S3 Table). For PC3 (hereafter PC_Family3), Lachnospiraceae contributed the most to the variance (31%), followed by Prevotellaceae (23%). They were not significantly correlated with each other (S3 Table).

For PC4 (hereafter PC_Family4), Rhodospirillales (uncultured) contributed the most to the variance (22%), followed by Oscillospiraceae (17%). Although these two families were negatively correlated, this was not significant (S3 Table). For PC5 (hereafter PC_Family5), Enterobacteriaceae contributed the most to the variance (25%), followed by Erysipelotrichaceae (16%), Veillonellaceae (15%) and Bacteroidaceae (10%). Enterobacteriaceae and Erysipelotrichaceae were significantly negatively correlated, while Veillonellaceae and Bacteroidaceae were significantly positively correlated (S3 Table) Finally, for PC6 (hereafter PC_Family6), Lactobacillaceae contributed the most to the variance (61%).

There was a significant treatment effect for PC_Family1 (ATS = 34.41; df = 1; p < 0.001; d = 2.48 [1.46, 3.46]; Fig 5A), which was likely associated with the abundance of Eubacteriaceae (ATS = 58.76; df = 1; p < 0.001; d = 1.35 [0.52, 2.17]), Muribaculaceae (ATS = 48.02; df = 1; p < 0.001; d = 2.28 [1.30, 3.23]), Peptostreptococcaceae (ATS = 39.04; df = 1; p < 0.001; d = -2.31 [-3.26, -1.33]) and Tannerellaceae (ATS = 19.17; df = 1; p < 0.001; d = -1.56 [-2.40, -0.70]) with Eubacteriaceae and Muribaculaceae showing significantly higher abundances in the period following treatment with antibiotics and illness, and Peptostreptococcaceae and Tannerellaceae showing significantly higher abundances during the period of antibiotic treatment and illness (Fig 5B). There was also a significant treatment effect for PC_Family4 (ATS = 4.36; df = 1; p = 0.037; Fig 5A; d = -0.49 [-1.24, 0.27]), which was likely associated with the abundance of Oscillospiraceae (ATS = 9.93; df = 1; p = 0.002; d = 0.86 [0.08, 1.63]), with a higher abundance being observed during the period following treatment with antibiotics and illness (Fig 5B). There were no significant treatment effects for the remaining families (S1 Table).

There was a significant sex effect for PC_Family1 (ATS = 4.00; df = 1; p = 0.046; d = -0.42 [-1.17, 0.35]), which was likely associated with sex effects for Muribaculaceae (ATS = 4.29; df = 1; p = 0.038; d = -0.42 [-1.18, 0.34]), Peptostreptococcaceae (ATS = 6.94; df = 1; p = 008; d = 0.46 [-0.30, 1.22]) and Rikenellaceae (ATS = 15.25; df = 1; p < 0.001; d = -0.75 [-1.51, 0.02]), with males having a significantly higher abundance of Muribaculaceae than females, but females having a significantly higher abundance of both Peptostreptococcaceae and Rikenellaceae. There was also a significant sex effect for PC_Family2 (ATS = 6.12; df = 1; p = 0.013; d = 0.16 [-0.58, 0.90]), although which family was driving this sex effect for this PC is not clear. There was also a significant sex * birth * treatment interaction for PC_Family4 (ATS = 4.18; df = 1; p = 0.041), which was likely associated with a treatment effect observed for Oscillospiraceae, and a near significant sex * birth * treatment effect for Rhodospirillales (uncultured) (ATS = 3.06; df = 1; p = 0.080). Wild-caught females and captive-born males showed a greater abundance of Rhodospirillales (uncultured) during the period of antibiotic treatment and illness, while the lowest abundance of Rhodospirillales (uncultured) was observed in wild-caught males during treatment and captive-born males following treatment (0.26% for each). There were no other significant effects (S1 Table).

Bacterial community diversity and species of interest

Mean observed overall abundance was significantly higher for the period following treatment with antibiotics and illness (t₁₃ = -16.21, p < 0.001; Fig 6). All alpha diversity indices calculated were greater for the period following treatment with antibiotics and illness (Fig 6).

Fig 6 — For rats treated with antibiotics (TREATMENT) and more than one year later (POST-TREATMENT).

Two bacterial species from Class Gammaproteobacteria, namely Pseudomonas aeruginosa (Family Pseudomonadaceae) and Stenotrophomonas maltophilia (Family Xanthomonadaceae), were identified from faecal samples collected during treatment with antibiotics and illness, but not from samples taken a year later. Using KEGG, three biological pathways for Pseudomonas aeruginosa were identified (biofilm formation, exopolysaccharide biosynthesis and quorum sensing), but no pathways were identified for Stenotrophomonas maltophilia. One bacterial species from Phylum Bacillota, namely Clostridium perfringens (Family Clostridiaceae), one bacterial species from Phylum Pseudomonadota, namely Haemophilus influenzae (Family Pasteurellaceae), and one bacterial species from Phylum Actinomycetota, namely Nocardiopsis dassonvillei (Family Nocardiopsaceae), were identified from faecal samples collected more than a year following treatment with antibiotics and illness, but not from samples taken during the illness itself. However, as both Haemophilus influenzae and Nocardiopsis dassonvillei were detected in only single, separate individual mosaic-tailed rats, their presence was unlikely a response to this illness. Using KEGG, one biological pathway for quorum sensing was identified for Clostridium perfringens. Finally, Clostridioides difficile (Family Peptostreptococcaceae) was present at both time periods, but at significantly higher abundance during the period of treatment with antibiotics and illness (V = 91, p = 0.013). No pathways were identified for C. difficile in the KEGG database. Several antibiotic resistance genes (FunGene database), including arna, beta_intI1 and vante were associated with all 6 bacterial species, while some in the aac2i family (e.g., aac2i and aac2ib) were only common to P. aeruginosa and Stenotrophomonas maltophilia. Not all associations are noted here.

Discussion

In this study, we explored the effects of antibiotic treatment and illness on the gut microbiota of fawn-footed mosaic-tailed rats at different taxonomic levels. Because this study was opportunistic, there were no incidences of sick individuals not receiving antibiotics and later recovering, nor were there incidences of healthy animals receiving antibiotics. Therefore, the results cannot be isolated specifically to the effects of antibiotics alone, the effects of illness alone, or a combination of antibiotics and illness. Furthermore, we cannot rule out potential contamination effects due to opportunistic sampling and analysis through an external laboratory [38]. As a result, we discuss the results with a broader view to possible effects, noting that future studies will be required to clearly untangle these effects.

At the level of the domain, there was a lower abundance of Bacteria during the period of illness and treatment with antibiotics. This is not surprising, as antibiotics are commonly used to eliminate or reduce the virulence of harmful bacteria that have accumulated in the body [39]. While some antibiotics are fairly specific to their target bacteria, many antibiotics prescribed are broad-spectrum, having the capacity to affect both harmful and beneficial bacteria [40]. Furthermore, symptoms of illness, such as diarrhoea, are also known to purge the gut of microbiota [41].

The Bacteroidota and Bacillota dominated the bacterial diversity, regardless of the period of time. This is consistent with other mammals (e.g., redfronted lemurs (Eulemur rufifrons) [42]; koalas (Phascolarctos cinereus) [23]). The positive correlation between Verrucomicrobiota, Fusobacteriota and Pseudomonadota, and the increased abundance of these bacterial phyla during the period of illness and treatment with antibiotics, suggest possible direct interactions between bacterial phyla. Increased abundance of Pseudomonadota during the period of illness and treatment with antibiotics is thought to arise due to increasing epithelial oxygenation, disrupting anaerobiosis and leading to an expansion of facultative Pseudomonadota [43]. Thus, Pseudomonadota are thought to be good signatures of illness [44], signalling the risk of infection and inflammatory response [45] and a bloom in Pseudomonadota reflects gut dysbiosis [46]. Dramatic colonisation of the gut microbiota by Verrucomicrobiota following antibiotic treatment is also known [47, 48]. Because of the important role of Verrucomicrobiota in glucose homeostasis [49], perhaps an increase in abundance of bacteria in this phylum in response to Pseudomonadotal blooms could reflect an attempt by the host to restore gut dysbiosis. Furthermore, we also found that there was a lower abundance of Bacillota during the period of illness and treatment with antibiotics, consistent with Xavier [50]. Importantly, the negative correlation between Bacillota and Bacteroidia is typical of the responses of these two phyla to antibiotic treatment [40], and further demonstrates how the ratio of Bacillota to Bacteroidia (known as the F/B ratio) is indicative of gut dysbiosis, particularly with relevance to inflammatory bowel disease [51].

The Bacteroidia and Clostridia dominated the bacterial classes, regardless of the period of time. This is consistent with studies by Kim et al. [52], Pajarillo et al. [53] and Dong et al. [54]. The decreased abundance of Bacilli and Clostridia in the guts of mosaic-tailed rats during the period of illness and treatment with antibiotics is likely reflective of the negative state of the animals at the time. Ulcerative colitis is an inflammatory bowel disease, and a decrease in the abundance of Bacilli occurs during ulcerative colitis [55]. Similarly, inflammatory bowel disease is characterised by a decreased abundance of Clostridia [56]. Finally, an increased abundance of Negativicutes during the period of illness and treatment with antibiotics is consistent with other studies (e.g., feedlot cattle [57]).

The majority of Negativicutes are Gram-negative, obligate anaerobes, whereas Bacilli are predominantly Gram-positive, with both anaerobic and aerobic species. Furthermore, Clostridia, while also strictly anaerobic, contain both Gram-positive and Gram-negative species. The decreased abundance of Bacilli and Clostridia is likely a consequence of purging of the gut microbiota from diarrhoea [41], consistent with symptoms presented by the illness in the colony of mosaic-tailed rats. It is also possible that the combination of sulfamethoxazole-trimethoprim is more effective against Gram-positive Bacilli and Clostridia, contributing to their decreased abundance, whereas this treatment may be less effective against Gram-negative species, such as Negativicutes. These associations warrant further investigation.

The Bacteroidales, Eubacteriales, Lactobacillales and Verrucomicrobiales dominated the bacterial orders, regardless of the period of time. This is largely consistent with Maurice et al. [58] for wild wood mice (Apodemus sylvaticus). Our findings of an increase in abundance of Fusobacteriales in response to antibiotic treatment is consistent with those for pigs [59], and a disruption to the gut microbiota, such as via infection, is known to lead to blooms of Enterobacterales in other species [60], which likely explains the increased abundance observed here. An increase in the abundance of Eubacteriales under antibiotic treatment is consistent with female BALB/c mice treated with a combination of metronidazole, ampicillin, neomycin sulphate, vancomycin, and ceftriaxone sodium [61]. Interestingly, this increased abundance is suggested to represent either a compensatory response to a reduction in bacteria belonging to the family Muribaculaceae [62], which we observed here, or that bacteria in this order, being more resistant to antibiotics [62] can flourish during these periods. However, why we found an increased abundance of Selenomonadales will require additional studies, although increased abundance of this group may be reflective of a particular diseased state (e.g., increased Selenomonadales abundance is seen for type 2 diabetes [63], but not type 1 diabetes [64]). Finally, our findings of decreased Erysipelotrichales during the period of illness and antibiotic treatment are consistent with studies on humans experiencing Crohn’s inflammatory bowel disease [65, 66], while increased Erysipelotrichales in the period following antibiotic treatment is suggestive that members of this order are highly immunogenic and can flourish post-antibiotic treatment [67, 68]. We also found that wild-caught individuals showed a slower recovery of this bacterial family over time compared to captive-born individuals. This variation in the overall abundance of Erysipelotrichales because of birth origin has also been observed in the endangered Amargosa vole (Microtus californicus scirpensis) [69]. Variation in the abundance of Erysipelotrichales, particularly Allobaculum, has been linked to ingestion of a high fibre and carbohydrate rich diet [70, 71]. However, these studies showed contrasting effects. If wild-caught mosaic-tailed rats retain some of their native microbial communities in response to the diet provided, this might explain why wild-caught and captive-born individuals differed specifically in this bacterial order.

The administration of antibiotics likely had a direct effect on the abundance of Peptostreptococcaceae, Muribaculaceae and Tannerellaceae, as a similar increase in abundance of Peptostreptococcaceae and Tannerellaceae, and decrease in abundance of Muribaculaceae, in different strains of laboratory mice, is known to occur in response to treatment with antibiotics (gentamycin sulphate and cefradine: Peptostreptococcaceae [72]; amoxicillin: Muribaculaceae [73]; Clindamycin: Tannerellaceae [74]). We also found sex-specific differences in gut microbial composition for Muribaculaceae, Peptostreptococcaceae and Rikenellaceae. A higher abundance of Muribaculaceae in males and a higher abundance of Rikenellaceae in females is consistent with studies of C57BL/6 laboratory mice [75]. Similarly, a higher abundance of Peptostreptococcaceae in females is consistent with studies on B6.129S wild-type mice [76].

A decreasing abundance of Oscillospiraceae, with a corresponding increase in Bacteroidaceae, is also consistent with a diseased state, particularly signalling the onset of inflammation [77]. Interestingly, we found a decreased abundance of Eubacteriaceae during the period of treatment with antibiotics and illness, which contrasts other studies showing the opposite pattern in humans treated with rifaximin [78] or in dogs in response to inflammatory bowel disease [79]. A decrease in abundance of this bacterial family could suggest co-adapted or synergistic interactions with Muribaculaceae, whereby effects experienced by one family affected the other. However, this remains to be tested.

Infectious agents interact with each other, and virulence can be affected by their interactions with other pathogens [80]. These mechanisms can include antagonisms or synergisms (e.g., quorum sensing [81]). Antagonisms or synergisms between different bacterial orders could explain why some bacterial groups increased in abundance while others decreased in abundance in response to the antibiotics and illness. However, targeted studies are needed to determine whether the relationships between the different groups are simply a consequence of their similar responses (e.g., both Eubacteriales and Lactobacillales increased in abundance, so they may be simply positively correlated because of this) or are the outcome of particular pathobiotic mechanisms [82].

Alpha diversity indices were lower during this period of illness and treatment with antibiotics. While diversity indices may fail in that they may not include lower abundance taxa [83], the overall abundance of bacteria was depressed during the period, suggesting that bacterial communities are compromised by illness, antibiotics, or both. During the period of illness and treatment with antibiotics, two bacterial species with pathogenic properties were identified, namely Pseudomonas aeruginosa and Stenotrophomonas maltophilia. Neither species was identified in the microbiome of mosaic-tailed rats assessed over a year later. Pseudomonas aeruginosa is an opportunistic multi-drug resistant pathogen that produces redox-active phenazines (e.g., pyocyanin and phenazine 1-carboxylic acid or PCA) involved in several biological pathways, including quorum sensing [84], biofilm formation and virulence [85, 86], iron acquisition [84, 85] and exopolysaccharide biosynthesis [87]. Pseudomonas aeruginosa converts PCA to pyocyanin via the phenazine-modifying genes, phzM and phzS [88] and is also known to suppress host immunity by activating the DAF-2-Insulin-like signalling pathway [89].

Stenotrophomonas maltophilia is an uncommon bacterium, and infection is difficult to treat [90]. It is involved in biofilm formation, with spgM, rmlA, and rpfF genes having a close association with biofilm formation [91]. Stenotrophomonas maltophilia also secretes outer membrane vesicles (OMVs) that cause an inflammatory response and stimulate the expression of proinflammatory cytokine and chemokine genes, including interleukin (IL)-1β, IL-6, IL-8, tumour necrosis factor-α and monocyte chemoattractant protein-1 [92].

Clostridium perfringens forms a normal component of the intestinal microflora [93]. Some of its isolates show resistance to sulfamethoxazole and trimethoprim antibiotics [94]. Thus, it is surprising that it was absent from samples obtained during the period of illness and antibiotic treatment. Why this was the case is not clear. Haemophilus influenzae and Nocardiopsis dassonvillei (an opportunistic human pathogen [95]) were each detected in only single, separate individuals, suggesting that their presence was unlikely a response to this illness.

Clostridioides difficile was present in the gut at both time periods; however, its abundance was higher during the period of illness and treatment with antibiotics. It is well known for its antibiotic resistance [96] and for causing serious diarrhoeal infections [97], although it can also become established in the gut without signs of disease [98]. This bacterium produces both enterotoxin [99] and cytotoxin [100], glucosyltransferases that target and inactivate the Rho family of GTPases [101], which are the causative agents of diarrhoea and inflammation. Clostridioides difficile is also involved in several biological pathways, including quorum sensing [102], exopolysaccharide biosynthesis, encoded by the slpA gene and 11 of its paralogs [103] and biofilm formation, a key regulator of which is the Spo0A gene [104].

Our results provide a greater understanding of how illness and antibiotics impact the gut microbiome of a native Australian rodent species kept under captive conditions. While the illness remains undiagnosed, antibiotic treatment was effective in curing all affected individuals, and no reoccurrence of the illness has subsequently occurred. Following the illness and treatment with antibiotics, all individuals were visually monitored daily and weighed every two weeks to assess body condition. While some potentially pathogenic bacteria were recorded in the guts of some individual mosaic-tailed rats in the period following illness and treatment with antibiotics, their general low abundance, and no physical manifestation of symptoms in individuals carrying these bacteria suggests that presence is not necessarily indicative of potential illness, and that these bacteria may simply comprise a normal component of the gut microflora, as is known for Clostridium perfringens [93]. Furthermore, that the overall bacterial diversity of the mosaic-tailed rat microbiome increased over time suggests that normal gut homeostasis was restored over time and provides a good baseline for future comparisons of the gut microbiota in this population.

Preventing or managing illness in captive species is a fundamental ethical issue, and humans have a duty of care to ensure that captive species are provided treatment in the event of illness (clause 3.2.1 [28]). However, as our study shows, illness and treatment with antibiotics can have vastly different effects on the different bacterial groups found in the gut, depleting some, while causing characteristic blooms in others. Future studies on the gut microbial composition of wild fawn-footed mosaic-tailed rats will be useful for understanding how captivity affects the microbiome independently of illness and antibiotic treatment, providing new insights into the effective management of this species and related species in captivity. Furthermore, studies with carefully considered controls and deliberate manipulation of antibiotics could equally provide insights into the specific reasons for why we observed changes in the gut microbial communities of mosaic-tailed rats.

Supporting information

S1 Table. Output of rank-based non-parametric analyses for longitudinal data models.

Different bacterial group abundances and the effects of treatment, sex, birth and their interactions. The * refers to results that are significant at the α = 0.05 level, and significant results are discussed in the main text.

(DOCX)

Click here for additional data file.^{(50.2KB, docx)}

S2 Table. Outputs of principle components analyses.

Generated from the abundance of Bacteria in fawn-footed mosaic-tailed rats (Melomys cervinipes) in two treatments (TREATMENT and POST-TREATMENT).

(DOCX)

Click here for additional data file.^{(33.7KB, docx)}

S3 Table. Spearman’s rank correlation matrices.

Generated for the various principal components analyses. Significant correlations indicated in bold.

(DOCX)

Click here for additional data file.^{(38.3KB, docx)}

S1 File. Excel spreadsheets of raw data.

(CSV)

Click here for additional data file.^{(18.8KB, csv)}

Acknowledgments

We are grateful to numerous volunteers for their assistance in maintaining the mosaic-tailed rat colony. Special thanks to Dr Misha Rowell for her care of the colony during the illness, and for the collection of faecal samples. Data are available in the S1 File.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

The author(s) received no specific funding for this work.

References

1.Ley RE, Peterson DA, Gordon JI. Ecological and evolutionary forces shaping microbial diversity in the human intestine. Cell. 2006; 124: 837–848. doi: 10.1016/j.cell.2006.02.017 [DOI] [PubMed] [Google Scholar]
2.Fung TC, Olson CA, Hsiao EY. Interactions between the microbiota, immune and nervous systems in health and disease. Nat Neurosci. 2017; 20: 145–155. doi: 10.1038/nn.4476 [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Belkaid Y, Hand TW. Role of the microbiota in immunity and inflammation. Cell. 2014; 157: 121–141. doi: 10.1016/j.cell.2014.03.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Honda K, Littman DR. The microbiota in adaptive immune homeostasis and disease. Nature. 2016; 535: 75–84. doi: 10.1038/nature18848 [DOI] [PubMed] [Google Scholar]
5.Rooks MG, Garrett WS. Gut microbiota, metabolites and host immunity. Nat Rev Immunol. 2016; 16: 341–352. doi: 10.1038/nri.2016.42 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Morikawa M, Tsujibe S, Kiyoshima-Shibata J, Watanabe Y, Kato-Nagaoka N, Shida K, et al. Microbiota of the small intestine is selectively engulfed by phagocytes of the lamina propria and Peyer’s patches. PLOS ONE. 2016; 11: e0163607. doi: 10.1371/journal.pone.0163607 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Flint HJ, Scott KP, Louis P, Duncan SH. The role of the gut microbiota in nutrition and health. Nat Rev Gastro Hepat. 2012; 9: 577–589. doi: 10.1038/nrgastro.2012.156 [DOI] [PubMed] [Google Scholar]
8.Foster JA, Neufeld KAM. Gut–brain axis: how the microbiome influences anxiety and depression. Trends Neurosci. 2013; 36: 305–312. doi: 10.1016/j.tins.2013.01.005 [DOI] [PubMed] [Google Scholar]
9.Lazar V, Ditu LM, Pircalabioru GG, Gheorghe I, Curutiu C, Holban AM, et al. Aspects of gut microbiota and immune system interactions in infectious diseases, immunopathology, and cancer. Front Immunol. 2018; 9: 1830. doi: 10.3389/fimmu.2018.01830 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Gill SR, Pop M, Deboy RT, Eckburg PB, Turnbaugh PJ, Samuel BS, et al. Metagenomic analysis of the human distal gut microbiome. Science. 2006; 312: 1355–1359. doi: 10.1126/science.1124234 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Sun L, Zhang X, Zhang Y, Zheng K, Xiang Q, Chen N, et al. Antibiotic-induced disruption of gut microbiota alters local metabolomes and immune responses. Front Cell Infect Microbiol. 2019; 9: 99. doi: 10.3389/fcimb.2019.00099 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Singh RK, Chang HW, Yan DI, Lee KM, Ucmak D, Wong K, et al. Influence of diet on the gut microbiome and implications for human health. J Transl Med. 2017; 15: 73. doi: 10.1186/s12967-017-1175-y [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Ferretti P, Pasolli E, Tett A, Asnicar F, Gorfer V, Fedi S, et al. Mother-to-infant microbial transmission from different body sites shapes the developing infant gut microbiome. Cell Host & Microbe. 2018; 24: 133–145. doi: 10.1016/j.chom.2018.06.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Iizumi T, Battaglia T, Ruiz V, Perez GIP. Gut microbiome and antibiotics. Arch Med Res. 2017; 48: 727–734. doi: 10.1016/j.arcmed.2017.11.004 [DOI] [PubMed] [Google Scholar]
15.Lambert PA. Cellular impermeability and uptake of biocides and antibiotics in Gram-positive bacteria and mycobacteria. J Appl Microbiol. 2002; 92: 46S–54S. doi: 10.1046/j.1365-2672.92.5s1.7.x [DOI] [PubMed] [Google Scholar]
16.Konstantinidis T, Tsigalou C, Karvelas A, Stavropoulou E, Voidarou C, Bezirtzoglou E. Effects of antibiotics upon the gut microbiome: a review of the literature. Biomedicines. 2020; 8: 502. doi: 10.3390/biomedicines8110502 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Wong M-L, Inserra A, Lewis MD, Mastronardi CA, Leong LEX, Choo J, et al. Inflammasome signaling affects anxiety-and depressive-like behavior and gut microbiome composition. Mol Psychiatr. 2016; 21: 797–805. doi: 10.1038/mp.2016.46 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Anhê FF, Roy D, Pilon G, Dudonné S, Matamoros S, Varin TV, et al. A polyphenol-rich cranberry extract protects from diet-induced obesity, insulin resistance and intestinal inflammation in association with increased Akkermansia spp. population in the gut microbiota of mice. Gut. 2015; 64: 872–883. doi: 10.1136/gutjnl-2014-307142 [DOI] [PubMed] [Google Scholar]
19.Schneeberger M, Everard A, Gómez-Valadés AG, Matamoros S, Ramírez S, Delzenne NM, et al. Akkermansia muciniphila inversely correlates with the onset of inflammation, altered adipose tissue metabolism and metabolic disorders during obesity in mice. Sci Rep. 2015; 5: 16643. doi: 10.1038/srep16643 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Dao MC, Everard A, Aron-Wisnewsky J, Sokolovska N, Prifti E, Verger EO, et al. Akkermansia muciniphila and improved metabolic health during a dietary intervention in obesity: relationship with gut microbiome richness and ecology. Gut. 2016; 65: 426–436. doi: 10.1136/gutjnl-2014-308778 [DOI] [PubMed] [Google Scholar]
21.Reunanen J, Kainulainen V, Huuskonen L, Ottman N, Belzer C, Huhtinen H, et al. Akkermansia muciniphila adheres to enterocytes and strengthens the integrity of the epithelial cell layer. Appl Environ Microb. 2015; 81: 3655–3662. doi: 10.1128/AEM.04050-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Trevelline BK, Fontaine SS, Hartup BK, Koh KD. Conservation biology needs a microbial renaissance: a call for the consideration of host-associated microbiota in wildlife management practices. P R Soc Lond B-Bio. 2019; 286: 20182448. doi: 10.1098/rspb.2018.2448 [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Chong R, Cheng Y, Hogg CJ, Belov K. Marsupial gut microbiome. Front Microbiol. 2020; 11: 1058. doi: 10.3389/fmicb.2020.01058 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Looft T, Allen HK. Collateral effects of antibiotics on mammalian gut microbiomes. Gut Microbes. 2012; 3: 463–467. doi: 10.4161/gmic.21288 [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Costanzo SD, Murby J, Bates J. Ecosystem response to antibiotics entering the aquatic environment. Mar Pollut Bull. 2005; 51: 218–223. doi: 10.1016/j.marpolbul.2004.10.038 [DOI] [PubMed] [Google Scholar]
26.Jobbins SE, Alexander KA. From whence they came—antibiotic-resistant Escherichia coli in African wildlife. J Wildlife Dis. 2015; 51: 811–820. doi: 10.7589/2014-11-257 [DOI] [PubMed] [Google Scholar]
27.Callaway WA, Turner AA, Croshaw OB, Ferguson JA, Julson ZJN, Volp TM, et al. Melomys cervinipes (Rodentia: Muridae). Mammal Species. 2018; 50: 134–147. doi: 10.1093/mspecies/sey015 [DOI] [Google Scholar]
28.National Health and Medical Research Council. Australian code for the care and use of animals for scientific purposes, 8th ed. Canberra: National Health and Medical Research Council; 2013.
29.Bee M, Bernal X, Calisi R, Carere C, Carter T, Fuertbauer L, et al. Guidelines for the treatment of animals in behavioural research and teaching. Anim Behav. 2022; 183: i–xi. doi: 10.1016/S0003-3472(21)00389-4 [DOI] [Google Scholar]
30.Rowell MK, Rymer TL. Innovation in a native Australian rodent, the fawn-footed mosaic-tailed rat (Melomys cervinipes). Anim Cogn. 2020; 23: 301–310. doi: 10.1007/s10071-019-01334-6 [DOI] [PubMed] [Google Scholar]
31.Klindworth A, Pruesse E, Schweer T, Peplies J, Quast C, Horn M, et al. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next‐generation sequencing‐based diversity studies. Nucleic Acids Res. 2013; 41: e1. doi: 10.1093/nar/gks808 [DOI] [PMC free article] [PubMed] [Google Scholar]
32.McKnight DT, Huerlimann R, Bower DS, Schwarzkopf L, Alford RA, Zenger KR. Methods for normalizing microbiome data: an ecological perspective. Methods Ecol Evol. 2019; 10: 389–400. doi: 10.1111/2041-210X.13115 [DOI] [Google Scholar]
33.Wei T, Simko V, Levy M, Xie Y, Jin Y, Zemla J. Package ‘corrplot’. https://peerj.com/articles/9945/Supplemental_Data_S10.pdf; accessed 10 October 2022.
34.Noguchi K, Gel YR, Brunner E, Konietschke F. nparLD: An R software package for the nonparametric analysis of longitudinal data in factorial experiments. J Stat Softw. 2012; 50: 1–23. doi: 10.18637/jss.v050.i1225317082 [DOI] [Google Scholar]
35.Ben-Shachar MS, Makowski D, Lüdecke D, Patil I, Wiernik BM, Kelley K, et al. Package ‘effectsize’. https://cran.r-project.org/web/packages/effectsize/effectsize.pdf; accessed 26 December 2022.
36.McMurdie PJ, Holmes S. phyloseq: An R package for reproducible interactive analysis and graphics of microbiome census data. PLoS One. 2013; 8: e61217. doi: 10.1371/journal.pone.0061217 [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Fish JA, Chai B, Wang Q, Sun Y, Brown CT, Tiedje JM, et al. FunGene: the functional gene pipeline and repository. Front Microbiol. 2013; 4: 291; doi: 10.3389/fmicb.2013.00291 [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Eisenhofer R, Minich JJ, Marotz C, Cooper A, Knight R, Weyrich LS. Contamination in low microbial biomass microbiome studies: issues and recommendations. Trends Microbiol. 2019; 27: 105–117. doi: 10.1016/j.tim.2018.11.003 [DOI] [PubMed] [Google Scholar]
39.Yim G, Wang HH, Davies J. The truth about antibiotics. Int J Med Microbiol. 2006; 296: 163–170. doi: 10.1016/j.ijmm.2006.01.039 [DOI] [PubMed] [Google Scholar]
40.Ianiro G, Tilg H, Gasbarrini A. Antibiotics as deep modulators of gut microbiota: between good and evil. Gut. 2016; 65: 1906–1915. doi: 10.1136/gutjnl-2016-312297 [DOI] [PubMed] [Google Scholar]
41.Jalanka J, Salonen A, Salojärvi J, Ritari J, Immonen O, Marciani L, et al. Effects of bowel cleansing on the intestinal microbiota. Gut. 2015; 64: 1562–1568. doi: 10.1136/gutjnl-2014-307240 [DOI] [PubMed] [Google Scholar]
42.Murillo T, Schneider D, Fichtel C, Daniel R. Dietary shifts and social interactions drive temporal fluctuations of the gut microbiome from wild redfronted lemurs. ISME Comm. 2022; 2: 3. doi: 10.1038/s43705-021-00086-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Litvak Y, Byndloss MX, Tsolis RM, Bäumler AJ. Dysbiotic Proteobacteria expansion: a microbial signature of epithelial dysfunction. Curr Opin Microbiol. 2017; 39: 1–6. doi: 10.1016/j.mib.2017.07.003 [DOI] [PubMed] [Google Scholar]
44.Rizzatti G, Lopetuso LR, Gibiino G, Binda C, Gasbarrini A. Proteobacteria: a common factor in human diseases. BioMed Res Int. 2017; 2017: 9351507. doi: 10.1155/2017/9351507 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Shao H, Zhang C, Xiao N, Tan Z. Gut microbiota characteristics in mice with antibiotic-associated diarrhea. BMC Microbiol. 2020; 20: 313. doi: 10.1186/s12866-020-01999-x [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Shin NR, Whon TW, Bae JW. Proteobacteria: microbial signature of dysbiosis in gut microbiota. Trends Biotechnol. 2015; 33: 496–503. doi: 10.1016/j.tibtech.2015.06.011 [DOI] [PubMed] [Google Scholar]
47.Dubourg G, Lagier JC, Armougom F, Robert C, Audoly G, Papazian L, et al. High-level colonisation of the human gut by Verrucomicrobia following broad-spectrum antibiotic treatment. Int J Antimicrob Ag. 2013; 41: 149–155. doi: 10.1016/j.ijantimicag.2012.10.012 [DOI] [PubMed] [Google Scholar]
48.Weingarden AR, Chen C, Bobr A, Yao D, Lu Y, Nelson VM, et al. Microbiota transplantation restores normal fecal bile acid composition in recurrent Clostridium difficile infection. Am J Physiol-Gastr L. 2014; 306: G310–G319. doi: 10.1152/ajpgi.00282.2013 [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Anderson JR, Carroll I, Azcarate-Peril MA, Rochette AD, Heinberg LJ, Peat C, et al. A preliminary examination of gut microbiota, sleep, and cognitive flexibility in healthy older adults. Sleep Med. 2017; 38: 104–107. doi: 10.1016/j.sleep.2017.07.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Xavier KB. Bacterial interspecies quorum sensing in the mammalian gut microbiota. C R Biol. 2018; 341: 297–299. doi: 10.1016/j.crvi.2018.03.006 [DOI] [PubMed] [Google Scholar]
51.Stojanov S, Berlec A, Štrukelj B. The influence of probiotics on the firmicutes/bacteroidetes ratio in the treatment of obesity and inflammatory bowel disease. Microorganisms. 2020; 8: 1715. doi: 10.3390/microorganisms8111715 [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Kim HB, Borewicz K, White BA, Singer RS, Sreevatsan S, Tu ZJ, Microbial shifts in the swine distal gut in response to the treatment with antimicrobial growth promoter, tylosin. P Natl A Sci USA. 2012; 109: 15485–15490. doi: 10.1073/pnas.1205147109 [DOI] [PMC free article] [PubMed] [Google Scholar]
53.Pajarillo EAB, Chae JP, Balolong MP, Kim HB, Seo KS, Kang DK. Characterization of the fecal microbial communities of Duroc pigs using 16S rRNA gene pyrosequencing. Asian Austral J Anim Sci. 2015; 28: 584–591. doi: 10.5713/ajas.14.0651 [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Dong L, Meng L, Liu H, Wu H, Schroyen M, Zheng N, et al. Effect of cephalosporin treatment on the microbiota and antibiotic resistance genes in feces of dairy cows with clinical mastitis. Antibiotics. 2022; 11: 117. doi: 10.3390/antibiotics11010117 [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Dai ZF, Ma XY, Yang RL, Wang HC, Xu DD, Yang JN, et al. Intestinal flora alterations in patients with ulcerative colitis and their association with inflammation. Exp Ther Med. 2021; 22: 1322. doi: 10.3892/etm.2021.10757 [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Walker AW, Sanderson JD, Churcher C, Parkes GC, Hudspith BN, Rayment N, et al. High-throughput clone library analysis of the mucosa-associated microbiota reveals dysbiosis and differences between inflamed and non-inflamed regions of the intestine in inflammatory bowel disease. BMC Microbiol. 2011; 11: 7. doi: 10.1186/1471-2180-11-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
57.Thomas M, Webb M, Ghimire S, Blair A, Olson K, Fenske GJ, et al. Metagenomic characterization of the effect of feed additives on the gut microbiome and antibiotic resistome of feedlot cattle. Sci Rep. 2017; 7: 12257. doi: 10.1038/s41598-017-12481-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
58.Maurice CF, Knowles SCL, Ladau J, Pollard KS, Fenton A, Pedersen AB, et al. Marked seasonal variation in the wild mouse gut microbiota. ISME J. 2015; 9: 2423–2434. doi: 10.1038/ismej.2015.53 [DOI] [PMC free article] [PubMed] [Google Scholar]
59.Yu M, Mu C, Zhang C, Yang Y, Su Y, Zhu W. Marked response in microbial community and metabolism in the ileum and cecum of suckling piglets after early antibiotics exposure. Front Microbiol. 2018; 9: 1166. doi: 10.3389/fmicb.2018.01166 [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Bujňáková D, Puvača N, Ćirković I. Virulence factors and antibiotic resistance of Enterobacterales. Microorganisms. 2022; 10: 1588. doi: 10.3390/microorganisms10081588 [DOI] [PMC free article] [PubMed] [Google Scholar]
61.Zhang Q, Cheng L, Wang J, Hao M, Che H. Antibiotic-induced gut microbiota dysbiosis damages the intestinal barrier, increasing food allergy in adult mice. Nutrients. 2021; 13: 3315. doi: 10.3390/nu13103315 [DOI] [PMC free article] [PubMed] [Google Scholar]
62.Yao J, Carter RA, Vuagniaux G, Barbier M, Rosch JW, Rock CO. A pathogen-selective antibiotic minimizes disturbance to the microbiome. Antimicrob Agents Ch. 2016; 60: 4264–4273. doi: 10.1128/AAC.00535-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
63.Du X, Liu J, Xue Y, Kong X, Lv C, Li Z, et al. Alteration of gut microbial profile in patients with diabetic nephropathy. Endocrine. 2021; 73: 71–84. doi: 10.1007/s12020-021-02721-1 [DOI] [PubMed] [Google Scholar]
64.Winther SA, Henriksen P, Vogt JK, Hansen TH, Ahonen L, Suvitaival T, et al. Gut microbiota profile and selected plasma metabolites in type 1 diabetes without and with stratification by albuminuria. Diabetologia. 2020; 63: 2713–2724. doi: 10.1007/s00125-020-05260-y [DOI] [PubMed] [Google Scholar]
65.Dey N, Soergel DA, Repo S, Brenner SE. Association of gut microbiota with post-operative clinical course in Crohn’s disease. BMC Gastroenterol. 2013; 13: 131. doi: 10.1186/1471-230X-13-131 [DOI] [PMC free article] [PubMed] [Google Scholar]
66.Gevers D, Kugathasan S, Denson LA, Vázquez-Baeza Y, Van Treuren W, Ren B, et al. The treatment-naive microbiome in new-onset Crohn’s disease. Cell Host Microbe. 2014; 15: 382–392. doi: 10.1016/j.chom.2014.02.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
67.Zhao Y, Wu J, Li JV, Zhou NY, Tang H, Wang Y. Gut microbiota composition modifies fecal metabolic profiles in mice. J Proteome Res. 2013; 12: 2987–2999. doi: 10.1021/pr400263n [DOI] [PubMed] [Google Scholar]
68.Palm NW, de Zoete MR, Cullen TW, Barry NA, Stefanowski J, Hao L, et al. Immunoglobulin A coating identifies colitogenic bacteria in inflammatory bowel disease. Cell 2014; 158, 1000–1010. doi: 10.1016/j.cell.2014.08.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
69.Allan N, Knotts TA, Pesapane R, Ramsey JJ, Castle S, Clifford D, et al. Conservation implications of shifting gut microbiomes in captive-reared endangered voles intended for reintroduction into the wild. Microorganisms. 2018; 6: 94. doi: 10.3390/microorganisms6030094 [DOI] [PMC free article] [PubMed] [Google Scholar]
70.Liu Y, Liu B, Liu C, Hu Y, Liu C, Li X, et al. Differences in the gut microbiomes of dogs and wolves: roles of antibiotics and starch. BMC Vet Res. 2021; 17: 112. doi: 10.1186/s12917-021-02815-y [DOI] [PMC free article] [PubMed] [Google Scholar]
71.Martínez-Mota R, Kohl KD, Orr TJ, Dearing MD. Natural diets promote retention of the native gut microbiota in captive rodents. ISME J. 2020; 14: 67–78. doi: 10.1038/s41396-019-0497-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
72.Xie G, Wu Y, Zheng T, Shen K, Tan Z. Effect of Debaryomyces hansenii combined with Qiweibaizhu powder extract on the gut microbiota of antibiotic-treated mice with diarrhea. 3 Biotech. 2020; 10: 127. doi: 10.1007/s13205-020-2121-x [DOI] [PMC free article] [PubMed] [Google Scholar]
73.Wu H, Chen Q, Liu J, Chen X, Luo H, Ye Z, et al. Microbiome analysis reveals gut microbiota alteration in mice with the effect of matrine. Microb Pathogenesis. 2021; 156: 104926. doi: 10.1016/j.micpath.2021.104926 [DOI] [PubMed] [Google Scholar]
74.Bellés A, Aguirre-Ramírez D, Abad I, Parras-Moltó M, Sánchez L, Grasa L. Lactoferrin modulates gut microbiota and Toll-like receptors (TLRs) in mice with dysbiosis induced by antibiotics. Food Funct. 2022; 13: 5854–5869. doi: 10.1039/d2fo00287f [DOI] [PubMed] [Google Scholar]
75.Bridgewater LC, Zhang C, Wu Y, Hu W, Zhang Q, Wang J, et al. Gender-based differences in host behavior and gut microbiota composition in response to high fat diet and stress in a mouse model. Sci Rep. 2017; 7: 10776. doi: 10.1038/s41598-017-11069-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
76.Kozik AJ, Nakatsu CH, Chun H, Jones-Hall YL. Age, sex, and TNF associated differences in the gut microbiota of mice and their impact on acute TNBS colitis. Exp Mol Pathol. 2017; 103: 311–319. doi: 10.1016/j.yexmp.2017.11.014 [DOI] [PubMed] [Google Scholar]
77.Harrison CA, Laubitz D, Ohland CL, Midura-Kiela MT, Patil K, Besselsen DG, et al. Microbial dysbiosis associated with impaired intestinal Na⁺/H⁺ exchange accelerates and exacerbates colitis in ex-germ free mice. Mucosal Immunol. 2018; 11: 1329–1341. doi: 10.1038/s41385-018-0035-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
78.Bajaj JS, Heuman DM, Sanyal AJ, Hylemon PB, Sterling RK, Stravitz RT, et al. Modulation of the metabiome by rifaximin in patients with cirrhosis and minimal hepatic encephalopathy. PLOS ONE. 2013; 8: e60042. doi: 10.1371/journal.pone.0060042 [DOI] [PMC free article] [PubMed] [Google Scholar]
79.Omori M, Maeda S, Igarashi H, Ohno K, Sakai K, Yonezawa T, et al. Fecal microbiome in dogs with inflammatory bowel disease and intestinal lymphoma. J Vet Med Sci. 2017; 17: 1840–1847. doi: 10.1292/jvms.17-0045 [DOI] [PMC free article] [PubMed] [Google Scholar]
80.Singer M. Pathogen-pathogen interaction: a syndemic model of complex biosocial processes in disease. Virulence. 2010; 1: 10–18. doi: 10.4161/viru.1.1.9933 [DOI] [PMC free article] [PubMed] [Google Scholar]
81.Miller MB, Bassler BL. Quorum sensing in bacteria. Annu Rev Microbiol. 2001; 55: 165–199. doi: 10.1146/annurev.micro.55.1.165 [DOI] [PubMed] [Google Scholar]
82.Bass D, Del Campo J. Microeukaryotes in animal and plant microbiomes: Ecologies of disease? Eur J Protistol. 2020; 76: 125719. doi: 10.1016/j.ejop.2020.125719 [DOI] [PubMed] [Google Scholar]
83.Li K, Bihan M, Yooseph S, Methé BA. Analyses of the microbial diversity across the human microbiome. PLoS One. 2012; 7: e32118. doi: 10.1371/journal.pone.0032118 [DOI] [PMC free article] [PubMed] [Google Scholar]
84.Dietrich LE, Price‐Whelan A, Petersen A, Whiteley M, Newman DK. The phenazine pyocyanin is a terminal signalling factor in the quorum sensing network of Pseudomonas aeruginosa. Mol Microbiol. 2006; 61: 1308–1321. doi: 10.1111/j.1365-2958.2006.05306.x [DOI] [PubMed] [Google Scholar]
85.Wang Y, Wilks JC, Danhorn T, Ramos I, Croal L, Newman DK. Phenazine-1-carboxylic acid promotes bacterial biofilm development via ferrous iron acquisition. J Bacteriol. 2011; 193: 3606–3617. doi: 10.1128/JB.00396-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
86.Rada B, Leto TL. Pyocyanin effects on respiratory epithelium: relevance in Pseudomonas aeruginosa airway infections. Trends Microbiol. 2013; 21: 73–81. doi: 10.1016/j.tim.2012.10.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
87.Rojas LJ, Yasmin M, Benjamino J, Marshall SM, DeRonde KJ, Krishnan NP, et al. Genomic heterogeneity underlies multidrug resistance in Pseudomonas aeruginosa: a population-level analysis beyond susceptibility testing. PLoS One. 2022; 17: e0265129. doi: 10.1371/journal.pone.0265129 [DOI] [PMC free article] [PubMed] [Google Scholar]
88.Mavrodi DV, Bonsall RF, Delaney SM, Soule MJ, Phillips G, Thomashow LS. Functional analysis of genes for biosynthesis of pyocyanin and phenazine-1-carboxamide from Pseudomonas aeruginosa PAO1. J Bacteriol. 2001; 183: 6454–6465. doi: 10.1128/JB.183.21.6454-6465.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
89.Evans EA, Kawli T, Tan MW. Pseudomonas aeruginosa suppresses host immunity by activating the DAF-2 insulin-like signaling pathway in Caenorhabditis elegans. PLoS Pathog. 2008; 4: e1000175. doi: 10.1371/journal.ppat.1000175 [DOI] [PMC free article] [PubMed] [Google Scholar]
90.Holifield K, Lazzaro DR. Case report: spontaneous Stenotrophomonas maltophilia keratitis in a diabetic patient. Eye Contact Lens. 2011; 37: 326–327. doi: 10.1097/ICL.0b013e3182146e26 [DOI] [PubMed] [Google Scholar]
91.Zhuo C, Zhao QY, Xiao SN. The impact of spgM, rpfF, rmlA gene distribution on biofilm formation in Stenotrophomonas maltophilia. PLoS One. 2014; 9: e108409. doi: 10.1371/journal.pone.0108409 [DOI] [PMC free article] [PubMed] [Google Scholar]
92.Kim YJ, Jeon H, Na SH, Kwon HI, Selasi GN, Nicholas A, et al. Stenotrophomonas maltophilia outer membrane vesicles elicit a potent inflammatory response in vitro and in vivo. Pathog Dis. 2016; 74: ftw104. doi: 10.1093/femspd/ftw104 [DOI] [PubMed] [Google Scholar]
93.Rood JI, Cole ST. Molecular genetics and pathogenesis of Clostridium perfringens. Microbiol Rev. 1991; 55: 621–648. doi: 10.1128/mr.55.4.621-648.1991 [DOI] [PMC free article] [PubMed] [Google Scholar]
94.Li J, Zhou Y, Yang D, Zhang S, Sun Z, Wang Y, et al. Prevalence and antimicrobial susceptibility of Clostridium perfringens in chickens and pigs from Beijing and Shanxi, China. Vet Microbiol. 2021; 252: 108932. doi: 10.1016/j.vetmic.2020.108932 [DOI] [PubMed] [Google Scholar]
95.Bennur T, Kumar AR, Zinjarde S, Javdekar V. Nocardiopsis species: incidence, ecological roles and adaptations. Microbiol Res. 2015; 174: 33–47. doi: 10.1016/j.micres.2015.03.010 [DOI] [PubMed] [Google Scholar]
96.Wickramage I, Spigaglia P, Sun X. Mechanisms of antibiotic resistance of Clostridioides difficile. J. Antimicrob Chemoth. 2021; 76: 3077–3090. doi: 10.1093/jac/dkab231 [DOI] [PMC free article] [PubMed] [Google Scholar]
97.Nwachuku E, Shan Y, Senthil-Kumar P, Braun T, Shadis R, Vu TQ. Toxic Clostridioides (formerly Clostridium) difficile colitis: no longer a diarrhea associated infection. Am J Surg. 2021; 221: 240–242. doi: 10.1016/j.amjsurg.2020.06.026 [DOI] [PubMed] [Google Scholar]
98.Prechter F, Katzer K, Bauer M, Stallmach A. Sleeping with the enemy: Clostridium difficile infection in the intensive care unit. Crit Care. 2017; 21: 260. doi: 10.1186/s13054-017-1819-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
99.Savidge TC, Pan WH, Newman P, O’Brien M, Anton PM, Pothoulakis C. Clostridium difficile toxin B is an inflammatory enterotoxin in human intestine. Gastroenterology. 2003; 125: 413–420. doi: 10.1016/S0016-5085(03)00902-8 [DOI] [PubMed] [Google Scholar]
100.Pothoulakis C, Barone LM, Ely R, Faris B, Clark ME, Franzblau C, et al. Purification and properties of Clostridium difficile cytotoxin B. J Biol Chem. 1986; 261: 1316–1321. doi: 10.1016/S0021-9258(17)36093-3 [DOI] [PubMed] [Google Scholar]
101.Just I, Selzer J, von Eichel-Streiber C, Aktories K. The low molecular mass GTP-binding protein Rho is affected by toxin A from Clostridium difficile. J Clin Invest. 1995; 95: 1026–1031. doi: 10.1172/JCI117747 [DOI] [PMC free article] [PubMed] [Google Scholar]
102.Carter GP, Purdy D, Williams P, Minton NP. Quorum sensing in Clostridium difficile: analysis of a luxS-type signalling system. J Med Microbiol. 2005; 54: 119–127. doi: 10.1099/jmm.0.45817-0 [DOI] [PubMed] [Google Scholar]
103.Sebaihia M, Wren BW, Mullany P, Fairweather NF, Minton N, Stabler R, et al. The multidrug-resistant human pathogen Clostridium difficile has a highly mobile, mosaic genome. Nat Genet. 2006; 38: 779–786. doi: 10.1038/ng1830 [DOI] [PubMed] [Google Scholar]
104.Dawson LF, Valiente E, Faulds-Pain A, Donahue EH, Wren BW. Characterisation of Clostridium difficile biofilm formation, a role for Spo0A. PLoS One. 2012; 7: e50527. doi: 10.1371/journal.pone.0050527 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0281533.r001

Decision Letter 0

Mohammad Tauqeer Alam

14 Nov 2022

PONE-D-22-28589The effects of antibiotics and illness on gut microbial composition in the fawn-footed mosaic-tailed rat (Melomys cervinipes)PLOS ONE

Dear Dr. Rymer,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please go through the reviewers comments and address their concerns specially about the animal health and obvious microbial changes due to antibiotic treatment.

Please submit your revised manuscript by Dec 29 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Mohammad Tauqeer Alam, PhD

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information regarding the experiments involving animals and ensure you have included details on (1) methods of sacrifice, (2) methods of anesthesia and/or analgesia, and (3) efforts to alleviate suffering.

3. As part of your revision, please complete and submit a copy of the Full ARRIVE 2.0 Guidelines checklist, a document that aims to improve experimental reporting and reproducibility of animal studies for purposes of post-publication data analysis and reproducibility: https://arriveguidelines.org/sites/arrive/files/documents/Author%20Checklist%20-%20Full.pdf Please include your completed checklist as a Supporting Information file. Note that if your paper is accepted for publication, this checklist will be published as part of your article.

4. Thank you for stating the following financial disclosure:

“The author(s) received no specific funding for this work. TR received general funding from James Cook University, and several donors contributed to a crowd funding campaign. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.”

At this time, please address the following queries:

a) Please clarify the sources of funding (financial or material support) for your study. List the grants or organizations that supported your study, including funding received from your institution.

b) State what role the funders took in the study. If the funders had no role in your study, please state: “The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.”

c) If any authors received a salary from any of your funders, please state which authors and which funders.

d) If you did not receive any funding for this study, please state: “The authors received no specific funding for this work.”

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

5. Thank you for stating the following in the Acknowledgments Section of your manuscript:

“We would like to thank James Cook University College of Science and Engineering for funding this project and to all the contributors in a Pozible.com crowd-funding campaign. We are grateful to numerous volunteers for their assistance in maintaining the mosaic-tailed rat colony. Special thanks to Dr Misha Rowell for her care of the colony during the illness, and for the collection of faecal samples.”

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

6. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

Additional Editor Comments:

Dear Dr. Rymer,

The review process of your manuscript is now complete. The reviewers have found your manuscript interesting and it has several good results. Also, the experimental design of the study and follow-up analysis approaches were appropriate. They did however raise several important issues. Additionally, both reviewers have suggested modifying the results and conclusions sections and briefly mentioning the animal health, and discussing the obvious shift in microbial structure due to antibiotic treatments.

Given the concerns and suggestions from both reviewers, unfortunately, we can not accept your manuscript in its current form. However, if you can address the reviewer's comment then we will be happy to consider the revised manuscript.

With best regards

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: No

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The paper described and quantified gut bacterial community composition changes in response to illness and treatment with antibiotics in a native Australian rodent, the fawn-footed mosaic-tailed rat (Melomys cervinipes), mainly by high throughput genome sequencing. This study seems to be an extension of a previously published study on a mosaic-tailed rat and builds on additional data on the dynamics of gut bacterial community composition in response to illness and treatment with antibiotics, and it is adequately planned, executed, and well-presented. NGS data could have been explored more with much deeper insight into the reason for changes in the gut bacterial community. In addition, it would have been interesting to include antibiotic-resistant bacteria (ARB) and genes (ARG), including functional analysis of bacterial community.

Reviewer #2: The authors summarized the effects of antibiotic treatment and 1-year post-treatment on gut microbial diversity in mosaic-tailed wild and captive rats. Overall, the manuscript is well-organized and well-written. Although the study was opportunistic having no controls and no significant rationale, my suggestion is to provide more detailed information on the overall health of the animal because of changes in gut microbial diversity. It would be worth adding some conclusions and suggestions for future studies on the basis of your observation otherwise this data is just information about different microbial species decreasing and increasing with antibiotics treatment. This is very obvious that gut microbial species change with antibiotics treatment and regained new homeostasis after some time with normal feed. It must be taken into account in the results section of the study to show the most important results that the research reached without going into excessive detail. In terms of the well-being of animals kept under captive conditions (it is one of the points highlighted in the article), authors must suggest how to manage the health of animals after antibiotic treatment according to their research results.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: MUNAWWAR ALI KHAN

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2023 Feb 24;18(2):e0281533. doi: 10.1371/journal.pone.0281533.r002

Author response to Decision Letter 0

4 Jan 2023

We have carefully considered the comments and respond to each comment below in bold. Where line numbers are provided, these refer to the line numbers in the unmarked manuscript (labelled “Manuscript”).

Responses to journal requirements:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming.

We have followed the style requirements as requested.

We originally included an ethical note in the methods sections (L108-123). We now include a statement that no animals were sacrificed for this experiment (L121-122), and that all deaths were natural a consequence of the undiagnosed illness (L122-123). In the original manuscript, we stated that all animals received antibiotics (L137-139). No anaesthesia or analgesia was used/administered. We have added that sick individuals were transported to a veterinarian once symptoms started, but four died prior to receiving treatment (L118-120). As stated, all animals received antibiotics, which alleviated suffering (we stated on L120-121 that they all recovered completely).

We have completed the checklist as requested.

4. a) Please clarify the sources of funding (financial or material support) for your study. List the grants or organizations that supported your study, including funding received from your institution.

James Cook University provides researchers with facilities such as a laboratory, access to printing, access to the internet and research databases (as similar). This is what is meant by “general funding”. No grant or organization supported this work per se. This funding helped support the maintenance of the colony and provided some funds towards several projects.

We stated this originally on submission. We state again: “The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

c) If any authors received a salary from any of your funders, please state which authors and which funders.

No authors received a salary from any funders.

d) If you did not receive any funding for this study, please state: “The authors received no specific funding for this work.”

We stated this originally on submission. We state again: “The authors received no specific funding for this work.”

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

Included in the above queries as requested.

5. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement.

We have removed this information from the Acknowledgements section.

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

Please see below amended statement:

“The author(s) received no specific funding for this work. TR received general funding (e.g. access to a research laboratory, printing, research databases, etc.) from James Cook University, and several donors contributed to a crowd funding campaign that generated general research funding (e.g. not specific to this project, but allowed for the colony to be maintained). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. No authors received a salary from any funders.”

Included as requested and provided in-text citations to match as provided in the guidelines.

Additional Editor Comments:

Thank you for the comments. We have responded to each reviewers’ comments below in bold.

Reviewers' comments:

1. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: No

We have addressed each of the reviewers’ comments below each in bold.

5. Review Comments to the Author

Thank you for the comments. There have been several other studies on mosaic-tailed rats in this colony. However, this is the first study to explore the gut bacterial community, so we have no prior knowledge or data as suggested.

NGS data could have been explored more with much deeper insight into the reason for changes in the gut bacterial community.

This study was opportunistic. As we have no specific controls, we are unable to state with certainty that the responses are seeing are definitively a consequence of the antibiotic treatment, the illness itself or a combination of both. Given the broad approach taken to this study, we do not feel that we can provide more insight into the reason for the changes. Rather, we document the changes at the taxonomic level, and suggest that future studies could explore these changes with more controlled experiments. We have included a bit more information on the overall variation in biodiversity indices, as well as some specific bacterial species variations at each time period (L244-251, L486-514, L630-666).

In addition, it would have been interesting to include antibiotic-resistant bacteria (ARB) and genes (ARG), including functional analysis of bacterial community.

25 bacterial species were identified through the ACE pipeline analysis. Of these, only 6 occurred in both time periods. We discuss one of these, Clostridioides difficile (L657-666). Furthermore, 2 bacterial species were identified to only occur during the period of treatment, namely Pseudomonas aeruginosa and Stenotrophomonas maltophilia (L633-649). We provide a discussion on these two species. During the period following treatment, while we identified some potentially interesting pathogenic, antibiotic resistant bacteria, their low occurrence and presence in only a few individuals suggests no relationship to this particular incidence (L650-656). Given the nature of the study, and the fact that we cannot state definitively the cause of changes in the gut microbiota, we conducted a simple analysis using phyloseq to explore whether there were differences in biodiversity indices of species between the two time periods, and then explored the aforementioned species in more detail, looking very briefly at functional pathways and genes (L244-251; L630-666).

Thank you for the comments. We have included that sick animals showed weight loss (associated with inappetence and diarrhoea as already stated) but no other symptoms were observed (L93-94). We have provided some additional information in the methods on healthy animals (L97-99). We have also provided information on what occurred once symptoms were detected in the first four individuals (L119-119).

It would be worth adding some conclusions and suggestions for future studies on the basis of your observation otherwise this data is just information about different microbial species decreasing and increasing with antibiotics treatment.

In the original manuscript, we stated the following (L685-689): “Future studies on the gut microbial composition of wild fawn-footed mosaic-tailed rats will be useful for understanding how captivity affects the microbiome independently of illness and antibiotic treatment, providing new insights into the effective management of this species in captivity.” We have now added “and related species” to this sentence. We also add (L689-691): “Furthermore, studies with carefully considered controls and deliberate manipulation of antibiotics could equally provide insights into the specific reasons for why we observed changes in the gut microbial communities of mosaic-tailed rats.”

This is very obvious that gut microbial species change with antibiotics treatment and regained new homeostasis after some time with normal feed. It must be taken into account in the results section of the study to show the most important results that the research reached without going into excessive detail.

Unfortunately, because this was an opportunistic study, we could not provide controls to definitively state whether the changes in community composition were a consequence of the illness, the antibiotics or both. Therefore, we chose to be cautious in our presentation and discussion of the results. We feel that we have dealt appropriately with the data at each taxonomic level at a level that is sufficient for this opportunistic study. However, we have added in some information on changes in abundance and more information on some specific species (L486-514, L630-666). If the reviewer can provide more specific recommendations on what they consider should be included and how, we will gladly consider this.

In terms of the well-being of animals kept under captive conditions (it is one of the points highlighted in the article), authors must suggest how to manage the health of animals after antibiotic treatment according to their research results.

We have provided some additional information as requested (L686-680).

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(39.1KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0281533.r003

Decision Letter 1

Mohammad Tauqeer Alam

26 Jan 2023

The effects of antibiotics and illness on gut microbial composition in the fawn-footed mosaic-tailed rat (Melomys cervinipes)

PONE-D-22-28589R1

Dear Dr. Rymer,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Mohammad Tauqeer Alam, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Dear Dr Tasmin,

The review process of your manuscript is now complete. I am pleased to see that the reviewers are happy with the revised version of the manuscript. We would like to thank you for addressing the comments in the review process!

Kind regards

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Partly

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #1: Thank you for revising the manuscript and addressing a few minor concerns in the previously submitted manuscript. I hope this study will lay the foundation for future in-depth research on similar or closely related study.

Reviewer #2: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: MUNAWWAR ALI KHAN

Reviewer #2: No

**********

PLoS One. doi: 10.1371/journal.pone.0281533.r004

Acceptance letter

Mohammad Tauqeer Alam

14 Feb 2023

PONE-D-22-28589R1

The effects of antibiotics and illness on gut microbial composition in the fawn-footed mosaic-tailed rat (Melomys cervinipes)

Dear Dr. Rymer:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Mohammad Tauqeer Alam

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. Output of rank-based non-parametric analyses for longitudinal data models.

(DOCX)

Click here for additional data file.^{(50.2KB, docx)}

S2 Table. Outputs of principle components analyses.

Generated from the abundance of Bacteria in fawn-footed mosaic-tailed rats (Melomys cervinipes) in two treatments (TREATMENT and POST-TREATMENT).

(DOCX)

Click here for additional data file.^{(33.7KB, docx)}

S3 Table. Spearman’s rank correlation matrices.

Generated for the various principal components analyses. Significant correlations indicated in bold.

(DOCX)

Click here for additional data file.^{(38.3KB, docx)}

S1 File. Excel spreadsheets of raw data.

(CSV)

Click here for additional data file.^{(18.8KB, csv)}

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(39.1KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

[pone.0281533.ref001] 1.Ley RE, Peterson DA, Gordon JI. Ecological and evolutionary forces shaping microbial diversity in the human intestine. Cell. 2006; 124: 837–848. doi: 10.1016/j.cell.2006.02.017 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref002] 2.Fung TC, Olson CA, Hsiao EY. Interactions between the microbiota, immune and nervous systems in health and disease. Nat Neurosci. 2017; 20: 145–155. doi: 10.1038/nn.4476 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref003] 3.Belkaid Y, Hand TW. Role of the microbiota in immunity and inflammation. Cell. 2014; 157: 121–141. doi: 10.1016/j.cell.2014.03.011 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref004] 4.Honda K, Littman DR. The microbiota in adaptive immune homeostasis and disease. Nature. 2016; 535: 75–84. doi: 10.1038/nature18848 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref005] 5.Rooks MG, Garrett WS. Gut microbiota, metabolites and host immunity. Nat Rev Immunol. 2016; 16: 341–352. doi: 10.1038/nri.2016.42 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref006] 6.Morikawa M, Tsujibe S, Kiyoshima-Shibata J, Watanabe Y, Kato-Nagaoka N, Shida K, et al. Microbiota of the small intestine is selectively engulfed by phagocytes of the lamina propria and Peyer’s patches. PLOS ONE. 2016; 11: e0163607. doi: 10.1371/journal.pone.0163607 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref007] 7.Flint HJ, Scott KP, Louis P, Duncan SH. The role of the gut microbiota in nutrition and health. Nat Rev Gastro Hepat. 2012; 9: 577–589. doi: 10.1038/nrgastro.2012.156 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref008] 8.Foster JA, Neufeld KAM. Gut–brain axis: how the microbiome influences anxiety and depression. Trends Neurosci. 2013; 36: 305–312. doi: 10.1016/j.tins.2013.01.005 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref009] 9.Lazar V, Ditu LM, Pircalabioru GG, Gheorghe I, Curutiu C, Holban AM, et al. Aspects of gut microbiota and immune system interactions in infectious diseases, immunopathology, and cancer. Front Immunol. 2018; 9: 1830. doi: 10.3389/fimmu.2018.01830 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref010] 10.Gill SR, Pop M, Deboy RT, Eckburg PB, Turnbaugh PJ, Samuel BS, et al. Metagenomic analysis of the human distal gut microbiome. Science. 2006; 312: 1355–1359. doi: 10.1126/science.1124234 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref011] 11.Sun L, Zhang X, Zhang Y, Zheng K, Xiang Q, Chen N, et al. Antibiotic-induced disruption of gut microbiota alters local metabolomes and immune responses. Front Cell Infect Microbiol. 2019; 9: 99. doi: 10.3389/fcimb.2019.00099 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref012] 12.Singh RK, Chang HW, Yan DI, Lee KM, Ucmak D, Wong K, et al. Influence of diet on the gut microbiome and implications for human health. J Transl Med. 2017; 15: 73. doi: 10.1186/s12967-017-1175-y [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref013] 13.Ferretti P, Pasolli E, Tett A, Asnicar F, Gorfer V, Fedi S, et al. Mother-to-infant microbial transmission from different body sites shapes the developing infant gut microbiome. Cell Host & Microbe. 2018; 24: 133–145. doi: 10.1016/j.chom.2018.06.005 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref014] 14.Iizumi T, Battaglia T, Ruiz V, Perez GIP. Gut microbiome and antibiotics. Arch Med Res. 2017; 48: 727–734. doi: 10.1016/j.arcmed.2017.11.004 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref015] 15.Lambert PA. Cellular impermeability and uptake of biocides and antibiotics in Gram-positive bacteria and mycobacteria. J Appl Microbiol. 2002; 92: 46S–54S. doi: 10.1046/j.1365-2672.92.5s1.7.x [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref016] 16.Konstantinidis T, Tsigalou C, Karvelas A, Stavropoulou E, Voidarou C, Bezirtzoglou E. Effects of antibiotics upon the gut microbiome: a review of the literature. Biomedicines. 2020; 8: 502. doi: 10.3390/biomedicines8110502 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref017] 17.Wong M-L, Inserra A, Lewis MD, Mastronardi CA, Leong LEX, Choo J, et al. Inflammasome signaling affects anxiety-and depressive-like behavior and gut microbiome composition. Mol Psychiatr. 2016; 21: 797–805. doi: 10.1038/mp.2016.46 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref018] 18.Anhê FF, Roy D, Pilon G, Dudonné S, Matamoros S, Varin TV, et al. A polyphenol-rich cranberry extract protects from diet-induced obesity, insulin resistance and intestinal inflammation in association with increased Akkermansia spp. population in the gut microbiota of mice. Gut. 2015; 64: 872–883. doi: 10.1136/gutjnl-2014-307142 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref019] 19.Schneeberger M, Everard A, Gómez-Valadés AG, Matamoros S, Ramírez S, Delzenne NM, et al. Akkermansia muciniphila inversely correlates with the onset of inflammation, altered adipose tissue metabolism and metabolic disorders during obesity in mice. Sci Rep. 2015; 5: 16643. doi: 10.1038/srep16643 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref020] 20.Dao MC, Everard A, Aron-Wisnewsky J, Sokolovska N, Prifti E, Verger EO, et al. Akkermansia muciniphila and improved metabolic health during a dietary intervention in obesity: relationship with gut microbiome richness and ecology. Gut. 2016; 65: 426–436. doi: 10.1136/gutjnl-2014-308778 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref021] 21.Reunanen J, Kainulainen V, Huuskonen L, Ottman N, Belzer C, Huhtinen H, et al. Akkermansia muciniphila adheres to enterocytes and strengthens the integrity of the epithelial cell layer. Appl Environ Microb. 2015; 81: 3655–3662. doi: 10.1128/AEM.04050-14 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref022] 22.Trevelline BK, Fontaine SS, Hartup BK, Koh KD. Conservation biology needs a microbial renaissance: a call for the consideration of host-associated microbiota in wildlife management practices. P R Soc Lond B-Bio. 2019; 286: 20182448. doi: 10.1098/rspb.2018.2448 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref023] 23.Chong R, Cheng Y, Hogg CJ, Belov K. Marsupial gut microbiome. Front Microbiol. 2020; 11: 1058. doi: 10.3389/fmicb.2020.01058 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref024] 24.Looft T, Allen HK. Collateral effects of antibiotics on mammalian gut microbiomes. Gut Microbes. 2012; 3: 463–467. doi: 10.4161/gmic.21288 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref025] 25.Costanzo SD, Murby J, Bates J. Ecosystem response to antibiotics entering the aquatic environment. Mar Pollut Bull. 2005; 51: 218–223. doi: 10.1016/j.marpolbul.2004.10.038 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref026] 26.Jobbins SE, Alexander KA. From whence they came—antibiotic-resistant Escherichia coli in African wildlife. J Wildlife Dis. 2015; 51: 811–820. doi: 10.7589/2014-11-257 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref027] 27.Callaway WA, Turner AA, Croshaw OB, Ferguson JA, Julson ZJN, Volp TM, et al. Melomys cervinipes (Rodentia: Muridae). Mammal Species. 2018; 50: 134–147. doi: 10.1093/mspecies/sey015 [DOI] [Google Scholar]

[pone.0281533.ref028] 28.National Health and Medical Research Council. Australian code for the care and use of animals for scientific purposes, 8th ed. Canberra: National Health and Medical Research Council; 2013.

[pone.0281533.ref029] 29.Bee M, Bernal X, Calisi R, Carere C, Carter T, Fuertbauer L, et al. Guidelines for the treatment of animals in behavioural research and teaching. Anim Behav. 2022; 183: i–xi. doi: 10.1016/S0003-3472(21)00389-4 [DOI] [Google Scholar]

[pone.0281533.ref030] 30.Rowell MK, Rymer TL. Innovation in a native Australian rodent, the fawn-footed mosaic-tailed rat (Melomys cervinipes). Anim Cogn. 2020; 23: 301–310. doi: 10.1007/s10071-019-01334-6 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref031] 31.Klindworth A, Pruesse E, Schweer T, Peplies J, Quast C, Horn M, et al. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next‐generation sequencing‐based diversity studies. Nucleic Acids Res. 2013; 41: e1. doi: 10.1093/nar/gks808 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref032] 32.McKnight DT, Huerlimann R, Bower DS, Schwarzkopf L, Alford RA, Zenger KR. Methods for normalizing microbiome data: an ecological perspective. Methods Ecol Evol. 2019; 10: 389–400. doi: 10.1111/2041-210X.13115 [DOI] [Google Scholar]

[pone.0281533.ref033] 33.Wei T, Simko V, Levy M, Xie Y, Jin Y, Zemla J. Package ‘corrplot’. https://peerj.com/articles/9945/Supplemental_Data_S10.pdf; accessed 10 October 2022.

[pone.0281533.ref034] 34.Noguchi K, Gel YR, Brunner E, Konietschke F. nparLD: An R software package for the nonparametric analysis of longitudinal data in factorial experiments. J Stat Softw. 2012; 50: 1–23. doi: 10.18637/jss.v050.i1225317082 [DOI] [Google Scholar]

[pone.0281533.ref035] 35.Ben-Shachar MS, Makowski D, Lüdecke D, Patil I, Wiernik BM, Kelley K, et al. Package ‘effectsize’. https://cran.r-project.org/web/packages/effectsize/effectsize.pdf; accessed 26 December 2022.

[pone.0281533.ref036] 36.McMurdie PJ, Holmes S. phyloseq: An R package for reproducible interactive analysis and graphics of microbiome census data. PLoS One. 2013; 8: e61217. doi: 10.1371/journal.pone.0061217 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref037] 37.Fish JA, Chai B, Wang Q, Sun Y, Brown CT, Tiedje JM, et al. FunGene: the functional gene pipeline and repository. Front Microbiol. 2013; 4: 291; doi: 10.3389/fmicb.2013.00291 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref038] 38.Eisenhofer R, Minich JJ, Marotz C, Cooper A, Knight R, Weyrich LS. Contamination in low microbial biomass microbiome studies: issues and recommendations. Trends Microbiol. 2019; 27: 105–117. doi: 10.1016/j.tim.2018.11.003 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref039] 39.Yim G, Wang HH, Davies J. The truth about antibiotics. Int J Med Microbiol. 2006; 296: 163–170. doi: 10.1016/j.ijmm.2006.01.039 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref040] 40.Ianiro G, Tilg H, Gasbarrini A. Antibiotics as deep modulators of gut microbiota: between good and evil. Gut. 2016; 65: 1906–1915. doi: 10.1136/gutjnl-2016-312297 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref041] 41.Jalanka J, Salonen A, Salojärvi J, Ritari J, Immonen O, Marciani L, et al. Effects of bowel cleansing on the intestinal microbiota. Gut. 2015; 64: 1562–1568. doi: 10.1136/gutjnl-2014-307240 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref042] 42.Murillo T, Schneider D, Fichtel C, Daniel R. Dietary shifts and social interactions drive temporal fluctuations of the gut microbiome from wild redfronted lemurs. ISME Comm. 2022; 2: 3. doi: 10.1038/s43705-021-00086-0 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref043] 43.Litvak Y, Byndloss MX, Tsolis RM, Bäumler AJ. Dysbiotic Proteobacteria expansion: a microbial signature of epithelial dysfunction. Curr Opin Microbiol. 2017; 39: 1–6. doi: 10.1016/j.mib.2017.07.003 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref044] 44.Rizzatti G, Lopetuso LR, Gibiino G, Binda C, Gasbarrini A. Proteobacteria: a common factor in human diseases. BioMed Res Int. 2017; 2017: 9351507. doi: 10.1155/2017/9351507 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref045] 45.Shao H, Zhang C, Xiao N, Tan Z. Gut microbiota characteristics in mice with antibiotic-associated diarrhea. BMC Microbiol. 2020; 20: 313. doi: 10.1186/s12866-020-01999-x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref046] 46.Shin NR, Whon TW, Bae JW. Proteobacteria: microbial signature of dysbiosis in gut microbiota. Trends Biotechnol. 2015; 33: 496–503. doi: 10.1016/j.tibtech.2015.06.011 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref047] 47.Dubourg G, Lagier JC, Armougom F, Robert C, Audoly G, Papazian L, et al. High-level colonisation of the human gut by Verrucomicrobia following broad-spectrum antibiotic treatment. Int J Antimicrob Ag. 2013; 41: 149–155. doi: 10.1016/j.ijantimicag.2012.10.012 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref048] 48.Weingarden AR, Chen C, Bobr A, Yao D, Lu Y, Nelson VM, et al. Microbiota transplantation restores normal fecal bile acid composition in recurrent Clostridium difficile infection. Am J Physiol-Gastr L. 2014; 306: G310–G319. doi: 10.1152/ajpgi.00282.2013 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref049] 49.Anderson JR, Carroll I, Azcarate-Peril MA, Rochette AD, Heinberg LJ, Peat C, et al. A preliminary examination of gut microbiota, sleep, and cognitive flexibility in healthy older adults. Sleep Med. 2017; 38: 104–107. doi: 10.1016/j.sleep.2017.07.018 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref050] 50.Xavier KB. Bacterial interspecies quorum sensing in the mammalian gut microbiota. C R Biol. 2018; 341: 297–299. doi: 10.1016/j.crvi.2018.03.006 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref051] 51.Stojanov S, Berlec A, Štrukelj B. The influence of probiotics on the firmicutes/bacteroidetes ratio in the treatment of obesity and inflammatory bowel disease. Microorganisms. 2020; 8: 1715. doi: 10.3390/microorganisms8111715 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref052] 52.Kim HB, Borewicz K, White BA, Singer RS, Sreevatsan S, Tu ZJ, Microbial shifts in the swine distal gut in response to the treatment with antimicrobial growth promoter, tylosin. P Natl A Sci USA. 2012; 109: 15485–15490. doi: 10.1073/pnas.1205147109 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref053] 53.Pajarillo EAB, Chae JP, Balolong MP, Kim HB, Seo KS, Kang DK. Characterization of the fecal microbial communities of Duroc pigs using 16S rRNA gene pyrosequencing. Asian Austral J Anim Sci. 2015; 28: 584–591. doi: 10.5713/ajas.14.0651 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref054] 54.Dong L, Meng L, Liu H, Wu H, Schroyen M, Zheng N, et al. Effect of cephalosporin treatment on the microbiota and antibiotic resistance genes in feces of dairy cows with clinical mastitis. Antibiotics. 2022; 11: 117. doi: 10.3390/antibiotics11010117 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref055] 55.Dai ZF, Ma XY, Yang RL, Wang HC, Xu DD, Yang JN, et al. Intestinal flora alterations in patients with ulcerative colitis and their association with inflammation. Exp Ther Med. 2021; 22: 1322. doi: 10.3892/etm.2021.10757 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref056] 56.Walker AW, Sanderson JD, Churcher C, Parkes GC, Hudspith BN, Rayment N, et al. High-throughput clone library analysis of the mucosa-associated microbiota reveals dysbiosis and differences between inflamed and non-inflamed regions of the intestine in inflammatory bowel disease. BMC Microbiol. 2011; 11: 7. doi: 10.1186/1471-2180-11-7 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref057] 57.Thomas M, Webb M, Ghimire S, Blair A, Olson K, Fenske GJ, et al. Metagenomic characterization of the effect of feed additives on the gut microbiome and antibiotic resistome of feedlot cattle. Sci Rep. 2017; 7: 12257. doi: 10.1038/s41598-017-12481-6 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref058] 58.Maurice CF, Knowles SCL, Ladau J, Pollard KS, Fenton A, Pedersen AB, et al. Marked seasonal variation in the wild mouse gut microbiota. ISME J. 2015; 9: 2423–2434. doi: 10.1038/ismej.2015.53 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref059] 59.Yu M, Mu C, Zhang C, Yang Y, Su Y, Zhu W. Marked response in microbial community and metabolism in the ileum and cecum of suckling piglets after early antibiotics exposure. Front Microbiol. 2018; 9: 1166. doi: 10.3389/fmicb.2018.01166 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref060] 60.Bujňáková D, Puvača N, Ćirković I. Virulence factors and antibiotic resistance of Enterobacterales. Microorganisms. 2022; 10: 1588. doi: 10.3390/microorganisms10081588 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref061] 61.Zhang Q, Cheng L, Wang J, Hao M, Che H. Antibiotic-induced gut microbiota dysbiosis damages the intestinal barrier, increasing food allergy in adult mice. Nutrients. 2021; 13: 3315. doi: 10.3390/nu13103315 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref062] 62.Yao J, Carter RA, Vuagniaux G, Barbier M, Rosch JW, Rock CO. A pathogen-selective antibiotic minimizes disturbance to the microbiome. Antimicrob Agents Ch. 2016; 60: 4264–4273. doi: 10.1128/AAC.00535-16 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref063] 63.Du X, Liu J, Xue Y, Kong X, Lv C, Li Z, et al. Alteration of gut microbial profile in patients with diabetic nephropathy. Endocrine. 2021; 73: 71–84. doi: 10.1007/s12020-021-02721-1 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref064] 64.Winther SA, Henriksen P, Vogt JK, Hansen TH, Ahonen L, Suvitaival T, et al. Gut microbiota profile and selected plasma metabolites in type 1 diabetes without and with stratification by albuminuria. Diabetologia. 2020; 63: 2713–2724. doi: 10.1007/s00125-020-05260-y [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref065] 65.Dey N, Soergel DA, Repo S, Brenner SE. Association of gut microbiota with post-operative clinical course in Crohn’s disease. BMC Gastroenterol. 2013; 13: 131. doi: 10.1186/1471-230X-13-131 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref066] 66.Gevers D, Kugathasan S, Denson LA, Vázquez-Baeza Y, Van Treuren W, Ren B, et al. The treatment-naive microbiome in new-onset Crohn’s disease. Cell Host Microbe. 2014; 15: 382–392. doi: 10.1016/j.chom.2014.02.005 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref067] 67.Zhao Y, Wu J, Li JV, Zhou NY, Tang H, Wang Y. Gut microbiota composition modifies fecal metabolic profiles in mice. J Proteome Res. 2013; 12: 2987–2999. doi: 10.1021/pr400263n [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref068] 68.Palm NW, de Zoete MR, Cullen TW, Barry NA, Stefanowski J, Hao L, et al. Immunoglobulin A coating identifies colitogenic bacteria in inflammatory bowel disease. Cell 2014; 158, 1000–1010. doi: 10.1016/j.cell.2014.08.006 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref069] 69.Allan N, Knotts TA, Pesapane R, Ramsey JJ, Castle S, Clifford D, et al. Conservation implications of shifting gut microbiomes in captive-reared endangered voles intended for reintroduction into the wild. Microorganisms. 2018; 6: 94. doi: 10.3390/microorganisms6030094 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref070] 70.Liu Y, Liu B, Liu C, Hu Y, Liu C, Li X, et al. Differences in the gut microbiomes of dogs and wolves: roles of antibiotics and starch. BMC Vet Res. 2021; 17: 112. doi: 10.1186/s12917-021-02815-y [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref071] 71.Martínez-Mota R, Kohl KD, Orr TJ, Dearing MD. Natural diets promote retention of the native gut microbiota in captive rodents. ISME J. 2020; 14: 67–78. doi: 10.1038/s41396-019-0497-6 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref072] 72.Xie G, Wu Y, Zheng T, Shen K, Tan Z. Effect of Debaryomyces hansenii combined with Qiweibaizhu powder extract on the gut microbiota of antibiotic-treated mice with diarrhea. 3 Biotech. 2020; 10: 127. doi: 10.1007/s13205-020-2121-x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref073] 73.Wu H, Chen Q, Liu J, Chen X, Luo H, Ye Z, et al. Microbiome analysis reveals gut microbiota alteration in mice with the effect of matrine. Microb Pathogenesis. 2021; 156: 104926. doi: 10.1016/j.micpath.2021.104926 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref074] 74.Bellés A, Aguirre-Ramírez D, Abad I, Parras-Moltó M, Sánchez L, Grasa L. Lactoferrin modulates gut microbiota and Toll-like receptors (TLRs) in mice with dysbiosis induced by antibiotics. Food Funct. 2022; 13: 5854–5869. doi: 10.1039/d2fo00287f [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref075] 75.Bridgewater LC, Zhang C, Wu Y, Hu W, Zhang Q, Wang J, et al. Gender-based differences in host behavior and gut microbiota composition in response to high fat diet and stress in a mouse model. Sci Rep. 2017; 7: 10776. doi: 10.1038/s41598-017-11069-4 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref076] 76.Kozik AJ, Nakatsu CH, Chun H, Jones-Hall YL. Age, sex, and TNF associated differences in the gut microbiota of mice and their impact on acute TNBS colitis. Exp Mol Pathol. 2017; 103: 311–319. doi: 10.1016/j.yexmp.2017.11.014 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref077] 77.Harrison CA, Laubitz D, Ohland CL, Midura-Kiela MT, Patil K, Besselsen DG, et al. Microbial dysbiosis associated with impaired intestinal Na⁺/H⁺ exchange accelerates and exacerbates colitis in ex-germ free mice. Mucosal Immunol. 2018; 11: 1329–1341. doi: 10.1038/s41385-018-0035-2 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref078] 78.Bajaj JS, Heuman DM, Sanyal AJ, Hylemon PB, Sterling RK, Stravitz RT, et al. Modulation of the metabiome by rifaximin in patients with cirrhosis and minimal hepatic encephalopathy. PLOS ONE. 2013; 8: e60042. doi: 10.1371/journal.pone.0060042 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref079] 79.Omori M, Maeda S, Igarashi H, Ohno K, Sakai K, Yonezawa T, et al. Fecal microbiome in dogs with inflammatory bowel disease and intestinal lymphoma. J Vet Med Sci. 2017; 17: 1840–1847. doi: 10.1292/jvms.17-0045 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref080] 80.Singer M. Pathogen-pathogen interaction: a syndemic model of complex biosocial processes in disease. Virulence. 2010; 1: 10–18. doi: 10.4161/viru.1.1.9933 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref081] 81.Miller MB, Bassler BL. Quorum sensing in bacteria. Annu Rev Microbiol. 2001; 55: 165–199. doi: 10.1146/annurev.micro.55.1.165 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref082] 82.Bass D, Del Campo J. Microeukaryotes in animal and plant microbiomes: Ecologies of disease? Eur J Protistol. 2020; 76: 125719. doi: 10.1016/j.ejop.2020.125719 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref083] 83.Li K, Bihan M, Yooseph S, Methé BA. Analyses of the microbial diversity across the human microbiome. PLoS One. 2012; 7: e32118. doi: 10.1371/journal.pone.0032118 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref084] 84.Dietrich LE, Price‐Whelan A, Petersen A, Whiteley M, Newman DK. The phenazine pyocyanin is a terminal signalling factor in the quorum sensing network of Pseudomonas aeruginosa. Mol Microbiol. 2006; 61: 1308–1321. doi: 10.1111/j.1365-2958.2006.05306.x [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref085] 85.Wang Y, Wilks JC, Danhorn T, Ramos I, Croal L, Newman DK. Phenazine-1-carboxylic acid promotes bacterial biofilm development via ferrous iron acquisition. J Bacteriol. 2011; 193: 3606–3617. doi: 10.1128/JB.00396-11 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref086] 86.Rada B, Leto TL. Pyocyanin effects on respiratory epithelium: relevance in Pseudomonas aeruginosa airway infections. Trends Microbiol. 2013; 21: 73–81. doi: 10.1016/j.tim.2012.10.004 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref087] 87.Rojas LJ, Yasmin M, Benjamino J, Marshall SM, DeRonde KJ, Krishnan NP, et al. Genomic heterogeneity underlies multidrug resistance in Pseudomonas aeruginosa: a population-level analysis beyond susceptibility testing. PLoS One. 2022; 17: e0265129. doi: 10.1371/journal.pone.0265129 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref088] 88.Mavrodi DV, Bonsall RF, Delaney SM, Soule MJ, Phillips G, Thomashow LS. Functional analysis of genes for biosynthesis of pyocyanin and phenazine-1-carboxamide from Pseudomonas aeruginosa PAO1. J Bacteriol. 2001; 183: 6454–6465. doi: 10.1128/JB.183.21.6454-6465.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref089] 89.Evans EA, Kawli T, Tan MW. Pseudomonas aeruginosa suppresses host immunity by activating the DAF-2 insulin-like signaling pathway in Caenorhabditis elegans. PLoS Pathog. 2008; 4: e1000175. doi: 10.1371/journal.ppat.1000175 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref090] 90.Holifield K, Lazzaro DR. Case report: spontaneous Stenotrophomonas maltophilia keratitis in a diabetic patient. Eye Contact Lens. 2011; 37: 326–327. doi: 10.1097/ICL.0b013e3182146e26 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref091] 91.Zhuo C, Zhao QY, Xiao SN. The impact of spgM, rpfF, rmlA gene distribution on biofilm formation in Stenotrophomonas maltophilia. PLoS One. 2014; 9: e108409. doi: 10.1371/journal.pone.0108409 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref092] 92.Kim YJ, Jeon H, Na SH, Kwon HI, Selasi GN, Nicholas A, et al. Stenotrophomonas maltophilia outer membrane vesicles elicit a potent inflammatory response in vitro and in vivo. Pathog Dis. 2016; 74: ftw104. doi: 10.1093/femspd/ftw104 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref093] 93.Rood JI, Cole ST. Molecular genetics and pathogenesis of Clostridium perfringens. Microbiol Rev. 1991; 55: 621–648. doi: 10.1128/mr.55.4.621-648.1991 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref094] 94.Li J, Zhou Y, Yang D, Zhang S, Sun Z, Wang Y, et al. Prevalence and antimicrobial susceptibility of Clostridium perfringens in chickens and pigs from Beijing and Shanxi, China. Vet Microbiol. 2021; 252: 108932. doi: 10.1016/j.vetmic.2020.108932 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref095] 95.Bennur T, Kumar AR, Zinjarde S, Javdekar V. Nocardiopsis species: incidence, ecological roles and adaptations. Microbiol Res. 2015; 174: 33–47. doi: 10.1016/j.micres.2015.03.010 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref096] 96.Wickramage I, Spigaglia P, Sun X. Mechanisms of antibiotic resistance of Clostridioides difficile. J. Antimicrob Chemoth. 2021; 76: 3077–3090. doi: 10.1093/jac/dkab231 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref097] 97.Nwachuku E, Shan Y, Senthil-Kumar P, Braun T, Shadis R, Vu TQ. Toxic Clostridioides (formerly Clostridium) difficile colitis: no longer a diarrhea associated infection. Am J Surg. 2021; 221: 240–242. doi: 10.1016/j.amjsurg.2020.06.026 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref098] 98.Prechter F, Katzer K, Bauer M, Stallmach A. Sleeping with the enemy: Clostridium difficile infection in the intensive care unit. Crit Care. 2017; 21: 260. doi: 10.1186/s13054-017-1819-6 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref099] 99.Savidge TC, Pan WH, Newman P, O’Brien M, Anton PM, Pothoulakis C. Clostridium difficile toxin B is an inflammatory enterotoxin in human intestine. Gastroenterology. 2003; 125: 413–420. doi: 10.1016/S0016-5085(03)00902-8 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref100] 100.Pothoulakis C, Barone LM, Ely R, Faris B, Clark ME, Franzblau C, et al. Purification and properties of Clostridium difficile cytotoxin B. J Biol Chem. 1986; 261: 1316–1321. doi: 10.1016/S0021-9258(17)36093-3 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref101] 101.Just I, Selzer J, von Eichel-Streiber C, Aktories K. The low molecular mass GTP-binding protein Rho is affected by toxin A from Clostridium difficile. J Clin Invest. 1995; 95: 1026–1031. doi: 10.1172/JCI117747 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0281533.ref102] 102.Carter GP, Purdy D, Williams P, Minton NP. Quorum sensing in Clostridium difficile: analysis of a luxS-type signalling system. J Med Microbiol. 2005; 54: 119–127. doi: 10.1099/jmm.0.45817-0 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref103] 103.Sebaihia M, Wren BW, Mullany P, Fairweather NF, Minton N, Stabler R, et al. The multidrug-resistant human pathogen Clostridium difficile has a highly mobile, mosaic genome. Nat Genet. 2006; 38: 779–786. doi: 10.1038/ng1830 [DOI] [PubMed] [Google Scholar]

[pone.0281533.ref104] 104.Dawson LF, Valiente E, Faulds-Pain A, Donahue EH, Wren BW. Characterisation of Clostridium difficile biofilm formation, a role for Spo0A. PLoS One. 2012; 7: e50527. doi: 10.1371/journal.pone.0050527 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

The effects of antibiotics and illness on gut microbial composition in the fawn-footed mosaic-tailed rat (Melomys cervinipes)

Tasmin L Rymer

Neville Pillay

Roles

Abstract

Introduction

Materials and methods

Ethical note

Subjects

Sample collection and preparation

DNA extraction protocol

PCR amplification and amplicon sequencing protocols

Sample analysis

Statistical analysis

Results

Domain

Fig 1. Box and whisker plot of Domain Bacteria (%) in fawn-footed mosaic-tailed rat (Melomys cervinipes) faecal samples.

Phylum

Fig 2.

Class

Fig 3.

Order

Fig 4.

Family

Fig 5.

Bacterial community diversity and species of interest

Fig 6. Species diversity measures of the bacterial community in fawn-footed mosaic-tailed rat (Melomys cervinipes) faecal samples.

Discussion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Mohammad Tauqeer Alam

Roles

Author response to Decision Letter 0

Decision Letter 1

Mohammad Tauqeer Alam

Roles

Acceptance letter

Mohammad Tauqeer Alam

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases