Skip to main content
International Journal of Molecular Sciences logoLink to International Journal of Molecular Sciences
. 2023 Feb 16;24(4):3996. doi: 10.3390/ijms24043996

Differentially Expressed Genes and Molecular Susceptibility to Human Age-Related Diseases

Svetlana Shikhevich 1, Irina Chadaeva 1, Bato Khandaev 1,2, Rimma Kozhemyakina 1, Karina Zolotareva 1,2, Anna Kazachek 1,2, Dmitry Oshchepkov 1,2, Anton Bogomolov 1,2, Natalya V Klimova 1, Vladimir A Ivanisenko 1,2, Pavel Demenkov 1, Zakhar Mustafin 1,2, Arcady Markel 1,2, Ludmila Savinkova 1, Nikolay A Kolchanov 1,2, Vladimir Kozlov 3, Mikhail Ponomarenko 1,*
Editor: Lidia Larizza
PMCID: PMC9966505  PMID: 36835409

Abstract

Mainstream transcriptome profiling of susceptibility versus resistance to age-related diseases (ARDs) is focused on differentially expressed genes (DEGs) specific to gender, age, and pathogeneses. This approach fits in well with predictive, preventive, personalized, participatory medicine and helps understand how, why, when, and what ARDs one can develop depending on their genetic background. Within this mainstream paradigm, we wanted to find out whether the known ARD-linked DEGs available in PubMed can reveal a molecular marker that will serve the purpose in anyone’s any tissue at any time. We sequenced the periaqueductal gray (PAG) transcriptome of tame versus aggressive rats, identified rat-behavior-related DEGs, and compared them with their known homologous animal ARD-linked DEGs. This analysis yielded statistically significant correlations between behavior-related and ARD-susceptibility-related fold changes (log2 values) in the expression of these DEG homologs. We found principal components, PC1 and PC2, corresponding to the half-sum and the half-difference of these log2 values, respectively. With the DEGs linked to ARD susceptibility and ARD resistance in humans used as controls, we verified these principal components. This yielded only one statistically significant common molecular marker for ARDs: an excess of Fcγ receptor IIb suppressing immune cell hyperactivation.

Keywords: human, age-related disease, molecular marker, Rattus norvegicus, RNA-Seq, qPCR, differentially expressed gene, meta-analysis, correlation, principal component, bootstrap

1. Introduction

Seven years ago, the World Health Organization (WHO) defined the Healthy Ageing Framework [1] and declared the decade between 2020 and 2030 as the Decade of Healthy Ageing [2]. Because a standard definition of age-related diseases (ARDs) has yet to be agreed upon, epidemiologists differentiate between, on the one hand, all non-infectious diseases with a reliance on incidence rates rising exponentially with age, no matter the lifespan, and, on the other hand, the diseases that start in early life and have stable or lowered incidence rates in the elderly [3]. Given this lack of strict classification, many age-related diseases can be named as ARDs: sarcopenic obesity [4], homeostasis dysregulation [5], subfertility [6], lipodystrophy [7], sarcopenia [8], macular degeneration [9], chronic inflammation [10], osteoarthritis [11], endothelial dysfunction [12], tissue senescence [13], cancer [14], atherosclerosis [15], cardiovascular diseases [16], chronic kidney disease [17], stroke [18], frontotemporal dementia [19], Alzheimer’s [20], and Parkinson’s [21], to mention some. Moreover, many other pathologies can contribute to ARDs: amyotrophic lateral sclerosis, to motoneuronal aging [22]; mitochondrial dysfunction, to aging as such [23]; vascular atherosclerosis, to cellular senescence [24]; hypertension, to vascular aging [25]; thalassemia, to myelodysplastic syndrome [26]; cancer, to immune system aging and vice versa [27]; and circadian rhythm disorder, to aging as such [28]. Furthermore, some diets enriched for fat [29], calcium [30], or citrates [31] can provoke ARDs, as do long-term hunger, malnutrition, anorexia, and appetite loss [32]. By contrast, moderate physical exercise [33], short-term fasting [34], and low-dose aspirin [35] can prevent such diseases.

This could be why mainstream transcriptome-profiling studies of ARD susceptibility versus ARD resistance in human volunteers [33,36,37,38,39,40,41,42,43] and animals [30,32,35,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64] are focused on the differentially expressed genes (DEGs) that are specific to gender, age, tissues, and pathogeneses. All previous research contributes to progress in predictive, preventive, personalized, participatory (4P) medicine [65] and helps us understand where, how, why, when, and what disorders can affect people depending on their genetic background, medical history, and lifestyle. Because none of us is able to escape an ARD, we expected that a meta-analysis of all available ARD-linked DEGs would eventually reveal the most common, universal theranostic molecular marker that will be permanently available in any tissue of anyone’s organism.

Because hypertension contributes to vascular aging [66] and vice versa, we have previously studied, within this mainstream paradigm, the inbred ISIAH (Inherited Stress-Induced Arterial Hypertension) rat strain [67] and sequenced transcriptomes in the brain stem [47], hypothalamus [48], renal medulla [49], renal cortex [50], and adrenal glands [51], with WAG rats used as controls. Additionally, we have recently obtained and compared transcriptomes of the midbrain tegmentum [68] in gray rats of a tame and an aggressive outbred strain [69,70,71,72]; this allowed us to identify, in in silico settings, potential molecular markers for neoteny, which has a power to reverse ARDs [73]. Furthermore, we have recently profiled transcriptomes in the hippocampus [74] of tame versus aggressive rat strains, in which deficient β-protocadherins and β-hemoglobin were found to be the statistically significantly most common theranostic molecular markers for ARD-related hypertension. That is why we sequenced, in the same way, one more transcriptome, that of the periaqueductal gray matter (PAG), in the tame versus aggressive rats, identified the corresponding behavior-related PAG-associated DEGs in them, and compared these DEGs with their homologous PubMed-based [75] ARD-linked DEGs in animals [30,32,35,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,68,74] and humans [33,36,37,38,39,40,41,42,43] to find out whether there are invariant molecular markers for such diseases among them.

2. Results

2.1. RNA-Seq and Mapping to the Reference Rat Genome

We focused on the PAG because the activity of this brain structure contributes to elevated pain tolerance [76], sociability, intelligence (IQ), and humor processing with increasing age [77]. In fact, our best hope was that if we had had all possible ARD molecular markers at hand, we would have eventually understand which of them might be the best helpers to relieve the suffering of ARD patients. We profiled the PAG transcriptome of three tame adult male gray rats (Rattus norvegicus) against three aggressive conspecifics on an Illumina NextSeq 550 system (see Section 4.2). The rats came from two outbred strains, one tame and one aggressive, maintained at the Institute of Cytology and Genetics of the Siberian Branch of the Russian Academy of Science [72,78] for more than 90 generations using the glove test [79]. The rats were not consanguineous (see Section 4.1). First, we sequenced 210,128,758 reads each 75 nt in length and deposited them in the NCBI SRA database [80] (ID PRJNA668014) (see Table 1). Next, we chose from among them 177,608,837 raw reads (84.5%) via mapping to the reference rat genome RGSC Rnor_6.0, UCSC Rn 6 July 2014 (Table 1). Then we identified 14,039 genes expressed in the PAG of the studied rats. Finally, we selected 39 DEGs using Fisher’s Z-test with the Benjamini correction for multiple comparisons and discarded hypothetical, tentative, predicted, uncharacterized, or non-protein-coding genes to minimize the false-positive error rates (Table 1 and Table 2).

Table 1.

A summary of searches for DEGs in the PAG transcriptomes of three tame adult male rats (R. norvegicus) and three aggressive adult male rats, all animals being unrelated.

Group Tame vs. Aggressive Rats
Total number of sequence reads (NCBI SRA ID: PRJNA668014) 210,128,758
Reads mapped to reference rat genome RGSC Rnor_6.0, UCSC Rn6, July 2014 (%) 177,608,837 (84.5%)
Expressed genes identified 14,039
Statistically significant DEGs (PADJ < 0.05, Fisher’s Z-test with the Benjamini correction) 39

Table 2.

Statistically significant DEGs newly identified in the PAG of the tame and aggressive adult male rats.

# Rat Gene Name Symbol log2 PADJ
1 Amylase α1A Amy1a 1.97 <0.05
2 Aldehyde oxidase 1 Aox1 1.82 <0.05
3 Achaete-scute family bHLH transcription factor 3 Ascl3 2.74 <10−4
4 BTG3-associated nuclear protein Banp 0.64 <0.05
5 Bradykinin receptor B2 Bdkrb2 1.62 <0.05
6 Cocaine- and amphetamine-regulated transcript prepropeptide Cartpt 3.53 <10−7
7 Cytochrome P450, family 2, subfamily j, polypeptide 10 Cyp2j10 1.10 <10−2
8 Defensin β17 Defb17 6.96 <10−2
9 Empty spiracles homeobox 2 Emx2 1.45 <10−2
10 FAT atypical cadherin 2 Fat2 4.96 <0.05
11 Fc γ receptor IIb Fcgr2b 2.02 <0.05
12 AP-1 transcription factor subunit FosB proto-oncogene Fosb 1.85 <10−3
13 Glycerol-3-phosphate dehydrogenase 1 Gpd1 0.99 <0.05
14 Hemoglobin, β adult major chain Hbb-b1 5.90 <10−5
15 Heat shock protein family A (Hsp70) member 1B Hspa1b 2.14 <10−7
16 Integral membrane protein 2A Itm2a 0.76 <10−2
17 Keratin 2 Krt2 1.85 <10−6
18 MORN repeat-containing 1 Morn1 0.75 <0.05
19 Myomesin 2 Myom2 1.63 <0.05
20 Nuclear transcription X-box-binding like 1 factor Nfxl1 0.69 <10−2
21 Neuromedin B Nmb 3.27 <10−4
22 Nicotinamide nucleotide adenylyltransferase 1 Nmnat1 0.94 <10−4
23 Purkinje cell protein 2 Pcp2 5.91 <10−2
24 Protein disulfide isomerase family A member 4 Pdia4 0.59 <10−2
25 Prodynorphin Pdyn 1.02 <10−2
26 Phospholipase A2, group IIC Pla2g2c 1.60 <10−4
27 Procollagen-lysine,2-oxoglutarate 5-dioxygenase 1 Plod1 0.85 <10−2
28 Phosphotriesterase-related protein Pter 1.27 <10−2
29 Glycogen phosphorylase L Pygl 0.95 <0.05
30 RNA-binding motif protein 3 Rbm3 1.22 <10−4
31 Retinol saturase Retsat −1.01 <0.05
32 Rho-related BTB domain-containing protein 3 Rhobtb3 0.85 <0.05
33 Relaxin 3 Rln3 3.73 <10−3
34 Sciellin Scel 1.24 <0.05
35 Schlafen family member 13 Slfn13 1.33 <0.05
36 Serine peptidase inhibitor, Kunitz type 1 Spint1 1.16 <10−3
37 Troponin T type 1 (skeletal, slow) Tnnt1 2.80 <0.05
38 Urocortin Ucn 2.61 <0.05
39 WD repeat and SOCS box-containing protein 1 Wsb1 0.95 <0.05

Note: Hereinafter, log2: the log2-transformed fold change (i.e., the ratio of the expression level of a given gene in tame rats to that in aggressive rats); p and PADJ: statistical significance according to Fisher’s Z-test and the Benjamini correction for multiple comparisons.

2.2. Quantitative PCR (qPCR)-Based Selective Verification of the Novel PAG-Related DEGs of the Tame and Aggressive Rats

From the same two strains of rats, we took 16 additional unrelated animals: eight tame and eight aggressive, each scoring 3.5 and –3.5, respectively, on a scale spanning from –4 (most aggressive) to +4 (least aggressive) in the glove test [79] run 1 month before the PAG specimens were sampled (Table 3).

Table 3.

qPCR data on a selection of DEGs from the PAG of 16 additional unrelated adult male rats, eight tame and eight aggressive.

Design Glove Test [79] and qPCR Data on Gene Expression [This Work]
Rat Set No. 1 2 3 4 5 6 7 8
Glove
test
A 3.5 3.5 3.5 3.5 3.5 3.5 3.5 3.5
T 3.5 3.5 3.5 3.5 3.5 3.5 3.5 3.5
DEG Set Relative expression with respect to three reference genes, qPCR, M0 ± SEM TOTAL
Ascl3 A 0.10 ± 0.05 0.26 ± 0.01 0.64 ± 0138 0.12 ± 0.03 0.24 ± 0.07 0.10 ± 0.03 0.13 ± 0.005 0.15 ± 0.02 0.22 ± 0.06
T 1.63 ± 0.03 1.66 ± 0.16 1.86 ± 0.15 4.30 ± 0.06 3.37 ± 0.18 4.91 ± 0.13 4.14 ± 0.90 4.95 ± 0.86 3.35 ± 0.51
Defb17 A 0.007 ± 0.005 ND ND ND 0.005 ± 0.005 0.005 ± 0.005 0.005 ± 0.005 0.005 ± 0.005 0.005 ± 0.005
T 3.17 ± 0.30 3.06 ± 0.16 2.91 ± 0.11 2.74 ± 0.22 1.62 ± 0.17 3.42 ± 0.51 1.67 ± 0.07 3.77 ± 0.07 2.08 ± 0.27

Note: Datasets: A, aggressive rats; T, tame rats. qPCR data: “M0 ± SEM” denotes the mean ± standard error of the mean for three technical replicates for each rat; ND, not detected.

Next, from among the 39 DEGs shown in Table 2, we selected Ascl3 and Defb17 (for details, see Table 3). Table 3 contains our qPCR data on these genes in the PAG of the tame and aggressive rats (see Section 4.4). These PCR data appear as the arithmetic mean ± standard error of the mean of Ascl3 and Defb17 expression levels normalized to those of three reference genes, B2m (β-2-microglobulin) [81], Hprt1 (hypoxanthine phosphoribosyltransferase 1) [82], and Rpl30 (ribosomal protein L30 [83]), in triplicate, according to the guidelines [84]. The rightmost column of Table 3 shows arithmetic mean estimates of the expression levels of Ascl3 and Defb17 in the PAG of the tame and aggressive rats.

As can be seen from Figure 1a, both Ascl3 and Defb17 are overexpressed in the PAG of the tame rats (white bars) compared to the aggressive rats (gray bars) according to our qPCR data, this overexpression being significant (p < 0.01, double asterisk) according to both the nonparametric Mann–Whitney U test and the parametric Fisher’s Z-test.

Figure 1.

Figure 1

qPCR-based selective verification of the DEGs identified with RNA-Seq in the PAG of tame versus aggressive rats. Legend: (a) Both DEGs, Ascl3 and Defb17, are significantly overexpressed in the PAG of the tame adult male rats (white bars) compared to their aggressive conspecifics (gray bars). Bar height: mean; error bars: standard error of the mean [SEM]; the double asterisk (i.e., double character “**”) denotes statistical significance at p < 0.01 according to nonparametric Mann–Whitney U test and parametric Fisher’s Z-test. (b) Pearson’s linear correlation between the relative expression levels of Ascl3, Defb17, and the reference genes [B2m (β-2-microglobulin) and Rpl30 (ribosomal protein L30) appearing as circles on the plot] in the tame versus aggressive rats is statistically significant, whether measured experimentally using RNA-Seq (x-axis) or qPCR (y-axis) and expressed on the log2 scale (see “Materials and Methods”). Dashed and dot-dash lines denote linear regression and its 95% confidence interval boundaries calculated using STATISTICA (StatsoftTM, Tulsa, OK, USA); r and p are Pearson’s linear correlation coefficient and its statistical significance, respectively.

This finding independently supports our RNA-Seq data (Table 2). Finally, Figure 1b shows Pearson’s linear correlation (r = 0.997, p < 0.005) between the log2 values (“log2” hereinafter means “the log2-transformed ratio of the expression level of a given gene between tame and aggressive rats under the given experimental conditions”) for four genes, Ascl3, Defb17, B2m, and Rpl30 (all appearing as open circles), within the RNA-Seq (x-axis) and qPCR (y-axis) datasets, both obtained here independently. This is one more piece of independent evidence in support of the relevance of our RNA-Seq data (Table 2).

2.3. Comparison of Known Animal ARD-Linked DEGs with Their Homologs among 39 Novel PAG-Related DEGs of the Tame and Aggressive Rats

We retrieved all transcriptomes of animals with ARD susceptibility and ARD resistance from the PubMed database [75] and collected 43 animal-based human ARD models (Table 4).

Table 4.

Found in PubMed [75]: DEGs in human ARD models based on animal data.

# Species ARD Susceptibility ARD Resistance Tissue NDEG Ref.
1 rat OXYS: spurt aging, 20-day-old Wistar, 20-day-old hippocampus 46 [44]
2 rat OXYS: spurt aging, 5-month-old Wistar, 5-month-old hippocampus 28 [44]
3 rat OXYS: spurt aging, 18-month-old Wistar, 18-month-old hippocampus 85 [44]
4 rat OXYS: spurt aging, 18-month-old Wistar, 18-month-old prefrontal cortex 59 [45]
5 rat OXYS: spurt aging, 18-month-old Wistar, 18-month-old retina 77 [46]
6 rat ISIAH (hypertensive aged vessels) WAG (norm) brain stem 206 [47]
7 rat ISIAH (hypertensive aged vessels) WAG (norm) hypothalamus 137 [48]
8 rat ISIAH (hypertensive aged vessels) WAG (norm) renal medulla 882 [49]
9 rat ISIAH (hypertensive aged vessels) WAG (norm) renal cortex 309 [50]
10 rat ISIAH (hypertensive aged vessels) WAG (norm) adrenal gland 1020 [51]
11 rat SHR (hypertensive aged vessels) Wistar (norm) brain pericytes 21 [52]
12 rat 20-passage-old 5-passage-old MSC(BM) 9167 [35]
13 rat 5-passage-old 5-passage-old, Aspirin MSC(BM) 1220 [35]
14 rat 20-passage-old 20-passage-old, Aspirin MSC(BM) 446 [35]
15 mice 11-month-old, bone fragility 2-month-old, norm bone 1011 [55]
16 mice 23-month-old, bone fragility 2-month-old, norm bone 1151 [55]
17 mice 30-month-old, bone fragility 2-month-old, norm bone 3725 [55]
18 mice 30-month-old, bone fragility 2-month-old, norm kidney 43 [56]
19 mice 27-month-old, males, renal fibrosis 2-month-old, males kidney 349 [56]
20 mice 27-month-old, females, renal fibrosis 2-month-old, females kidney 100 [56]
21 mice 24-month-old, renal fibrosis 3-month-old kidney 599 [57]
22 mice PolG D257A, cardiac disorder wild-typed norm heart right ventricle 402 [58]
23 mice 20-month-old, parabiont, 8 weeks 6-month-old, parabiont, 8 weeks aortic arch 23 [59]
24 mice 8 h:8 h biorhythm (autistic-like) 12 h/12 h biorhythm norm hippocampus 158 [60]
25 mice wild-type, 20-week-old, 60% diet wild-type, 20-week-old, ad libitum skeletal muscle 1178 [61]
26 mice wild-type, 80-week-old, 60% diet wild-type, 80-week-old, ad libitum skeletal muscle 747 [61]
27 mice Sirt1-KO, 20-week-old, 60% diet Sirt1-KO, 20-week-old, ad libitum skeletal muscle 2323 [61]
28 mice Sirt1-KI, 20-week-old, 60% diet Sirt1-KI, 20-week-old, ad libitum skeletal muscle 1919 [61]
29 mice Sirt1-KO, 80-week-old, 60% diet Sirt1-KO, 80-week-old, ad libitum skeletal muscle 721 [61]
30 mice Sirt1-KI, 80-week-old, 60% diet Sirt1-KI, 80-week-old, ad libitum skeletal muscle 2641 [61]
31 mice Sirt1-KO, 80-week-old, ad libitum wild-type, 80-week-old, ad libitum skeletal muscle 1976 [61]
32 mice wild-type, 80-week-old, ad libitum Sirt1-KI, 80-week-old, ad libitum skeletal muscle 445 [61]
33 mice Sirt1-KO, 20-week-old, ad libitum wild-type, 20-week-old, ad libitum skeletal muscle 1152 [61]
34 mice wild-type, 20-week-old, ad libitum Sirt1-KI, 20-week-old, ad libitum skeletal muscle 135 [61]
35 mice BPH/2J, hypertensive, aged vessels BPN/3J, norm kidney 883 [62]
36 rabbit under Goldblatt 2-kidney 1-clip under sham-operated control prefrontal cortex 229 [63]
37 chicken 1.2% Ca diet: worst health 0.8% Ca diet: best health kidney 92 [30]
38 chicken 1% Ca diet, health threshold 0.8% Ca diet: best health kidney 83 [30]
39 chicken 1.2% Ca diet: worst health 1% Ca diet, health threshold kidney 64 [30]
40 chicken 456-day-old, subfertility 224-day-old, fertility peak ovary 259 [34]
41 chicken 469-day-old, hunger, infertility 456-day-old, subfertility ovary 926 [34]
42 chicken 469-day-old, hunger, infertility 527-day-old, fasting-diet, fertility ovary 698 [34]
43 fruit fly 10-day-old, Alzheimer disease-like 0-day-old, just post-eclosion head 99 [64]
Σ 5 species 43 human age-related disease models using animals 17 tissues 37,834 22 Refs

Note: NDEG: the number of DEGs; OXIS, Wistar, BPH/2J, and BPH/3J: laboratory animal strains used; MSC(BM): bone-marrow-derived mesenchymal stromal cells; aspirin and fasting: rejuvenators; PolG: DNA polymerase γ, catalytic subunit; Sirt1: sirtuin 1; KO and KI: knock-out and knock-in, respectively.

The total number of DEGs found in 22 original works [30,32,35,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64] was 37,834 in 17 tissues of five animal species. Figure 2 shows our procedure of comparison of 37,834 animal ARD-linked DEGs (Table 4) with the 39 PAG-related DEGs of the tame and aggressive rats (Table 2). In this figure, a Venn diagram and a table explain the procedure that led us to the following conclusion: there is a correlation between the expression of homologous genes in the tame rats and the ARD-susceptible animals. At the first step, we compiled 459 pairs of homologous DEGs, where one of 39 DEGs was taken from Table 2 and its homolog was chosen from among 37,834 DEGs in Table 4, both now being present in Table S1 (see “Supplementary Materials”). At the second step, we for the first time found the following statistically significant correlations between behavior-related and disease-susceptibility-related log2 values of the homologous animal DEGs: Pearson’s linear correlation (r = 0.13, p < 0.01), Spearman’s rank correlation (R = 0.14, p < 0.005), Kendall’s rank correlation (τ = 0.10, p < 0.0025), and the Goodman–Kruskal generalized correlation (γ = 0.10, p < 0.0025) (Figure 2). These correlations suggest a certain similarity in the expression patterns of the novel PAG-related DEGs between the tame and aggressive rats and a similarity in the expression patterns of their homologous DEGs between ARD-susceptible and ARD-resistant animals. The biological sense of these similarities was elucidated at the final step. We processed entries in Table S1 with principal component analysis in the bootstrap mode with the freely available toolbox PAST4.04 [85]. In the result, we found two principal components, major PC1 and minor PC2, corresponding to the half-sum and the half-difference of the behavior-related and ARD-susceptibility-related log2 values for the homologous animal DEGs, respectively. Here, the half-sum of the behavior- and ARD-associated log2 values, which appears as the major PC1, implies that the sense of the significant positive correlations found between these log2 values at step 2 is that their signs in the novel PAG-related rat DEGs and in the known ARD-linked animal DEGs are matching. Their formulas and 95% confidence intervals are given in the bottom part of Figure 2.

Figure 2.

Figure 2

Comparison of the novel DEGs in the PAG of the tame and aggressive rats with the known DEGs related to animal ARD susceptibility and resistance. Legend: See the legend to Figure 1 and the footnote to Table 4; the x- and y-axes correspond to columns iii and x of Table S1; circles correspond to rows of Table S1; R, τ, and γ are the coefficients of Spearman’s rank correlation, Kendall’s rank correlation, and the Goodman–Kruskal generalized correlation, respectively, calculated using STATISTICA (StatsoftTM, Tulsa, OK, USA); PC1 and PC2: principal components calculated in the bootstrap-based refinement mode of the PAST4.04 software [85].

2.4. Animal ARD-Linked DEGs Are Relevant to Humans

We additionally searched for all the PubMed DEGs in ARD patients and otherwise healthy volunteers [75] (see Table 5). The total number of human ARD-linked DEGs found is 14,535 in ten tissues from 14 binary “susceptibility versus resistance” models of human ARDs (the rightmost column of Table 5) [33,36,37,38,39,40,41,42,43]. Figure 3 illustrates a modification of the previous procedure, with the animal ARD-linked DEGs replaced by their human counterparts (Table 5).

Table 5.

DEGs in the binary “susceptibility versus resistance” models of human ARDs (PubMed data, [75]).

# ARD Susceptibility ARD Resistance Tissue NDEG Ref.
1 renal medullary hypertension norm renal medulla 13 [36]
2 pulmonary arterial hypertension norm blood 14 [37]
3 pulmonary arterial hypertension norm lung 118 [38]
4 fibrosis in pulmonary hypertension norm lung 3516 [39]
5 idiopathic pulmonary hypertension norm lung 5639 [39]
6 nephrosclerosis as kidney aging norm kidney 16 [40]
7 atrial fibrillation as heart aging norm auricle tissue 300 [41]
8 myocardial ischemia as aged heart norm peripheral blood 1524 [41]
9 ALS as aged motoneurons norm small extracellular vesicles 402 [42]
10 FTD as cognitive ageing norm small extracellular vesicles 164 [42]
11 ALS as aged motor neurons norm large extracellular vesicles 62 [42]
12 FTD as cognitive ageing norm large extracellular vesicles 55 [42]
13 before exercise training after exercise training vastus externus 170 [33]
14 LPS-stimulated atherogenesis ARID5B-KO as atheroprotection THP1 monocytes 2542 [43]
14 binary models of human ARDs 10 tissues 14,535 9 Refs

Note: See the footnote to Table 4. Diseases: ALS, amyotrophic lateral sclerosis; FTD, frontotemporal dementia. LPS, lipopolysaccharide; ARID5B, the AT-rich interaction domain 5B gene.

Figure 3.

Figure 3

Animal ARD-linked DEGs are relevant to humans. Legend: See the legend to Figure 2 and the footnote to Table 2.

The results serve as independent control medical data (Table S2). Although no correlation was found between the behavior-related log2 values for the novel PAG-related rat DEGs and the ARD-susceptibility-related log2 values for their human homologs, their half-sum and half-difference corresponded to principal components PC1 (major) and PC2 (minor) within their quite similar 95% confidence intervals (Figure 3). This finding confirmed the results of our meta-analysis of ARD susceptibility versus ARD resistance in animals.

2.5. Searching for ARD Molecular Markers among Human Genes Orthologous to 39 Novel PAG-Related DEGs of the Tame and Aggressive Rats

First, we used the PubMed database [75] and characterized each of the 39 novel PAG-related DEGs of the tame and aggressive rats (Table 2) by answering the question as to how under- or overexpression of their human orthologs can aggravate or alleviate ARDs [86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,105,106,107,108,109,110,111,112,113,114,115,116,117,118,119,120,121,122,123,124,125,126,127,128,129,130,131,132,133,134,135,136,137,138,139,140,141,142,143,144,145,146,147,148,149,150,151,152,153,154,155,156,157,158,159,160,161,162,163,164,165,166,167,168,169,170,171,172,173,174,175,176,177,178,179,180,181,182,183,184,185,186,187,188,189,190,191,192,193,194,195,196,197,198] (Table S3). Next, for each novel PAG-related rat DEG (Table 2), we determined the sign of the behavior-related log2 value and found how many of their homologs in the ARD-susceptible and ARD-resistant subjects have matching signs of the ARD-susceptibility-related log2 value (n = NPC1) and how many have opposite signs (n = NPC2). This is because the principal components PC1 and PC2 correspond to the half-sum and the half-difference, respectively, of these log2 values (Figure 2 and Figure 3). Table 6 shows these figures (NPC1 and NPC2) alongside their statistical significance estimates according to the binomial distribution both before (p-values) and after (PADJ values) Bonferroni’s correction for multiple comparisons.

Table 6.

Searching for ARD molecular genetic markers among human genes homologous to 39 novel PAG-related DEGs of the tame and aggressive rats. The number of these homologous DEGs linked to ARD susceptibility and ARD resistance in humans and animals is taken into account.

Rat Gene Total Number of DEGs Binomial
Distribution
Rat Gene Total Number of DEGs Binomial Distribution
# Symbol NPC1:
Matching Signs
NPC2:
Opposite Signs
p P ADJ # Symbol NPC1:
Matching Signs
NPC2:
Opposite Signs
P P ADJ
i ii iii iv v vi i ii iii iv V vi
1 Amy1a 7 3 0.17 1.00 21 Nmb 1 4 0.19 1.00
2 Aox1 8 5 0.29 1.00 22 Nmnat1 3 7 0.17 1.00
3 Ascl3 3 1 0.31 1.00 23 Pcp2 5 1 0.11 1.00
4 Banp 8 3 0.11 1.00 24 Pdia4 10 6 0.23 1.00
5 Bdkrb2 3 4 0.50 1.00 25 Pdyn 0 0 ND ND
6 Cartpt 1 1 0.50 1.00 26 Pla2g2c 40 32 0.20 1.00
7 Cyp2j10 6 5 0.50 1.00 27 Plod1 16 3 0.002 0.08
8 Defb17 10 1 0.006 0.23 28 Pter 2 3 0.50 1.00
9 Emx2 1 0 0.50 1.00 29 Pygl 4 9 0.13 1.00
10 Fat2 15 5 0.021 0.81 30 Rbm3 27 12 0.012 0.46
11 Fcgr2b 17 1 0.00007 0.005 31 Retsat 4 8 0.19 1.00
12 Fosb 7 13 0.13 1.00 32 Rhobtb3 8 18 0.038 1.00
13 Gpd1 7 4 0.27 1.00 33 Rln3 0 2 0.25 1.00
14 Hbb-b1 10 18 0.09 1.00 34 Scel 2 3 0.50 1.00
15 Hspa1b 28 21 0.20 1.00 35 Slfn13 16 7 0.05 1.00
16 Itm2a 4 17 0.004 0.14 36 Spint1 2 4 0.34 1.00
17 Krt2 27 21 0.24 1.00 37 Tnnt1 5 9 0.21 1.00
18 Morn1 12 2 0.006 0.25 38 Ucn 2 0 0.25 1.00
19 Myom2 11 8 0.32 1.00 39 Wsb1 3 3 0.65 1.00
20 Nfxl1 3 5 0.36 1.00

Note: p and PADJ: significance according to the binomial distribution without or with Bonferroni’s correction for multiple comparisons, respectively; ND: not detected; underlined is the only common statistically significant ARD molecular marker found in this work: Fcgr2b. Matching signs: the same direction of expression change; opposite signs: opposite directions of expression change.

As can be seen from this table, only one of the 39 novel DEGs in the PAG of the tame and aggressive rats is linked with PC1, namely Fcgr2b encoding Fcγ receptor IIb, which suppresses the hyperactivation of immune cells [199] (Table 7). Entries in this table suggest that the immunoregulatory DEGs homologous to rat Fcgr2b are significantly overexpressed in ARD-susceptible human and animal subjects compared to their ARD-resistant peers [35,39,43,51,55,56,58]. This leads us to propose that an excess of the immunoregulators homologous to rat Fcgr2b might be regarded as a candidate theranostic molecular marker for human ARDs.

Table 7.

Statistically significant data on upregulation of Fcγ-receptor-IIb-related DEGs linked to ARD susceptibility and ARD resistance in the subject species.

# Species Age-Related Disease
Susceptibility
Age-Related Disease
Resistance
Tissue DEG log2 PADJ Ref.
1 rat 20-passage-old 5-passage-old MSC(BM) Fcgr2b 6.24 10−3 [35]
2 rat 20-passage-old 5-passage-old MSC(BM) Fcgr2a 3.99 10−80 [35]
3 rat 20-passage-old 5-passage-old MSC(BM) Fcgr3a 2.86 10−44 [35]
4 rat 20-passage-old 20-passage-old, Aspirin MSC(BM) Fcgr2b 1.00 10−6 [35]
5 rat ISIAH, hypertensive aged vessels WAG (norm) adrenal gland Fcgr1a 0.76 0.05 [51]
6 rat ISIAH, hypertensive aged vessels WAG (norm) adrenal gland Fcgr3a 0.67 0.05 [51]
7 mice 30-month-old, bone fragility 2-month-old, norm Bone Fcgr2b 1.11 10−3 [55]
8 mice 30-month-old, bone fragility 2-month-old, norm Bone Fcgr1 1.12 10−2 [55]
9 mice 30-month-old, bone fragility 2-month-old, norm Bone Fcgr3 0.92 10−2 [55]
10 mice 30-month-old, bone fragility 2-month-old, norm Bone Fcgr3 1.39 0.05 [56]
11 mice PolG D257A, cardiac disorder wild-type, norm heart right ventricle Fcgr4 1.91 10−2 [58]
12 human fibrosis in pulmonary
hypertension
norm Lung FCGR1B 1.30 0.05 [39]
13 human idiopathic pulmonary
hypertension
norm Lung FCGR2A 0.27 0.05 [39]
14 human idiopathic pulmonary
hypertension
norm Lung FCGR3A 0.22 0.05 [39]
15 human LPS-stimulated
atherogenesis
ARID5B-KO as
atheroprotection
THP1 monocytes FCGR1A 0.41 10−4 [43]
16 human LPS-stimulated
atherogenesis
ARID5B-KO as
atheroprotection
THP1 monocytes FCGR1B 0.55 10−4 [43]
17 human LPS-stimulated
atherogenesis
ARID5B-KO as
atheroprotection
THP1 monocytes FCGR1C 0.30 10−2 [43]
18 human LPS-stimulated
atherogenesis
ARID5B-KO as
atheroprotection
THP1 monocytes FCGR2A 0.49 10−5 [43]

Note: See footnotes to Table 4 and Table 5.

2.6. Can Human Fcγ Receptor IIb Upregulation Serve as a Theranostic Molecular Marker for ARDs?

The following facts and hypotheses were thought to be relevant to this question: (i) the number of human infections increases when new wild animals are domesticated and become a bridge between the anthropogenic environment and wildlife [200], (ii) stray cats live longer than pet cats due to stronger disease resistance [201], and (iii) human evolutionary origin involves self-domestication [202], although this hypothesis is still debatable [203].

With this information in mind, we searched PubMed [75] and retrieved all available transcriptomes of domestic animals compared to their wild conspecifics (Table 8). As can be seen from the bottom line of Table 8, RNA-Seq data represent 2866 DEGs in eight tissues of seven domestic animal species compared to their seven wild conspecifics studied in ten original experimental works [68,74,204,205,206,207,208,209,210,211].

Table 8.

RNA-Seq transcriptomes of domestic animals versus their wild conspecifics (PubMed data [75]).

# Domestic Animals Wild Animals Tissue NDEG Ref.
1 tame rats aggressive rats hypothalamus 46 [204]
2 tame rats aggressive rats hippocampus 42 [74]
3 tame rats aggressive rats midbrain tegmentum 31 [68]
4 tame rats aggressive rats frontal cortex 20 [205]
5 guinea pigs cavy frontal cortex 883 [205]
6 domestic rabbits wild rabbits frontal cortex 17 [205]
7 domestic rabbits wild rabbits parietal-temporal cortex 216 [206]
8 domestic rabbits wild rabbits amygdala 118 [206]
9 domestic rabbits wild rabbits hypothalamus 43 [206]
10 domestic rabbits wild rabbits hippocampus 100 [206]
11 dogs wolves blood 450 [207]
12 dogs wolves frontal cortex 13 [205]
13 tame foxes aggressive foxes pituitary 327 [208]
14 pigs boars frontal cortex 30 [205]
15 pigs boars frontal cortex 34 [209]
16 pigs boars pituitary 22 [210]
17 domestic chicken wild chicken pituitary 474 [211]
Σ 7 domestic animal species 7 wild animal species 8 tissues 2866 10 Refs

By looking at the entries in the left half of Table 9, it becomes clear why underexpression of the human FCGR2B gene, which is orthologous to the rat Fcgr2b gene (this being the only gene we have identified as a theranostic molecular marker for ARD; Table 9), alleviates such diseases [117,118], while its overexpression aggravates them [119,120].

Table 9.

Comparison of the effects of unidirectional changes in the expression (a) of the human FCGR2B gene on ARD severity in humans and (b) of its animal homologs on the microevolutionary events leading to domestic and wild animals.

(a) Humans (b) Animals
Effect of changes in human FCGR2B expression on
ARDs: aggravating (→) or alleviating (←)
Effect of changes in the expression of animal genes homologous to human FCGR2B
deficient effect excessive effect deficient excessive tissue DEG log2 PADJ Refs
In South Asia and Africa, the human FCGR2B-deficient alleles have the most frequent occurrence as protectors against infection [117], susceptibility to which increases with age as immunosenescence [118] FCGR2B has been explored using the “C-type lectin-like molecule-1”/”Fc-domain” fusion protein as a target antigen for chemotherapy against acute myeloid leukemia [119] as a cellular-senescence-related immunogenic disease [120] aggressive rat tame
rat
PAG Fcgr2b 2.02 0.05 [this work]
aggressive rat tame
rat
hypothalamus Fcrl2 1.12 0.05 [204]
aggressive rat tame
rat
hypothalamus Fcgr3a 2.06 10−2 [204]
aggressive rat tame
rat
midbrain
tegmentum
Fcgr2b 2.01 0.05 [68]
aggressive fox tame fox pituitary Fcrl1 0.43 10−2 [208]
wild
rabbit
domestic rabbit parietal-temporal cortex Fcgr3b 1.35 10−2 [206]
guinea pig cavy frontal cortex Fcer2 1.36 0.05 [205]

Note: See footnotes to Table 4 and Table 5. Fcer2: Fc epsilon receptor II; Fcrl1 and Fcrl2: Fc-receptor-like 1 and 2, respectively.

From among the 39 novel PAG-related rat DEGs (Table 2) and these 2866 known animal DEGs (Table 8), we selected seven animal genes homologous to the rat Fcgr2b gene (the right half of Table 9). Furthermore, we transformed the log2 value characterizing the animal DEGs into either underexpression or overexpression of these animal genes after the domestic and wild animals split from their most recent common ancestor, according to the commonly accepted phylogeny concept [212,213,214,215,216]) (Table 9).

Downregulation of the human gene FCGR2B, which provides protection against infection, alleviates ARDs [117,118] and matches downregulation of the homologous genes Fcer2, Fcgr2b, Fcgr3a, Fcgr3b, Fcrl1, and Fcrl2 in wild rabbits [206], aggressive rats [68,204], and aggressive foxes [208] after they and their domestic conspecifics split from their most recent common ancestor (Table 9).

By contrast, an excess of this immunosuppressor in humans aggravates the cellular-senescence-related immunogenic disease [119,120] and corresponds to the excess of its homologous immunoregulators in cavies [205], domestic rabbits [206], tame rats [68,204], and tame foxes [208] during their microevolution (Table 9).

The left half of Table 10 summarizes the data shown in Table 9 in the form of a 2 × 2 contingency table, where this difference is statistically significant according to both Pearson’s χ2 test (p < 0.01) and Fisher’s exact test (p < 0.05).

Table 10.

Correlations between the effects of unidirectional changes in the expression (a) of the human FCGR2B gene on ARD severity in humans and (b) of its animal homologs on the microevolutionary events leading to domestic and wild animals.

(a) Humans Effect of Changes in Human FCGR2B Expression on ARDs Pearson’s χ2 Test Fisher’s Exact Test
(b) Animals Alleviating (←) Aggravating (→) χ2 p
Effect of changes in the expression of animal homologs to human FCGR2B wild 6 1 7.14 10−2 0.05
domestic 1 6

In this regard, upregulation of the immunoregulators homologous to the rat Fcgr2b gene can serve as a theranostic ARD molecular marker permanently available in any tissue of anyone’s organism.

3. Discussion

3.1. Overexpression of Human Genes Homologous to the Rat Fcgr2b Gene Identified as A Molecular Marker for ARDs Is Consistent with Overexpression of Known ARD-Linked DEGs

We have found that upregulation of the human immunoregulators homologous to the rat Fcgr2b gene can serve as a theranostic ARD molecular marker permanently available in any tissue of anyone’s organism (see Table 7). As can be seen from Table 7, the immunoregulators homologous to the rat Fcgr2b gene are excessive in all tissues of all ARD-affected subjects (humans and animals) with only one exception: FCGR1B deficiency in the lungs of a patient with fibrosis in pulmonary arterial hypertension [39] (Table 7: line #12). This implies that an excess of the human immunoregulators homologous to the rat Fcgr2b gene identified in this work as being a molecular marker for age-related human diseases is consistent with the ARD-linked DEGs found independently by other authors.

3.2. Excess of Rat Fcgr2b Identified as A Molecular Marker for ARDs Is Consistent with Independent RNA-Seq Data on the Rise in the Levels of Murine Fcgr2b in Astrocytes with Age

We will discuss this result in comparison with independent RNA-Seq data [217] from a human ARD model using mice aged 7 days, 32 days, 10 weeks, 9.5 months, and 2 years. Although murine Fcgr2b was not identified as a DEG within the model in question [217], we have found a statistically significant increase in the expression of this gene in astrocytes (see Figure 4) from the hippocampus (open circles), striatum (gray circles), and cortex (black circles) of mice with increasing age. This could be regarded as an in vivo piece of independent direct evidence in support to our findings in this work.

Figure 4.

Figure 4

An RNA-Seq experiment run within the mouse model of human ARDs [217] revealed a statistically significant increase in Fcgr2b expression in astrocytes from the hippocampus (open circles, ○), striatum (gray circles, ) and cortex (black circles, ●) with increasing age, providing independent in vivo evidence in support of this finding. Legend: See the legend to Figure 1 and Figure 2; FPKM, fragments per kilobase of transcript per million mapped reads [217].

3.3. Stabilizing Selection Preserves the Expression Pattern of the Human FCGR2B Gene Orthologous to the Rat Fcgr2b Gene, a Molecular Marker for ARDs

Because it now seems interesting to discuss how such an extraordinary expression pattern—that is, with levels increasing with age—can have been preserved, we will examine the proximal promoter of the human FCGR2B gene (see Figure S1). As can be seen from Figure S1a, the current build (No. 155) of the dbSNP database [218] contains only one single-nucleotide polymorphism, SNP rs780467580, within the 70 bp proximal promoter of the human FCGR2B gene. We have previously used our publicly available development, SNP_TATA_Comparator [219], and manually analyzed 15,080 SNPs within 1585 proximal promoters, each 70 bp in length, located upstream of the transcription start sites of protein-coding transcripts from 534 human genes (for review, see [220]). The number of SNPs within these promoters varied from one to 64 (9.51 ± 0.21; mean ± SEM), with the 95% confidence interval being between 9 and 10; therefore, the existence of only one SNP rs34166473 within the examined region of the human FCGR2B gene promoter seems to suggest a statistically significant loss of SNPs (p < 0.01, binomial distribution). It is generally recognized that the biological function of any genomic region containing such a small number of SNPs is of vital importance, and so it is preserved by natural selection [221]. This observation is consistent with the neutrality of this single SNP rs34166473 within the human FCGR2B gene promoter in question, the neutrality having been confirmed with the use of our previously developed publicly available web service SNP_TATA_Comparator [219] (see Figure S1).

3.4. The Use of Tame and Aggressive Rats as Belyaev’s Laboratory-Animal-Based Domestication Model can Represent an Adequate Domesticated-Animal-Based Model of Human ARDs

In searching for ARD molecular markers, we used tame and aggressive rats as Belyaev’s laboratory-animal-based domestication model [69,70,71,72], because we have already found molecular markers for hypertension (incidentally, this being an ARD) and potential molecular markers for neoteny (this can reverse ARDs [73]), which correspond to the hippocampal [74] and midbrain tegmental [68] transcriptomes of these rat strains. As can be seen from Table 9 and Table 10, within tissues of the domesticated compared to wild animals there is a statistically significant excess of immunoregulators homologous to rat Fcgr2b according to two independent criteria, Pearson’s χ2 test (χ2 = 7.14; p < 0.01) and Fisher’s exact test (p < 0.05). This implies that domesticated animals are susceptible to ARDs, while their wild conspecifics are not. This result is consistent with the findings reported by Fallahshahroudi and co-workers [201] that, in the wild, natural selection on animals seeks to eliminate affected individuals, while artificial animal selection during domestication does not, as it serves human needs (for example, broilers are the cheapest poultry meat, no matter whether they are susceptible or resistant to ARDs [30,34]). This is in line with our whole-genome observations suggesting that the TATA-binding protein binding sites within the gene promoters in domesticated animals have significantly more candidate SNP markers for rheumatoid polyarthritis [222] and reproductive disorders [223,224], both being ARDs, compared to their wild conspecifics. Overall, we can conclude that Belyaev’s model of domestication using tame and aggressive rats as laboratory animals seems to be applicable as one of the adequate animal-based human ARD models.

3.5. Our Focus on the PAG of Tame and Aggressive Rats Is Adequate for the Search for the ARD-Linked Rat DEGs

In this work, we focused on the PAG of the tame and aggressive rats because the activity of this brain structure contributes to elevated pain tolerance with age [77]. Our interest was to find ARD-linked rat DEGs such that, if their human homologs were taken into account, we could help reduce the suffering of patients with such diseases (see Section 2.1). Recently, a meta-analysis of the microarray datasets GSE24982, GSE63442, and GSE63651 (from the Gene Expression Omnibus (GEO) database [225]) identified the rat Fcgr2b gene as one of the six most likely hub genes responsible for neuropathic pain and aging [226], just as we found the same rat Fcgr2b gene to be a molecular marker for ARDs (see Table 2, Table 6, Table 7, Table 9, and Table 10). Apparently, this independent microarray meta-analysis result [226] favors the adequacy of our focus on the PAG of the tame versus aggressive rats in the search for ARD-linked rat DEGs.

Briefly, we used the PAG of the tame and aggressive rats and found rat Fcgr2b overexpression to be a molecular marker for elevated neuropathic pain tolerance in ARDs.

3.6. In Silico Associative Gene Network of Human Immunoregulators Homologous to the Rat Fcgr2b Gene Identified as a Molecular Marker for Pain Tolerance in ARDs

For a more detailed discussion of this correspondence between our present findings and the independent experimental data [226], see Figure 5. It presents an FCGR2B-related associative gene network as a data-mining summary of both papers and databases, which we built here using the automated mode of our publicly available web service ANDSystem [227] with “Human, FCGR2B, gene, protein” as input data. First of all, there are all six human genes in the figure, FCGR1A, FCGR2A, FCGR2B, FCGR2C, FCGR3A, and FCGR3B, homologous to the rat Fcgr2b gene identified as a molecular marker for elevated neuropathic pain tolerance in ARDs. Furthermore, there are many epigenetic regulation genes (e.g., HDAC9 for histone deacetylase 9) in line with an ortholog-based expectable age-dependent expression pattern of these immunoregulatory genes (Figure 5), which may be under stabilizing selection (Figure S1). Finally, at the bottom of this figure, are the top five diseases with the best ratings of statistical significance for the contribution of FCGR2B to their pathogenesis, namely: acute myeloid leukemia (PADJ < 10−84), rheumatoid arthritis (PADJ < 10−71), inflammation (PADJ < 10−69), systemic lupus erythematosus (PADJ < 10−67), and autoimmune diseases (PADJ < 10−60). Two of these five diseases, systemic lupus erythematosus and autoimmune diseases, were among the same top five of 174 diseases most significantly associated with the human FCGR2B gene according to the human disease database MalaCards [228] (statistical significance according to the binomial distribution; p < 0.01).

Figure 5.

Figure 5

The FCGR2B-related associative gene network as a data-mining summary of molecular genetic research articles and databases. The network was built using the automated mode of our publicly available web service ANDSystem [227] with “Human, FCGR2B, gene, protein” as input. Legend: Nodes: red circles, proteins; icons “double DNA helix”, genes; “Bowl of Hygieia” symbols, diseases. Edges: turquoise sharp and blunt arrows, expression and degradation, respectively; pink sharp and blunt arrows, up- and downregulation, respectively; blue arrows, transport regulation; purple, orange, and black lines: involvement, coexpression, and association, respectively. CRP and APCS, pentraxin 1 and 2, respectively; CD19, CD36, CD40, and CD79A, proteins CD19, CD36, CD40, and CD79a, respectively; CDK11B, cyclin-dependent kinase 11B; CRP, C-reactive protein; FAS, Fas cell surface death receptor; FASN, fatty acid synthase; FCGR1A, FCGR2A, FCGR2C, FCGR3A, and FCGR3B, Fcγ receptors Ia, IIa, IIc, IIIa, and IIIb, respectively; FOS, FOSB, JUN, JUNB, and JUND, transcription factor AP-1 subunits Fos, FosB, Jun, JunB, and JunD, respectively; GATA4, GATA-binding protein 4; GRASP65, Golgi reassembly-stacking protein 1; HDAC9, histone deacetylase 9; IFNG, interferon γ; IL3, IL4, IL10, and IL13, interleukins 3, 4, 10, and 13, respectively; INPP5D, inositol polyphosphate-5-phosphatase D; INS, insulin; ITGAM, integrin subunit αM; KARS1, lysyl-tRNA synthetase 1; KRT20, keratin 20; LGALS3, galectin 3; LYN, tyrosine-protein kinase Lyn; MS4A1, membrane-spanning 4-domains subfamily A member 1; PTPN11, protein tyrosine phosphatase non-receptor type 11; RELA, NFκB subunit Rela; SH2D1A, SH2 domain-containing protein 1A; SMAD3, SMAD family member 3; STAT3, signal transducer and activator of transcription 3; SYK, spleen tyrosine kinase; SYT1, synaptotagmin 1; TGFB1 and TGFBR2, transforming growth factor β1 and its receptor II TLR9 (Toll-like receptor 9); VWF, von Willebrand factor; WNK1, WNK lysine-deficient protein kinase 1.

3.7. Human Immunoregulatory Genes Homologous to the Rat Fcgr2b Gene Identified as a Molecular Marker for Pain Tolerance in Age-Related Diseases Are Young on the Molecular-Evolution Scale

Because the human FCGR2B gene orthologous to the rat Fcgr2b gene identified as a molecular marker for elevated neuropathic pain tolerance in age-related diseases seems to be under stabilizing selection (Figure S1), we used our Orthoscape plug-in [229,230] within the Cytoscape software suite [231] and estimated BLAST-based [232] phylostratigraphic age indexes (PAIs) for (a) 39 human genes homologous to the behavior-related PAG-associated rat DEGs identified in this work (Table 2) and (b) 48 human FCGR2B-associated genes (Figure 5). The results are in the top and bottom parts of Table S4. As can be seen from the top part of this table, FCGR2B is one of the two youngest behavior-related human genes. Furthermore, the top ten youngest genes among all 48 human genes in its bottom part contain all six human FCGR1A, FCGR2A, FCGR2B, FCGR2C, FCGR3A, and FCGR3B genes, which is a statistically significant event according to the binomial distribution (p < 0.0001). Finally, as can be seen from Figure 6, the 48 FCGR2B-associated human genes examined are significantly younger than the 39 behavior-related human genes, according to the nonparametric Mann–Whitney U test (p < 0.01) and the parametric Fisher’s Z-test (p < 0.01).

Figure 6.

Figure 6

A comparison between 48 human FCGR2B-associated genes using the publicly available toolbox ANDSystem [227] (Figure 5) and the human genes homologous to 39 novel PAG-related rat DEGs (Table 2). Legend: the double asterisk (i.e., double character “**”) denotes statistical significance at p < 0.01 according to nonparametric Mann–Whitney U test and parametric Fisher’s Z-test; PAI, a gene’s phylostratigraphic age index evaluated against the BLAST-based scale [232] using the freely available web service Orthoscape [229]; BLAST-based PAI scale: 0, Cellular organisms; 1, Eukaryota; 2, Opisthokonta; 3, Metazoa; 4, Eumetazoa; 5, Bilateria; 6, Deuterostomia; 7, Chordata; 8, Craniata; 9, Vertebrata; 10, Gnathostomata; 11, Teleostomi; 12, Euteleostomi; 13, Sarcopterygii; 14, Dipnotetrapodomorpha; 15, Tetrapoda; 16, Amniota; 17, Mammalia; 18, Theria; 19, Eutheria; 20, Euarchontoglires; 21, Primates; 22, Haplorrhini; 23, Simiiformes; 24, Catarrhini; 25, Hominoidea; 26, Hominidae; 27, Homininae; and 28, Homo.

3.8. Human Immunoregulatory Genes Homologous to the Rat Fcgr2b Gene Identified as a Molecular Marker for Pain Tolerance in ARDs can Be Permanently Available in Any Tissue of Anyone’s Organism

Human immunoregulatory genes homologous to the rat Fcgr2b gene that we have identified as a molecular marker for elevated neuropathic pain tolerance in ARDs are expressed at increased rates mostly in conventional, monocyte-derived, and plasmacytoid dendritic cells as well as macrophages [233], which occur in most tissues, where they are critical to tissue homeostasis [234]. According to the GeneCard database [235], a large number of microarray, RNA-Seq, and proteomics experiments have detected molecular products expressed from the human genes FCGR1A, FCGR2A, FCGR2B, FCGR2C, FCGR3A, and FCGR3B in the majority of the human tissues studied. Because disruptions in the cellular-senescence-associated tissue homeostasis compromise the correct activation of immune responses to pathogens and cancer cells [236,237], these human immunoregulatory genes can be permanently overexpressed in any tissue of anyone’s organism as molecular markers for elevated neuropathic pain tolerance in ARDs (see Table 7).

4. Materials and Methods

4.1. Animals

The animals used were adult male gray rats (R. norvegicus) artificially bred for over 90 generations for either aggressive or tame behavior towards humans as two outbred strains. The rats were kept under standard conditions of the Conventional Animal Facility at the ICG SB RAS (Novosibirsk, Russia), as described elsewhere [72,79,238]. The total number of rats was 22 (11 tame and 11 aggressive), each 4 months old and weighing 250–270 g, all from unrelated litters. For the gene expression analysis, all the rats were decapitated. PAG samples were excised according to a handbook technique [239], flash-frozen in liquid nitrogen, and stored at −70 °C until use. This work was conducted in line with the guidelines of the Declaration of Helsinki, of Directive 2010/63/EU of the European Parliament, and of the European Council resolution of 22 September 2010. The research protocol was approved by the Interinstitutional Commission on Bioethics at the ICG SB RAS, Novosibirsk, Russia (Approval documentation No. 8 dated 19 March 2012).

4.2. RNA-Seq

Total RNA was isolated from ~100 mg of the PAG tissue samples of tame (n = 3) and aggressive (n = 3) rats using the TRIzol™ reagent (Invitrogen, Carlsbad, CA, USA). The quality of the total-RNA samples was measured on a Bioanalyzer 2100 (Agilent, Santa-Clara, CA, USA). Samples with optimal RNA integrity numbers (RINs) were selected for further analysis. Furthermore, the total RNA was analyzed quantitatively on an Invitrogen Qubit™ 2.0 fluorometer (Invitrogen). Different RNA types were separated with the mirVana™ Kit (Thermo Fisher Scientific, Waltham, MA, USA). The Dynabeads mRNA Purification Kit (Invitrogen) was used to prepare highly purified mRNA from 5 μg of the RNA fraction depleted of small RNAs. Preparation of RNA-Seq libraries from 15–30 ng of an mRNA fraction was carried out with the help of the ScriptSeq™ v2 RNA-Seq Library Preparation Kit (epicenter®, Madison, WI, USA). The quality of the libraries obtained was examined on a Bioanalyzer 2100. After normalization, barcoded libraries were pooled and handed over to the Multi-Access Center of Genomic Research (ICG SB RAS, Novosibirsk, Russia) for sequencing on an Illumina NextSeq 550 instrument in a NextSeq® 500/550 High Output Kit v2 cassette (75 cycles) under the assumption of a direct read of 75 nucleotides, with at least 40 million reads.

4.3. Mapping of RNA Sequences to the R. norvegicus Reference Genome

The primary raw Fastq files were examined using a quality-control tool for high-throughput sequencing data (FastQC; https://www.bioinformatics.babraham.ac.uk/projects/fastqc; accessed on 19 December 2018). Next, we improved the quality of the raw reads using the Trimmomatic tool [240] in a step-by-step manner as follows: (i) discarded a base from either the start or end position if the quality was low; (ii) trimmed bases with a sliding-window method, and (iii) eliminated any remaining reads that were less than 36 bases in length. After that, we aligned the trimmed reads to the R. norvegicus reference genome (RGSC Rnor_6.0, UCSC version Rn6, July 2014 assembly) using the TopHat2 toolbox [241]. Next, we reformatted these alignments into sorted BAM files in SAMtools version 1.4 [242]. Then we assigned the reads in question to these genes using the htseq-count tool from the preprocessing software HTSeq v.0.7.2 [243] along with gtf files containing the coordinates of the rat genes according to Rnor_6.0 and an indexed SAM file. Finally, we used DESeq2 [244] via the web service IRIS (http://bmbl.sdstate.edu/IRIS/; accessed on 16 January 2020), rated differential expression levels of the rat genes, and, to minimize false-positive error rates, applied Fisher’s Z-test [245] with the Benjamini correction for multiple comparisons as well as discarded all hypothetical, tentative, predicted, uncharacterized, and non-protein-coding genes.

4.4. qPCR

To examine independently and selectively the novel tame versus aggressive rat PAG DEGs identified here (Table 2), we performed a qPCR control assay on the total RNA taken from the remaining samples of the PAG of tame (n = 8) and aggressive (n = 8) rats. First, we isolated total RNA using TRIzol™, purified it on Agencourt RNAClean XP Kit magnetic beads (Beckman, #A63987), and quantified it using a Qubit™ 2.0 fluorometer (Invitrogen/Life Technologies) and a Qubit™ RNA High-Sensitivity Assay Kit (Invitrogen, cat. # Q32852). Next, we synthesized cDNA using the Reverse Transcription Kit (Syntol, #OT-1). Finally, we designed oligonucleotide primers for qPCR using the web service PrimerBLAST [246] (Table 11).

Table 11.

qPCR primers selected via the publicly available web service PrimerBLAST [246].

No. Gene Forward, 5′→3′ Reverse, 5′→3′
Novel DEGs Identified in the PAG of Tame versus Aggressive Adult Male Rats
1 Ascl3 CCTCTGCTGCCCTTTTCCAG ACTTGACTCGCTGCCTCTCT
2 Defb17 TGGTAGCTTGGACTTGAGGAAAGAA TGCAGCAGTGTGTTCCAGGTC
Reference genes
3 B2m GTGTCTCAGTTCCACCCACC TTACATGTCTCGGTCCCAGG
4 Hprt1 TCCCAGCGTCGTGATTAGTGA CCTTCATGACATCTCGAGCAAG
5 Rpl30 CATCTTGGCGTCTGATCTTG TCAGAGTCTGTTTGTACCCC

Note: For the DEGs subjected to this qPCR-based verification, see Table 2; reference rat genes: B2m, β-2-microglobulin [81]; Hprt1, hypoxanthine phosphoribosyltransferase 1 [82]; and Rpl30, ribosomal protein L30 [83].

After that, we conducted qPCR on a LightCycler® 96 (Roche, Basel, Basel-Stadt, Switzerland) with the EVA Green I Kit in three technical replicates. We estimated qPCR efficiency using serial cDNA dilutions (standards). Following the recommendations set out in the MIQE guidelines [84], we analyzed three reference genes at once: B2m (β-2-microglobulin) [81], Hprt1 (hypoxanthine phosphoribosyltransferase 1) [82], and Rpl30 (ribosomal protein L30) [83].

4.5. DEGs

We have analyzed all publicly available independent experimental RNA-Seq datasets of the transcriptomes of tissues from ARD-susceptible versus ARD-resistant subjects (humans [33,36,37,38,39,40,41,42,43] and animals [30,32,35,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64]) and the transcriptomes of tissues from domestic versus wild animals [68,74,204,205,206,207,208,209,210,211].

4.6. Human Genes

We analyzed the 39 human genes that are orthologous to the 39 PAG-related DEGs of the tame and aggressive rats (Table 2). With reliance on PubMed [75], we gathered clinical information about whether downregulation or upregulation of each of these 39 human genes can alleviate or aggravate ARDs (Table 9 and Table S3).

4.7. DNA Sequences

For in silico analysis of the human genes encoding the novel candidate molecular markers for ARDs, we retrieved the DNA sequences and SNPs of their 70 bp proximal promoters from the Ensembl database [247] and the dbSNP database [218], respectively, using the UCSC Genome Browser (reference human genome assembly GRCh38/hg38) [248] in both dialog mode and automated mode using the Bioperl toolkit [249] (Figure S1).

4.8. In Silico Analysis of DNA Sequences

We analyzed SNPs within DNA sequences using our previously published publicly available web service SNP_TATA_Comparator [219], which implements our bioinformatic model of three-step binding of TATA-binding protein (TBP) to a given 70 bp proximal promoter of the human gene under study, as detailed in the Supplementary Materials (Section S1 “Supplementary methods for DNA sequence analysis”) [250,251,252,253,254,255,256,257,258,259,260,261,262] and additionally illustrated in Figure S1.

4.9. A Knowledge Base for Domestic Animal DEGs Whose Human Orthologs Can Affect ARD Severity

In files with the flat Excel-compatible textual format, we have documented all proposed associations between the domestic and wild animal DEGs homologous to the 39 novel DEGs that we found in the PAG of the tame and aggressive rats. We have also documented how downregulation or upregulation of the human genes homologous to these PAG-related rat DEGs can affect ARD severity. Finally, we have added our current findings to our previously published public PetDEGsDB knowledge base, its new build being freely available at www.sysbio.ru/domestic-wild (accessed on 14 December 2022) in the MariaDB 10.2.12 database management system (MariaDB Corp AB, Espoo, Finland).

4.10. Data Mining of Literature Sources and Databases Publicly Available on the Internet

We conducted data mining using the automated mode of our previously published freely available web service ANDSystem [227], with “Human, FCGR2B, gene, protein” as input keywords, with all the other parameters set at their default values.

4.11. In Silico Estimation of the BLAST-Based PAIs of a Given Human Gene

We estimated the BLAST-based [232] PAIs for a given human gene whose NCBI Entrez gene number served as input for our Orthoscape plug-in [229,230] within the Cytoscape software suite [231]. The output was the most recent common ancestor of all the animal species whose DNA sequence of this gene is already known. The following evolutionary rank scale was used: 0, Cellular organisms; 1, Eukaryota; 2, Opisthokonta; 3, Metazoa; 4, Eumetazoa; 5, Bilateria; 6, Deuterostomia; 7, Chordata; 8, Craniata; 9, Vertebrata; 10, Gnathostomata; 11, Teleostomi; 12, Euteleostomi; 13, Sarcopterygii; 14, Dipnotetrapodomorpha; 15, Tetrapoda; 16, Amniota; 17, Mammalia; 18, Theria; 19, Eutheria; 20, Euarchontoglires; 21, Primates; 22, Haplorrhini; 23, Simiiformes; 24, Catarrhini; 25, Hominoidea; 26, Hominidae; 27, Homininae; and 28, Homo.

4.12. Statistical Analysis

We performed the Mann–Whitney U test, Fisher’s Z-test, Pearson’s linear correlation test, Goodman–Kruskal generalized correlation test, Spearman’s and Kendall’s rank correlation tests, Pearson’s χ2 test, Fisher’s exact test, and the binomial-distribution analysis using appropriate options in the standard software STATISTICA (StatsoftTM). Furthermore, using the PAST4.04 software package [85], we conducted a principal component analysis in the bootstrap refinement mode via its mode selection path “Multivariate”→”Ordination”→“Principal Components (PCA)”→“Correlation”→“Bootstrap.”

5. Conclusions

First, we have profiled the PAG transcriptome in three tame adult male rats versus three aggressive conspecifics, all animals being unrelated, and made the primary raw reads publicly available (NCBI SRA database ID: PRJNA668014) [80]. With the use of this transcriptome, we have found 39 PAG-related DEGs whose statistical significance (PADJ < 0.05, Fisher’s Z-test with the Benjamini correction for multiple comparisons) was acceptable (Table 2). We have selectively verified these DEGs with independent experimental analyses (qPCR) of eight other tame and eight other aggressive adult male rats from unrelated litters of the same two outbred strains (Table 3 and Figure 1).

Secondly, we have found that Fcγ receptor IIb overexpression is a statistically significant molecular marker for ARDs. To come to this conclusion, we compared 39 novel DEGs in the PAG of tame and aggressive rats to their known homologs associated with ARDs in animals and humans, using correlation and principal component analysis, as well as Bonferroni’s correction for multiple comparisons.

Finally, we propose the human immunoregulatory genes FCGR1A, FCGR2A, FCGR2B, FCGR2C, FCGR3A, and FCGR3B homologous to the rat Fcgr2b gene as theranostic molecular markers for age-related diseases.

Acknowledgments

We are also thankful to the multi-access bioinformatics center for the use of computational resources as supported by Russian government project No. FWNR-2022-0020.

Abbreviations

ARD age-related disease
DEG differentially expressed gene
log2 value log2-transformed gene expression fold change
PAG periaqueductal gray matter
PAI phylostratigraphic age index
PC1 (PC2) major (minor) principal component
qPCR quantitative polymerase chain reaction
RNA-Seq RNA sequencing
SNP single-nucleotide polymorphism
TBP TATA-binding protein
WHO World Health Organization

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms24043996/s1.

Author Contributions

Conceptualization and supervision, N.A.K. and V.K.; methodology, A.M.; investigation, I.C., R.K., N.V.K., and S.S.; software, A.B.; validation, L.S.; resources, D.O., V.A.I., P.D., and Z.M.; data curation, K.Z., A.K., and B.K.; writing—original draft preparation, M.P. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

This work was conducted in line with the guidelines of the Declaration of Helsinki, of Directive 2010/63/EU of the European Parliament, and of the European Council resolution of 22 September 2010. The research protocol was approved by the Interinstitutional Commission on Bioethics at the ICG SB RAS, Novosibirsk, Russia (Approval documentation No. 8 dated 19 March 2012).

Informed Consent Statement

Not applicable.

Data Availability Statement

The primary RNA-Seq data obtained in this work were deposited in the NCBI SRA database (ID = PRJNA668014).

Conflicts of Interest

The authors declare no conflict of interest.

Funding Statement

This study was supported by the Russian Federal Science and Technology Program for the Development of Genetic Technologies.

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Byles J. The 45 and up study: An investment in healthy ageing. Public. Health Res. Pract. 2022;32:3242231. doi: 10.17061/phrp3242231. [DOI] [PubMed] [Google Scholar]
  • 2.Lum T.Y.S. The pathways to healthy ageing: Evidence from longitudinal studies and real-time data. Innov. Aging. 2021;5:467. doi: 10.1093/geroni/igab046.1806. [DOI] [Google Scholar]
  • 3.Le Couteur D.G., Thillainadesan J. What is an aging-related disease? An epidemiological perspective. J. Gerontol. A. Biol. Sci. Med. Sci. 2022;77:2168–2174. doi: 10.1093/gerona/glac039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Nunan E., Wright C.L., Semola O.A., Subramanian M., Balasubramanian P., Lovern P.C., Fancher I.S., Butcher J.T. Obesity as a premature aging phenotype–Implications for sarcopenic obesity. Geroscience. 2022;44:1393–1405. doi: 10.1007/s11357-022-00567-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Yue Z., Nie L., Zhang P., Chen Q., Lv Q., Wang Q. Tissue-resident macrophage inflammaging aggravates homeostasis dysregulation in age-related diseases. Cell. Immunol. 2021;361:104278. doi: 10.1016/j.cellimm.2020.104278. [DOI] [PubMed] [Google Scholar]
  • 6.Deryabin P.I., Borodkina A.V. Epigenetic clocks provide clues to the mystery of uterine ageing. Hum. Reprod. Update. 2022:dmac042. doi: 10.1093/humupd/dmac042. [DOI] [PubMed] [Google Scholar]
  • 7.Zammouri J., Vatier C., Capel E., Auclair M., Storey-London C., Bismuth E., Mosbah H., Donadille B., Janmaat S., Feve B., et al. Molecular and cellular bases of lipodystrophy syndromes. Front. Endocrinol. 2022;12:803189. doi: 10.3389/fendo.2021.803189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Zhang X., Li H., He M., Wang J., Wu Y., Li Y. Immune system and sarcopenia: Presented relationship and future perspective. Exp. Gerontol. 2022;164:111823. doi: 10.1016/j.exger.2022.111823. [DOI] [PubMed] [Google Scholar]
  • 9.Armstrong G.W., Miller J.B. Telemedicine for the diagnosis and management of age-related macular degeneration: A review. J. Clin. Med. 2022;11:835. doi: 10.3390/jcm11030835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Gomez C.R. Role of heat shock proteins in aging and chronic inflammatory diseases. Geroscience. 2021;43:2515–2532. doi: 10.1007/s11357-021-00394-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Boulestreau J., Maumus M., Jorgensen C., Noel D. Extracellular vesicles from mesenchymal stromal cells: Therapeutic perspectives for targeting senescence in osteoarthritis. Adv. Drug. Deliv. Rev. 2021;175:113836. doi: 10.1016/j.addr.2021.113836. [DOI] [PubMed] [Google Scholar]
  • 12.Ting K.K., Coleman P., Zhao Y., Vadas M.A., Gamble J.R. The aging endothelium. Vasc. Biol. 2021;3:R35–R47. doi: 10.1530/VB-20-0013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Tuttle C.S.L., Luesken S.W.M., Waaijer M.E.C., Maier A.B. Senescence in tissue samples of humans with age-related diseases: A systematic review. Ageing. Res. Rev. 2021;68:101334. doi: 10.1016/j.arr.2021.101334. [DOI] [PubMed] [Google Scholar]
  • 14.Martins W.K., Belotto R., Silva M.N., Grasso D., Suriani M.D., Lavor T.S., Itri R., Baptista M.S., Tsubone T.M. Autophagy regulation and photodynamic therapy: Insights to improve outcomes of cancer treatment. Front Oncol. 2021;10:610472. doi: 10.3389/fonc.2020.610472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kishimoto Y., Kondo K., Momiyama Y. The protective role of sestrin2 in atherosclerotic and cardiac diseases. Int. J. Mol. Sci. 2021;22:1200. doi: 10.3390/ijms22031200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Sutton N.R., Malhotra R., St Hilaire C., Aikawa E., Blumenthal R.S., Gackenbach G., Goyal P., Johnson A., Nigwekar S.U., Shanahan C.M., et al. Molecular mechanisms of vascular health: Insights from vascular aging and calcification. Arterioscler. Thromb. Vasc. Biol. 2023;43:15–29. doi: 10.1161/ATVBAHA.122.317332. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Figuer A., Bodega G., Tato P., Valera G., Serroukh N., Ceprian N., de Sequera P., Morales E., Carracedo J., Ramirez R., et al. Premature aging in chronic kidney disease: The outcome of persistent inflammation beyond the bounds. Int. J. Environ. Res. Public. Health. 2021;18:8044. doi: 10.3390/ijerph18158044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Li X., Gao X., Zhang W., Liu M., Han Z., Li M., Lei P., Liu Q. Microglial replacement in the aged brain restricts neuroinflammation following intracerebral hemorrhage. Cell. Death. Dis. 2022;13:33. doi: 10.1038/s41419-021-04424-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Jicha G.A. Medical management of frontotemporal dementias: The importance of the caregiver in symptom assessment and guidance of treatment strategies. J. Mol. Neurosci. 2011;45:713–723. doi: 10.1007/s12031-011-9558-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Schramm C., Wallon D., Nicolas G., Charbonnier C. What contribution can genetics make to predict the risk of Alzheimer’s disease? Rev. Neurol. 2022;178:414–421. doi: 10.1016/j.neurol.2022.03.005. [DOI] [PubMed] [Google Scholar]
  • 21.Bohnen N.I., Yarnall A.J., Weil R.S., Moro E., Moehle M.S., Borghammer P., Bedard M.A., Albin R.L. Cholinergic system changes in Parkinson’s disease: Emerging therapeutic approaches. Lancet. Neurol. 2022;21:381–392. doi: 10.1016/S1474-4422(21)00377-X. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Ni Y.Q., Xu H., Liu Y.S. Roles of long non-coding RNAs in the Development of aging-related neurodegenerative diseases. Front. Mol. Neurosci. 2022;15:844193. doi: 10.3389/fnmol.2022.844193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Schroth J., Henson S.M. Mitochondrial dysfunction accelerates ageing. Immunometabolism. 2020;2:e200035. doi: 10.20900/immunometab20200035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Wang J.C., Bennett M. Aging and atherosclerosis: Mechanisms, functional consequences, and potential therapeutics for cellular senescence. Circ. Res. 2012;111:245–259. doi: 10.1161/CIRCRESAHA.111.261388. [DOI] [PubMed] [Google Scholar]
  • 25.Schreckenberger Z.J., Wenceslau C.F., Joe B., McCarthy C.G. Mitophagy in hypertension-associated premature vascular aging. Am. J. Hypertens. 2020;33:804–812. doi: 10.1093/ajh/hpaa058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Liu C., Zou C., Zou S., Wang Q., Xiao D., Zhang L. Abnormal hemoglobin H band in myelodysplastic syndromes (MDS): A case report. Transfus. Clin. Biol. 2021;28:206–210. doi: 10.1016/j.tracli.2020.10.009. [DOI] [PubMed] [Google Scholar]
  • 27.Mandelblatt J. Squamous cell cancer of the cervix, immune senescence and HPV: Is cervical cancer an age-related neoplasm? Adv. Exp. Med. Biol. 1993;330:13–26. doi: 10.1007/978-1-4615-2926-2_2. [DOI] [PubMed] [Google Scholar]
  • 28.Manoogian E.N.C., Panda S. Circadian rhythms, time-restricted feeding, and healthy aging. Ageing Res. Rev. 2017;39:59–67. doi: 10.1016/j.arr.2016.12.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Longo V.D., Anderson R.M. Nutrition, longevity and disease: From molecular mechanisms to interventions. Cell. 2022;185:1455–1470. doi: 10.1016/j.cell.2022.04.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Park W., Rengaraj D., Kil D.Y., Kim H., Lee H.K., Song K.D. RNA-seq analysis of the kidneys of broiler chickens fed diets containing different concentrations of calcium. Sci. Rep. 2017;7:11740. doi: 10.1038/s41598-017-11379-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Mycielska M.E., James E.N., Parkinson E.K. Metabolic alterations in cellular senescence: The role of citrate in ageing and age-related disease. Int. J. Mol. Sci. 2022;23:3652. doi: 10.3390/ijms23073652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.de Souto Barreto P., Cesari M., Morley J.E., Roberts S., Landi F., Cederholm T., Rolland Y., Vellas B., Fielding R. Appetite loss and anorexia of aging in clinical care: An ICFSR task force report. J. Frailty. Aging. 2022;11:129–134. doi: 10.14283/jfa.2022.14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Melov S., Tarnopolsky M.A., Beckman K., Felkey K., Hubbard A. Resistance exercise reverses aging in human skeletal muscle. PLoS ONE. 2007;2:e465. doi: 10.1371/journal.pone.0000465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Zhang T., Chen Y., Wen J., Jia Y., Wang L., Lv X., Yang W., Qu C., Li H., Wang H., et al. Transcriptomic analysis of laying hens revealed the role of aging-related genes during forced molting. Genes. 2021;12:1767. doi: 10.3390/genes12111767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Liu X., Zhan Y., Xu W., Liu L., Liu X., Da J., Zhang K., Zhang X., Wang J., Liu Z., et al. Characterization of transcriptional landscape in bone marrow-derived mesenchymal stromal cells treated with aspirin by RNA-seq. PeerJ. 2022;10:e12819. doi: 10.7717/peerj.12819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Wu Y.B., Zang W.D., Yao W.Z., Luo Y., Hu B., Wang L., Liang Y.L. Analysis of FOS, BTG2, and NR4A in the function of renal medullary hypertension. Genet. Mol. Res. 2013;12:3735–3741. doi: 10.4238/2013.September.19.4. [DOI] [PubMed] [Google Scholar]
  • 37.Li C., Zhang Z., Xu Q., Wu T., Shi R. Potential mechanisms and serum biomarkers involved in sex differences in pulmonary arterial hypertension. Medicine. 2020;99:e19612. doi: 10.1097/MD.0000000000019612. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Stearman R.S., Bui Q.M., Speyer G., Handen A., Cornelius A.R., Graham B.B., Kim S., Mickler E.A., Tuder R.M., Chan S.Y., et al. Systems analysis of the human pulmonary arterial hypertension lung transcriptome. Am. J. Respir. Cell Mol. Biol. 2019;60:637–649. doi: 10.1165/rcmb.2018-0368OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Yao X., Jing T., Wang T., Gu C., Chen X., Chen F., Feng H., Zhao H., Chen D., Ma W. Molecular characterization and elucidation of pathways to identify novel therapeutic targets in pulmonary arterial hypertension. Front. Physiol. 2021;12:694702. doi: 10.3389/fphys.2021.694702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Neusser M.A., Lindenmeyer M.T., Moll A.G., Segerer S., Edenhofer I., Sen K., Stiehl D.P., Kretzler M., Grone H.J., Schlondorff D., et al. Human nephrosclerosis triggers a hypoxia-related glomerulopathy. Am. J. Pathol. 2010;176:594–607. doi: 10.2353/ajpath.2010.090268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Zheng Y., He J.Q. Common differentially expressed genes and pathways correlating both coronary artery disease and atrial fibrillation. EXCLI J. 2021;20:126–141. doi: 10.17179/excli2020-3262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Sproviero D., Gagliardi S., Zucca S., Arigoni M., Giannini M., Garofalo M., Fantini V., Pansarasa O., Avenali M., Ramusino M.C., et al. Extracellular vesicles derived from plasma of patients with neurodegenerative disease have common transcriptomic profiling. Front. Aging. Neurosci. 2022;14:785741. doi: 10.3389/fnagi.2022.785741. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Liu Y., Reynolds L.M., Ding J., Hou L., Lohman K., Young T., Cui W., Huang Z., Grenier C., Wan M., et al. Blood monocyte transcriptome and epigenome analyses reveal loci associated with human atherosclerosis. Nat. Commun. 2017;8:393. doi: 10.1038/s41467-017-00517-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Stefanova N.A., Maksimova K.Y., Rudnitskaya E.A., Muraleva N.A., Kolosova N.G. Association of cerebrovascular dysfunction with the development of Alzheimer’s disease-like pathology in OXYS rats. BMC Genom. 2018;19:75. doi: 10.1186/s12864-018-4480-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Stefanova N.A., Ershov N.I., Maksimova K.Y., Muraleva N.A., Tyumentsev M.A., Kolosova N.G. The rat prefrontal-cortex transcriptome: Effects of aging and sporadic Alzheimer’s disease-like pathology. J. Gerontol. A Biol. Sci. Med. Sci. 2019;74:33–43. doi: 10.1093/gerona/gly198. [DOI] [PubMed] [Google Scholar]
  • 46.Kozhevnikova O.S., Korbolina E.E., Ershov N.I., Kolosova N.G. Rat retinal transcriptome: Effects of aging and AMD-like retinopathy. Cell Cycle. 2013;12:1745–1761. doi: 10.4161/cc.24825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Fedoseeva L.A., Klimov L.O., Ershov N.I., Efimov V.M., Markel A.L., Orlov Y.L., Redina O.E. The differences in brain stem transcriptional profiling in hypertensive ISIAH and normotensive WAG rats. BMC Genom. 2019;20:297. doi: 10.1186/s12864-019-5540-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Klimov L.O., Ershov N.I., Efimov V.M., Markel A.L., Redina O.E. Genome-wide transcriptome analysis of hypothalamus in rats with inherited stress-induced arterial hypertension. BMC. Genet. 2016;17:13. doi: 10.1186/s12863-015-0307-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Ryazanova M.A., Fedoseeva L.A., Ershov N.I., Efimov V.M., Markel A.L., Redina O.E. The gene-expression profile of renal medulla in ISIAH rats with inherited stress-induced arterial hypertension. BMC Genet. 2016;17:151. doi: 10.1186/s12863-016-0462-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Fedoseeva L.A., Ryazanova M.A., Ershov N.I., Markel A.L., Redina O.E. Comparative transcriptional profiling of renal cortex in rats with inherited stress-induced arterial hypertension and normotensive Wistar Albino Glaxo rats. BMC Genet. 2016;17:12. doi: 10.1186/s12863-015-0306-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Fedoseeva L.A., Klimov L.O., Ershov N.I., Alexandrovich Y.V., Efimov V.M., Markel A.L., Redina O.E. Molecular determinants of the adrenal gland functioning related to stress-sensitive hypertension in ISIAH rats. BMC Genom. 2016;17:989. doi: 10.1186/s12864-016-3354-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Yuan X., Wu Q., Liu X., Zhang H., Xiu R. Transcriptomic profile analysis of brain microvascular pericytes in spontaneously hypertensive rats by RNA-Seq. Am. J. Transl. Res. 2018;10:2372–2386. [PMC free article] [PubMed] [Google Scholar]
  • 53.Liddelow S.A., Dziegielewska K.M., Ek C.J., Habgood M.D., Bauer H., Bauer H.C., Lindsay H., Wakefield M.J., Strazielle N., Kratzer I., et al. Mechanisms that determine the internal environment of the developing brain: A transcriptomic, functional and ultrastructural approach. PLoS ONE. 2013;8:e65629. doi: 10.1371/journal.pone.0065629. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Chen Z., Huang Z., Zhao X., Zhou Y., Zhang P., Li Y. Transcriptome analysis of differentially expressed genes involved in the inflammageing status of gingiva in aged mice. Oral. Dis. 2022 doi: 10.1111/odi.14222. [DOI] [PubMed] [Google Scholar]
  • 55.Kaya S., Schurman C.A., Dole N.S., Evans D.S., Alliston T. Prioritization of genes relevant to bone fragility through the unbiased integration of aging mouse bone transcriptomics and human GWAS analyses. J. Bone. Miner. Res. 2022;37:804–817. doi: 10.1002/jbmr.4516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Wang Y., Eng D.G., Pippin J.W., Gharib S.A., McClelland A., Gross K.W., Shankland S.J. Sex differences in transcriptomic profiles in aged kidney cells of renin lineage. Aging. 2018;10:606–621. doi: 10.18632/aging.101416. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Li J., Gao F., Wei L., Chen L., Qu N., Zeng L., Luo Y., Huang X., Jiang H. Predict the role of lncRNA in kidney aging based on RNA sequencing. BMC Genom. 2022;23:254. doi: 10.1186/s12864-022-08479-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Gorr M.W., Francois A., Marcho L.M., Saldana T., McGrail E., Sun N., Stratton M.S. Molecular signature of cardiac remodeling associated with Polymerase Gamma mutation. Life Sci. 2022;298:120469. doi: 10.1016/j.lfs.2022.120469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Kiss T., Nyul-Tooth A., Gulej R., Tarantini S., Csipo T., Mukli P., Ungvari A., Balasubramanian P., Yabluchanskiy A., Benyo Z., et al. Old blood from heterochronic parabionts accelerates vascular aging in young mice: Transcriptomic signature of pathologic smooth muscle remodeling. Geroscience. 2022;44:953–981. doi: 10.1007/s11357-022-00519-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Fang K., Liu D., Pathak S.S., Yang B., Li J., Karthikeyan R., Chao O.Y., Yang Y.M., Jin V.X., Cao R. Disruption of circadian rhythms by ambient light during neurodevelopment leads to autistic-like molecular and behavioral alterations in adult mice. Cells. 2021;10:3314. doi: 10.3390/cells10123314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Myers M.J., Shaik F., Shaik F., Always S.E., Mohamed J.S. Skeletal muscle gene expression profile in response to caloric restriction and aging: A role for SirT1. Genes. 2021;12:691. doi: 10.3390/genes12050691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Puig O., Wang I.M., Cheng P., Zhou P., Roy S., Cully D., Peters M., Benita Y., Thompson J., Cai T.Q. Transcriptome profiling and network analysis of genetically hypertensive mice identifies potential pharmacological targets of hypertension. Physiol. Genomics. 2010;42:24–32. doi: 10.1152/physiolgenomics.00010.2010. [DOI] [PubMed] [Google Scholar]
  • 63.Loke S.Y., Wong P.T., Ong W.Y. Global gene expression changes in the prefrontal cortex of rabbits with hypercholesterolemia and/or hypertension. Neurochem. Int. 2017;102:33–56. doi: 10.1016/j.neuint.2016.11.010. [DOI] [PubMed] [Google Scholar]
  • 64.da Costa Silva J.R., Fujimura P.T., Batista L.L., Malta S.M., Filho R.M., Silva M.H., de Souza A.G., Silva A.P.M., Borges L.D.F., Bastos V.A.F., et al. Differential gene expression by RNA-seq during Alzheimer’s disease-like progression in the Drosophila melanogaster model. Neurosci. Res. 2022;180:1–12. doi: 10.1016/j.neures.2022.02.003. [DOI] [PubMed] [Google Scholar]
  • 65.Trovato G.M. Sustainable medical research by effective and comprehensive medical skills: Overcoming the frontiers by predictive, preventive and personalized medicine. EPMA. J. 2014;5:14. doi: 10.1186/1878-5085-5-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Litwin M., Feber J. Origins of primary hypertension in children: Early vascular or biological aging? Hypertension. 2020;76:1400–1409. doi: 10.1161/HYPERTENSIONAHA.120.14586. [DOI] [PubMed] [Google Scholar]
  • 67.Markel A.L. Features of the behavior of the rat with hereditarily determined arterial hypertension. Zh. Vyssh. Nerv. Deiat. Im. IP. Pavlov. 1986;36:956–962. [PubMed] [Google Scholar]
  • 68.Oshchepkov D., Chadaeva I., Kozhemyakina R., Shikhevich S., Sharypova E., Savinkova L., Klimova N.V., Tsukanov A., Levitsky V.G., Markel A.L. Transcription factors as important regulators of changes in behavior through domestication of gray rats: Quantitative data from RNA sequencing. Int. J. Mol. Sci. 2022;23:12269. doi: 10.3390/ijms232012269. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Herbek Y.E., Zakharov I.K., Trapezov O.V., Shumny V.K. Evolution compressed in time. Philos. Sci. 2013;1:115–139. [Google Scholar]
  • 70.Oskina I.N., Herbeck Y.E., Shikhevich S.G., Plyusnina I.Z., Gulevich R.G. Alterations in the hypothalamus-pituitary-adrenal and immune systems during selection of animals for tame behavior. Information. Bulletin. VOGiS. 2008;12:39–49. [Google Scholar]
  • 71.Prasolova L.A., Gerbek Y.E., Gulevich R.G., Shikhevich S.G., Konoshenko M.Y., Kozhemyakina R.V., Oskina I.N., Plyusnina I.Z. The effects of prolonged selection for behavior on the stress response and activity of the reproductive system of male grey mice (Rattus norvegicus) Russ. J. Genet. 2014;50:846–852. doi: 10.1134/S1022795414080031. [DOI] [PubMed] [Google Scholar]
  • 72.Belyaev D.K., Borodin P.M. The influence of stress on variation and its role in evolution. Biol. Zent. 1982;100:705–714. [Google Scholar]
  • 73.Melamed D., Scott D.W. Aging and neoteny in the B lineage. Blood. 2012;120:4143–4149. doi: 10.1182/blood-2012-07-444711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Oshchepkov D., Chadaeva I., Kozhemyakina R., Zolotareva K., Khandaev B., Sharypova E., Ponomarenko P., Bogomolov A., Klimova N.V., Shikhevich S., et al. Stress reactivity, susceptibility to hypertension, and differential expression of genes in hypertensive compared to normotensive patients. Int. J. Mol. Sci. 2022;23:2835. doi: 10.3390/ijms23052835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Lu Z. PubMed and beyond: A survey of web tools for searching biomedical literature. Database. 2011;2011:baq036. doi: 10.1093/database/baq036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Petitjean H., Fatima T., Mouchbahani-Constance S., Davidova A., Ferland C.E., Orlowski J., Sharif-Naeini R. Loss of SLC9A6/NHE6 impairs nociception in a mouse model of Christianson syndrome. Pain. 2020;161:2619–2628. doi: 10.1097/j.pain.0000000000001961. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Vrticka P., Black J.M., Neely M., Walter Shelly E., Reiss A.L. Humor processing in children: Influence of temperament, age and IQ. Neuropsychologia. 2013;51:2799–2811. doi: 10.1016/j.neuropsychologia.2013.09.028. [DOI] [PubMed] [Google Scholar]
  • 78.Osadchuk A.V., Markel A.L., Khusainov R.A., Naumenko E.V., Beliaev D.K. Problems in the genetics of stress. IV. A genetic analysis of the level of autonomic reactivity in emotional stress in rats. Sov. Genet. 1979;15:1847–1857. [PubMed] [Google Scholar]
  • 79.Plyusnina I., Oskina I. Behavioral and adrenocortical responses to open-field test in rats selected for reduced aggressiveness toward humans. Physiol. Behav. 1997;61:381–385. doi: 10.1016/S0031-9384(96)00445-3. [DOI] [PubMed] [Google Scholar]
  • 80.Sayers E.W., Beck J., Bolton E.E., Bourexis D., Brister J.R., Canese K., Comeau D.C., Funk K., Kim S., Klimke W., et al. Database resources of the National Center for Biotechnology Information. Nucleic. Acids. Res. 2021;49:D10–D17. doi: 10.1093/nar/gkaa892. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Tian L., Chen Y., Wang D.W., Liu X.H. Validation of reference genes via qRT-PCR in multiple conditions in brandt’s voles, lasiopodomys brandtii. Animals. 2021;11:897. doi: 10.3390/ani11030897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Zamani A., Powell K.L., May A., Semple B.D. Validation of reference genes for gene expression analysis following experimental traumatic brain injury in a pediatric mouse model. Brain. Res. Bull. 2020;156:43–49. doi: 10.1016/j.brainresbull.2019.12.015. [DOI] [PubMed] [Google Scholar]
  • 83.Penning L.C., Vrieling H.E., Brinkhof B., Riemers F.M., Rothuizen J., Rutteman G.R., Hazewinkel H.A. A validation of 10 feline reference genes for gene expression measurements in snap-frozen tissues. Vet. Immunol. Immunopathol. 2007;120:212–222. doi: 10.1016/j.vetimm.2007.08.006. [DOI] [PubMed] [Google Scholar]
  • 84.Bustin S.A., Benes V., Garson J.A., Hellemans J., Huggett J., Kubista M., Mueller R., Nolan T., Pfaffl M.W., Shipley G.L., et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009;55:611–622. doi: 10.1373/clinchem.2008.112797. [DOI] [PubMed] [Google Scholar]
  • 85.Hammer O., Harper D.A.T., Ryan P.D. PAST: Paleontological statistics software package for education and data analysis. Palaeontol. Electron. 2001;4:1–9. [Google Scholar]
  • 86.Byman E., Nagga K., Gustavsson A.M., Andersson-Assarsson J., Hansson O., Sonestedt E., Wennstrom M., Netherlands Brain Bank Alpha-amylase 1A copy number variants and the association with memory performance and Alzheimer’s dementia. Alzheimers. Res. Ther. 2020;12:158. doi: 10.1186/s13195-020-00726-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Alzheimer’s Association Alzheimer’s disease facts and figures. Alzheimers. Dement. 2021;17:327–406. doi: 10.1002/alz.12328. [DOI] [PubMed] [Google Scholar]
  • 88.Wu J., Wei Y., Li T., Lin L., Yang Z., Ye L. DNA methylation-mediated lowly expressed AOX1 promotes cell migration and invasion of prostate cancer. Urol. Int. 2022;9:e522634. doi: 10.1159/000522634. [DOI] [PubMed] [Google Scholar]
  • 89.Freeland J., Crowell P.D., Giafaglione J.M., Boutros P.C., Goldstein A.S. Aging of the progenitor cells that initiate prostate cancer. Cancer Lett. 2021;515:28–35. doi: 10.1016/j.canlet.2021.05.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Turnell B.R., Kumpitsch L., Reinhardt K. Production and scavenging of reactive oxygen species both affect reproductive success in male and female Drosophila melanogaster. Biogerontology. 2021;22:379–396. doi: 10.1007/s10522-021-09922-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Wang C.Y., Shahi P., Huang J.T., Phan N.N., Sun Z., Lin Y.C., Lai M.D., Werb Z. Systematic analysis of the achaete-scute complex-like gene signature in clinical cancer patients. Mol. Clin. Oncol. 2017;6:7–18. doi: 10.3892/mco.2016.1094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92.Sarkozy C., Salles G., Falandry C. The biology of aging and lymphoma: A complex interplay. Curr. Oncol. Rep. 2015;17:32. doi: 10.1007/s11912-015-0457-x. [DOI] [PubMed] [Google Scholar]
  • 93.Hu C., Beebe K., Hernandez E.J., Lazaro-Guevara J.M., Revelo M.P., Huang Y., Maschek J.A., Cox J.E., Kohan D.E. Multiomic identification of factors associated with progression to cystic kidney disease in mice with nephron Ift88 disruption. Am. J. Physiol. Renal. Physiol. 2022;322:F175–F192. doi: 10.1152/ajprenal.00409.2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94.Lenoir O., Tharaux P.L., Huber T.B. Autophagy in kidney disease and aging: Lessons from rodent models. Kidney Int. 2016;90:950–964. doi: 10.1016/j.kint.2016.04.014. [DOI] [PubMed] [Google Scholar]
  • 95.Khan D., Katoch A., Das A., Sharathchandra A., Lal R., Roy P., Das S., Chattopadhyay S., Das S. Reversible induction of translational isoforms of p53 in glucose deprivation. Cell. Death. Differ. 2015;22:1203–1218. doi: 10.1038/cdd.2014.220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96.Dent E., Wright O.R.L., Woo J., Hoogendijk E.O. Malnutrition in older adults. Lancet. 2023 doi: 10.1016/S0140-6736(22)02612-5. [DOI] [PubMed] [Google Scholar]
  • 97.Perhal A., Wolf S., Jamous Y.F., Langer A., Abd Alla J., Quitterer U. Increased reactive oxygen species generation contributes to the atherogenic activity of the B2 bradykinin receptor. Front. Med. 2019;6:32. doi: 10.3389/fmed.2019.00032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Zha Y., Zhuang W., Yang Y., Zhou Y., Li H., Liang J. Senescence in vascular smooth muscle cells and atherosclerosis. Front. Cardiovasc. Med. 2022;9:910580. doi: 10.3389/fcvm.2022.910580. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 99.Yang Y., Wang J., Shi F., Shan A., Xu S., Lv W. BDKRB2 is a novel EMT-related biomarker and predicts poor survival in glioma. Aging. 2021;13:7499–7516. doi: 10.18632/aging.202614. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100.Kim M., Ladomersky E., Mozny A., Kocherginsky M., O’Shea K., Reinstein Z.Z., Zhai L., Bell A., Lauing K.L., Bollu L., et al. Glioblastoma as an age-related neurological disorder in adults. Neurooncol. Adv. 2021;3:125. doi: 10.1093/noajnl/vdab125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101.Shcherbina L., Edlund A., Esguerra J.L., Abels M., Zhou Y., Ottosson-Laakso E., Wollheim C.B., Hansson O., Eliasson L., Wierup N. Endogenous beta-cell CART regulates insulin secretion and transcription of beta-cell genes. Mol. Cell. Endocrinol. 2017;447:52–60. doi: 10.1016/j.mce.2017.02.027. [DOI] [PubMed] [Google Scholar]
  • 102.Aizawa T. Alteration of insulin secretion in the elderly. Nihon. Rinsho. 2006;64:34–38. [PubMed] [Google Scholar]
  • 103.Abels M., Riva M., Shcherbina L., Fischer A.T., Banke E., Degerman E., Lindqvist A., Wierup N. Overexpressed beta cell CART increases insulin secretion in mouse models of insulin resistance and diabetes. Peptides. 2022;151:170747. doi: 10.1016/j.peptides.2022.170747. [DOI] [PubMed] [Google Scholar]
  • 104.Shemtov S.J., Emani R., Bielska O., Covarrubias A.J., Verdin E., Andersen J.K., Winer D.A. The intestinal immune system and gut barrier function in obesity and ageing. FEBS J. 2022 doi: 10.1111/febs.16558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 105.Lu J., Chen A., Ma X., Shang X., Zhang Y., Guo Y., Liu M., Wang X. Generation and characterization of cytochrome P450 2J3/10 CRISPR/Cas9 knockout rat model. Drug. Metab. Dispos. 2020;48:1129–1136. doi: 10.1124/dmd.120.000114. [DOI] [PubMed] [Google Scholar]
  • 106.Evangelista E.A., Aliwarga T., Sotoodehnia N., Jensen P.N., McKnight B., Lemaitre R.N., Totah R.A., Gharib S.A. CYP2J2 modulates diverse transcriptional programs in adult human cardiomyocytes. Sci. Rep. 2020;10:5329. doi: 10.1038/s41598-020-62174-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 107.Azam T., Zhang H., Zhou F., Wang X. Recent advances on drug development and emerging therapeutic agents through targeting cellular homeostasis for ageing and cardiovascular disease. Front. Aging. 2022;3:888190. doi: 10.3389/fragi.2022.888190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 108.Huang J., Zhao Q., Li M., Duan Q., Zhao Y., Zhang H. The effects of endothelium-specific CYP2J2 overexpression on the attenuation of retinal ganglion cell apoptosis in a glaucoma rat model. FASEB J. 2019;33:11194–11209. doi: 10.1096/fj.201900756R. [DOI] [PubMed] [Google Scholar]
  • 109.Stelzer G., Rosen N., Plaschkes I., Zimmerman S., Twik M., Fishilevich S., Stein T.I., Nudel R., Lieder I., Mazor Y., et al. The GeneCards suite: From gene data mining to disease genome sequence analyses. Curr. Protoc. Bioinform. 2016;54:1.30.1–1.30.33. doi: 10.1002/cpbi.5. [DOI] [PubMed] [Google Scholar]
  • 110.Damour A., Garcia M., Seneschal J., Leveque N., Bodet C. Eczema herpeticum: Clinical and pathophysiological aspects. Clin. Rev. Allergy. Immunol. 2020;59:1–18. doi: 10.1007/s12016-019-08768-3. [DOI] [PubMed] [Google Scholar]
  • 111.Shen Z.Y., Liu W., Bao Z.X., Zhou Z.T., Wang L.Z. Oral melanotic macule and primary oral malignant melanoma: Epidemiology, location involved, and clinical implications. Oral. Surg. Oral. Med. Oral. Pathol. Oral. Radiol. Endod. 2011;112:e21–e25. doi: 10.1016/j.tripleo.2011.02.040. [DOI] [PubMed] [Google Scholar]
  • 112.Liu R., Zhang Z., Liu H., Hou P., Lang J., Wang S., Yan H., Li P., Huang Z. Human β-defensin 2 is a novel opener of Ca2+-activated potassium channels and induces vasodilation and hypotension in monkeys. Hypertension. 2013;62:415–425. doi: 10.1161/HYPERTENSIONAHA.111.01076. [DOI] [PubMed] [Google Scholar]
  • 113.Aykut B., Ochs M., Radhakrishnan P., Brill A., Hocker H., Schwarz S., Weissinger D., Kehm R., Kulu Y., Ulrich A., et al. EMX2 gene expression predicts liver metastasis and survival in colorectal cancer. BMC Cancer. 2017;17:555. doi: 10.1186/s12885-017-3556-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 114.Kim S.E., Paik H.Y., Yoon H., Lee J.E., Kim N., Sung M.K. Sex- and gender-specific disparities in colorectal cancer risk. World J. Gastroenterol. 2015;21:5167–5175. doi: 10.3748/wjg.v21.i17.5167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 115.Feng Z., Yin Y., Liu B., Zheng Y., Shi D., Zhang H., Qin J. Prognostic and immunological role of FAT family genes in non-small cell lung cancer. Cancer Control. 2022;29:10732748221076682. doi: 10.1177/10732748221076682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 116.Hong H., Wang Q., Li J., Liu H., Meng X., Zhang H. Aging, cancer and immunity. J. Cancer. 2019;10:3021–3027. doi: 10.7150/jca.30723. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 117.Willcocks L.C., Carr E.J., Niederer H.A., Rayner T.F., Williams T.N., Yang W., Scott J.A., Urban B.C., Peshu N., Vyse T.J., et al. A defunctioning polymorphism in FCGR2B is associated with protection against malaria but susceptibility to systemic lupus erythematosus. Proc. Natl. Acad. Sci. USA. 2010;107:7881–7885. doi: 10.1073/pnas.0915133107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 118.Liao S., Ning Q., Chen Y., Zhao X., Tang S. Interaction of aging and immunosenescence: New therapeutic targets of aging. Int. Immunopharmacol. 2022;113:109397. doi: 10.1016/j.intimp.2022.109397. [DOI] [PubMed] [Google Scholar]
  • 119.Wang J., Chen S., Xiao W., Li W., Wang L., Yang S., Wang W., Xu L., Liao S., Liu W., et al. CAR-T cells targeting CLL-1 as an approach to treat acute myeloid leukemia. J. Hematol. Oncol. 2018;11:7. doi: 10.1186/s13045-017-0553-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 120.Mao Y., Xu J., Xu X., Qiu J., Hu Z., Jiang F., Zhou G. Comprehensive analysis for cellular senescence-related immunogenic characteristics and immunotherapy prediction of acute myeloid leukemia. Front. Pharmacol. 2022;13:987398. doi: 10.3389/fphar.2022.987398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 121.Shandilya J., Gao Y., Nayak T.K., Roberts S.G., Medler K.F. AP1 transcription factors are required to maintain the peripheral taste system. Cell Death Dis. 2016;7:e2433. doi: 10.1038/cddis.2016.343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 122.Wei H., Zhen T., Tuo Y., Li H., Liang J., Chen S., Shi H., Han A. Clinicopathologic and molecular features of vascular tumors in a series of 118 cases. Am. J. Transl. Res. 2022;14:2939–2951. [PMC free article] [PubMed] [Google Scholar]
  • 123.Zhang W., He X., Yin H., Cao W., Lin T., Chen W., Diao W., Ding M., Hu H., Mo W., et al. Allosteric activation of the metabolic enzyme GPD1 inhibits bladder cancer growth via the lysoPC-PAFR-TRPV2 axis. J. Hematol. Oncol. 2022;15:93. doi: 10.1186/s13045-022-01312-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 124.Richters A., Aben K.K.H., Kiemeney L.A.L.M. The global burden of urinary bladder cancer: An update. World. J. Urol. 2020;38:1895–1904. doi: 10.1007/s00345-019-02984-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 125.Smith J.R., Hayman G.T., Wang S.J., Laulederkind S.J.F., Hoffman M.J., Kaldunski M.L., Tutaj M., Thota J., Nalabolu H.S., Ellanki S.L.R., et al. The Year of the Rat: The Rat Genome Database at 20: A multi-species knowledgebase and analysis platform. Nucleic Acids Res. 2020;48:D731–D742. doi: 10.1093/nar/gkz1041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 126.Fallahzadeh M.K., Borhani Haghighi A., Namazi M.R., Fallahzadeh M.H. Beta-thalassemia trait as a protective factor against Alzheimer disease. Alzheimer Dis. Assoc. Disord. 2009;23:186–187. doi: 10.1097/WAD.0b013e31819cb582. [DOI] [PubMed] [Google Scholar]
  • 127.Derakhshani A., Safarpour H., Abdoli Shadbad M., Hemmat N., Leone P., Asadzadeh Z., Pashazadeh M., Baradaran B., Racanelli V. The role of hemoglobin subunit delta in the immunopathy of multiple sclerosis: Mitochondria matters. Front. Immunol. 2021;12:709173. doi: 10.3389/fimmu.2021.709173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 128.Louapre C., Papeix C., Lubetzki C., Maillart E. Multiple sclerosis and aging. Geriatr. Psychol. Neuropsychiatr. Vieil. 2017;15:402–408. doi: 10.1684/pnv.2017.0685. [DOI] [PubMed] [Google Scholar]
  • 129.Park H.K., Cho A.R., Lee S.C., Ban J.Y. MPTP-induced model of Parkinson’s disease in heat shock protein 70.1 knockout mice. Mol. Med. Rep. 2012;5:1465–1468. doi: 10.3892/mmr.2012.839. [DOI] [PubMed] [Google Scholar]
  • 130.Tatar M., Khazaeli A.A., Curtsinger J.W. Chaperoning extended life. Nature. 1997;390:30. doi: 10.1038/36237. [DOI] [PubMed] [Google Scholar]
  • 131.Singh R., Kolvraa S., Rattan S.I. Genetics of human longevity with emphasis on the relevance of HSP70 as candidate genes. Front. Biosci. 2007;12:4504–4513. doi: 10.2741/2405. [DOI] [PubMed] [Google Scholar]
  • 132.Li Y., Wang J., Gao C., Hu Q., Mao X. Integral membrane protein 2A enhances sensitivity to chemotherapy via notch signaling pathway in cervical cancer. Bioengineered. 2021;12:10183–10193. doi: 10.1080/21655979.2021.2001218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 133.Smith A.J.B., Beavis A.L., Rositch A.F., Levinson K. Disparities in diagnosis and treatment of cervical adenocarcinoma compared with squamous cell carcinoma: An analysis of the national cancer database, 2004-2017. J. Low Genit. Tract. Dis. 2023;27:29–34. doi: 10.1097/LGT.0000000000000702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 134.Zhou C., Wang M., Yang J., Xiong H., Wang Y., Tang J. Integral membrane protein 2A inhibits cell growth in human breast cancer via enhancing autophagy induction. Cell. Commun. Signal. 2019;17:105. doi: 10.1186/s12964-019-0422-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 135.Kelm-Nelson C.A., Gammie S. Gene expression within the periaqueductal gray is linked to vocal behavior and early-onset parkinsonism in Pink1 knockout rats. BMC Genom. 2020;21:625. doi: 10.1186/s12864-020-07037-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 136.Chesnokova A.Y., Ekimova I.V., Pastukhov Y.F. Parkinson’s disease and aging. Adv. Gerontol. 2018;31:668–678. [PubMed] [Google Scholar]
  • 137.Cebrat M., Strzadala L., Kisielow P. Wnt inhibitory factor-1: A candidate for a new player in tumorigenesis of intestinal epithelial cells. Cancer Lett. 2004;20:107–113. doi: 10.1016/j.canlet.2003.10.024. [DOI] [PubMed] [Google Scholar]
  • 138.Kim M.J., Lee E.J., Kim D.S., Lee D.H., Youk E.G., Kim H.J. Composite intestinal adenoma-microcarcinoid in the colon and rectum: A case series and historical review. Diagn. Pathol. 2017;12:78. doi: 10.1186/s13000-017-0665-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 139.139. Xu Z., Gu Y., Chen J., Chen X., Song Y., Fan J., Ji X., Li Y., Zhang W., Zhang R. Epigenome-wide gene-age interaction study reveals reversed effects of MORN1 DNA methylation on survival between young and elderly oral squamous cell carcinoma patients. Front. Oncol. 2022;12:941731. doi: 10.3389/fonc.2022.941731. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 140.Ikawa H., Tonogi M., Yamane G.Y., Yamauchi T., Tanaka Y., Sato M., Matsui J., Ando N., Katakura A. Upper gastrointestinal tract cancers as double-cancers in elderly patients with oral squamous cell carcinoma. Bull. Tokyo Dent. Coll. 2012;53:9–16. doi: 10.2209/tdcpublication.53.9. [DOI] [PubMed] [Google Scholar]
  • 141.Banszerus V.L., Konig M., Landmesser U., Vetter V.M., Demuth I. Epigenetic aging in patients diagnosed with coronary artery disease: Results of the LipidCardio study. Clin. Epigenetics. 2023;15:16. doi: 10.1186/s13148-023-01434-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 142.Kocaman S.A., Cetin M., Durakoglugil M.E., Erdogan T., Canga A., Cicek Y., Dogan S., Sahin I., Satıroglu O., Bostan M. The degree of premature hair graying as an independent risk marker for coronary artery disease: A predictor of biological age rather than chronological age. Anadolu Kardiyol. Derg. 2012;12:457–463. doi: 10.5152/akd.2012.150. [DOI] [PubMed] [Google Scholar]
  • 143.Rozanski A., Takano A.P., Kato P.N., Soares A.G., Lellis-Santos C., Campos J.C., Ferreira J.C., Barreto-Chaves M.L., Moriscot A.S. M-protein is down-regulated in cardiac hypertrophy driven by thyroid hormone in rats. Mol. Endocrinol. 2013;27:2055–2065. doi: 10.1210/me.2013-1018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 144.Ashton K.J., Tupicoff A., Williams-Pritchard G., Kiessling C.J., See Hoe L.E., Headrick J.P., Peart J.N. Unique transcriptional profile of sustained ligand-activated preconditioning in pre- and post-ischemic myocardium. PLoS ONE. 2013;8:e72278. doi: 10.1371/journal.pone.0072278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 145.Villanueva P., Nudel R., Hoischen A., Fernandez M.A., Simpson N.H., Gilissen C., Reader R.H., Jara L., Echeverry M.M., Francks C., et al. Exome sequencing in an admixed isolated population indicates NFXL1 variants confer a risk for specific language impairment. PLoS Genet. 2015;11:e1004925. doi: 10.1371/journal.pgen.1004925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 146.Martinez-Nicolas I., Llorente T.E., Martinez-Sanchez F., Meilan J.J.G. Ten years of research on automatic voice and speech analysis of people with alzheimer’s disease and mild cognitive impairment: A systematic review article. Front. Psychol. 2021;12:620251. doi: 10.3389/fpsyg.2021.620251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 147.Park H.J., Kim M.K., Kim Y., Kim H.J., Bae S.K., Bae M.K. Neuromedin B modulates phosphate-induced vascular calcification. BMB Rep. 2021;54:569–574. doi: 10.5483/BMBRep.2021.54.11.089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 148.Wu Y.Y., Shan S.K., Lin X., Xu F., Zhong J.Y., Wu F., Duan J.Y., Guo B., Li F.X., Wang Y., et al. Cellular crosstalk in the vascular wall microenvironment: The role of exosomes in vascular calcification. Front. Cardiovasc. Med. 2022;9:912358. doi: 10.3389/fcvm.2022.912358. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 149.Sokolov D., Sechrest E.R., Wang Y., Nevin C., Du J., Kolandaivelu S. Nuclear NAD+-biosynthetic enzyme NMNAT1 facilitates development and early survival of retinal neurons. Elife. 2021;10:e71185. doi: 10.7554/eLife.71185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 150.Fleckenstein M., Keenan T.D.L., Guymer R.H., Chakravarthy U., Schmitz-Valckenberg S., Klaver C.C., Wong W.T., Chew E.Y. Age-related macular degeneration. Nat. Rev. Dis. Primers. 2021;7:31. doi: 10.1038/s41572-021-00265-2. [DOI] [PubMed] [Google Scholar]
  • 151.Zhang Y., Guo X., Peng Z., Liu C., Ren L., Liang J., Wang P. Nicotinamide mononucleotide adenylyltransferase 1 regulates cerebral ischemia-induced blood-brain barrier disruption through NAD+/SIRT1 signaling pathway. Mol. Neurobiol. 2022;59:4879–4891. doi: 10.1007/s12035-022-02903-6. [DOI] [PubMed] [Google Scholar]
  • 152.Gallego I., Villate-Beitia I., Saenz-Del-Burgo L., Puras G., Pedraz J.L. Therapeutic opportunities and delivery strategies for brain revascularization in stroke, neurodegeneration, and aging. Pharmacol Rev. 2022;74:439–461. doi: 10.1124/pharmrev.121.000418. [DOI] [PubMed] [Google Scholar]
  • 153.Friedrich B., Euler P., Ziegler R., Kuhn A., Landwehrmeyer B.G., Luthi-Carter R., Weiller C., Hellwig S., Zucker B. Comparative analyses of Purkinje cell gene expression profiles reveal shared molecular abnormalities in models of different polyglutamine diseases. Brain Res. 2012;1481:37–48. doi: 10.1016/j.brainres.2012.08.005. [DOI] [PubMed] [Google Scholar]
  • 154.Pradhan S., Gao R., Bush K., Zhang N., Wairkar Y.P., Sarkar P.S. Polyglutamine expansion in huntingtin and mechanism of DNA damage repair defects in Huntington’s disease. Front. Cell. Neurosci. 2022;16:837576. doi: 10.3389/fncel.2022.837576. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 155.Goswami J., Martin L.A., Goldowitz D., Beitz A.J., Feddersen R.M. Enhanced Purkinje cell survival but compromised cerebellar function in targeted anti-apoptotic protein transgenic mice. Mol. Cell. Neurosci. 2005;29:202–221. doi: 10.1016/j.mcn.2005.02.010. [DOI] [PubMed] [Google Scholar]
  • 156.Chen T.Y., Yang C.Y., Yang M.T., Kuo T.F., Chang C.L., Chen C.L., Lee T.H., Yang G., Yang W.C., Chiu C.F., et al. Protein disulfide isomerase a4 promotes lung cancer development via the Stat3 pathway in stromal cells. Clin. Transl. Med. 2022;12:e606. doi: 10.1002/ctm2.606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 157.Li H., Liu Q., Xiao K., He Z., Wu C., Sun J., Chen X., Chen S., Yang J., Ma Q., et al. PDIA4 correlates with poor prognosis and is a potential biomarker in glioma. Oncol. Targets Ther. 2021;14:125–138. doi: 10.2147/OTT.S287931. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 158.Menard C., Tse Y.C., Cavanagh C., Chabot J.G., Herzog H., Schwarzer C., Wong T.P., Quirion R. Knockdown of prodynorphin gene prevents cognitive decline, reduces anxiety, and rescues loss of group 1 metabotropic glutamate receptor function in aging. J. Neurosci. 2013;33:12792–12804. doi: 10.1523/JNEUROSCI.0290-13.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 159.Miki Y., Kidoguchi Y., Sato M., Taketomi Y., Taya C., Muramatsu K., Gelb M.H., Yamamoto K., Murakami M. Dual roles of group iid phospholipase A2 in inflammation and cancer. J. Biol. Chem. 2016;291:15588–155601. doi: 10.1074/jbc.M116.734624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 160.Ter Haar E.L.M., Thomas S.E., van den Reek J.M.P.A., Otero M.E., Njoo M.D., Ossenkoppele P.M., Kop E.N., Dodemont S.R.P., Korver J.E.M., Kuijpers A.L.A., et al. Drug survival, safety, and effectiveness of biologics in older patients with psoriasis: A comparison with younger patients-a BioCAPTURE registry study. Drugs Aging. 2022;39:715–727. doi: 10.1007/s40266-022-00961-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 161.Tan J., Xu Y., Han F., Ye X. Genetical modification on adipose-derived stem cells facilitates facial nerve regeneration. Aging. 2019;11:908–920. doi: 10.18632/aging.101790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 162.Zhang Q., Li J., Weng L. Identification and validation of aging-related genes in Alzheimer’s disease. Front. Neurosci. 2022;16:905722. doi: 10.3389/fnins.2022.905722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 163.Cheng C.W., Chang L.C., Tseng T.L., Wu C.C., Lin Y.F., Chen J.S. Phosphotriesterase-related protein sensed albuminuria and conferred renal tubular cell activation in membranous nephropathy. J. Biomed. Sci. 2014;21:32. doi: 10.1186/1423-0127-21-32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 164.Deegens J.K., Wetzels J.F. Membranous nephropathy in the older adult: Epidemiology, diagnosis and management. Drugs Aging. 2007;24:717–732. doi: 10.2165/00002512-200724090-00002. [DOI] [PubMed] [Google Scholar]
  • 165.Wu S., Zhao Z., Liu S., Li M., Wang T., Wang S., Xu M., Chen Y., Dai M., Zhang D., et al. The association between age at diagnosis of type 2 diabetes and albuminuria in Chinese adults: A nationwide population study. J. Diabetes. 2021;13:987–997. doi: 10.1111/1753-0407.13213. [DOI] [PubMed] [Google Scholar]
  • 166.Liu Q., Li J., Zhang W., Xiao C., Zhang S., Nian C., Li J., Su D., Chen L., Zhao Q., et al. Glycogen accumulation and phase separation drives liver tumor initiation. Cell. 2021;184:5559–5576.e19. doi: 10.1016/j.cell.2021.10.001. [DOI] [PubMed] [Google Scholar]
  • 167.Gusarov I., Nudler E. Glycogen at the crossroad of stress resistance, energy maintenance, and pathophysiology of aging. Bioessays. 2018;40:e1800033. doi: 10.1002/bies.201800033. [DOI] [PubMed] [Google Scholar]
  • 168.Zhao C.Y., Hua C.H., Li C.H., Zheng R.Z., Li X.Y. High PYGL expression predicts poor prognosis in human gliomas. Front. Neurol. 2021;12:652931. doi: 10.3389/fneur.2021.652931. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 169.Hafez A.M., Seleem M.M., Alattar A.Z., Elshorbagy S., Elsayed W.S.H. RNA-binding proteins RBM-HuR, RBM3 and PODXL expression in urothelial carcinoma of the urinary bladder. prognostic and clinical implications. Contemp. Oncol. 2021;25:279–290. doi: 10.5114/wo.2021.112371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 170.Hamade A., Li D., Tyryshkin K., Xu M., Conseil G., Yolmo P., Hamilton J., Chenard S., Robert Siemens D., Koti M. Sex differences in the aging murine urinary bladder and influence on the tumor immune microenvironment of a carcinogen-induced model of bladder cancer. Biol. Sex Differ. 2022;13:19. doi: 10.1186/s13293-022-00428-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 171.Schupp M., Lefterova M.I., Janke J., Leitner K., Cristancho A.G., Mullican S.E., Qatanani M., Szwergold N., Steger D.J., Curtin J.C., et al. Retinol saturase promotes adipogenesis and is downregulated in obesity. Proc. Natl. Acad. Sci. USA. 2009;106:1105–1110. doi: 10.1073/pnas.0812065106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 172.Santos A.L., Sinha S. Obesity and aging: Molecular mechanisms and therapeutic approaches. Ageing Res. Rev. 2021;67:101268. doi: 10.1016/j.arr.2021.101268. [DOI] [PubMed] [Google Scholar]
  • 173.Jiang X., He Y., Shen Q., Duan L., Yuan Y., Tang L., Shi Y., Liu B., Zhai H., Shi P., et al. RETSAT mutation selected for hypoxia adaptation inhibits tumor growth. Front. Cell Dev. Biol. 2021;9:744992. doi: 10.3389/fcell.2021.744992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 174.Kim K., Kim Y.J. RhoBTB3 regulates proliferation and invasion of breast cancer cells via Col1a1. Mol. Cells. 2022;45:631–639. doi: 10.14348/molcells.2022.2037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 175.Yang S.H., Liu W., Peng J., Xu Y.J., Liu Y.F., Li Y., Peng M.Y., Ou-Yang Z., Chen C., Liu E.Y. High expression of RhoBTB3 predicts favorable chemothrapy outcomes in non-M3 acute myeloid leukemia. J. Cancer. 2021;12:4229–4239. doi: 10.7150/jca.50472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 176.Zjablovskaja P., Florian M.C. Acute myeloid leukemia: Aging and epigenetics. Cancers. 2019;12:103. doi: 10.3390/cancers12010103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 177.Samuel C.S., Unemori E.N., Mookerjee I., Bathgate R.A., Layfield S.L., Mak J., Tregear G.W., Du X.J. Relaxin modulates cardiac fibroblast proliferation, differentiation, and collagen production and reverses cardiac fibrosis in vivo. Endocrinology. 2004;145:4125–4133. doi: 10.1210/en.2004-0209. [DOI] [PubMed] [Google Scholar]
  • 178.Leysen H., Walter D., Clauwaert L., Hellemans L., van Gastel J., Vasudevan L., Martin B., Maudsley S. The relaxin-3 receptor, RXFP3, is a modulator of aging-related disease. Int. J. Mol. Sci. 2022;23:4387. doi: 10.3390/ijms23084387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 179.Chou C.K., Fan C.C., Lin P.S., Liao P.Y., Tung J.C., Hsieh C.H., Hung M.C., Chen C.H., Chang W.C. Sciellin mediates mesenchymal-to-epithelial transition in colorectal cancer hepatic metastasis. Oncotarget. 2016;7:25742–25754. doi: 10.18632/oncotarget.8264. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 180.Yamadera M., Shinto E., Nagata K., Shiraishi T., Kajiwara Y., Mochizuki S., Okamoto K., Kishi Y., Ueno H. Proposal for a tumor budding predictive score derived from endoscopic biopsy samples in colorectal cancer. Int. J. Clin. Oncol. 2022;27:756–764. doi: 10.1007/s10147-021-02104-6. [DOI] [PubMed] [Google Scholar]
  • 181.Dekker E., Tanis P.J., Vleugels J.L.A., Kasi P.M., Wallace M.B. Colorectal cancer. Lancet. 2019;394:1467–1480. doi: 10.1016/S0140-6736(19)32319-0. [DOI] [PubMed] [Google Scholar]
  • 182.Yang J.Y., Deng X.Y., Li Y.S., Ma X.C., Feng J.X., Yu B., Chen Y., Luo Y.L., Wang X., Chen M.L., et al. Structure of Schlafen13 reveals a new class of tRNA/rRNA- targeting RNase engaged in translational control. Nat. Commun. 2018;9:1165. doi: 10.1038/s41467-018-03544-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 183.Crouch J., Shvedova M., Thanapaul R.J.R.S., Botchkarev V., Roh D. Epigenetic regulation of cellular senescence. Cells. 2022;11:672. doi: 10.3390/cells11040672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 184.Wang Q., Zhou D., Wu F., Liang Q., He Q., Peng M., Yao T., Hu Y., Qian B., Tang J., et al. Immune microenvironment signatures as biomarkers to predict early recurrence of stage ia-b lung cancer. Front. Oncol. 2021;11:680287. doi: 10.3389/fonc.2021.680287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 185.Schneider J.L., Rowe J.H., Garcia-de-Alba C., Kim C.F., Sharpe A.H., Haigis M.C. The aging lung: Physiology, disease, and immunity. Cell. 2021;184:1990–2019. doi: 10.1016/j.cell.2021.03.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 186.Borowicz S., Principe D.R., Dorman M.J., McHenry A.J., Sondarva G., Kumar S., Ananthanarayanan V., Simms P.E., Hess A., Rana A. HAI-1 is an independent predictor of lung cancer mortality and is required for M1 macrophage polarization. PLoS ONE. 2021;16:e0252197. doi: 10.1371/journal.pone.0252197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 187.Wu Q., Yin G., Luo J., Zhang Y., Ai T., Tian J., Jin Y., Lei J., Liu S. Comprehensive analysis of the expression and prognostic value of SPINT1/2 in breast carcinoma. Front. Endocrinol. 2021;12:665666. doi: 10.3389/fendo.2021.665666. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 188.Marongiu F., DeGregori J. The sculpting of somatic mutational landscapes by evolutionary forces and their impacts on aging-related disease. Mol. Oncol. 2022;16:3238–3258. doi: 10.1002/1878-0261.13275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 189.Wei B., Lu Y., Jin J.P. Deficiency of slow skeletal muscle troponin T causes atrophy of type I slow fibres and decreases tolerance to fatigue. J. Physiol. 2014;592:1367–1380. doi: 10.1113/jphysiol.2013.268177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 190.Angioni D., Virecoulon Giudici K., Montoya Martinez M., Rolland Y., Vellas B., de Souto Barreto P. Neuroimaging markers of chronic fatigue in older people: A narrative review. Aging Clin. Exp. Res. 2021;33:1487–1492. doi: 10.1007/s40520-020-01666-1. [DOI] [PubMed] [Google Scholar]
  • 191.Fei X., Kong L., Shi C., Wang G., Liu C., Wang C., Liu P., Tan X. Identification of prognosis-related molecular subgroups and construction of a prognostic prediction model using immune-related genes in pancreatic cancer. J. Oncol. 2022;2022:7117014. doi: 10.1155/2022/7117014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 192.Yin M.Y., Xi L.T., Liu L., Zhu J.Z., Qian L.J., Xu C.F. Pancreatic cancer incidence and mortality patterns in 2006–2015 and prediction of the epidemiological trend to 2025 in China. World J. Clin. Cases. 2022;10:4404–4413. doi: 10.12998/wjcc.v10.i14.4404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 193.Saul D., Geisberg L.K., Gehle T., Hoffmann D.B., Tezval M., Sehmisch S., Komrakova M. Changes in musculoskeletal system and metabolism in osteoporotic rats treated with urocortin. Front. Endocrinol. 2019;10:400. doi: 10.3389/fendo.2019.00400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 194.Latchman D.S. Urocortin. Int. J. Biochem. Cell Biol. 2002;34:907–910. doi: 10.1016/S1357-2725(02)00011-0. [DOI] [PubMed] [Google Scholar]
  • 195.Laurence H., Kumar S., Owston M.A., Lanford R.E., Hubbard G.B., Dick E.J., Jr. Natural mortality and cause of death analysis of the captive chimpanzee (Pan troglodytes): A 35-year review. J. Med. Primatol. 2017;46:106–115. doi: 10.1111/jmp.12267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 196.Che J., Jin Z., Yan F., You J., Xie J., Chen B., Cheng G., Zhu H., He Q., Hu Y., et al. Discovery of 5,6-Bis(4-methoxy-3-methylphenyl)pyridin-2-amine as a WSB1 degrader to inhibit cancer cell metastasis. J. Med. Chem. 2021;64:8621–8643. doi: 10.1021/acs.jmedchem.1c00586. [DOI] [PubMed] [Google Scholar]
  • 197.Fane M., Weeraratna A.T. Normal aging and its role in cancer metastasis. Cold Spring Harb. Perspect. Med. 2020;10:a037341. doi: 10.1101/cshperspect.a037341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 198.Kim J.J., Lee S.B., Yi S.Y., Han S.A., Kim S.H., Lee J.M., Tong S.Y., Yin P., Gao B., Zhang J., et al. WSB1 overcomes oncogene-induced senescence by targeting ATM for degradation. Cell Res. 2017;27:274–293. doi: 10.1038/cr.2016.148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 199.Wang J., Li Z., Xu L., Yang H., Liu W. Transmembrane domain dependent inhibitory function of FcγRIIB. Protein Cell. 2018;9:1004–1012. doi: 10.1007/s13238-018-0509-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 200.Morand S., McIntyre K.M., Baylis M. Domesticated animals and human infectious diseases of zoonotic origins: Domestication time matters. Infect. Genet. Evol. 2014;24:76–81. doi: 10.1016/j.meegid.2014.02.013. [DOI] [PubMed] [Google Scholar]
  • 201.Zhang X., Jamwal K., Distl O. Tracking footprints of artificial and natural selection signatures in breeding and non-breeding cats. Sci. Rep. 2022;12:18061. doi: 10.1038/s41598-022-22155-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 202.Theofanopoulou C., Gastaldon S., O’Rourke T., Samuels B.D., Martins P.T., Delogu F., Alamri S., Boeckx C. Self-domestication in Homo sapiens: Insights from comparative genomics. PLoS ONE. 2017;12:e0185306. doi: 10.1371/journal.pone.0185306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 203.Del Savio L., Mameli M. Human domestication and the roles of human agency in human evolution. Hist. Philos. Life Sci. 2020;42:21. doi: 10.1007/s40656-020-00315-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 204.Chadaeva I., Ponomarenko P., Kozhemyakina R., Suslov V., Bogomolov A., Klimova N., Shikhevich S., Savinkova L., Oshchepkov D., Kolchanov N.A., et al. Domestication explains two-thirds of differential-gene-expression variance between domestic and wild animals; the remaining one-third reflects intraspecific and interspecific variation. Animals. 2021;11:2667. doi: 10.3390/ani11092667. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 205.Albert F.W., Somel M., Carneiro M., Aximu-Petri A., Halbwax M., Thalmann O., Blanco-Aguiar J.A., Plyusnina I.Z., Trut L., Villafuerte R., et al. A comparison of brain gene expression levels in domesticated and wild animals. PLoS Genet. 2012;8:e1002962. doi: 10.1371/journal.pgen.1002962. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 206.Sato D.X., Rafati N., Ring H., Younis S., Feng C., Blanco-Aguiar J.A., Rubin C.J., Villafuerte R., Hallbook F., Carneiro M., et al. Brain transcriptomics of wild and domestic rabbits suggests that changes in dopamine signaling and ciliary function contributed to evolution of tameness. Genome Biol. Evol. 2020;12:1918–1928. doi: 10.1093/gbe/evaa158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 207.Yang X., Zhang H., Shang J., Liu G., Xia T., Zhao C., Sun G., Dou H. Comparative analysis of the blood transcriptomes between wolves and dogs. Anim. Genet. 2018;49:291–302. doi: 10.1111/age.12675. [DOI] [PubMed] [Google Scholar]
  • 208.Hekman J.P., Johnson J.L., Edwards W., Vladimirova A.V., Gulevich R.G., Ford A.L., Kharlamova A.V., Herbeck Y., Acland G.M., Raetzman L.T., et al. Anterior pituitary transcriptome suggests differences in ACTH release in tame and aggressive foxes. Genes Genomes Genet. 2018;8:859–873. doi: 10.1534/g3.117.300508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 209.Long K., Mao K., Che T., Zhang J., Qiu W., Wang Y., Tang Q., Ma J., Li M., Li X. Transcriptome differences in frontal cortex between wild boar and domesticated pig. Anim. Sci. J. 2018;89:848–857. doi: 10.1111/asj.12999. [DOI] [PubMed] [Google Scholar]
  • 210.Yang Y., Adeola A.C., Xie H.B., Zhang Y.P. Genomic and transcriptomic analyses reveal selection of genes for puberty in Bama Xiang pigs. Zool. Res. 2018;39:424–430. doi: 10.24272/j.issn.2095-8137.2018.068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 211.Fallahshahroudi A., Lotvedt P., Belteky J., Altimiras J., Jensen P. Changes in pituitary gene expression may underlie multiple domesticated traits in chickens. Hered. Edinb. 2019;122:195–204. doi: 10.1038/s41437-018-0092-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 212.Samet H. A top-down quadtree traversal algorithm. IEEE. Trans. Pattern. Anal. Mach. Intell. 1985;7:94–98. doi: 10.1109/TPAMI.1985.4767622. [DOI] [PubMed] [Google Scholar]
  • 213.Sun G.-L., Shen W., Wen J.-F. Triosephosphate Isomerase Genes in Two Trophic Modes of Euglenoids (Euglenophyceae) and Their Phylogenetic Analysis. J. Eukaryot. Microbiol. 2008;55:170–177. doi: 10.1111/j.1550-7408.2008.00324.x. [DOI] [PubMed] [Google Scholar]
  • 214.Morozova O.V., Alekseeva A.E., Sashina T.A., Brusnigina N.F., Epifanova N.V., Kashnikov A.U., Zverev V.V., Novikova N.A. Phylodynamics of G4P [8] and G2P[4] strains of rotavirus A isolated in Russia in 2017 based on full-genome analyses. Virus Genes. 2020;56:537–545. doi: 10.1007/s11262-020-01771-3. [DOI] [PubMed] [Google Scholar]
  • 215.Hakizimana J.N., Yona C., Kamana O., Nauwynck H., Misinzo G. African Swine Fever Virus Circulation between Tanzania and Neighboring Countries: A Systematic Review and Meta-Analysis. Viruses. 2021;13:306. doi: 10.3390/v13020306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 216.Zhang Y., Katoh T.K., Finet C., Izumitani H.F., Toda M.J., Watabe H.-A., Katoh T. Phylogeny and evolution of mycophagy in the Zygothrica genus group (Diptera: Drosophilidae) Mol. Phylogenetics Evol. 2021;163:107257. doi: 10.1016/j.ympev.2021.107257. [DOI] [PubMed] [Google Scholar]
  • 217.Clarke L.E., Liddelow S.A., Chakraborty C., Munch A.E., Heiman M., Barres B.A. Normal aging induces A1-like astrocyte reactivity. Proc. Natl. Acad. Sci. USA. 2018;115:E1896–E1905. doi: 10.1073/pnas.1800165115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 218.Day I.N. dbSNP in the detail and copy number complexities. Hum. Mutat. 2010;31:2–4. doi: 10.1002/humu.21149. [DOI] [PubMed] [Google Scholar]
  • 219.Ponomarenko M., Rasskazov D., Arkova O., Ponomarenko P., Suslov V., Savinkova L., Kolchanov N. How to use SNP_TATA_Comparator to find a significant change in gene expression caused by the regulatory SNP of this gene’s promoter via a change in affinity of the TATA-binding protein for this promoter. Biomed. Res. Int. 2015;2015:359835. doi: 10.1155/2015/359835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 220.Rasskazov D., Chadaeva I., Sharypova E., Zolotareva K., Khandaev B., Ponomarenko P., Podkolodnyy N., Tverdokhleb N., Vishnevsky O., Bogomolov A., et al. Plant_SNP_TATA_Z-Tester: A Web Service that unequivocally estimates the impact of proximal promoter mutations on plant gene expression. Int. J. Mol. Sci. 2022;23:8684. doi: 10.3390/ijms23158684. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 221.Korkuc P., Schippers J.H., Walther D. Characterization and identification of cis-regulatory elements in Arabidopsis based on single-nucleotide polymorphism information. Plant Physiol. 2014;164:181–200. doi: 10.1104/pp.113.229716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 222.Klimova N.V., Oshchepkova E., Chadaeva I., Sharypova E., Ponomarenko P., Drachkova I., Rasskazov D., Oshchepkov D., Ponomarenko M., Savinkova L., et al. Disruptive selection of human immunostimulatory and immunosuppressive genes both provokes and prevents rheumatoid arthritis, respectively, as a self-domestication syndrome. Front. Genet. 2021;12:610774. doi: 10.3389/fgene.2021.610774. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 223.Vasiliev G., Chadaeva I., Rasskazov D., Ponomarenko P., Sharypova E., Drachkova I., Bogomolov A., Savinkova L., Ponomarenko M., Kolchanov N., et al. A bioinformatics model of human diseases on the basis of differentially expressed genes (of domestic versus wild animals) that are orthologs of human genes associated with reproductive-potential changes. Int. J. Mol. Sci. 2021;22:2346. doi: 10.3390/ijms22052346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 224.Ponomarenko M.P., Chadaeva I.V., Ponomarenko P.M., Bogomolov A.G., Oshchepkov D.Y., Sharypova E.B., Suslov V.V., Osadchuk A.V., Osadchuk L.V., Matushkin Y.G. A bioinformatic search for correspondence between differentially expressed genes of domestic versus wild animals and orthologous human genes altering reproductive potential. Vavilovskii Zhurnal Genet. Selektsii. 2022;26:96–108. doi: 10.18699/VJGB-22-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 225.Barrett T., Wilhite S.E., Ledoux P., Evangelista C., Kim I.F., Tomashevsky M., Marshall K.A., Phillippy K.H., Sherman P.M., Holko M., et al. NCBI GEO: Archive for functional genomics data sets-update. Nucleic Acids Res. 2013;41:D991–D995. doi: 10.1093/nar/gks1193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 226.Ye Q., Huang Z., Lu W., Yan F., Zeng W., Xie J., Zhong W. Identification of the common differentially expressed genes and pathogenesis between neuropathic pain and aging. Front. Neurosci. 2022;16:994575. doi: 10.3389/fnins.2022.994575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 227.Ivanisenko V.A., Demenkov P.S., Ivanisenko T.V., Mishchenko E.L., Saik O.V. A new version of the ANDSystem tool for automatic extraction of knowledge from scientific publications with expanded functionality for reconstruction of associative gene networks by considering tissue-specific gene expression. BMC Bioinformatics. 2019;20:34. doi: 10.1186/s12859-018-2567-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 228.Rappaport N., Twik M., Plaschkes I., Nudel R., Iny Stein T., Levitt J., Gershoni M., Morrey C.P., Safran M., Lancet D. MalaCards: An amalgamated human disease compendium with diverse clinical and genetic annotation and structured search. Nucleic Acids Res. 2017;45:D877–D887. doi: 10.1093/nar/gkw1012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 229.Mustafin Z.S., Lashin S.A., Matushkin Y.G., Gunbin K.V., Afonnikov D.A. Orthoscape: A cytoscape application for grouping and visualization KEGG based gene networks by taxonomy and homology principles. BMC Bioinformatics. 2017;18:1427. doi: 10.1186/s12859-016-1427-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 230.Mustafin Z.S., Zamyatin V.I., Konstantinov D.K., Doroshkov A.V., Lashin S.A., Afonnikov D.A. Phylostratigraphic analysis shows the earliest origination of the abiotic stress associated genes in A. thaliana. Genes. 2019;10:963. doi: 10.3390/genes10120963. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 231.Shannon P., Markiel A., Ozier O., Baliga N.S., Wang J.T., Ramage D., Amin N., Schwikowski B., Ideker T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003;13:2498–2504. doi: 10.1101/gr.1239303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 232.Altschul S.F., Gish W., Miller W., Myers E.W., Lipman D.J. Basic local alignment search tool. J. Mol. Biol. 1990;215:403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
  • 233.Guilliams M., Bruhns P., Saeys Y., Hammad H., Lambrecht B.N. The function of Fcγ receptors in dendritic cells and macrophages. Nat. Rev. Immunol. 2014;14:94–108. doi: 10.1038/nri3582. [DOI] [PubMed] [Google Scholar]
  • 234.Okabe Y., Medzhitov R. Tissue biology perspective on macrophages. Nat. Immunol. 2016;17:9–17. doi: 10.1038/ni.3320. [DOI] [PubMed] [Google Scholar]
  • 235.Safran M., Rosen N., Twik M., BarShir R., Iny Stein T., Dahary D., Fishilevich S., Lancet D. The GeneCards Suite. In: Abugessaisa I., Kasukawa T., editors. Practical Guide to Life Science Databases. Springer; Singapore: 2022. pp. 27–56. [DOI] [Google Scholar]
  • 236.Zhang L., Pitcher L.E., Yousefzadeh M.J., Niedernhofer L.J., Robbins P.D., Zhu Y. Cellular senescence: A key therapeutic target in aging and diseases. J. Clin. Investig. 2022;132:e158450. doi: 10.1172/JCI158450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 237.Bleve A., Motta F., Durante B., Pandolfo C., Selmi C., Sica A. Immunosenescence, inflammaging, and frailty: Role of myeloid cells in age-related diseases. Clin. Rev. Allergy Immunol. 2022;22:e8909–e9107. doi: 10.1007/s12016-021-08909-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 238.Naumenko E., Popova N., Nikulina E., Dygalo N., Shishkina G., Borodin P., Markel A. Behavior, adrenocortical activity, and brain monoamines in Norway rats selected for reduced aggressiveness towards man. Pharmacol. Biochem. Behav. 1989;33:85–91. doi: 10.1016/0091-3057(89)90434-6. [DOI] [PubMed] [Google Scholar]
  • 239.Paxinos G., Watson C.R. The Rat Brain in Stereotaxic Coordinates. 7th ed. Academic Press; London, UK: 2013. p. 472. [Google Scholar]
  • 240.Bolger A.M., Lohse M., Usadel B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30:2114–2120. doi: 10.1093/bioinformatics/btu170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 241.Kim D., Pertea G., Trapnell C., Pimentel H., Kelley R., Salzberg S.L. TopHat2: Accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genom. Biol. 2013;14:36. doi: 10.1186/gb-2013-14-4-r36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 242.Li H., Handsaker B., Wysoker A., Fennell T., Ruan J., Homer N., Marth G., Abecasis G., Durbin R. The Sequence alignment/map (SAM) format and SAMtools. Bioinform. 2009;25:2078–2079. doi: 10.1093/bioinformatics/btp352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 243.Anders S., Pyl P.T., Huber W. HTSeq—A Python framework to work with high-throughput sequencing data. Bioinformatics. 2015;31:166–169. doi: 10.1093/bioinformatics/btu638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 244.Love M.I., Huber W., Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:550. doi: 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 245.Anders S., Huber W. Differential expression analysis for sequence count data. Genom. Biol. 2010;11:106. doi: 10.1186/gb-2010-11-10-r106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 246.Ye J., Coulouris G., Zaretskaya I., Cutcutache I., Rozen S., Madden T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012;13:134. doi: 10.1186/1471-2105-13-134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 247.Zerbino D., Wilder S., Johnson N., Juettemann T., Flicek P. The Ensembl regulatory build. Genom. Biol. 2015;16:56. doi: 10.1186/s13059-015-0621-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 248.Haeussler M., Raney B., Hinrichs A., Clawson H., Zweig A., Karolchik D., Casper J., Speir M., Haussler D., Kent W. Navigating protected genomics data with UCSC Genome Browser in a box. Bioinformatics. 2015;31:764–766. doi: 10.1093/bioinformatics/btu712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 249.Stajich J.E., Block D., Boulez K., Brenner S.E., Chervitz S.A., Dagdigian C., Fuellen G., Gilbert J.G., Korf I., Lapp H., et al. The Bioperl toolkit: Perl modules for the life sciences. Genom. Res. 2002;12:1611–1618. doi: 10.1101/gr.361602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 250.Hahn S., Buratowski S., Sharp P., Guarente L. Yeast TATA-binding protein TFIID binds to TATA elements with both consensus and nonconsensus DNA sequences. Proc. Natl. Acad. Sci. USA. 1989;86:5718–5722. doi: 10.1073/pnas.86.15.5718. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 251.Ponomarenko P., Savinkova L., Drachkova I., Lysova M., Arshinova T., Ponomarenko M., Kolchanov N. A step-by-step model of TBP/TATA box binding allows predicting human hereditary diseases by single nucleotide polymorphism. Dokl. Biochem. Biophys. 2008;419:88–92. doi: 10.1134/S1607672908020117. [DOI] [PubMed] [Google Scholar]
  • 252.Bucher P. Weight matrix descriptions of four eukaryotic RNA polymerase II promoter elements derived from 502 unrelated promoter sequences. J. Mol. Biol. 1990;212:563–578. doi: 10.1016/0022-2836(90)90223-9. [DOI] [PubMed] [Google Scholar]
  • 253.Karas H., Knuppel R., Schulz W., Sklenar H., Wingender E. Combining structural analysis of DNA with search routines for the detection of transcription regulatory elements. Comput. Appli. Biosci. 1996;12:441–446. doi: 10.1093/bioinformatics/12.5.441. [DOI] [PubMed] [Google Scholar]
  • 254.Ponomarenko M., Ponomarenko J., Frolov A., Podkolodny N., Savinkova L., Kolchanov N., Overton G. Identification of sequence-dependent features correlating to activity of DNA sites interacting with proteins. Bioinformatics. 1999;15:687–703. doi: 10.1093/bioinformatics/15.7.687. [DOI] [PubMed] [Google Scholar]
  • 255.Waardenberg A., Basset S., Bouveret R., Harvey R. CompGO: An R package for comparing and visualizing Gene Ontology enrichment differences between DNA binding experiments. BMC Bioinform. 2015;16:275. doi: 10.1186/s12859-015-0701-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 256.Varzari A., Tudor E., Bodrug N., Corloteanu A., Axentii E., Deyneko I.V. Age-specific association of CCL5 gene polymorphism with pulmonary tuberculosis: A case-control study. Genet. Test. Mol. Biomarkers. 2018;22:281–287. doi: 10.1089/gtmb.2017.0250. [DOI] [PubMed] [Google Scholar]
  • 257.Coleman R.A., Pugh B.F. Evidence for functional binding and stable sliding of the TATA binding protein on nonspecific DNA. J. Biol. Chem. 1995;270:13850–13859. doi: 10.1074/jbc.270.23.13850. [DOI] [PubMed] [Google Scholar]
  • 258.Berg O.G., von Hippel P.H. Selection of DNA binding sites by regulatory proteins. Statistical-mechanical theory and application to operators and promoters. J. Mol. Biol. 1987;193:723–750. doi: 10.1016/0022-2836(87)90354-8. [DOI] [PubMed] [Google Scholar]
  • 259.Flatters D., Lavery R. Sequence-dependent dynamics of TATA-box binding sites. Biophys. J. 1998;75:372–381. doi: 10.1016/S0006-3495(98)77521-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 260.Kim J.L., Nikolov D.B., Burley S.K. Co-crystal structure of TBP recognizing the minor groove of a TATA element. Nature. 1993;365:520–527. doi: 10.1038/365520a0. [DOI] [PubMed] [Google Scholar]
  • 261.Kim Y., Geiger J.H., Hahn S., Sigler P.B. Crystal structure of a yeast TBP/TATA-box complex. Nature. 1993;365:512–520. doi: 10.1038/365512a0. [DOI] [PubMed] [Google Scholar]
  • 262.Delgadillo R.F., Whittington J.E., Parkhurst L.K., Parkhurst L.J. The TATA-binding protein core domain in solution variably bends TATA sequences via a three-step binding mechanism. Biochemistry. 2009;48:1801–1809. doi: 10.1021/bi8018724. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

The primary RNA-Seq data obtained in this work were deposited in the NCBI SRA database (ID = PRJNA668014).


Articles from International Journal of Molecular Sciences are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES