Skip to main content
Life logoLink to Life
. 2023 Jan 27;13(2):344. doi: 10.3390/life13020344

Impact of Dietary Administration of Seaweed Polysaccharide on Growth, Microbial Abundance, and Growth and Immune-Related Genes Expression of The Pacific Whiteleg Shrimp (Litopenaeus vannamei)

Eman M Abbas 1, Ahmed Said Al-Souti 2,*, Zaki Z Sharawy 1, Ehab El-Haroun 3,*, Mohamed Ashour 1
Editor: Alejandro Romero
PMCID: PMC9962296  PMID: 36836701

Abstract

This work aims to determine the impact of dietary supplementation of polysaccharide, extracted from brown seaweeds Sargassum dentifolium on growth indices, feed utilization, biochemical compositions, microbial abundance, expressions of growth and immunity-related genes, and stress genes of the Pacific Whiteleg shrimp Litopenaeus vannamei. A total of 360 post-larvae of L. vannamei were randomly distributed into a 12-glass aquarium (40 L of each) at a stocking density of 30 shrimp with an initial weight of (0.0017 ± 0.001 g). During the 90-day experiment trial, all shrimp larvae were fed their respective diets at 10% of total body weight, three times a day. Three experimental diets were prepared with different seaweed polysaccharide (SWP) levels. The basal control diet had no polysaccharide level (SWP0), while SWP1, SWP2, and SWP3 contained polysaccharides at concentrations of 1, 2, and 3 g kg−1 diet, respectively. Diets supplemented with polysaccharide levels showed significant improvements in weight gain and survival rate, compared to the control diet. Whole-body biochemical composition and the microbial abundance (the total count of heterotrophic bacteria and Vibrio spp.) of L. vannamei showed significant differences among polysaccharide-treated diets compared to the control. At the end of the feeding experiment, the dietary supplementation of polysaccharide levels enhanced the expression of growth-related genes (Insulin-like growth factors (IGF-I, IGF-II), immune-related genes (β -Glucan-binding protein (β-Bgp), Prophenoloxidase (ProPO), Lysozyme (Lys), and Crustin), and stress genes (Superoxide dismutase (SOD) and Glutathione peroxidase (GPx) in the muscle tissue of L. vannamei. However, the current study concluded that the inclusion rate of 2 g kg–1 of polysaccharide as a dietary additive administration enhanced both weight gain and survival rate of L. vannamei, while the incorporation level of 3 g kg–1 reduces the abundance of pathogenic microbes and enhances the growth-, immunity- and stress-related gene expressions of L. vannamei.

Keywords: Sargassum dentifolium, feed additives, shrimp industry, growth performances, growth-related genes, immune-related genes, stress genes

1. Introduction

The shrimp aquaculture industry has experienced rapid growth and has become the most significant and leading aquaculture sector [1,2]. Although the shrimp industry has developed rapidly, the challenges faced by farmers are obtaining an increase in growth rate, low-price diets, and reducing disease outbreaks [3,4]. Furthermore, the world’s shrimp consumption has risen over the previous ten years, forcing nutrition experts to incorporate a lot of substances derived from agriculture in aquatic animal diets [1,5,6]. The Pacific Whiteleg shrimp (Litopenaeus vannamei) is most frequently grown worldwide, achieving more than 70% of all worldwide shrimp cultivation [7,8]. To sustain the shrimp industry worldwide, many issues must be resolved, such as poor water quality, low survivability, and diet industry improvement [9,10,11,12,13,14]. Moreover, climate change and the negative impact of environmental pollution are significant problems restricting the sustainability of aquaculture, fisheries, aquatic ecosystems, and aquatic animals so far [15,16,17,18,19,20].

Hence, shrimp diets have been expanded using several strategies to deal with such global development in the shrimp farming sector [10,21]. One of the most fundamental strategies is feed additive supplementation, which has grown to be very important for many shrimp species as a growth stimulus, immunological booster, and alternative disease resistance approach [22,23]. Aquatic plants (microalgae and seaweeds) are still widely employed in many important sectors, such as aqua-feed additives [24], plant growth enhancers [25], phytoremediation [26,27,28,29,30], human food supplement [31,32], pharmaceuticals [33,34], cosmetics substances [35,36], antimicrobial activities [37,38], and bioenergy [39,40]. As reported in 2018, the global production of seaweeds (wild captured and farmed) was about 34.4 Million Tonnes, with an industrial value of about USD 13.3 Billion [41]. This production comes from about 35 countries, while the largest producer, which produces more than 99%, is China [42]. Seaweeds have high levels of proteins, fibers, vitamins, fatty acids, minerals, pigments, and several bioactive compounds [43,44,45,46]. Among seaweed families, brown seaweeds are known as a high source of sugars, which can protect aquatic organisms from several harmful impacts while their polysaccharide has been successively used as a feed additive for Nile tilapia [47] and red tilapia [2]. The available literature has demonstrated that the polysaccharide extracted from seaweed could promote innate immunity, and enhance the resistance against pathogen infection of shrimp [48,49,50] due to its polysaccharide composition and structure (degree of branching, substituents, sulphation, and type of linkages) which are quite different from terrestrial plants [51,52] Sargassum dentifolium, brown seaweed is found to contain abundant polysaccharide which is a rich resource in Egypt, has been confirmed to exert multiple pharmacological properties, such as antitumor, antioxidation, hematopoiesis, immunomodulation, and gastrointestinal protection, while the dietary administration was reported to improve the non-specific immune responses in fishes [2].

Despite the importance of feed additives applied for the Pacific whiteleg shrimp, little is known about the application of polysaccharides prepared from brown seaweeds in the shrimp feed additive industry [53,54]. Immunostimulants have importance as synthetic substances that boost the immune system’s capacity to combat infections and diseases by stimulating immunological responses. Bacteria and bacterial products, complex carbohydrates, dietary factors, animal extracts, cytokines, lectins, plant extracts, and synthetic medications such as levamisole are all examples of immunostimulants that are presently available [55]. Antibiotics in the diets of cultured fish and crustaceans have been commonly used to control disease infection as well as to improve both survival and growth. However, it has been widely criticized due to the drug resistance and accumulation of chemicals in aquatic animal tissues, which can be possibly dangerous to public health. Alternatively, natural immune stimulants such as probiotics, and prebiotics are generally suggested to use in feeds to effectively promote growth and immune response, and control various diseases in aquatic animals [56].

The stimulatory effects of immunostimulants such as glucan, chitosan, nucleotides, lipopolysaccharide (LPS), sodium alginate, and other polysaccharides have been the subject of several works on fish and crustaceans [55,57].

Recently, special attention has been paid to the use of prebiotics as natural alternatives to antibiotics and immune stimulants in aquaculture. Functional polysaccharides are non-digestible ingredients because of their β-1, 3 or β-1, 4 linkages. Consumption of functional polysaccharides can reportedly improve growth performance and enhance the immune response and disease resistance of aquatic animals [58]. According to previous studies, diets containing certain polysaccharides, including medicinal plants and marine-derived polysaccharides, may improve growth rate in respect of the immune system and gastrointestinal condition in fishes and shrimps [59,60,61].

Disease resistance has been linked to an increase in cellular and humoral responses, including phagocytosis, bactericidal activity, phenoloxidase (PO) activity, respiratory burst, superoxide dismutase (SOD), and lysozyme activities in crustaceans [62]. Essential information regarding immune system activation and regulation is revealed by the expression of immune-related genes in shrimp [63]. Pattern recognition proteins (PRPs), which attach to molecules on the microbial surface, mediate the detection of invading organisms as an important step in the shrimp immune response [64].

PRP recognition of invading pathogens is a crucial intermediate step in prophenoloxidase-activating system (ProPO) system activation [65]. Peptidoglycan recognition proteins [66], C-type lectins [67], β-glucan-binding proteins (β-Bgps) [68], and lipopolysaccharide (LPS) and 1,3-glucan binding proteins (1,3-Lgp) [69] have all been described as PRPs in the ProPO system. The Prophenoloxidase (ProPO)-activating mechanism, which is triggered by PRPs binding to a microorganism’s cell wall components, is known to activate the host’s immune system [70]. Stress activates the glycolytic reactions which in turn increases the consumption of O2, and enhances the release of reactive oxygen species (ROS) (as hydroxyl radical, hydrogen peroxide, and superoxide anions) [71]. However, the ROS can eliminate the stressor; the increase in the ROS will cause severe destruction. Therefore, the rapid removal of excessive ROS is critical for the appropriate function of the cell. This is achieved by increasing the expression of antioxidant enzymes [72]. Superoxide dismutase (SOD) are antioxidant enzyme that relies on superoxide anions. Superoxide radicals are detoxified by SOD by being transformed into oxygen and hydrogen peroxide, which are subsequently changed into H2O and O2 by catalase and supplied to the cell as safe composites [73,74].

The copper–zinc superoxide dismutase CuZnSOD gene and other immune genes are also implicated in the indirect immunity of shrimp-like Crustin, which is essential for immunity to infections [75,76]. In L. vannamei, the dietary Panax ginseng polysaccharide extract reduces inflammation, boosts immune enzyme activity, and modifies immune gene expression [77]. A large number of genes regulate development characteristics, including growth hormone (GH), and insulin-like growth factors (IGF-I and IGF-II) [78]. The fast growth of L. vannamei aquaculture demands the creation of rapid genetic lines [79]. To the best of our knowledge, little is known about the influences of dietary polysaccharides supplementation of Sargassum dentifolium on shrimp growth, immunity, and stress-related gene expressions. Therefore, this study was undertaken to evaluate the effect of dietary administration of polysaccharide derived from brown seaweed (S. dentifolium) on growth performances, feed utilization, body composition, microbial communities, and growth, immunity, and stress genes expressions of the Whiteleg shrimp Litopenaeus vannamei.

2. Materials and Methods

2.1. Brown Seaweed, Sargassum dentifolium

Brown seaweed, S. dentifolium, was collected from Abu-Qir Bay, Alexandria, Egypt (31.3000 N and 30.1667 E) [2]. The epiphytes were removed from the obtained samples, as previously described [80]. Before use, the samples were then washed, cleaned, air-dried, powdered, and stored in plastic bags at room temperature [29]. The procedures outlined by [81] were used to extract the polysaccharide from the brown seaweed S. dentifolium.

2.2. Investigation of Water Quality

Throughout the feeding experiment, we made sure that the levels of NH3− (mg L−1), NO2− (mg L−1), NO3− (mg L−1), alkalinity (mg L−1), and PO4− (mg L−1) were within the ranges suggested for shrimp [82] and the guidelines of APHA [83]. In addition, daily measurements of temperature (°C), salinity (ppt), and pH were taken at 1 p.m. A thermometer hung at a depth of 30 cm was used to get an accurate reading of the water’s temperature, and a pH meter and a refractometer (Orion, Ipswich, MA, USA) were used to get accurate readings of the water’s acidity and alkalinity daily at 9.00 h.

2.3. The Pacific Whiteleg Shrimp (Litopenaeus vannamei)

2.3.1. Animal Experiment

A private hatchery supplied post larvae (PLs) of Pacific Whiteleg shrimp L. vannamei to the Invertebrates Laboratory, Aquaculture Division, Suez-Branch of NIOF, Egypt. PLs were then acclimatized for 15 days in two 500-L fibreglass tanks under controlled conditions (28.0 ± 1.0 °C and salinity 29 ± 3.0 ppt) The Research Committee of the NIOF, Egypt, approved the experimental design and the adherence to ethical standards of shrimp handling.

2.3.2. Experimental Design and Facilities

The current feeding trial was conducted using a completely randomized design, with triplicates. A total of 360 PLs (with an initial weight of 0.0017 ± 0.001 g) were stocked at a density of 30 shrimp in 12 glass aquariums (each with a 40 L capacity). For the 90-day feeding trial, PLs were given 10% of the total shrimp body weight three times a day (at 6:00 a.m., 12:00 p.m., and 6:00 p.m.). Each aquarium was emptied of waste and uneaten food every morning and cleaned with a siphon and 10% of the water volume was replaced with fresh, oxygenated, and filtered seawater daily [82].

2.3.3. Experimental Diet

Four diets were provided to shrimp: SWP0: commercial shrimp diet (Aller-Aqua, Egypt, as a control basal diet, crude protein of 40% and crude lipid of 9%). The remaining three experimental diets (SWP1, SWP2, and SWP3) are commercial shrimp diets supplemented with 1, 2, and 3 g kg−1 of S. dentifolium polysaccharide, respectively. The additions of polysaccharide levels were performed, as previously described by Abdelrhman et al. [2]. Briefly, the commercial shrimp diet was first milled and split into three equal portions. Each polysaccharide level (1, 2, and 3 g kg−1) was dissolved in distilled water and then sprayed on the diet surface until complete absorption and the same adequate volume of distilled water was sprayed on the control diet (SWP0) without polysaccharide [84]. The sunflower oil (5 mL kg−1) was then sprayed over diets to cover the polysaccharide solution [85]. Finally, the diets were homogenized and re-pelletized into pellets, air-dried, placed in cellophane bags, and refrigerated at 4 °C until use.

2.4. Tested Parameters

2.4.1. Growth Performances

At the end of the trial, the number of shrimps and weights were recorded, after 24 h of fasting, to determine the different growth indices and feed utilization using the following formulas:

Weight Gain (WG, g)=FW − IW (1)

where IW & FW are initial and final body weight (g), respectively.

Specific growth rate (SGR, %/day)=100×(Ln FW−Ln IW t) (2)

where Ln and t are t natural logarithmic and time in days, respectively.

Survival Rate (%)=100× Final number of shrimp  Initial number of shrimp  (3)
Feed conversion ratio (FCR)=Feed intake g Body weight gain g (4)

2.4.2. Biochemical Composition Analysis

Both experimental diets and shrimp were subjected to proximate analysis for estimating their biochemical content according to AOAC [86] guidelines prepared as detailed in the prior article [87]. To estimate the whole-body constituent (dry matter, crude fat, crude protein, and crude ash), 5 shrimp were obtained randomly from each replicate after the feeding session was completed. Shrimp were then pulverized, blended until smooth, and stored at −20 °C for further examination.

2.4.3. Microbial Communities

The APHA approach [83] was used to determine the richness of microbial communities. Water (1 mL) and intestine of shrimp (1 g) samples were taken from each replicate (3 shrimp per replicate, n = 9) once the experiment was completed. Each sample (intestine and water) was inoculated with 9 mL of sterile distilled water onto plates of Trypticase soy agar (TSA) and Thio-sulphate-Citrate-Bile salts (TCBS) [88]. Plates of TSA and TCBS were incubated at 37 °C, while TCBS plates were incubated at 28 °C. Colony-forming units per milliliter were used to determine the quantity of hetero-trophic bacteria and Vibrio colonies present after 24 h (CFU mL−1) [89].

2.4.4. RNA Extraction and cDNA Synthesis for Genes Expression

Triplicate samples of the shrimp’s abdominal muscles from each replicate were directly excised with fully sterile dissecting tools under cold conditions. Before performing the gene expression study, part of the muscles was frozen at −80 °C. TRIzol reagent (easy-RED, iNtRON Biotechnology) was used to extract total RNA from the shrimp’s abdomen region at the end of the experiment, as directed by the manufacturer. Using a NanoDrop system (Bio-Drop), the optical density (OD) ratio of RNA purity was determined, and 1 ng L−1 of RNA was used for cDNA synthesis in each reaction when the ratio was ideal (A260/A280 = 1.8). To determine the quality of the RNA, the 260/280 nm OD ratio was used. Total RNA that had been processed with DNase I (NEB, USA) was utilized as a template in a reverse transcriptase kit (RT-PCR beads, Enzynomics, Daejeon, Korea) to generate first-strand cDNA. The reaction was performed using PCR amplification (using an American product, an Applied Biosystems Veriti 96-Well Thermal Cycler) and was carried out following the manufacturer’s instructions. Real-Time PCR (Bico, Thermo-Fisher) was performed under the following cDNA conditions to detect unique and distinct products: After an initial denaturation at 95 °C for 15 min, the protein was subjected to 40 cycles at the following conditions: 95 °C for 10 s, 58–62 °C for 20 s, and 72 °C for 30 s; and finally, after the final cycle, the temperature was raised from 58–62 °C to 95 °C in increments of 0.5 °C. Primers used to probe similar genes are listed in Table 1.

Table 1.

Oligonucleotide primer sequences applied in RT-PCR for immune-related, antioxidant genes and growth-related genes.

Genes Sequences Amplicon Size
β-actin (AF300705) F: GCCCATCTACGAGGGATA
R: GGTGGTCGTGAAGGTGTAA
121 bp
Bgp (AY249858) F: ACGAGAACGGACAAGAAGTG
R: TTCAGCATAGAAGCCATCAGG
137 bp
ProPO (AY723296) F: CGGTGACAAAGTTCCTCTTC
R: GCAGGTCGCCGTAGTAAG
122 bp
Crustin (AF430076) F: ACGAGGCAACCATGAAGG
R: AACCACCACCAACACCTAC
141
Lys (AY170126) F: GGACTACGGCATCTTCCAGA
R: ATCGGACATCAGATCGGAAC
97 bp
IGF-I (KP420228) * F: GTGGGCAGGGACCAAATC
R: TCAGTTACCACCAGCGATT
123 bp
IGF-II (XM02739466) * F: CTCTGTACAGTCAGCCCAGC
R: CACACCCAGTCAGTCCCAAG
220 bp
SOD (DQ005531) F: AATTGGAGTGAAAGGCTCTGGCT R: ACGGAGGTTCTTGTACTGAAGGT 153
GPx (AY973252) F: AGG GACTTC CAC CAG ATG
R: CAA CAACTC CCC TTC GGTA
117

* Designed by NCBI tool.

The housekeeping gene (β-actin) was utilized to assess target gene expression or fold change [90]. When the 2ΔΔCt method is used to normalize the critical threshold (Ct) quantities of the target genes with quantities of β-actin, the values reveal an n-fold difference in comparison to the control [91].

2.5. Statistical Analysis

To evaluate water quality, growth performances feed utilization indices, body composition analysis, microbial communities, and immunity and growth-related gene expression, a one-way ANOVA was employed to identify significant differences (p < 0.05) in the means for each variable between the polysaccharide treatments (SWP1, SWP2 and SWP0) and the control (SWP0). The statistical analysis was performed using GraphPad Prism version 9. To examine any correlation between the treatments, Tukey’s tests were utilized. Before performing the statistical analysis, all data have been checked for the normality of distribution and homogeneity of variance. Before the analysis, all data (percentages) were arc-sin transformed [92]. However, to facilitate comparisons, the data were presented as untransformed.

3. Results

3.1. Water Quality

Table 2 displays the water quality conditions recorded during feeding experiments. According to the supplied data (Table 2), the water quality was acceptable (falling under the permissible limits) for raising shrimp.

Table 2.

Water quality parameters of experimental diets.

Tested Parameters SWP0 SWP1 SWP2 SWP3
NH3− (mg L−1) 0.119 ± 0.001 0.106 ± 0.016 0.123 ± 0.015 0.125 ± 0.004
NO2− (mg L−1) 0.119 ± 0.016 bc 0.101 ± 0.009 c 0.140 ± 0.001 a 0.132 ± 0.003 ab
NO3− (mg L−1) 0.222 ± 0.028 0.217 ± 0.008 0.262 ± 0.004 0.257 ± 0.005
PO4− (mg L−1) 0.485 ± 0.010 0.495 ± 0.018 0.505 ± 0.007 0.485 ± 0.018
Alkalinity (mg L−1) 7.700 ± 0.625 b 7.625 ± 0.050 b 8.563 ± 0.438 ab 9.038 ± 0.763 a
Temperature (°C) 26.84 ± 0.20 a 26.75 ± 0.07 a 26.46 ± 0.04 b 26.65 ± 0.15 ab
Salinity (ppt) 32.25 ± 0.09 b 32.35 ± 0.03 b 32.46 ± 0.02 a 32.32 ± 0.04 b
pH 7.79 ± 0.02 a 7.82 ± 0.01 a 7.78 ± 0.03 a 7.73 ± 0.08 b

SWP0, SWP1, SWP2, and SWP3: diets supplemented with 0, 1, 2, and 3 g of polysaccharide extracted from brown seaweed S. dentifolium. The presented data are Means ± SD (n = 3). Different letters in the same column are significantly different (p < 0.05). The absence of letters in the same row means that there are no significant differences.

3.2. Growth Performances and Nutrient Utilization Indices

Table 3 demonstrates the impact of polysaccharide dietary supplementation on shrimp growth, survival, and feed utilization. Compared to SWP0, Table 3 showed that SWP1, SWP2, and SWP3 demonstrated significant (p < 0.05) increases in WG. Moreover, SWP1 and SWP2 showed significant (p < 0.05) increases in SR, while SWP3 showed significant (p < 0.05) decreases, compared to SWP0. On the other hand, there were no significant differences (p < 0.05) in SGR or FCR across the supplemented diets (SWP0, SWP1, SWP2, and SWP3), as presented in Table 3.

Table 3.

Growth performance and feed utilization of shrimp L. vannamei fed on experimental diets.

Indicator SWP0 SWP1 SWP2 SWP3
IW (g) 0.0017 ± 0.001 0.0017 ± 0.001 0.0017 ± 0.001 0.0017 ± 0.001
WG (g) 10.43 ± 1.15 c 12.75 ± 2.21 b 14.97 ± 1.26 a 15.06 ± 1.28 a
SR (%) 75.56 ± 2.94 b 77.78 ± 4.08 a 83.33 ± 3.74 a 60.00 ± 2.45 c
SGR 7.29 ± 0.55 7.45 ± 0.77 7.59 ± 0.33 7.59 ± 0.41
FCR 1.58 ± 0.05 1.59 ± 0.07 1.59 ± 0.09 1.58 ± 0.15

SWP0, SWP1, SWP2, and SWP3: diets supplemented with 0, 1, 2, and 3 g of polysaccharide extracted from brown seaweed S. dentifolium. The presented data are Means ± SD (n = 3). Different letters in the same column are significantly different (p < 0.05). The absence of letters in the same row means that there are no significant differences.

3.3. Shrimp Body Composition Analysis

The body composition analysis of the content (% of dry weight) of protein, fat, ash, and dry matter is presented in Table 4. The highest significant (p < 0.05) values of protein and dry matter were reported by SWP0 followed by SWP1, SWP3, and SWP2, while the highest significant (p < 0.05) values of fat and ash were reported by SWP2 followed by SWP3, SWP1, and SWP0 (Table 4).

Table 4.

Composition analysis (%) of shrimp L. vannamei fed on different experimental diets.

Diets Composition Analysis (% of Dry Weight)
Dry Matter Protein Fat Ash
SWP0 26.53 ± 0.13 a 23.12 ± 0.03 a 7.79 ± 0.01 d 1.60 ± 0.01 d
SWP1 25.33 ± 0.04 b 22.32 ± 0.03 b 10.61 ± 0.02 c 1.89 ± 0.01 c
SWP2 24.60 ± 0.03 d 21.88 ± 0.02 d 11.00 ± 0.01 a 2.48 ± 0.02 a
SWP3 24.93 ± 0.04 c 22.10 ± 0.01 c 10.78 ± 0.03 b 2.19 ± 0.01 b

SWP0, SWP1, SWP2, and SWP3: diets supplemented with 0, 1, 2, and 3 g of polysaccharide extracted from brown seaweed S. dentifolium. The presented data are Means ± SD (n = 3). Different letters in the same column are significantly different (p < 0.05). The absence of letters in the same row means that there are no significant differences.

3.4. Microbial Communities

Table 5 shows the impact of experimental diets supplemented with different concentrations of the polysaccharide (SWP1, SWP2, and SWP3), compared to SWP0, on the total count of THB and TVC in both the water and intestine of shrimp. The data showed that the abundance of microbes (THB and TVC) was higher in the intestine than in water. Compared to SWP0 both THB and TVC count in both water and intestine gradually decreased as polysaccharide levels increased (Table 5).

Table 5.

Effect of brown seaweed polysaccharide on the bacterial abundance in water and intestine of L. vannamei, total heterotrophic bacteria (THB), total vibrio count (TVC), and TVC/THB ratio.

Bacterial Count
(CFU mL−1 × 105)
Experimental Diets
SWP0 SWP1 SWP2 SWP3
Water
THB 7.251 ± 0.0033 d 4.200 ± 0.0030 c 2.651 ± 0.0063 b 0.119 ± 0.0066 a
TVC 0.114 ± 0.0005 d 0.068 ± 0.0002 c 0.045 ± 0.0003 b 0.005 ± 0.0004 a
Intestine
THB 80.00 ± 0.0033 d 50.00 ± 0.0035 c 35.00 ± 0.0020 b 3.00 ± 0.0033 a
TVC 0.591 ± 0.4583 d 0.476 ± 0.4041 c 0.282 ± 0.5508 b 0.007 ± 0.0306 a

SWP0, SWP1, SWP2, and SWP3: diets supplemented with 0, 1, 2, and 3 g of polysaccharide extracted from brown seaweed S. dentifolium. The presented data are Means ± SD (n = 3). Different letters in the same column are significantly different (p < 0.05). The absence of letters in the same row means that there are no significant differences.

3.5. Growth, Immunity, and Stress-Related Genes Expressions

At the end of the experiment, the dietary supplementation of polysaccharides enhanced the expressions of immune-related, growth-related, and stress genes in the muscle tissue of L. vannamei. Regarding the expressions of growth-related genes (IGF-I and IGF-II), their expressions were considerably up-regulated (p < 0.05) in the treatments with the different polysaccharide concentrations compared to the control (SWP0). The expression was increased in the SWP3 and found to be higher than the SWP0 with approximately 12 and 11-fold change, respectively (Figure 1A,B). The expressions of immune-related genes (Bgp, ProPO, Crustin, and Lys) were markedly up-regulated in the SWP3 treatment where the fold changes were 9.3, 12.4, 10.5, and 8.8, respectively, which were higher than SWP0 (Figure 1C–F).

Figure 1.

Figure 1

Figure 1

Analysis of gene expressions of growth-related genes [IGF-I (A) and IGF-II (B)], immune-related genes [Bgp (C), ProPO (D), Crustin (E), and Lys (F)], and stress genes [(SOD (G) and GPx (H)], compared to the expression of a housekeeping gene (β-actin gene) in the different dietary supplementation of polysaccharide-extracted from brown seaweed, S. dentifolium. The presented data are Means ± SD (n = 3). Different letters are significantly different (p < 0.05). In general, the commercial diet supplemented with 3 g kg−1 of polysaccharide produced from brown seaweed S. dentifolium resulted in the highest expression of the eight genes (p < 0.05) compared to the other diets examined.

Compared to the control group (SWP0), the ProPO gene exhibits the highest expression levels across all treatment concentrations. For the Crustin gene, there is a significant difference between the SWP3 treatment and the control, while there was no significant difference between the SWP1 and SWP2 and the control. Furthermore, the expression of stress genes (SOD and GPx) in SWP3 were considerably increased by 5.2- and 6.9-folds, respectively, relative to the control (Figure 1G,H). However, there was a significant difference (p < 0.05) in SOD gene expression among all treatments compared to the control with more increase in the SWP3 treatment. Meanwhile, there was a significant difference (p < 0.05) in the gene expression of GPx between SWP3 and SWP2 treatments relative to the control SWP0, but no significant difference was observed between SWP2 and SWP1 treatments.

4. Discussion

Seaweed polysaccharides are recognized as high-value active molecules that improve growth performances, enhance the immune system response, and have many health benefits for aquaculture organisms [2,54,93,94,95,96,97]. In the present study, we hypothesized that the dietary administration of polysaccharide derived from brown seaweed (Sargassum dentifolium) ameliorates the growth performances, feed utilization, body composition, microbial communities, and growth, immunity, and stress genes expressions of the Whiteleg shrimp L. vannamei. The current feeding trial demonstrated that the weight gain of L. vannamei was improved significantly with increasing polysaccharide levels in the commercial diet compared to the control diet. The present findings are parallel to the previous studies conducted on different shrimp and fish species. For example, Lee et al. [98] reported that the hot-water extract of the brown seaweed Sargassum horneri significantly improves growth performances, stimulates innate immunities, and enhances immune gene expressions of shrimp L. vannamei and recommended that the ideal inclusion level is 5 g kg–1. Additionally, the study by Liu et al. [99] investigated the impact of different inclusion levels (0, 1, 2, and 3 g kg–1) of polysaccharides extracted from green seaweed (Enteromorpha) into the diet of banana shrimp F. merguiensis and concluded that 1 g kg–1 significantly enhances growth performance, improves nonspecific immunity, and modulates the intestinal function of F. merguiensis, while Abdelrhman et al. [2] investigated the effect of different dietary inclusion rates (0, 10, 20, and 30 g kg–1) of polysaccharides obtained from brown seaweed S. dentifolium on the hybrid red tilapia, and concluded that the 30 g kg–1 level achieved the highest significant growth performance, FCR, and hematological indices. However, the inconsistency in the inclusion levels among these studies may be due to the different initial weight, seaweed species, species (fish and shrimp species), age, etc.

Gut microbiota abundance rapidly responds to variations in dietary intake, composition, and components. Therefore, it has a huge impact on the health benefits of all aquatic organisms such as food consumption, digestion, nutrient utilization, absorption, and immunity responses [22,87,100,101]. At present, the evaluation of disease resistance is important in the aquaculture industry, the blood antioxidant and immune factor activity is a good health status indicator for investigating the immune response and disease resistance in L. vannamei such as white spot syndrome virus (WSSV) [49] and Vibrio alginolyticus [102]. Reactive oxygen species (ROS) are chemically reactive molecules containing oxygen, such as oxygen ions and peroxides. Excessive amounts of ROS can affect the structure and stability of functional proteins, unsaturated fatty acids, and nucleic acids, causing oxidative damage to the immune system of the organism and increasing the susceptibility to pathogens in shrimp [73]. Hence, the health of aquatic organisms depends on the balance between the production of ROS and antioxidant enzymes such as SOD and GPx which protect the animal cells against free radicals. The current findings showed that dietary polysaccharides derived from brown seaweed (S. dentifolium) effectively improved the activities of antioxidant enzymes, including SOD and GPx. Similarly, the SOD and GPx activities of different crustaceans were increased after feeding diets supplemented with Angelica sinensis polysaccharides in whiteleg shrimp [60] and β-glucan [103], and Rhodiola rosea polysaccharides in red swamp crayfish [104].

The current work reported that, compared to SWP0, the THB and TVC counts were significantly (p > 0.05) decreased with the increase in the inclusion levels of polysaccharides (SWP1, SWP2, and SWP3). These results are in agreement with those reported in the study by Mansour et al. [87] who found that the increasing levels of astaxanthin, extracted from the cyanobacterium strain, Arthrospira platensis NIOF17/003, in L. vannamei diet significantly (p > 0.05) decreased the counts of THB and TVC. However, the action mechanism of how seaweed-polysaccharide affected the abundance of microbiota is still not clear and requires further studies [87,101].

Several genes involved in immunological response were the focus of the current investigation. In SWP3 treatment, the up-regulatory gene expression was noticeably higher. Results showed increased expression with the treatments compared to the control (SWP0), suggesting that the polysaccharide can improve the immune status of shrimp through microbial cell walls composed of peptidoglycans, lipopolysaccharides (LPS), and β-1, 3-glucans, which can activate the shrimp immune response by triggering the main non-specific defense mechanism [22,87,105,106].

Prophenoloxidase is a crucial enzyme in invertebrate humoral immunity that promotes melanization to get rid of invasive pathogens [107], and is linked to cuticle sclerotization and wound healing [108]. Invertebrates have a non-self-recognition system called the ProPO activation system, which may detect and react to intruders using peptidoglycan or lipopolysaccharides from bacteria and β-1, 3-glucans from fungi [109]. The mRNA expression of the ProPO gene was shown to be considerably higher across all treatments compared to the control group, and this expression was found to be the greatest among all the investigated genes as seaweed polysaccharide content was increased (3 g kg–1 diet). Feeding P. monodon shrimp a diet that included the polysaccharide fucoidan from the brown seaweed S. wightii increased the expression of the ProPO gene [110]. Some other dietary supplements derived from microalgae and seaweeds raised the shrimp’s ProPO system and improved the humoral immune response. Our findings are consistent with prior studies conducted on L. vannamei [22,87].

Crustin, defined as part of the innate immune system [111], is a protein found in the hemocyte granules of crustaceans and is effective against several microorganisms. In this study, supplemented diets of the extracted polysaccharide increased Crustin gene expression, and there was a clear difference between the three treatments. Significant elevation of Crustin mRNA levels in Marsupenaeus japonicus has been observed after the administration of peptidoglycan [112]. The Crustin gene was upregulated (p < 0.05) in Pacific white shrimp L. vannamei administered supplemental astaxanthin [87,113]. As a protein found in eukaryotes and prokaryotes, lysozyme has been around for quite some time and is considered to be one of the earliest known antibacterial proteins [114]. Non-specific innate immunity relies on its ability to break down the b -1,4 glycosidic link between N-acetylmuramic acid and N-acetylglucosamine in bacterial cell wall peptdoglycan [115].

In the current investigation, Lys gene expression was shown to be considerably greater in the treatment groups (SWP1, SWP2, and SWP3) than in the control group (SWP0). Another transcriptome investigation using species that face environmental challenges also produced similar findings [116,117]. These findings demonstrated that lysozyme is a crucial part of the shrimp’s anti-bacterial defense mechanism and is evoked by a variety of immunostimulating substances. The antioxidant enzymes catalase and glutathione peroxidase convert hydrogen peroxide into oxygen and water, while SOD, one of the stress genes, is involved in the elimination of superoxide anions by converting them into hydrogen peroxide and water [118]. Consequently, these antioxidant enzymes give post-phagocytosis self-protection to the hemocytes of oxygen-respiring animals, hence preserving the organisms’ health and viability [119,120]. Compared to the control, the expression of the SOD gene was elevated in the three experimental conditions, and previous research [22,87,113,116] indicated that the feeding additive increased the expression of the SOD gene, which is involved in the antioxidant enzyme system in L. vannamei.

In the glutathione defense system, GPx is responsible for the reduction of hydrogen peroxide to water [117,121]. In our investigation, the expression of GPx was found to be higher in the SWP3 treatment where a higher concentration of seaweed polysaccharides was used. Thus, both stress genes in this study are significantly upregulated in comparison to the control group, and the activities of the SOD and GPx increase together with an increase in superoxide anion (O2−) and hydrogen peroxide (H2O2), which may indicate increases in the activity of NADPH-oxidase and the production of a mass of reactive oxygen species (ROS) that can represent as a defense mechanism against microbial infection [73,122]. Recent research has evaluated the expression of genes involved in immunity in shrimp [123,124] and has concentrated on ways to boost their natural defenses.

There are two types of insulin-like growth factor (IGF) peptide hormones, IGF-I and IGF-II; there are also cell surface receptors and circulating binding proteins. IGF-II, like IGF-I, has a role in protein metabolism, cellular differentiation, cell proliferation, and somatic growth. Based on the findings of the current study, it appears that seaweed polysaccharide extraction may increase the expression of growth-related genes at the mRNA level, hence boosting growth capacity indirectly. Other studies examining the impact of employing different carbon sources for boosting IGF-I and IGF-II gene expression revealed similar outcomes [123]. Furthermore, utilizing the green microalga, T. suecica, and A. platensis nanoparticles as the supplementary feeds for L. vannamei greatly increased the expression of both genes and improved growth [22,100].

5. Conclusions

Globally, shrimp diets have expanded by using several strategies to deal with the development in the farming of the Pacific whiteleg shrimp L. vannamei. Despite the importance of feed additives for L. vannamei, little is known about the application of polysaccharides prepared from brown seaweeds in the L. vannamei feed additive industry. In the current work, the inclusion rate of 2 g kg–1 of polysaccharides, a high-value active molecule prepared from brown seaweed Sargassum dentifolium, as dietary additive administration enhances final weight gain and survival rate of the Pacific Whiteleg shrimp, L. vannamei, while incorporation level of 3 g kg–1 reduces the abundance of pathogenic microbes, moreover, enhances the immunity and stress-related gene expressions of L. vannamei. However, further studies should be conducted to maximize the benefits of polysaccharides prepared from seaweed species as additive administrations to the Pacific whiteleg shrimp L. vannamei.

Acknowledgments

The open access of this work was partially supported by AL Hail Aquaculture Unit, Department of Marine Science and Fisheries, College of Agriculture and Marine Science, Sultan Qaboos University, Oman.

Author Contributions

Conceptualization, E.M.A., Z.Z.S. and M.A.; methodology, E.M.A., Z.Z.S. and M.A.; software, E.M.A., Z.Z.S. and M.A.; validation, E.M.A., Z.Z.S., M.A. and E.E.-H.; formal analysis, E.M.A., Z.Z.S. and M.A.; investigation, E.M.A., Z.Z.S., M.A. and E.E.-H.; resources, E.M.A., Z.Z.S. and M.A.; data curation, E.M.A., Z.Z.S. and M.A.; writing—original draft preparation, E.M.A., Z.Z.S. and M.A.; writing—review and editing, E.M.A., Z.Z.S., M.A., A.S.A.-S. and E.E.-H.; visualization, E.M.A., Z.Z.S., M.A. and E.E.-H.; supervision, Z.Z.S., M.A. and E.E.-H.; project administration, E.M.A.; funding acquisition, E.M.A., Z.Z.S., M.A. and A.S.A.-S. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Compliance with ethical standards in the experimental setup and shrimp handling was approved by the Research Committee of the NIOF, Egypt, approval no.: NIOF/AQ3/1/22/R/012 on 22 January 2021.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

Funding Statement

This research received no external funding.

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Abbas E.M., Ali F.S., Desouky M.G., Ashour M., El-Shafei A., Maaty M.M., Sharawy Z.Z. Novel Comprehensive Molecular and Ecological Study Introducing Coastal Mud Shrimp (Solenocera crassicornis) Recorded at the Gulf of Suez, Egypt. J. Mar. Sci. Eng. 2020;9:9. doi: 10.3390/jmse9010009. [DOI] [Google Scholar]
  • 2.Abdelrhman A.M., Ashour M., Al-Zahaby M.A., Sharawy Z.Z., Nazmi H., Zaki M.A., Ahmed N.H., Ahmed S.R., El-Haroun E., Van Doan H. Effect of polysaccharides derived from brown macroalgae Sargassum dentifolium on growth performance, serum biochemical, digestive histology and enzyme activity of hybrid red tilapia. Aquac. Rep. 2022;25:101212. doi: 10.1016/j.aqrep.2022.101212. [DOI] [Google Scholar]
  • 3.Goda A., Saad A., Hanafy M., Sharawy Z., El-Haroun E. Dietary effects of Azolla pinnata combined with exogenous digestive enzyme (Digestin™) on growth and nutrients utilization of freshwater prawn, Macrobrachium rosenbergii (de Man 1879) J. Oceanol. Limnol. 2018;36:1434–1441. doi: 10.1007/s00343-018-7019-7. [DOI] [Google Scholar]
  • 4.Sharawy Z.Z., Abbas E.M., Abdelkhalek N.K., Ashry O.A., Abd El-Fattah L.S., El-Sawy M.A., Helal M.F., El-Haroun E. Effect of organic carbon source and stocking densities on growth indices, water microflora, and immune-related genes expression of Litopenaeus vannamei Larvae in intensive culture. Aquaculture. 2022;546:737397. doi: 10.1016/j.aquaculture.2021.737397. [DOI] [Google Scholar]
  • 5.Gillett R. Global study of shrimp fisheries. FAO Fish Tech. Pap. 2008;475:25–29. [Google Scholar]
  • 6.Ahmed N., Thompson S., Glaser M. Global aquaculture productivity, environmental sustainability, and climate change adaptability. Environ. Manag. 2019;63:159–172. doi: 10.1007/s00267-018-1117-3. [DOI] [PubMed] [Google Scholar]
  • 7.Lukwambe B., Nicholaus R., Zhang D., Yang W., Zhu J., Zheng Z. Successional changes of microalgae community in response to commercial probiotics in the intensive shrimp (Litopenaeus vannamei Boone) culture systems. Aquaculture. 2019;511:734257. doi: 10.1016/j.aquaculture.2019.734257. [DOI] [Google Scholar]
  • 8.Li E., Xu C., Wang X., Wang S., Zhao Q., Zhang M., Qin J.G., Chen L. Gut microbiota and its modulation for healthy farming of Pacific white shrimp Litopenaeus vannamei. Rev. Fish. Sci. Aquac. 2018;26:381–399. doi: 10.1080/23308249.2018.1440530. [DOI] [Google Scholar]
  • 9.Stevens C., Croft D., Paull G., Tyler C. Stress and welfare in ornamental fishes: What can be learned from aquaculture? J. Fish Biol. 2017;91:409–428. doi: 10.1111/jfb.13377. [DOI] [PubMed] [Google Scholar]
  • 10.El-Sayed A.F.M. Use of biofloc technology in shrimp aquaculture: A comprehensive review, with emphasis on the last decade. Rev. Aquac. 2021;13:676–705. doi: 10.1111/raq.12494. [DOI] [Google Scholar]
  • 11.Anh N.T.N., Shayo F.A., Nevejan N., Van Hoa N. Effects of stocking densities and feeding rates on water quality, feed efficiency, and performance of white leg shrimp Litopenaeus vannamei in an integrated system with sea grape Caulerpa lentillifera. J. Appl. Phycol. 2021;33:3331–3345. doi: 10.1007/s10811-021-02501-4. [DOI] [Google Scholar]
  • 12.Emerenciano M.G., Rombenso A.N., Vieira F.d.N., Martins M.A., Coman G.J., Truong H.H., Noble T.H., Simon C.J. Intensification of Penaeid Shrimp Culture: An Applied Review of Advances in Production Systems, Nutrition and Breeding. Animals. 2022;12:236. doi: 10.3390/ani12030236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Mansour A.T., Ashry O.A., Ashour M., Alsaqufi A.S., Ramadan K.M., Sharawy Z.Z. The optimization of dietary protein level and carbon sources on biofloc nutritive values, bacterial abundance, and growth performances of whiteleg shrimp (Litopenaeus vannamei) juveniles. Life. 2022;12:888. doi: 10.3390/life12060888. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Mansour A.T., Ashry O.A., El-Neweshy M.S., Alsaqufi A.S., Dighiesh H.S., Ashour M., Kelany M.S., El-Sawy M.A., Mabrouk M.M., Abbas E.M. Effect of Agricultural By-Products as a Carbon Source in a Biofloc-Based System on Growth Performance, Digestive Enzyme Activities, Hepatopancreas Histology, and Gut Bacterial Load of Litopenaeus vannamei Post Larvae. J. Mar. Sci. Eng. 2022;10:1333. doi: 10.3390/jmse10101333. [DOI] [Google Scholar]
  • 15.Iber B.T., Kasan N.A. Recent advances in Shrimp aquaculture wastewater management. Heliyon. 2021;7:e08283. doi: 10.1016/j.heliyon.2021.e08283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Zaki M.A., Ashour M., Heneash A.M.M., Mabrouk M.M., Alprol A.E., Khairy H.M., Nour A.M., Mansour A.T., Hassanien H.A., Gaber A., et al. Potential Applications of Native Cyanobacterium Isolate (Arthrospira platensis NIOF17/003) for Biodiesel Production and Utilization of Its Byproduct in Marine Rotifer (Brachionus plicatilis) Production. Sustainability. 2021;13:1769. doi: 10.3390/su13041769. [DOI] [Google Scholar]
  • 17.Abisha R., Krishnani K.K., Sukhdhane K., Verma A., Brahmane M., Chadha N. Sustainable development of climate-resilient aquaculture and culture-based fisheries through adaptation of abiotic stresses: A review. J. Water Clim. Change. 2022;13:2671–2689. doi: 10.2166/wcc.2022.045. [DOI] [Google Scholar]
  • 18.Alprol A.E., Ashour M., Mansour A.T., Alzahrani O.M., Mahmoud S.F., Gharib S.M. Assessment of Water Quality and Phytoplankton Structure of Eight Alexandria Beaches, Southeastern Mediterranean Sea, Egypt. J. Mar. Sci. Eng. 2021;9:1328. doi: 10.3390/jmse9121328. [DOI] [Google Scholar]
  • 19.Metwally A.S., El-Naggar H.A., El-Damhougy K.A., Bashar M.A.E., Ashour M., Abo-Taleb H.A.H. GC-MS analysis of bioactive components in six different crude extracts from the Soft Coral (Sinularia maxim) collected from Ras Mohamed, Aqaba Gulf, Red Sea, Egypt. Egypt. J. Aquat. Biol. Fish. 2020;24:425–434. doi: 10.21608/ejabf.2020.114293. [DOI] [Google Scholar]
  • 20.Magouz F.I., Essa M.A., Matter M., Tageldein Mansour A., Alkafafy M., Ashour M. Population Dynamics, Fecundity and Fatty Acid Composition of Oithona nana (Cyclopoida, Copepoda), Fed on Different Diets. Animals. 2021;11:1188. doi: 10.3390/ani11051188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kesselring J., Gruber C., Standen B., Wein S. Effect of a phytogenic feed additive on the growth performance and immunity of Pacific white leg shrimp, Litopenaeus vannamei, fed a low fishmeal diet. J. World Aquac. Soc. 2021;52:303–315. doi: 10.1111/jwas.12739. [DOI] [Google Scholar]
  • 22.Sharawy Z.Z., Ashour M., Labena A., Alsaqufi A.S., Mensour A.T., Abbas E. Effects of dietary Arthrospira platensis nanoparticles on growth performance, feed utilization, and growth-related gene expression of Pacific white shrimp, Litopenaeus vannamei. Aquaculture. 2022;551:737905. doi: 10.1016/j.aquaculture.2022.737905. [DOI] [Google Scholar]
  • 23.Ceseña C.E., Jacinto E.C., González A.L., Villasante F.V., Castro R.M.M., Ochoa N., Montes R.E., Ramírez D.T., Ortiz A.C.S., Campa-Córdova A.I. Dietary supplementation of Debaryomyces hansenii enhanced survival, antioxidant and immune response in juvenile shrimp penaeus vannamei challenged with Vibrio Parahaemolyticus. Trop. Subtrop. Agroecosyst. 2021;24:2. doi: 10.56369/tsaes.3616. [DOI] [Google Scholar]
  • 24.Mansour A.T., Ashour M., Alprol A.E., Alsaqufi A.S. Aquatic Plants and Aquatic Animals in the Context of Sustainability: Cultivation Techniques, Integration, and Blue Revolution. Sustainability. 2022;14:3257. doi: 10.3390/su14063257. [DOI] [Google Scholar]
  • 25.Hassan S.M., Ashour M., Soliman A.A.F., Hassanien H.A., Alsanie W.F., Gaber A., Elshobary M.E. The Potential of a New Commercial Seaweed Extract in Stimulating Morpho-Agronomic and Bioactive Properties of Eruca vesicaria (L.) Cav. Sustainability. 2021;13:4485. doi: 10.3390/su13084485. [DOI] [Google Scholar]
  • 26.Essa D., Abo-Shady A., Khairy H., Abomohra A.E.-F., Elshobary M. Potential cultivation of halophilic oleaginous microalgae on industrial wastewater. Egypt. J. Bot. 2018;58:205–216. doi: 10.21608/EJBO.2018.809.1054. [DOI] [Google Scholar]
  • 27.Mansour A.T., Alprol A.E., Abualnaja K.M., El-Beltagi H.S., Ramadan K.M.A., Ashour M. Dried Brown Seaweed’s Phytoremediation Potential for Methylene Blue Dye Removal from Aquatic Environments. Polymers. 2022;14:1375. doi: 10.3390/polym14071375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Mansour A.T., Alprol A.E., Abualnaja K.M., El-Beltagi H.S., Ramadan K.M.A., Ashour M. The Using of Nanoparticles of Microalgae in Remediation of Toxic Dye from Industrial Wastewater: Kinetic and Isotherm Studies. Materials. 2022;15:3922. doi: 10.3390/ma15113922. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Mansour A.T., Alprol A.E., Ashour M., Ramadan K.M., Alhajji A.H., Abualnaja K.M. Do Red Seaweed Nanoparticles Enhance Bioremediation Capacity of Toxic Dyes from Aqueous Solution? Gels. 2022;8:310. doi: 10.3390/gels8050310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Abou-Shanab R.A.I., El-Dalatony M.M., El-Sheekh M.M., Ji M.-K., Salama E.-S., Kabra A.N., Jeon B.-H. Cultivation of a new microalga, Micractinium reisseri, in municipal wastewater for nutrient removal, biomass, lipid, and fatty acid production. Biotechnol. Bioprocess Eng. 2014;19:510–518. doi: 10.1007/s12257-013-0485-z. [DOI] [Google Scholar]
  • 31.Vieira M.V., Pastrana L.M., Fuciños P. Microalgae encapsulation systems for food, pharmaceutical and cosmetics applications. Mar. Drugs. 2020;18:644. doi: 10.3390/md18120644. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Fais G., Manca A., Bolognesi F., Borselli M., Concas A., Busutti M., Broggi G., Sanna P., Castillo-Aleman Y.M., Rivero-Jiménez R.A. Wide Range Applications of Spirulina: From Earth to Space Missions. Mar. Drugs. 2022;20:299. doi: 10.3390/md20050299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Shao W., Ebaid R., El-Sheekh M., Abomohra A., Eladel H. Pharmaceutical applications and consequent environmental impacts of Spirulina (Arthrospira): An overview. Grasas Y Aceites. 2019;70:e292. doi: 10.3989/gya.0690181. [DOI] [Google Scholar]
  • 34.Ashour M., Omran A.M.M.M. Recent Advances in Marine Microalgae Production: Highlighting Human Health Products from Microalgae in View of the Coronavirus Pandemic (COVID-19) Fermentation. 2022;8:466. doi: 10.3390/fermentation8090466. [DOI] [Google Scholar]
  • 35.Mourelle M.L., Gómez C.P., Legido J.L. The potential use of marine microalgae and cyanobacteria in cosmetics and thalassotherapy. Cosmetics. 2017;4:46. doi: 10.3390/cosmetics4040046. [DOI] [Google Scholar]
  • 36.Zhuang D., He N., Khoo K.S., Ng E.-P., Chew K.W., Ling T.C. Application progress of bioactive compounds in microalgae on pharmaceutical and cosmetics. Chemosphere. 2021;291:132932. doi: 10.1016/j.chemosphere.2021.132932. [DOI] [PubMed] [Google Scholar]
  • 37.Osman M.E.H., Abo-shady A.M., Elshobary M.E. In vitro screening of antimicrobial activity of extracts of some macroalgae collected from Abu-Qir bay Alexandria, Egypt. Afr. J. Biotechnol. 2010;9:7203–7208. [Google Scholar]
  • 38.Osman M.E.H., Abo-Shady A.M., Elshobary M.E., Abd El-Ghafar M.O., Abomohra A.E.-F. Screening of seaweeds for sustainable biofuel recovery through sequential biodiesel and bioethanol production. Environ. Sci. Pollut. Res. 2020;27:32481–32493. doi: 10.1007/s11356-020-09534-1. [DOI] [PubMed] [Google Scholar]
  • 39.Abomohra A.E.-F., Elshobary M. Microalgae Biotechnology for Development of Biofuel and Wastewater Treatment. Springer; Cham, Switzerland: 2019. Biodiesel, Bioethanol, and Biobutanol Production from Microalgae; pp. 293–321. [DOI] [Google Scholar]
  • 40.Elshobary M.E., El-Shenody R.A., Abomohra A.E.F. Sequential biofuel production from seaweeds enhances the energy recovery: A case study for biodiesel and bioethanol production. Int. J. Energy Res. 2021;45:6457–6467. doi: 10.1002/er.6181. [DOI] [Google Scholar]
  • 41.Cai J., Lovatelli A., Aguilar-Manjarrez J., Cornish L., Dabbadie L., Desrochers A., Diffey S., Garrido Gamarro E., Geehan J., Hurtado A. FAO Fisheries and Aquaculture Circular. FAO; Rome, Italy: 2021. Seaweeds and Microalgae: An Overview for Unlocking Their Potential in Global Aquaculture Development. [DOI] [Google Scholar]
  • 42.Chopin T., Tacon A.G. Importance of seaweeds and extractive species in global aquaculture production. Rev. Fish. Sci. Aquac. 2021;29:139–148. doi: 10.1080/23308249.2020.1810626. [DOI] [Google Scholar]
  • 43.Wan A.H., Davies S.J., Soler-Vila A., Fitzgerald R., Johnson M.P. Macroalgae as a sustainable aquafeed ingredient. Rev. Aquac. 2019;11:458–492. doi: 10.1111/raq.12241. [DOI] [Google Scholar]
  • 44.Khalid S., Abbas M., Saeed F., Bader-Ul-Ain H., Suleria H.A.R. Therapeutic Potential of Seaweed Bioactive Compounds. IntechOpen; London, UK: 2018. [Google Scholar]
  • 45.Gamero-Vega G., Palacios-Palacios M., Quitral V. Nutritional composition and bioactive compounds of red seaweed: A mini-review. J. Food Nutr. Res. 2020;8:431–440. doi: 10.12691/jfnr-8-8-7. [DOI] [Google Scholar]
  • 46.Syakilla N., George R., Chye F.Y., Pindi W., Mantihal S., Wahab N.A., Fadzwi F.M., Gu P.H., Matanjun P. A Review on Nutrients, Phytochemicals, and Health Benefits of Green Seaweed, Litopenaeus vannamei. Foods. 2022;11:2832. doi: 10.3390/foods11182832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Pereira V.A., de Alencar D.B., de Araújo I.W.F., Rodrigues J.A.G., Lopes J.T., Nunes L.T., Ferreira Y.M., Lobato J.S., Montenegro A.R., Vanderley C.S.B.S. Supplementation of cryodiluent media with seaweed or Nile tilapia skin sulfated polysaccharides for freezing of Colossoma macropomum (Characiformes: Serrasalmidae) semen. Aquaculture. 2020;528:735553. doi: 10.1016/j.aquaculture.2020.735553. [DOI] [Google Scholar]
  • 48.Yudiati E., Isnansetyo A., Handayani C.R. Innate immune-stimulating and immune genes up-regulating activities of three types of alginate from Sargassum siliquosum in Pacific white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol. 2016;54:46–53. doi: 10.1016/j.fsi.2016.03.022. [DOI] [PubMed] [Google Scholar]
  • 49.Cantelli L., Goncalves P., Guertler C., Kayser M., Pilotto M.R., Barracco M.A., Perazzolo L.M. Dietary supplementation with sulfated polysaccharides from Gracilaria birdiae promotes a delayed immunostimulation in marine shrimp challenged by the white spot syndrome virus. Aquac. Int. 2019;27:349–367. doi: 10.1007/s10499-018-0328-1. [DOI] [Google Scholar]
  • 50.Setyawan A., Isnansetyo A., Murwantoko M., Indarjulianto S., Handayani C. Comparative immune response of dietary fucoidan from three Indonesian brown algae in white shrimp Litopenaeus vannamei. AACL Bioflux. 2018;11:1707–1723. [Google Scholar]
  • 51.Yangthong M., Hutadilok-Towatana N., Thawonsuwan J., Phromkunthong W. An aqueous extract from Sargassum sp. enhances the immune response and resistance against Streptococcus iniae in the Asian sea bass (Lates calcarifer Bloch) J. Appl. Phycol. 2016;28:3587–3598. [Google Scholar]
  • 52.Yuguchi Y., Bui L.M., Takebe S., Suzuki S., Nakajima N., Kitamura S., Thanh T.T.T. Primary structure, conformation in aqueous solution, and intestinal immunomodulating activity of fucoidan from two brown seaweed species Sargassum crassifolium and Padina australis. Carbohydr. Polym. 2016;147:69–78. doi: 10.1016/j.carbpol.2016.03.101. [DOI] [PubMed] [Google Scholar]
  • 53.Øverland M., Mydland L.T., Skrede A. Marine macroalgae as sources of protein and bioactive compounds in feed for monogastric animals. J. Sci. Food Agric. 2019;99:13–24. doi: 10.1002/jsfa.9143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Vidhya Hindu S., Chandrasekaran N., Mukherjee A., Thomas J. A review on the impact of seaweed polysaccharide on the growth of probiotic bacteria and its application in aquaculture. Aquac. Int. 2019;27:227–238. doi: 10.1007/s10499-018-0318-3. [DOI] [Google Scholar]
  • 55.Sakai M. Current research status of fish immunostimulants. Aquaculture. 1999;172:63–92. doi: 10.1016/S0044-8486(98)00436-0. [DOI] [Google Scholar]
  • 56.Yan J., Guo C., Dawood M., Gao J. Effects of dietary chitosan on growth, lipid metabolism, immune response and antioxidant-related gene expression in Misgurnus anguillicaudatus. Benef. Microbes. 2017;8:439–449. doi: 10.3920/BM2016.0177. [DOI] [PubMed] [Google Scholar]
  • 57.Kumari N., Kumar M., Lorenzo J.M., Sharma D., Puri S., Pundir A., Dhumal S., Bhuyan D.J., Jayanthy G., Selim S. Onion and garlic polysaccharides: A review on extraction, characterization, bioactivity, and modifications. Int. J. Biol. Macromol. 2022;219:1047–1061. doi: 10.1016/j.ijbiomac.2022.07.163. [DOI] [PubMed] [Google Scholar]
  • 58.Song S.K., Beck B.R., Kim D., Park J., Kim J., Kim H.D., Ringø E. Prebiotics as immunostimulants in aquaculture: A review. Fish Shellfish Immunol. 2014;40:40–48. doi: 10.1016/j.fsi.2014.06.016. [DOI] [PubMed] [Google Scholar]
  • 59.Paiva L., Lima E., Neto A.I., Baptista J. Seasonal variability of the biochemical composition and antioxidant properties of Fucus spiralis at two Azorean Islands. Mar. Drugs. 2018;16:248. doi: 10.3390/md16080248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Pan S., Jiang L., Wu S. Stimulating effects of polysaccharide from Angelica sinensis on the nonspecific immunity of white shrimps (Litopenaeus vannamei) Fish Shellfish Immunol. 2018;74:170–174. doi: 10.1016/j.fsi.2017.12.067. [DOI] [PubMed] [Google Scholar]
  • 61.Eissa H., Hegazi M.M., Elmor M.E., Sharawy Z.Z. Effects of partial substitution of fish meal with different levels of marine macroalgae species on growth indices and RNA/DNA ratio of hybrid red tilapia. Egypt. J. Aquat. Biol. Fish. 2021;25:395–410. doi: 10.21608/ejabf.2021.175848. [DOI] [Google Scholar]
  • 62.Sritunyalucksana K., Söderhäll K. The proPO and clotting system in crustaceans. Aquaculture. 2000;191:53–70. doi: 10.1016/S0044-8486(00)00411-7. [DOI] [Google Scholar]
  • 63.Wang Y.-B. Effect of probiotics on growth performance and digestive enzyme activity of the shrimp Penaeus vannamei. Aquaculture. 2007;269:259–264. doi: 10.1016/j.aquaculture.2007.05.035. [DOI] [Google Scholar]
  • 64.Janeway C.A. Approaching the asymptote? Evolution and revolution in immunology. Cold Spring Harb. Symp. Quant. Biol. 1989;54:1–13. doi: 10.1101/SQB.1989.054.01.003. [DOI] [PubMed] [Google Scholar]
  • 65.Amparyup P., Sutthangkul J., Charoensapsri W., Tassanakajon A. Pattern recognition protein binds to lipopolysaccharide and β-1, 3-glucan and activates shrimp prophenoloxidase system. J. Biol. Chem. 2012;287:10060–10069. doi: 10.1074/jbc.M111.294744. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Kanost M.R., Jiang H., Yu X.Q. Innate immune responses of a lepidopteran insect, Manduca sexta. Immunol. Rev. 2004;198:97–105. doi: 10.1111/j.0105-2896.2004.0121.x. [DOI] [PubMed] [Google Scholar]
  • 67.Yu X.-Q., Kanost M.R. Immulectin-2, a pattern recognition receptor that stimulates hemocyte encapsulation and melanization in the tobacco hornworm, Manduca sexta. Dev. Comp. Immunol. 2004;28:891–900. doi: 10.1016/j.dci.2004.02.005. [DOI] [PubMed] [Google Scholar]
  • 68.Romo-Figueroa M.a.G., Vargas-Requena C., Sotelo-Mundo R.R., Vargas-Albores F., Higuera-Ciapara I., Söderhäll K., Yepiz-Plascencia G. Molecular cloning of a β-glucan pattern-recognition lipoprotein from the white shrimp Penaeus (Litopenaeus) vannamei: Correlations between the deduced amino acid sequence and the native protein structure. Dev. Comp. Immunol. 2004;28:713–726. doi: 10.1016/j.dci.2003.11.008. [DOI] [PubMed] [Google Scholar]
  • 69.Lee S.Y., Wang R., Söderhäll K. A lipopolysaccharide-and β-1, 3-glucan-binding protein from hemocytes of the freshwater crayfish Pacifastacus leniusculus: Purification, characterization, and cDNA cloning. J. Biol. Chem. 2000;275:1337–1343. doi: 10.1074/jbc.275.2.1337. [DOI] [PubMed] [Google Scholar]
  • 70.Lee S.Y., Söderhäll K. Early events in crustacean innate immunity. Fish Shellfish Immunol. 2002;12:421–437. doi: 10.1006/fsim.2002.0420. [DOI] [PubMed] [Google Scholar]
  • 71.Holmblad T., Söderhäll K. Cell adhesion molecules and antioxidative enzymes in a crustacean, possible role in immunity. Aquaculture. 1999;172:111–123. doi: 10.1016/S0044-8486(98)00446-3. [DOI] [Google Scholar]
  • 72.Campa-Córdova A., Hernández-Saavedra N., De Philippis R., Ascencio F. Generation of superoxide anion and SOD activity in haemocytes and muscle of American white shrimp (Litopenaeus vannamei) as a response to β-glucan and sulphated polysaccharide. Fish Shellfish Immunol. 2002;12:353–366. doi: 10.1006/fsim.2001.0377. [DOI] [PubMed] [Google Scholar]
  • 73.Yu B.P. Cellular defenses against damage from reactive oxygen species. Physiol. Rev. 1994;74:139–162. doi: 10.1152/physrev.1994.74.1.139. [DOI] [PubMed] [Google Scholar]
  • 74.Zhang Q., Li F., Wang B., Zhang J., Liu Y., Zhou Q., Xiang J. The mitochondrial manganese superoxide dismutase gene in Chinese shrimp Fenneropenaeus chinensis: Cloning, distribution and expression. Dev. Comp. Immunol. 2007;31:429–440. doi: 10.1016/j.dci.2006.08.005. [DOI] [PubMed] [Google Scholar]
  • 75.Han L., Hole J.A., Stock J.M., Fuis G.S., Kell A., Driscoll N.W., Kent G.M., Harding A.J., Rymer M.J., González-Fernández A. Continental rupture and the creation of new crust in the Salton Trough rift, Southern California and northern Mexico: Results from the Salton Seismic Imaging Project. J. Geophys. Res. Solid Earth. 2016;121:7469–7489. doi: 10.1002/2016JB013139. [DOI] [Google Scholar]
  • 76.Tassanakajon A., Rimphanitchayakit V., Visetnan S., Amparyup P., Somboonwiwat K., Charoensapsri W., Tang S. Shrimp humoral responses against pathogens: Antimicrobial peptides and melanization. Dev. Comp. Immunol. 2018;80:81–93. doi: 10.1016/j.dci.2017.05.009. [DOI] [PubMed] [Google Scholar]
  • 77.Zhu Z.-y., Liu R.-q., Si C.-l., Zhou F., Wang Y.-x., Ding L.-n., Jing C., Liu A.-j., Zhang Y.-m. Structural analysis and anti-tumor activity comparison of polysaccharides from Astragalus. Carbohydr. Polym. 2011;85:895–902. doi: 10.1016/j.carbpol.2011.04.020. [DOI] [Google Scholar]
  • 78.Picha M.E., Turano M.J., Tipsmark C.K., Borski R.J. Regulation of endocrine and paracrine sources of Igfs and Gh receptor during compensatory growth in hybrid striped bass (Morone chrysops × Morone saxatilis) J. Endocrinol. 2008;199:81. doi: 10.1677/JOE-07-0649. [DOI] [PubMed] [Google Scholar]
  • 79.Castillo-Juárez H., Campos-Montes G.R., Caballero-Zamora A., Montaldo H.H. Genetic improvement of Pacific white shrimp [Penaeus (Litopenaeus) vannamei]: Perspectives for genomic selection. Front. Genet. 2015;6:93. doi: 10.3389/fgene.2015.00093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Ashour M., Abo-Taleb H.A., Hassan A.-K.M., Abdelzaher O.F., Mabrouk M.M., Elokaby M.A., Alzahrani O.M., Mahmoud S.F., El-feky M.M.M., Shaban W.M., et al. Valorization Use of Amphipod Meal, Gammarus pulex, as a Fishmeal Substitute on Growth Performance, Feed Utilization, Histological and Histometric Indices of the Gut, and Economic Revenue of Grey Mullet. J. Mar. Sci. Eng. 2021;9:1336. doi: 10.3390/jmse9121336. [DOI] [Google Scholar]
  • 81.Tabarsa M., Shin I.-S., Lee J.H., Surayot U., Park W., You S. An immune-enhancing water-soluble α-glucan from Chlorella vulgaris and structural characteristics. Food Sci. Biotechnol. 2015;24:1933–1941. doi: 10.1007/s10068-015-0255-0. [DOI] [Google Scholar]
  • 82.Boyd C.E., Tucker C.S. Pond Aquaculture Water Quality Management. Springer Science & Business Media; Berlin/Heidelberg, Germany: 2012. [Google Scholar]
  • 83.APHA . Standard Methods for the Examination of Water and Wastewater. American Public Health Association (APHA); Washington, DC, USA: 2005. [Google Scholar]
  • 84.Mehrabi Z., Firouzbakhsh F., Jafarpour A. Effects of dietary supplementation of synbiotic on growth performance, serum biochemical parameters and carcass composition in rainbow trout (Oncorhynchus mykiss) fingerlings. J. Anim. Physiol. Anim. Nutr. 2012;96:474–481. doi: 10.1111/j.1439-0396.2011.01167.x. [DOI] [PubMed] [Google Scholar]
  • 85.Zeraatpisheh F., Firouzbakhsh F., Khalili K.J. Effects of the macroalga Sargassum angustifolium hot water extract on hematological parameters and immune responses in rainbow trout (Oncohrynchus mykiss) infected with Yersinia rukeri. J. Appl. Phycol. 2018;30:2029–2037. doi: 10.1007/s10811-018-1395-4. [DOI] [Google Scholar]
  • 86.AOAC . Official Methods of Analysis of the ASSOCIATION of Official Analytical Chemists. Volume 2 The Association of Official Analytical Chemists; Washington DC, USA: 2003. [Google Scholar]
  • 87.Mansour A.T., Ashour M., Abbas E.M., Alsaqufi A.S., Kelany M.S., El-Sawy M.A., Sharawy Z.Z. Growth Performance, Immune-Related and Antioxidant Genes Expression, and Gut Bacterial Abundance of Pacific White Leg Shrimp, Litopenaeus vannamei, Dietary Supplemented with Natural Astaxanthin. Front. Physiol. 2022;13:874172. doi: 10.3389/fphys.2022.874172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Draper N.R., Smith H. Applied Regression Analysis. Volume 326 John Wiley & Sons; Hoboken, NJ, USA: 1998. [Google Scholar]
  • 89.Ganesh E.A., Das S., Chandrasekar K., Arun G., Balamurugan S. Monitoring of total heterotrophic bacteria and Vibrio spp. in an aquaculture pond. Curr. Res. J. Biol. Sci. 2010;2:48–52. [Google Scholar]
  • 90.Xu Z., Regenstein J.M., Xie D., Lu W., Ren X., Yuan J., Mao L. The oxidative stress and antioxidant responses of Litopenaeus vannamei to low temperature and air exposure. Fish Shellfish Immunol. 2018;72:564–571. doi: 10.1016/j.fsi.2017.11.016. [DOI] [PubMed] [Google Scholar]
  • 91.Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 92.Zar J. Biostat—Stical Anaslysis. 2nd ed. Prentice-Hall Inc.; Englewood Cliffs, NJ, USA: 1984. [Google Scholar]
  • 93.Abdel-Latif H.M., Dawood M.A., Alagawany M., Faggio C., Nowosad J., Kucharczyk D. Health benefits and potential applications of fucoidan (FCD) extracted from brown seaweeds in aquaculture: An updated review. Fish Shellfish Immunol. 2022;122:115–130. doi: 10.1016/j.fsi.2022.01.039. [DOI] [PubMed] [Google Scholar]
  • 94.Huang X., Zhou H., Zhang H. The effect of Sargassum fusiforme polysaccharide extracts on vibriosis resistance and immune activity of the shrimp, Fenneropenaeus chinensis. Fish Shellfish Immunol. 2006;20:750–757. doi: 10.1016/j.fsi.2005.09.008. [DOI] [PubMed] [Google Scholar]
  • 95.Milledge J.J., Nielsen B.V., Bailey D. High-value products from macroalgae: The potential uses of the invasive brown seaweed, Sargassum muticum. Rev. Environ. Sci. Bio/Technol. 2016;15:67–88. doi: 10.1007/s11157-015-9381-7. [DOI] [Google Scholar]
  • 96.Raguraman V., Ravindran N., Selvaraju K., Kasivelu G. Seaweed polysaccharides as potential therapeutic agents against white spot syndrome virus (WSSV): A mini review. Aquac. Int. 2020;28:2333–2343. doi: 10.1007/s10499-020-00587-0. [DOI] [Google Scholar]
  • 97.Thanigaivel S., Vickram S., Saranya V., Ali H., Alarifi S., Modigunta J.K.R., Anbarasu K., Lakshmipathy R., Rohini K. Seaweed polysaccharide mediated synthesis of silver nanoparticles and its enhanced disease resistance in Oreochromis mossambicus. J. King Saud Univ. Sci. 2022;34:101771. doi: 10.1016/j.jksus.2021.101771. [DOI] [Google Scholar]
  • 98.Lee P.-T., Tran H.T.Q., Huang H.-T., Nan F.-H., Lee M.-C. Sargassum horneri extracts stimulate innate immunity, enhance growth performance, and upregulate immune genes in the white shrimp Litopenaeus vannamei. Fish Shellfish Immunol. 2020;102:276–285. doi: 10.1016/j.fsi.2020.04.049. [DOI] [PubMed] [Google Scholar]
  • 99.Liu W.-C., Zhou S.-H., Balasubramanian B., Zeng F.-Y., Sun C.-B., Pang H.-Y. Dietary seaweed (Enteromorpha) polysaccharides improves growth performance involved in regulation of immune responses, intestinal morphology and microbial community in banana shrimp Fenneropenaeus merguiensis. Fish Shellfish Immunol. 2020;104:202–212. doi: 10.1016/j.fsi.2020.05.079. [DOI] [PubMed] [Google Scholar]
  • 100.Ashour M., Mabrouk M.M., Ayoub H.F., El-Feky M.M.M.M., Zaki S.Z., Hoseinifar S.H., Rossi W., Van Doan H., El-Haroun E., Goda A.M.A.S. Effect of dietary seaweed extract supplementation on growth, feed utilization, hematological indices, and non-specific immunity of Nile Tilapia, Oreochromis niloticus challenged with Aeromonas hydrophila. J. Appl. Phycol. 2020;32:3467–3479. doi: 10.1007/s10811-020-02178-1. [DOI] [Google Scholar]
  • 101.Ringø E., Zhou Z., Vecino J.G., Wadsworth S., Romero J., Krogdahl Å., Olsen R.E., Dimitroglou A., Foey A., Davies S. Effect of dietary components on the gut microbiota of aquatic animals. A never-ending story? Aquac. Nutr. 2016;22:219–282. doi: 10.1111/anu.12346. [DOI] [Google Scholar]
  • 102.Kitikiew S., Chen J.-C., Putra D.F., Lin Y.-C., Yeh S.-T., Liou C.-H. Fucoidan effectively provokes the innate immunity of white shrimp Litopenaeus vannamei and its resistance against experimental Vibrio alginolyticus infection. Fish Shellfish Immunol. 2013;34:280–290. doi: 10.1016/j.fsi.2012.11.016. [DOI] [PubMed] [Google Scholar]
  • 103.Wongsasak U., Chaijamrus S., Kumkhong S., Boonanuntanasarn S. Effects of dietary supplementation with β-glucan and synbiotics on immune gene expression and immune parameters under ammonia stress in Pacific white shrimp. Aquaculture. 2015;436:179–187. doi: 10.1016/j.aquaculture.2014.10.028. [DOI] [Google Scholar]
  • 104.Cheng Y. The growth performance and nonspecific immunity of red swamp crayfish Procambarus clarkia affected by dietary Rhodiola rosea polysaccharide. Fish Shellfish Immunol. 2019;93:796–800. doi: 10.1016/j.fsi.2019.08.046. [DOI] [PubMed] [Google Scholar]
  • 105.Labbe P., Little T.J. ProPhenolOxidase in Daphnia magna: cDNA sequencing and expression in relation to resistance to pathogens. Dev. Comp. Immunol. 2009;33:674–680. doi: 10.1016/j.dci.2008.11.012. [DOI] [PubMed] [Google Scholar]
  • 106.Panigrahi A., Saranya C., Sundaram M., Kannan S.V., Das R.R., Kumar R.S., Rajesh P., Otta S. Carbon: Nitrogen (C: N) ratio level variation influences microbial community of the system and growth as well as immunity of shrimp (Litopenaeus vannamei) in biofloc based culture system. Fish Shellfish Immunol. 2018;81:329–337. doi: 10.1016/j.fsi.2018.07.035. [DOI] [PubMed] [Google Scholar]
  • 107.Rowley A.F., Powell A. Invertebrate immune systems–specific, quasi-specific, or nonspecific? J. Immunol. 2007;179:7209–7214. doi: 10.4049/jimmunol.179.11.7209. [DOI] [PubMed] [Google Scholar]
  • 108.Ai-Aql Z., Alagl A.S., Graves D.T., Gerstenfeld L.C., Einhorn T.A. Molecular mechanisms controlling bone formation during fracture healing and distraction osteogenesis. J. Dent. Res. 2008;87:107–118. doi: 10.1177/154405910808700215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 109.Söderhäll K., Cerenius L. Role of the prophenoloxidase-activating system in invertebrate immunity. Curr. Opin. Immunol. 1998;10:23–28. doi: 10.1016/S0952-7915(98)80026-5. [DOI] [PubMed] [Google Scholar]
  • 110.Sivagnanavelmurugan M., Thaddaeus B.J., Palavesam A., Immanuel G. Dietary effect of Sargassum wightii fucoidan to enhance growth, prophenoloxidase gene expression of Penaeus monodon and immune resistance to Vibrio parahaemolyticus. Fish Shellfish Immunol. 2014;39:439–449. doi: 10.1016/j.fsi.2014.05.037. [DOI] [PubMed] [Google Scholar]
  • 111.Vargas-Albores F., Martínez-Porchas M. Crustins are distinctive members of the WAP-containing protein superfamily: An improved classification approach. Dev. Comp. Immunol. 2017;76:9–17. doi: 10.1016/j.dci.2017.05.012. [DOI] [PubMed] [Google Scholar]
  • 112.Rattanachai A., Hirono I., Ohira T., Takahashi Y., Aoki T. Cloning of kuruma prawn Marsupenaeus japonicus crustin-like peptide cDNA and analysis of its expression. Fish. Sci. 2004;70:765–771. doi: 10.1111/j.1444-2906.2004.00869.x. [DOI] [Google Scholar]
  • 113.Wang H., Dai A., Liu F., Guan Y. Effects of dietary astaxanthin on the immune response, resistance to white spot syndrome virus and transcription of antioxidant enzyme genes in Pacific white shrimp Litopenaeus vannamei. Iran. J. Fish. Sci. 2015;14:699–718. [Google Scholar]
  • 114.Tyagi V.V., Buddhi D. PCM thermal storage in buildings: A state of art. Renew. Sustain. Energy Rev. 2007;11:1146–1166. doi: 10.1016/j.rser.2005.10.002. [DOI] [Google Scholar]
  • 115.Ringø E. Evaluation of probiotic strain Bacillus subtilis C-3102 as a feed supplement for koi carp (Cyprinus carpio) J. Aquac. Res. Dev. 2011 doi: 10.4172/2155-9546.S1-005. [DOI] [Google Scholar]
  • 116.Zhang J., Li F., Wang Z., Xiang J. Cloning and recombinant expression of a crustin-like gene from Chinese shrimp, Fenneropenaeus chinensis. J. Biotechnol. 2007;127:605–614. doi: 10.1016/j.jbiotec.2006.08.013. [DOI] [PubMed] [Google Scholar]
  • 117.Liu W.-J., Chang Y.-S., Wang C.-H., Kou G.-H., Lo C.-F. Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp. Virology. 2005;334:327–341. doi: 10.1016/j.virol.2005.01.047. [DOI] [PubMed] [Google Scholar]
  • 118.Feng K., Yu J., Cheng Y., Ruan M., Wang R., Ye Q., Zhou G., Li Z., Yao Z., Yang Y. The SOD gene family in tomato: Identification, phylogenetic relationships, and expression patterns. Front. Plant Sci. 2016;7:1279. doi: 10.3389/fpls.2016.01279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 119.Campa-Córdova A., Hernández-Saavedra N., Aguirre-Guzmán G., Ascencio F. Respuesta inmunomoduladora de la superóxido dismutasa en juveniles de camarón blanco (Litopenaeus vannamei) expuestos a inmunoestimulantes. Ciencias marinas. 2005;31:661–669. doi: 10.7773/cm.v31i4.32. [DOI] [Google Scholar]
  • 120.Wang K.H.-C., Tseng C.-W., Lin H.-Y., Chen I.-T., Chen Y.-H., Chen Y.-M., Chen T.-Y., Yang H.-L. RNAi knock-down of the Litopenaeus vannamei Toll gene (LvToll) significantly increases mortality and reduces bacterial clearance after challenge with Vibrio harveyi. Dev. Comp. Immunol. 2010;34:49–58. doi: 10.1016/j.dci.2009.08.003. [DOI] [PubMed] [Google Scholar]
  • 121.Sharawy Z.Z., Thiele R., Abbas E.M., El-Magd M.A., Hassaan M.S., Peter C., Schmidt J., Saborowski R., Goda A.M., Slater M.J. Antioxidant response and body composition of whiteleg shrimp co-cultured with Nile tilapia in recirculating aquaculture. Aquac. Environ. Interact. 2017;9:257–268. doi: 10.3354/aei00229. [DOI] [Google Scholar]
  • 122.Roch P. Defense mechanisms and disease prevention in farmed marine invertebrates. Aquaculture. 1999;172:125–145. doi: 10.1016/S0044-8486(98)00439-6. [DOI] [Google Scholar]
  • 123.Hassan S.A., Sharawy Z.Z., El Nahas A.F., Hemeda S.A., El-Haroun E., Abbas E.M. Carbon sources improve water quality, microbial community, immune-related and antioxidant genes expression and survival of challenged Litopenaeus vannamei Postlarvae in biofloc system. Aquac. Res. 2022;53:5902–5914. doi: 10.1111/are.16058. [DOI] [Google Scholar]
  • 124.Hassan S.A., Sharawy Z.Z., El Nahas A.F., Hemeda S.A., El-Haroun E., Abbas E.M. Modulatory effects of various carbon sources on growth indices, digestive enzymes activity and expression of growth-related genes in Whiteleg shrimp, Litopenaeus vannamei reared under an outdoor zero-exchange system. Aquac. Res. 2022;53:5594–5605. doi: 10.1111/are.16041. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Not applicable.


Articles from Life are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES