Skip to main content
Journal of Taibah University Medical Sciences logoLink to Journal of Taibah University Medical Sciences
. 2023 Jan 5;18(4):831–841. doi: 10.1016/j.jtumed.2022.12.020

Virgin coconut oil reverses behavioral phenotypes of letrozole-model of PCOS in Wistar rats via modulation of NRF2 upregulation

Olabode O Akintoye a,, Ayodeji J Ajibare a, Idowu O Omotuyi b
PMCID: PMC9957901  PMID: 36852244

Abstract

Objectives

Polycystic ovarian syndrome (PCOS) is an endocrine disorder associated with insulin resistance, hyperandrogenism, and sub-infertility. Virgin coconut oil (VCO) has been reported to have health benefits, such as anti-inflammatory, anti-oxidant, and antiviral properties. This study investigated the effects of dietary VCO supplementation on memory and cognitive impairment in female rats with letrozole induced PCOS.

Methods

Thirty female rats were randomly divided into five groups. All rats except controls were treated with letrozole for 21 days to induce PCOS and were subsequently treated for 14 days with 10% VCO, clomiphene (CLO), or VCO + CLO. Three neurobehavioral tests were conducted: elevated plus maze, Y maze, and novel object recognition tests.

Results

Our results indicated statistically elevated serum concentrations of sex hormones in rats with PCOS, compared with the control and treated groups. In addition, all treated groups showed significant reversal of the low serum concentrations of catalase and down-regulated gene expression of Nrf2 in the hippocampus seen in the PCOS rats. In addition, gene expression of acetylcholine esterase was up-regulated in PCOS rats, and was statistically reverted in the VCO treated groups.

Conclusion

Anxiety-like behavior and impaired short-term memory were observed in PCOS rats; however, VCO supplementation reversed these effects by modulating the gene expression of Nrf2 and AchE.

Keywords: Acetylcholine esterase, Anxiety, Memory, Oxidative stress, Polycystic ovarian syndrome, Virgin coconut oil

Introduction

Polycystic ovarian syndrome (PCOS) is a heterogeneous clinical condition characterized by anovulation, metabolic imbalances, and endocrine and mental health abnormalities1. Globally, PCOS is responsible for approximately 10% of all cases of female infertility2; thus, clinical and pharmacological interventions are urgently required. Research is now focusing on delineating etiological pathways and possible drug targets for the treatment of PCOS.3,4 According to current understanding, PCOS is associated with hypothalamic inflammation linked to a redox imbalance, thus resulting in hypothalamic–pituitary–gonadal axis dysregulation, central obesity, insulin resistance, hyperandrogenism, and infertility.5, 6, 7 These underlying pathologies clinically manifest as cognitive and memory deficit, depression, anxiety disorder, and social phobia.1,8, 9, 10

Previous studies have reviewed the important role of the cholinergic system in memory and cognition.62 Acetylcholine esterase (AchE) inhibitors have shown great potential in the management of patients with cognitive disorders, such as those in multiple sclerosis.63

Redox imbalance, which is indicated by excess formation of oxidants from reactive oxygen species (ROS) in the absence of an adequate anti-oxidant defense system, has been associated with the pathogenesis of PCOS (Turrens, 2003). The Kelch-like ECH-associated protein 1 (Keap1)/nuclear factor erythroid 2-associated factor 2 (Nrf2) pathway plays a central role in redox balance. Activation of Nrf2 results in the downstream expression of several anti-oxidant genes such as heme oxygenase, superoxide dismutase (SOD) and catalase (Suzuki and Yamamoto, 2017; Bellezza et al., 2018).

Virgin coconut oil (VCO), produced from coconuts, is rich in medium-chain fatty acids, polyphenols, and flavonoids. This functional food has broad health benefits, including anti-inflammatory, anti-oxidant, and antiviral properties, which have been well documented in the literature.15

The current study evaluated VCO, whose role as a redox modulator has been well documented,2,3 in a letrozole model of PCOS. The results indicated that NRF2 gene upregulation was the mechanism underlying the reversal of behavioral phenotypes of PCOS in an experimental model.

Materials and Methods

Drugs

Clomiphene citrate tablets were purchased from Doppel Farmaceutici Sri Italy. Letrozole was purchased from Novartis Pharmaceuticals, India. SOD, prolactin, progesterone, estrogen, testosterone, luteinizing hormone (LH), follicle stimulating hormone (FSH), and gonadotropin-releasing hormone (GnRH) detection kits were purchased from Fortress diagnostics, United Kingdom.

Animals

Thirty virgin female Wistar rats (190–210 g) were purchased from Ekiti State University, Ado Ekiti, Ekiti State, Nigeria, and housed in the animal laboratory of the Physiology Department, Ekiti State University, Ado Ekiti, Ekiti State, Nigeria, at room temperature with a lighting schedule of 12 h light/12 h dark. Rats were fed rat chow and water ad libitum. This study was approved by the Ethics and Research Committee of the Faculty of Basic Medical Sciences, College of Medicine Ekiti State University, under protocol number EKSU/P100/2022/09/012, and followed the guidelines of the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH, 2011).

Preparation of virgin coconut oil and supplemented diet

VCO was prepared according to a previously described method.16 Briefly, fresh mature coconut was procured from a market in Ado-Ekiti, Ekiti State, Nigeria. The coconuts were grated, and their natural water was mixed and strained into a viscous paste until all creamy milk was released. The creamy milk was stored at room temperature for 48 h until adequate fermentation had occurred. Three layers were formed: a creamy mixture on top, VCO in the middle, and water on the bottom. The oil was gently collected and filtered into a container. The supplemented diet was subsequently prepared by weighing 10% w/w VCO from the freshly prepared oil, adding it to 90 g standard rat chow, and thoroughly mixing. The 10% VCO diets were mixed as needed.17

Experimental method

A total of 30 female rats were randomly divided into five groups (n = 6). Group 1 received 1 ml/kg of distilled water daily for 21 days. The remaining animals were administered 1 mg/kg letrozole daily for 21 days to induce PCOS18 and were further divided randomly into four groups. Group 2 received oral doses of 1 mg/kg of vehicle. Group 3 received clomiphene citrate at 1 mg/kg in 0.9% NaCl.19 Group 4 received a 10% VCO supplemented diet. Group 5 received clomiphene citrate and a 10% VCO supplemented diet. Except for group 1, all groups were treated for 15 days (from day 22–36).

Confirmation of PCOS with vaginal smear detection of the estrous cycle

Vaginal smears were performed for estrous cycle determination. The estrous cycle phase was studied through daily observations of vaginal smears of rats between 7 am and 9 am for 21 days, as previously reported (Kausaret al., 2021) Microscopic inspections of the vaginal smears of rats with polycystic ovarian cysts demonstrated a diestrous phase with a predominant leukocyte cell type, thus confirming the anovulatory status of the animals.

Behavioral tests

All tests were conducted in the physiology experimental room on experimental day 35 (elevated plus maze and Y maze) and day 36 (novel object recognition) within the hours of 7:00 pm to 11:00 pm daily.

Elevated plus maze test

The animals were tested for anxiety with an elevated plus maze20 on experimental day 35. The maze was constructed from black plywood. The four arms were elevated 80 cm above the plane surface and consisted of two opposing open arms (45 × 10 cm) and two opposing closed arms with similar dimensions (50 cm wall height). On the test day, each rat was placed at the central platform of the maze facing the open arm and was allowed to explore the arms for 5 min. A blinded observer recorded the time spent in either the open or closed arm in seconds, as well as the number of entries into the arms. The percentage time spent in open arms was calculated as the total time spent in an open arm/300 s × 100. The percentage entry was calculated as (total open arm entry/total number of entries into both arms) × 100, and was also applicable to the closed arms. The anxiety index was calculated as 1 − [(time spent in open arms/total time spent) + (open arm entries/total entries)]/2. Entry was assumed when the four limbs of a rat were completely inside the particular arm.

Y maze

The animals’ short-term working memory was evaluated with the Y maze apparatus.21 A smooth plywood structure comprised three arms (25 × 10 × 75 cm) with 120° between them.

On the experimental day, each rat was placed at the center of the maze and allowed to explore the three arms for exactly 6 min. A blinded observer recorded the pattern of arm entries, which were initially designated A, B, and C. Normally, rats are expected to visit a relatively new arm and not return to the arm that they just came from or a recently visited arm. Thus, a rat with a higher visit sequence of arms A, B, and C consecutively without repetition is considered to show spontaneous alternation performance (SAP) indicating better short-term memory performance. The %SAP was calculated as (number of SAP)/(total number of arm entries – 2) × 100. Entry was assumed when the four limbs of a rat were completely inside a particular arm. Between tests, the maze was cleaned with ethanol (20%) soaked cotton wool, then allowed to dry properly before use for the next rodent.

Novel object recognition tests

Cognitive performance was examined with the novel object recognition task experimental approach.22 This procedure has three separate phases. First was the habituation phase, in which each rat was allowed to freely explore an empty test arena (70 × 25 × 50 cm) for 10 min on experimental days 34 and 35. Next was the familiarization phase, wherein the rat was placed in the test chamber, in which two familiar objects (red toy of similar size and shape) were placed in two adjacent corners. The rat was allowed to explore the objects for 10 min and then was returned to its cage. The last phase, performed 1 h after the prior phase, included new similar toys that had the same shape, size, and color (novel objects) but were different from the two previous familiar objects (in shape and color), and were placed at adjacent corners of the chamber. Thus, a total of four objects were placed in the chamber: two similar familiar objects and two similar novel objects. Each rat was allowed to explore freely for 5 min. The time spent exploring each object was monitored and recorded with a camera placed on the roof of the chamber. The recognition ratio was calculated as the time spent exploring the novel object divided by the total time spent exploring both objects.

Between tests, the chamber was cleaned with ethanol (20%) soaked cotton wool, then allowed to dry properly before use for the next rodent, to eliminate olfactory memory.

Biochemical analysis

Blood samples were collected from the experimental rats through retro-orbital puncture 24 h after the last treatment dose. The blood samples were stored in universal bottles, separated by centrifugation at 3000 rpm/min for 15 min, and frozen at 20 °C until hormonal assays of GnRH, FSH, LH, testosterone, estrogen, and SOD, according to the manufacturer's instructions.

Gene expression in brain tissue

According to the manufacturer's protocol, for each group, the brain (hippocampus) was harvested in TRIzol reagent (Thermo Fisher Scientific) and was used for total RNA isolation. The extracted RNA was subjected to DNase I treatment (Thermo Fisher Scientific). DNA-free RNA was then transcribed into cDNA with a ProtoScript® First Strand cDNA Synthesis Kit (NEB). PCR amplification was performed with OneTaq® 2X Master Mix (NEB)23 with forward and reverse primer sets for Nrf2, nuclear factor-kappa B (NFKB), and AchE.

ENE Forward primer Reverse primer
NRF2 GTCAGCTACTCCCAGGTTGC CAGGGCAAGCGACTGAAATG
AchE ACGTGAGCCTGAACCTGAAG CTCGTCCAGCGTGTCTGTG

Statistical analysis

Bar graphs were plotted to reflect mean ± SEM (n = 6) values of the gene/β-actin ratio of the gel (1.5% agarose in TAE buffer) image for each sample, as computed in ImageJ. The photographs are representative snapshots of pooled samples. For statistical analysis, GraphPad Prism version 9 was used to perform one-way analysis of variance (ANOVA) followed by post hoc Tukey tests. The statistical significance threshold was set at p < 0.05.

Results

Figure 1 indicated statistically elevated serum concentrations of GnRH, FSH, and LH in the PCOS rats compared with the control and treated groups, thus reflecting the physiological negative feedback response to significantly low serum levels of estradiol in the PCOS rats. Compared with rats receiving standard drug treatment, rats treated with only VCO showed significantly lower levels of anterior pituitary hormones (p = 0.0487 and 0.0285, respectively) and statistical reversion of serum estradiol and testosterone levels (p = 0.0002 and < 0.0001, respectively). Animals receiving combined treatment showed no significant improvements over VCO only treated rats.

Figure 1.

Figure 1

Hypothalamic-Pituitary-Gonadal Axis. Data are expressed are means ± SEM, n = 6. Data were analyzed with one-way way analysis of variance (ANOVA) followed by Tukey's multiple post hoc test. p < 0.05. PCOS (polycystic ovarian syndrome); CLO (clomiphene); VCO (virgin coconut oil); GnRH (gonadotropin releasing hormone); FSH (follicle stimulating hormone); LH (luteinizing hormone)

Hypothalamic-Pituitary-Gonadal Axis.64

Figure 1 data are expressed are means ± SEM, n = 6. Data were analyzed with one-way way analysis of variance (ANOVA) followed by Tukey's multiple post hoc test. p < 0.05. PCOS (polycystic ovarian syndrome); CLO (clomiphene); VCO (virgin coconut oil); GnRH (gonadotropin releasing hormone); FSH (follicle stimulating hormone); LH (luteinizing hormone).

Our results in Figure 2A and B indicated that all treated groups showed significant reversal of the low serum concentrations of catalase and SOD observed in the PCOS group. However, the group receiving combined treatment showed a statistically higher concentration than the other two treated groups (p = 0.0075 and 0.0119, respectively) in Figure 2A. The down-regulated gene expression of Nrf-2 in PCOS rats, as shown in Figure 1B, was also statistically reversed in the VCO, CLO, and CLO + VCO treated groups.

Figure 2.

Figure 2

Anti-oxidant properties of VCO in rats with letrozole induced PCOS. (A and B): Serum concentrations of catalase and SOD, respectively, expressed as mean ± SEM, n = 6. Data were analyzed with one-way way analysis of variance (ANOVA) followed by Tukey's multiple post hoc test. PCOS (polycystic ovarian syndrome); CLO (clomiphene); VCO (virgin coconut oil); SOD (superoxide dismutase). C: Brain (hippocampus) homogenate anti-oxidant gene expression in the control, PCOS, and treatment groups. Values of quantified bands from each sample for the indicated genes across the five groups are expressed as mean ± SEM, n = 6. Data were analyzed with one-way way analysis of variance (ANOVA) followed by Tukey's multiple post hoc test. The gel image is representative of the pooled samples. (Each bar graph represents control normalized relative expression (specific gene/β-actin). PCOS (polycystic ovarian syndrome); CLO (clomiphene); VCO (virgin coconut oil); NFR-2 (nuclear factor-erythroid related factor 2)

Figure 2 (A and B): Serum concentrations of catalase and SOD, respectively, expressed as mean ± SEM, n = 6. Data were analyzed with one-way way analysis of variance (ANOVA) followed by Tukey's multiple post hoc test. PCOS (polycystic ovarian syndrome); CLO (clomiphene); VCO (virgin coconut oil); SOD (superoxide dismutase). C: Brain (hippocampus) homogenate anti-oxidant gene expression in the control, PCOS, and treatment groups. Values of quantified bands from each sample for the indicated genes across the five groups are expressed as mean ± SEM, n = 6. Data were analyzed with one-way way analysis of variance (ANOVA) followed by Tukey's multiple post hoc test. The gel image is representative of the pooled samples. (Each bar graph represents control normalized relative expression (specific gene/β-actin). PCOS (polycystic ovarian syndrome); CLO (clomiphene); VCO (virgin coconut oil); NFR-2 (nuclear factor-erythroid related factor 2).

The high serum levels of IL-1B in PCOS rats, as shown in Figure 3, were statistically reversed in VCO, CLO, and CLO + VCO treated animals.

Figure 3.

Figure 3

All treatment groups demonstrate relatively potent anti-inflammatory properties in rats with letrozole induced PCOS. Serum concentration of IL-1B, expressed as mean ± SEM, n = 6. Data were analyzed with one-way way analysis of variance (ANOVA) followed by Tukey's multiple post hoc test. PCOS (polycystic ovarian syndrome); CLO (clomiphene); VCO (virgin coconut oil); IL-1β (interleukin 1-beta)

Figure 3 Serum concentration of IL-1B, expressed as mean ± SEM, n = 6. Data were analyzed with one-way way analysis of variance (ANOVA) followed by Tukey's multiple post hoc test. PCOS (polycystic ovarian syndrome); CLO (clomiphene); VCO (virgin coconut oil); IL-1β (interleukin 1-beta).

The PCOS rats showed a statistically evident anxiety-like behavior, which was reversed in the VCO only and VCO + CLO treatment groups (Table 1). Statistically, PCOS rats spent little time in the open arm and the most time in the closed arm, as compared with the VCO and CLO + VCO groups (p = 0.0005 and <0.0001) (p = 0.0017 and <0.0001), respectively. The standard drug showed the same trend in the diseased rats. The PCOS + CLO + VCO rats showed statistically greater cognitive stability than the VCO only treated rats (p = 0.0379).

Table 1.

Behavioral effects on rats with letrozole induced PCOS in the elevated plus maze test.

Control PCOS PCOS + CLO PCOS + VCO PCOS + CLO + VCO
%Time (Open) 55.17 ± 2.7 9.33 ± 1.5a 8.33 ± 0.9a 25.2 ± 2.0abc 39.83 ± 3.3abcd
%Time (Closed) 43.0 ± 3.4 90.5 ± 1.6a 91 ± 1.3a 75 ± 2.0abc 60.17 ± 3.3abcd
%Open Arm Entry 67.7 ± 5.0 12.5 ± 5.59a 11.83 ± 7.5a 47.2 ± 3.83bc 57.5 ± 4.0bc
%Closed Arm Entry 32.2 ± 4.9 88 ± 5.4a 88.3 ± 7.8a 52.7 ± 3.7bc 42.5 ± 4.0bc
Anxiety Index 0.38 ± 0.03 0.9 ± 0.02a 0.9 ± 0.03a 0.64 ± 0.02abc 0.52 ± 0.02abcd

Data expressed are means ± SEM, n = 6. Data were analyzed with one-way way analysis of variance (ANOVA) followed by Tukey's multiple post hoc test. a, b, c, d: p < 0.05 vs control, PCOS, PCOS + CLO, PCOS + VCO, and PCOS + CLO + VCO, respectively. PCOS (polycystic ovarian syndrome); CLO (clomiphene); VCO (virgin coconut oil); % (percentage).

As shown in Table 2, rats treated with CLO and VCO only spent a significantly higher proportion of time exploring the novel object than did rats in the PCOS group and the group receiving combined treatment (p = <0.0001, <0.0001, <0.0001, and <0.0001, respectively). Similar trends were observed in the calculated recognition ratio results. SAP tests (Figure 4A and B) showed that the CLO and VCO only treatments statistically reversed the short-term memory deficits observed in the diseased group and combined treatment group.

Table 2.

Behavioral effects in rats with letrozole induced PCOS in novel object recognition tests.

Control PCOS PCOS + CLO PCOS + VCO PCOS + CLO + VCO
Ex. Familiar (Sec) 107 ± 4.8 154.5 ± 2.7a 95.2 ± 2.8b 91.7 ± 3.3b 160 ± 4.5acd
Ex. Novel (Sec) 154.2 ± 3.8 113.2 ± 2.8a 170 ± 4.6b 169.7 ± 4.1b 95.2 ± 7.1acd
Rec Ratio 0.59 ± 0.01 0.42 ± 0.01a 0.61 ± 0.01b 0.64 ± 0.01b 0.37 ± 0.02acd

Data expressed are means ± SEM, n = 6. Data were analyzed with one-way way analysis of variance (ANOVA) followed by Tukey's multiple post hoc test. a, b, c, d: p < 0.05 vs control, PCOS, PCOS + CLO, PCOS + VCO, and PCOS + CLO + VCO, respectively. PCOS (polycystic ovarian syndrome); CLO (clomiphene); VCO (virgin coconut oil); Ex (Exploration time); Rec Ratio (recognition ratio).

Figure 4.

Figure 4

VCO reverses anxiety-like behavior in rats with letrozole induced PCOS compared with clomiphene treated animals. Effects of VCO in short-term memory cognitive functional tests and Y-maze assessment tests in female rats with letrozole induced PCOS. Data are expressed as mean ± SEM, n = 6. Data were analyzed with one-way way analysis of variance (ANOVA) followed by Tukey's multiple post hoc test. PCOS (polycystic ovarian syndrome); CLO (clomiphene); VCO (virgin coconut oil); SAP (spontaneous alternation performance) SAP% (spontaneous alternation performance ratio)

Figure 4 effects of VCO in short-term memory cognitive functional tests and Y-maze assessment tests in female rats with letrozole induced PCOS. Data are expressed as mean ± SEM, n = 6. Data were analyzed with one-way way analysis of variance (ANOVA) followed by Tukey's multiple post hoc test. PCOS (polycystic ovarian syndrome); CLO (clomiphene); VCO (virgin coconut oil); SAP (spontaneous alternation performance) SAP% (spontaneous alternation performance ratio).

Figure 5 VCO and CLO reverse the up-regulation of acetylcholine esterase observed in rats with letrozole induced PCOS

Figure 5.

Figure 5

VCO showed an optimizing effect on the short-term memory deficits seen in rats with letrozole induced PCOS. Brain (hippocampus) homogenate gene expression in the control, PCOS, and treatment groups. Values of quantified bands from each sample for the indicated inflammatory genes across the five groups are expressed as mean ± SEM, n = 6. Data were analyzed with one-way analysis of variance (ANOVA) followed by Tukey's multiple post hoc test. The gel image is representative of the pooled samples. (Each bar graph represents control normalized relative expression (specific gene/β-actin). PCOS (polycystic ovarian syndrome); CLO (clomiphene); VCO (virgin coconut oil); AchE (acetylcholine esterase)

Our results indicated up-regulated gene expression of AchE in PCOS rats (Figure 5). This effect was statistically reverted in the VCO and CLO and CLO + VCO treated groups (p ≤ 0.0001, <0.0001, and <0.0001, respectively). No synergistic effect of CLO and VCO was observed, because single doses resulted in lower mRNA expression of AchE than that observed in the combined treatment rats.

Figure 5 Brain (hippocampus) homogenate gene expression in the control, PCOS, and treatment groups. Values of quantified bands from each sample for the indicated inflammatory genes across the five groups are expressed as mean ± SEM, n = 6. Data were analyzed with one-way analysis of variance (ANOVA) followed by Tukey's multiple post hoc test. The gel image is representative of the pooled samples. (Each bar graph represents control normalized relative expression (specific gene/β-actin). PCOS (polycystic ovarian syndrome); CLO (clomiphene); VCO (virgin coconut oil); AchE (acetylcholine esterase).

Discussion

The treatment of PCOS has been classified into (1) nonpharmacological treatments (such as dietary modification and exercise) that cause a relative decrease in body weight, insulin resistance, and generation of oxidative and pro-inflammatory cytokines, thereby indirectly diminishing the neurological manifestations of PCOS, and (2) pharmacological treatments, which are often used to supplement nonpharmacological treatments.24,25

This experiment was designed to investigate the effects of VCO as am oral dietary supplement on memory and cognitive impairment in female rats with letrozole induced PCOS.

Our diagnosis of PCOS was based on biochemical evidence of sex hormonal dysfunction and hyperandrogenism,26,27 in agreement with the Rotterdam criteria of 2003 (Rotterdam, 2003).28 Our results showed that letrozole-only treated animals had significantly elevated serum GnRH, LH, and testosterone, and low FSH values. These effects were ameliorated by VCO treatment, which restored the hypothalamic–pituitary–gonadal axis, a physiological endocrine pathway that is essential in the pathogenesis of PCOS.29 Of note, VCO-only treated rats showed better treatment efficacy than clomiphene-only treated rats. In contrast, the combined treatment group showed the statistically lowest efficacy, as compared with the other treatment groups.

Strong links exist among obesity, redox oxygen imbalances, chronic low-grade inflammation,30 and disruption in neural pathways in the hypothalamus. These pathways involve Kisspeptin-neurokinin B and dynorphin neurons (KNDγ). Kisspeptin-neurokinin B, when activated, increases GnRH pulsatility, whereas activation of dynorphin neurons inhibits this effect.31 Moreover, the melanocortin system, which drives the energy balance at the cellular level,32 comprises the leptin-pro-opiomelanocortin (POMC)-melanocyte-stimulating hormone-melanocortin 3/4 (MC3/4R) receptor in the hypothalamus, producing anorectic behavior after eating,33,34 and insulin activation of the orexigenic Agouti-related protein (AgRP) expression inhibits gene expression of POMC, thereby increasing food intake behavior.35

Generalized chronic low-grade inflammation leads to activation of several inflammatory pathways locally in the hypothalamus that result in potentiation of AgRP neurons and leptin resistance,36 thereby increasing insulin resistance,37,38 endoplasmic reticulum stress, and mitochondrial dysfunction and regeneration defects39,40 in brain neurons and microglia.37 In addition, poor hypothalamic–pituitary–gonadal axis control, poor hypothalamic glucose homeostasis control, and diminished memory and cognitive function41,42 are observed in PCOS.43,44

The overt generation of free radical oxygen activates Nrf2, thus leading to the generation and release of antioxidants (catalase and SOD), which are used by the body to combat ROS generation via NRSF/ARE mechanisms.23 Our work indicated that oral VCO supplementation potentiated this pathway, thus resulting in statistically higher Nrf2 gene expression in the frontal brain lobe, and higher catalase and SOD serum levels than those in the PCOS rats. Likewise, VCO demonstrated good anti-inflammatory properties, as previously reported,45 by decreasing the serum concentration of IL-1β below those in diseased animals. This efficacy was similar between the control drug and the combined treatment.

Beyond its role in glucose homeostasis, insulin has been identified to play crucial roles in cognition,46 learning, and memory, by promoting neural and microglial growth47 and the release of neurotransmitters including AchE,46,48 and supporting hippocampal synaptic plasticity.49 Thus, the insulin resistance associated with PCOS tends to negatively affect cognition. In addition, we postulated that the brain neural oxidative and chronic inflammation status in PCOS accompanies memory impairment and cognitive dysfunction. Our results indicated that VCO treated animals showed greater mood stability than clomiphene treated and PCOS rats as they explored the open arm. Notably, a synergistic response was observed in animals receiving combined treatment.

Likewise, VCO and clomiphene restored the short-term memory impairment in the letrozole-only treated rats. Nevertheless, no synergistic effect was observed between VCO and clomiphene, as noted in the case of the anxiety response. In contrast, clomiphene (a selective estrogen receptor modulator) has been found to ameliorate memory impairment.50,51 One possible mechanism is modulation of the AchE enzyme, which has not previously been reported. The clomiphene and VCO treated animals had statistically lower gene expression of AchE than the diseased and combined treated animals. In line with our results, several findings have implicated a defective brain cholinergic system in the pathophysiology of dementia and Alzheimer's disease.52,53 Islam et al., 201754 have also reported that the memory and learning impairments seen in older people and patients with Alzheimer's disease are closely associated with low acetylcholine and elevated AchE activity at the synapses. This neurological finding is strongly associated with a high oxidative stress state in the brain cells (neurons and supporting cells, such as glia cells and astrocytes).55

The antioxidant and anti-inflammatory effects of VCO are well supported by the scientific literature56,57; consequently, VCO has been considered as a routine daily food supplement.58,59 Furthermore, its phytochemical properties include those of P-coumaric and ferulic phenolic compounds, which have been documented to have potent anti-oxidant and anti-inflammatory effects.60,61 VCO also contains flavonoids and polyphenols, which are good free radical scavengers that might have contributed to the neuroprotective effects of VCO observed in this study. Ultimately, this study indicated the upstream mopping up of generated free radicals and attenuation of the chronic low-grade inflammation by VCO, which directly or indirectly resulted in PCOS and its various clinical reproductive and non-reproductive manifestations, such as impaired short-term memory and impaired cognitive function.

Conclusion

This study demonstrated anxiety-like behavior and impaired short-term memory via redox oxygen imbalance and chronic low-grade inflammation, which up-regulated AchE gene expression in the brain. However, oral VCO supplementation ameliorated the hormonal imbalance and neurotoxic manifestations of PCOS by modulating Nrf2 and AchE gene expression.

Source of funding

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Conflict of interest

The authors have no conflict of interest to declare.

Ethical approval

Ethical approval was obtained from the Ekiti State University (reference number EKSU/P100/2022/09/012) with a date of approval of November 16, 2021.

Authors’ contributions

OOA and AJA were responsible for the conceptualization of this study and the acquisition of relevant data. All aspects of the study were undertaken, carefully examined, reviewed, and approved by both authors. They are both responsible for the content of the manuscript. All authors have critically reviewed and approved the final draft and are responsible for the content and similarity index of the manuscript.

Footnotes

Peer review under responsibility of Taibah University.

Contributor Information

Olabode O. Akintoye, Email: olabode.akintoye@eksu.edu.ng.

Ayodeji J. Ajibare, Email: ajibare.ayodeji@eksu.edu.ng.

References

  • 1.Ethirajulu A., Alkasabera A., Onyali C.B., Anim-Koranteng C., Shah H.E., Bhawnani N., et al. 2021. Insulin resistance, hyperandrogenism, and its associated symptoms are the precipitating factors for depression in women with polycystic ovarian syndrome. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Morgante G., Massaro M.G., Di Sabatino A., Capppelli V., De Leo V. Therapeutic approach for metabolic disorders and infertility in woman with PCOS. Gynecol Endocrinol. 2018;34(1):4–9. doi: 10.1080/09513590.2017.1370644. [DOI] [PubMed] [Google Scholar]
  • 3.Witchel S.F., Oberfield S.E., Pena A.S. Polycystic ovary syndrome; pathophysiology, presentation, and treatment with emphasis on adolescent girls. J Endocr Soc. 2019;3(8):1545–1573. doi: 10.1210/js.2019-00078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Barlampa D., Bompoula M.S., Bargiota A., Kalantaridou S., Mastorakos G., Valsamakis G. Hypothalamic inflammation as a potential pathophysiologic basis for the heterogeneity of clinical, hormonal, and metabolic presentation in PCOS. Nutrients. 2021;13:520. doi: 10.3390/nu13020520. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Rodriguez-Paris D., Remlinger-Molenda A., Kurzawa R., et al. Psychiatric disorders in women with polycystic ovary syndrome. Psychiatr Pol. 2019;53:955–966. doi: 10.12740/PP/OnlineFirst/93105. [DOI] [PubMed] [Google Scholar]
  • 6.Greenwood E.A., Pasch L.A., Cedars M.I., Legro R.S., Eisenberg E., Huddleston H.G. Insulin resistance is associated with depression risk in polycystic ovary syndrome. Fertil Steril. 2018;110:27–34. doi: 10.1016/j.fertnstert.2018.03.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Cinar N., Kizilarslanoglu M.C., Harmanci A., AksoyDY, Bozdag G., Demir B., et al. Depression, anxiety and cardiometabolic risk in polycystic ovary syndrome. Hum Reprod. 2011;26:3339–3345. doi: 10.1093/humrep/der338. [DOI] [PubMed] [Google Scholar]
  • 8.Dokras A. Mood and anxiety disorders in women with PCOS. Steroids. 2012;77(4):338–341. doi: 10.1016/j.steroids.2011.12.008. [DOI] [PubMed] [Google Scholar]
  • 9.Rees D.A., Udiawar M., Berlot R., Jones D.K., O'Sullivan M.J. White matter microstructure and cognitive function in young women with polycystic ovary syndrome. J Clin Endocrinol Metab. 2016;101(1):314–323. doi: 10.1210/jc.2015-2318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Cooney L.G., Lee I., Sammel M.D., Dokras A. High prevalence of moderate and severe depressive and anxiety symptoms in polycystic ovary syndrome: a systematic review and meta-analysis. Hum Reprod. 2017;32:1075–1091. doi: 10.1093/humrep/dex044. [DOI] [PubMed] [Google Scholar]
  • 15.Ghani N.A.A., Channip A.A., ChokHweeHwa P., Ja’afar F., Yasin H.M., Usman A. Physicochemical properties, antioxidant capacities, and metal contents of virgin coconut oil produced by wet and dry processes. Food Sci Nutr. 2018;6(5):1298–1306. doi: 10.1002/fsn3.671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Famurewa A.C., Folawiyo A.M., Enohnyaket E.B., Azubuike-Osu S.O., Abi Innocent. Beneficial role of virgin coconut oil supplementation against acute methotrexate chemotherapy-induced oxidative toxicity and inflammation in rats. Integr Med Res. 2018 doi: 10.1016/j.imr.2018.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Famurewa A.C., Ufebea O.G., Egedigweb C.A., Nwankwoc O.E., Obajed G.S. Virgin coconut oil supplementation attenuates acute chemotherapy hepatotoxicity induced by anticancer drug methotrexate via inhibition of oxidative stress in rats. Biomed Pharmacother. 2017;87(2017):437–442. doi: 10.1016/j.biopha.2016.12.123. [DOI] [PubMed] [Google Scholar]
  • 18.Mvondo M.A., Tsoplfack F.I.M., Awounfack C.F., Njamen D. The leaf aqueous extract of Myrianthus arboreus P. Beauv. (Cecropiaceae) improved letrozole-induced polycystic ovarian syndrome associated condition and infertility in female rat. BMC Complement Med Therap. 2020;20(1) doi: 10.1186/s12906-020-03070-8. pN.PAG-N.PAG. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Kuscu G.C., Gurel C., Buhur A., Oltulu F., Akman L., Kose T., et al. The regulatory effect of clomiphene and tamoxifen on mTOR and LC3-II expressions in relation to autophagy in experimental polycystic ovary syndrome (PCOS) Mol Biol Rep. 2022;49:1721–1729. doi: 10.1007/s11033-021-0698-y. [DOI] [PubMed] [Google Scholar]
  • 20.Shoji H., Miyakawa T. Effects of test experience, closed-arm wall color, and illumination level on behavior and plasma corticosterone response in an elevated plus maze in male C57BL/6J mice: a challenge against conventional interpretation of the test. Mol Brain. 2020;14:34. doi: 10.1186/s13041-020-00721-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ann-Katrin K., Paul C.G., Zolta’n S. The Y-maze for assessment of spatial working and reference memory in mice. Pre-clinical models: techniques and protocols. Methods Mol Biol. 2019;1916 doi: 10.1007/978-1-4939-8994-2_10. [DOI] [PubMed] [Google Scholar]
  • 22.Bingrui X., Wen Z., Longqing Z., Xian H., Wenchang Z., Qian Z., et al. Hippocampal glutamatergic synapses impairment mediated novel-object recognition dysfunction in rats with neuropathic pain. Pain. 2020;161:1824–1836. doi: 10.1097/j.pain.0000000000001878. [DOI] [PubMed] [Google Scholar]
  • 23.OmotuyiOI, Nash O., Enejoh O.A., Oribamise E.I., Adelakun N.S. Chromolaena odorata flavonoids attenuate experimental nephropathy: Involvement of pro-inflammatory genes downregulation. Toxicol Rep. 2020;7(2020):1421–1427. doi: 10.1016/j.toxrep.2020.10.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Cooney L.G., Milman L.W., Hantsoo L., et al. Cognitive-behavioral therapy improves weight loss and quality of life in women with polycystic ovary syndrome: a pilot randomized clinical trial. Fertil Steril. 2018;110:161–171.e1. doi: 10.1016/j.fertnstert.2018.03.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ostadmohammadi V., Jamilian M., Bahmani F., Asemi Z. Vitamin D and probiotic co-supplementation affects mental health, hormonal, inflammatory and oxidative stress parameters in women with polycystic ovary syndrome. J Ovarian Res. 2019;12:5. doi: 10.1186/s13048-019-0480-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.TeedeHJ, Misso M.L., Costello M.F. Recommendations from the international evidence-based guideline for the assessment and management of polycystic ovary syndrome. Hum Reprod. 2018;33(9):1602–1618. doi: 10.1093/humrep/dey256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Mohammadi M., Fatemi I., Taghipour Z., Azin M., Kaeidi A., Hakimizadeh E., Taghizadeh R., Hassanipou M. Polycystic ovary syndrome can lead to neurocognitive changes in female rats treated with letrozole. Arch Neurosci. 2021;8(2) doi: 10.5812/ans.112023. [DOI] [Google Scholar]
  • 28.Rotterdam ESHRE/ASRM-Sponsored PCOS Consensus Workshop Group Revised 2003 consensus on diagnostic criteria and long-term health risks related to polycystic ovary syndrome. Fertil Steril. 2004;81(1):19–25. doi: 10.1016/j.fertnstert.2003.10.004. [DOI] [PubMed] [Google Scholar]
  • 29.Katulski K., Podfigurna A., Czyzyk A., et al. Kisspeptin and LH pulsatile temporal coupling in PCOS patients. Endocrine. 2018;61(1):149–157. doi: 10.1007/s12020-018-1609-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Barber T.M., Kyrou I., Randeva H.S., Weickert M.O. Mechanisms of insulin resistance at the crossroad of obesity with associated metabolic abnormalities and cognitive dysfunction. Int J Mol Sci. 2021;22:546. doi: 10.3390/ijms22020546. 2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Antoniou-Tsigkos A., Macut D., Mastorakos G. In: Physiopathology, diagnosis, and treatment of secondary female hypogonadism BT-hypothalamic-pituitary diseases. Casanueva F.F., Ghigo E., editors. Springer International Publishing; Cham, Switzerland; Berlin/Heidelberg, Germany: 2018. pp. 247–287. [Google Scholar]
  • 32.Schneider J.E. Energy balance and reproduction. Physiol Behav. 2004;81:289–317. doi: 10.1016/j.physbeh.2004.02.007. [DOI] [PubMed] [Google Scholar]
  • 33.Kleinridders A., Könner A.C., Bruning J.C. CNS-targets in control of energy and glucose homeostasis. Curr Opin Pharmacol. 2009;9:794–804. doi: 10.1016/j.coph.2009.10.006. [DOI] [PubMed] [Google Scholar]
  • 34.Könner A.C., Klöckener T., Brüning J.C. Control of energy homeostasis by insulin and leptin: targeting the arcuate nucleus and beyond. Physiol Behav. 2009;97:632–638. doi: 10.1016/j.physbeh.2009.03.027. [DOI] [PubMed] [Google Scholar]
  • 35.Williams K.W., Margatho L.O., Lee C.E., Choi M., Lee S., Scott M.M., et al. Segregation of acute leptin and insulin effects in distinct populations of arcuate proopiomelanocortin neurons. J Neurosci. 2010;30:2472–2479. doi: 10.1523/JNEUROSCI.3118-09.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Tsaousidou E., Paeger L., Belgardt B.F., Pal M., Wunderlich C.M., Brönneke H., et al. Distinct roles for JNK and IKK activation in agouti-related peptide neurons in the development of obesity and insulin resistance. Cell Rep. 2014;9:1495–1506. doi: 10.1016/j.celrep.2014.10.045. [DOI] [PubMed] [Google Scholar]
  • 37.Ernst M.B., Wunderlich C.M., Hess S., Paehler M., Mesaros A., Koralov S.B., et al. Enhanced Stat3 activation in POMC neurons provokes negative feedback inhibition of leptin and insulin signaling in obesity. J Neurosci. 2009;29:11582–11593. doi: 10.1523/JNEUROSCI.5712-08.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Yang L., Qi Y., Yang Y. Astrocytes control food intake by inhibiting AGRP neuron activity via adenosine A1 receptors. Cell Rep. 2015;11:798–807. doi: 10.1016/j.celrep.2015.04.002. [DOI] [PubMed] [Google Scholar]
  • 39.Pallavi S., Srabani M. Mitochondrial dysfunction: an emerging link in the pathophysiology of polycystic ovary syndrome. Mitochondrion. 2020;52:24–39. doi: 10.1016/j.mito.2020.02.006. [DOI] [PubMed] [Google Scholar]
  • 40.Di M.S., Iossa S., Venditti P. Skeletal muscle insulin resistance: role of mitochondria and other ROS sources. J Endocrinol. 2017;233:R15–R42. doi: 10.1530/JOE-16-0598. [DOI] [PubMed] [Google Scholar]
  • 41.Ma L., Wang J., Li Y. Insulin resistance and cognitive dysfunction. Clin Chim Acta. 2015;444:18–23. doi: 10.1016/j.cca.2015.01.027. [DOI] [PubMed] [Google Scholar]
  • 42.Liu C.C., Liu C.C., Kanekiyo T., Xu H., Bu G. Apolipoprotein E and Alzheimer disease: risk, mechanisms and therapy. Nat Rev Neurol. 2013;9:106–118. doi: 10.1038/nrneurol.2012.263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Yan J., Zhang H., Yin Y., Li J., Tang Y., Purkayastha S., et al. Obesity- and aging-induced excess of central transforming growth factor-_ potentiates diabetic development via an RNA stress response. Nat Med. 2014;20:1001–1008. doi: 10.1038/nm.3616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Schofield C.J., Sutherland C. Disordered insulin secretion in the development of insulin resistance and Type 2 diabetes. Diabet Med. 2012;29:972–979. doi: 10.1111/j.1464-5491.2012.03655.x. [DOI] [PubMed] [Google Scholar]
  • 45.Famurewa A.C., Folawiyob A.M., Enohnyaketb E.B., Azubuike-Osuc S.A., Abid I., Obajee S.G., et al. Beneficial role of virgin coconut oil supplementation against acute ethotrexate chemotherapy-induced oxidative toxicity and inflammation in rats. Integr Med Res. 2018;7(3):257–263. doi: 10.1016/j.imr.2018.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Park S.J., Chung Y.H., Lee J.H., Dang D.K., Nam Y., Jeong J.H., et al. Growth hormone-releaser diet attenuates cognitive dysfunction in klotho mutant mice via insulin-like growth factor-1 receptor activation in a genetic aging model. Endocrinol Metab. 2014;29:336–348. doi: 10.3803/EnM.2014.29.3.336. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Brankatschk M., Dunst S., Nemetschke L., Eaton S. Delivery of circulating lipoproteins to specific neurons in the Drosophila brain regulates systemic insulin signalling. Elife. 2014;3 doi: 10.7554/eLife.02862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Mao Y.F., Guo Z., Zheng T., Jiang Y., Yan Y., Yin X., et al. Intranasal insulin alleviates cognitive deficits and amyloid pathology in young adult APPswe/PS1dE9 mice. Aging Cell. 2016;15:893–902. doi: 10.1111/acel.12498. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Zhao F., SiuJJ, Huang W., Askwith C., Cao L. Insulin modulates excitatory synaptic transmission and synaptic plasticity in the mouse Hippocampus. Neuroscience. 2019;411:237–254. doi: 10.1016/j.neuroscience.2019.05.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Hackett G., Kirby M. British society for sexual medicine guidelines on adult testosterone deficiency, with statements for UK practice. J Sex Med. 2017;14(12):1504–1523. doi: 10.1016/j.jsxm.2017.10.067. [DOI] [PubMed] [Google Scholar]
  • 51.Wheeler K., Sharma D., et al. Clomiphene citrate for the treatment of hypogonadism. Sex Med Revi. 2019;7(2):272–276. doi: 10.1016/j.sxmr.2018.10.001. [DOI] [PubMed] [Google Scholar]
  • 52.Ghasemi R., Dargahi L., Haeri A., Moosavi M., Mohamed Z., Ahmadiani A. Brain insulin dysregulation: implication for neurological and neuropsychiatric disorders. Mol Neurobiol. 2013;47:1045–1065. doi: 10.1007/s12035-013-8404-z. 2013. [DOI] [PubMed] [Google Scholar]
  • 53.Schliebs R., Arendt T. The cholinergic system in aging and neuronal degeneration. Behav Brain Res. 2011;221(2):555–563. doi: 10.1016/j.bbr.2010.11.058. [DOI] [PubMed] [Google Scholar]
  • 54.Ul Islam B., et al. Elucidating treatment of Alzheimer's disease via different receptors. Curr Top Med Chem. 2017;17(12):1400–1407. doi: 10.2174/1568026617666170103163715. [DOI] [PubMed] [Google Scholar]
  • 55.Lee Y.K., et al. Protective effect of the ethanol extract of Magnolia officinalis and 4- O-methylhonokiol on scopolamine-induced memory impairment and the inhibition of acetylcholinesterase activity. J Nat Med. 2009;63(3):274–282. doi: 10.1007/s11418-009-0330-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Otuechere C.A., Madarikan G., Simisola T., Bankole O., Osho A. Virgin coconut oil protects against liver damage in albino rats challenged with the anti-folate combination, trimethoprim-sulfamethoxazole. J Basic Clin Physiol Pharmacol. 2014;25:249–253. doi: 10.1515/jbcpp-2013-0059. [DOI] [PubMed] [Google Scholar]
  • 57.Nair S.S., Manalil J.J., Ramavarma S.K., Suseela I.M., Thekkepatt A., Raghavamenon A.C. Virgin coconut oil supplementation ameliorates cyclophosphamide-induced systemic toxicity in mice. Hum Exp Toxicol. 2016;35:205–212. doi: 10.1177/0960327115578867. [DOI] [PubMed] [Google Scholar]
  • 58.Zakaria Z.A., Somchit M.N., Mat-Jais A.M., Teh L.K., Salleh M.Z., Long K. In vivo antinociceptive and anti-inflammatory activities of dried and fermented processed virgin coconut oil. Med Princ Pract. 2011;20:231–236. doi: 10.1159/000323756. [DOI] [PubMed] [Google Scholar]
  • 59.Jaarin K., Norliana M., Kamisah Y., Nursyafiza M., Qodriyah H.M. Potential role of virgin coconut oil in reducing cardiovascular risk factors. Exp Clin Cardiol. 2014;20:3399–3410. [Google Scholar]
  • 60.Marina A.M., Che-Man Y.B., Nazimah S.A., Amin I. Antioxidant capacity and phenolic acids of virgin coconut oil. Int J Food Sci Nutr. 2009;60:114–123. doi: 10.1080/09637480802549127. [DOI] [PubMed] [Google Scholar]
  • 61.Mussatto S.I., Dragone G., Roberto I.C. Ferulic and p-coumaric acids extraction by alkaline hydrolysis of brewer's spent grain. Ind Crop Prod. 2007;25:231–237. [Google Scholar]
  • 62.Ghasemi Simagol, Moradzadeh Malihe, Hosseini Mahmoud, Beheshti Farimah, Sadeghnia Hamid Reza. Beneficial effects of Urtica dioica on scopolamine-induced memory impairment in rats: protection against acetylcholinesterase activity and neuronal oxidative damage. Drug Chem Toxicol. 2018 doi: 10.1080/01480545.2018.1463238. [DOI] [PubMed] [Google Scholar]
  • 63.Cottera Jack, Muhlertb Nils, Talwara Anahita, Grangera Kiri. Examining the effectiveness of acetylcholinesterase inhibitors and stimulant based medications for cognitive dysfunction in multiple sclerosis: a systematic review and meta-analysis. Neurosci Biobehav Rev. 2018;86:99–107. doi: 10.1016/j.neubiorev.2018.01.006. [DOI] [PubMed] [Google Scholar]
  • 64.Koopman Peter. StatPearls Publishing LLC. NCBI Bookshelf; 2022. A service of the National Library of Medicine, National Institute of Medicine. [Google Scholar]

Articles from Journal of Taibah University Medical Sciences are provided here courtesy of Taibah University

RESOURCES