Skip to main content
Veterinary World logoLink to Veterinary World
. 2023 Jan 3;16(1):1–11. doi: 10.14202/vetworld.2023.1-11

Distribution pattern of antibiotic resistance genes in Escherichia coli isolated from colibacillosis cases in broiler farms of Egypt

Mona A A Abdel-Rahman 1,✉, Engy A Hamed 1, May F Abdelaty 1, Hend K Sorour 1, Heba Badr 1, Wafaa M Hassan 1, Azhar G Shalaby 1, Ahmed Abd-Elhalem Mohamed 1, Mohamed A Soliman 1, Heba Roshdy 1
PMCID: PMC9967716  PMID: 36855348

Abstract

Background and Aim:

Multidrug resistance (MDR) of Escherichia coli has become an increasing concern in poultry farming worldwide. However, E. coli can accumulate resistance genes through gene transfer. The most problematic resistance mechanism in E. coli is the acquisition of genes encoding broad-spectrum β-lactamases, known as extended-spectrum β-lactamases, that confer resistance to broad-spectrum cephalosporins. Plasmid-mediated quinolone resistance genes (conferring resistance to quinolones) and mcr-1 genes (conferring resistance to colistin) also contribute to antimicrobial resistance. This study aimed to investigate the prevalence of antimicrobial susceptibility and to detect β-lactamase and colistin resistance genes of E. coli isolated from broiler farms in Egypt.

Materials and Methods:

Samples from 938 broiler farms were bacteriologically examined for E. coli isolation. The antimicrobial resistance profile was evaluated using disk diffusion, and several resistance genes were investigated through polymerase chain reaction amplification.

Results:

Escherichia coli was isolated and identified from 675/938 farms (72%) from the pooled internal organs (liver, heart, lung, spleen, and yolk) of broilers. Escherichia coli isolates from the most recent 3 years (2018–2020) were serotyped into 13 serotypes; the most prevalent serotype was O125 (n = 8). The highest phenotypic antibiotic resistance profiles during this period were against ampicillin, penicillin, tetracycline, and nalidixic acid. Escherichia coli was sensitive to clinically relevant antibiotics. Twenty-eight selected isolates from the most recent 3 years (2018–2020) were found to have MDR, where the prevalence of the antibiotic resistance genes ctx, tem, and shv was 46% and that of mcr-1 was 64%. Integrons were found in 93% of the isolates.

Conclusion:

The study showed a high prevalence of E. coli infection in broiler farms associated with MDR, which has a high public health significance because of its zoonotic relevance. These results strengthen the application of continuous surveillance programs.

Keywords: antibiotic resistance, Egypt, Escherichia coli, integron, mcr-1, poultry

Introduction

Avian colibacillosis is a major poultry disease that affects all ages of poultry globally and is caused by Escherichia coli. The disease is associated with septicemia, pericarditis, airsacculitis, perihepatitis, peritonitis, and other extraintestinal lesions in poultry and with high economic loss due to the high mortality and low productivity of poultry farms. Many studies have reported an intensive increase in multidrug resistance (MDR) in E. coli strains [1–4].

Antibiotics are used for treatment and prophylaxis against bacterial infections as well as growth promoters, particularly in chicken production; most antibiotics used in veterinary practices are very similar to those used for the clinical treatment of human diseases [5]. During the past decade, antibiotic resistance that emerged as a global problem has engaged international health agencies to comply with the management policies for antibiotic use to avoid exacerbating the problem and to ensure the protection of public health [6–8]. Foodborne bacteria may carry and transfer resistance genes to humans [9]. The resistant bacteria acting as a reservoir could then transfer those genes to commensal microorganisms in addition to pathogenic microorganisms inside the human digestive tract [10]. Transfer of MDR in this manner would make it very difficult to treat bacterial infections [11].

β-lactam antibiotics are some of the most widely used antibiotics that produce an increase in antibiotic-resistant isolates because of increased selective pressure [12]. β-lactamases that hydrolyze an expanded spectrum of cephalosporins and monobactams are classified as extended-spectrum β-lactamases (ESBLs) [13].

Extended-spectrum β-lactamases of Class A mainly includes a variety of hydrolyzing enzymes, such as TEM, SHV, CTX-M, and VEB, and the highest number of variants is found in the CTX-M enzymes. Studies over the past 10 years have revealed that the most widely used CTX-M β-lactamase-producing bacteria were Enterobacteriaceae [14]. There are two classifications of β-lactamases that are currently in use. One is based on the amino acid sequence that includes a serine utilized for lactate hydrolysis. These enzymes are subdivided into Classes A, C, and D enzymes and Class B, which respond to metalloenzymes that require divalent zinc ions for substrate hydrolysis. The updated classification is Group 1, including Class C; Group 2, including Class Al; and Group 3, including Group B [13, 15]. Escherichia coli isolated from broiler farms have been shown to be resistant to penicillins and cephalosporins as well as aztreonam mainly due to the production of CTX-M, TEM, and SHV β-lactamases which are encoded by the blaCTX-M, blaSHV, and blaTEM genes, respectively [16].

Quinolone is considered one of the important antibiotics used in treating E. coli infections in poultry farms. The presence of quinolone resistance genes in bacteria is an evolving problem in E. coli infection control. Quinolones work by interfering with gyrase and topoisomerase IV activity, leading to fragmentation of the bacterial chromosome; this subsequently drives mutations in the gyrase and topoisomerase IV genes and the development of bacterial resistance to quinolones [17, 18].

Colistin resistance is encoded by the mcr-1 gene, which has been detected in isolates of Enterobacteriaceae from humans, food, and livestock [19–21]. Colistin resistance usually develops by mutations in the lipid synthesis enzymes of the bacterial outer membrane [22–24]. Recently, colistin has been widely used as the drug of choice for several bacterial infections, especially in cases infected by MDR Gram-negative bacteria, especially β-lactamase-resistant Enterobacteriaceae [19, 25]. The extensive usage of colistin in the animal production industry as a tool for productivity improvement, besides infection control, contributes to the appearance of colistin resistance in E. coli, which is usually accompanied by the emergence of the plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4, and mcr-5 [26].

Integrons are bacterial genetic elements that are commonly distributed between Gram-negative bacteria in humans and animals. Furthermore, they can be encoded with antimicrobial resistance factors and are subsequently known as resistance integrons or MDR integrons [27]. This class of integrons is usually detected in clinical isolates and is known as clinical integrons [28] and acts as a genetic construction kit for bacteria [29, 30]. Furthermore, integrons are involved in developing and disseminating antibiotic resistance genes in enteric bacteria.

There are several virulence factors detected in E. coli strains that have been isolated from cellulitis and other colibacillosis lesions [31, 32]. Shiga toxins (Stx) are the main virulence factors that are responsible for E. coli pathogenicity, and these occur as two genes: stx1 and stx2 [33]. In addition, the increased serum survival (iss) gene found on episomes can control expression of protectins/serum resistance genes to enhance the ability of bacteria to survive in the host serum [34].

This study aimed to determine the antimicrobial susceptibility of E. coli isolated from broiler farms in different localities in Egypt and assess the degree of antimicrobial resistance, such as the presence of β-lactamase and colistin resistance genes.

Materials and Methods

Ethical approval

The study procedures were approved by the Animal Care Committee of the Animal Health Research Institute (AHRI) Dokki, Giza, Egypt under protocol number (AHRI-42429/2020).

Study period and location

This study was conducted from January 2014 to December 2020 in Reference Laboratory for Veterinary Quality Control on Poultry production - Animal Health Research Institute, Egypt.

Samples

This study was conducted to trace E. coli isolation. Samples were taken from 938 broiler poultry farms located in 25 governorates in Egypt; the number of examined farms from each governorate differs according to the local distribution of poultry farms in Egypt. From each farm, five clinically diseased birds from 7 to 35 days of age were inspected postmortem; bacteriological examination was conducted on the collected pooled organs (liver, lung, spleen, heart, and yolk) from diseased birds to represent one sample. The diseased birds showed different rates of mortalities, diarrhea, colisepticemia, airsacculitis, perihepatitis, and pericarditis.

Isolation and identification of E. coli

Escherichia coli was isolated and identified according to Nolan et al. [1]. Briefly, all the collected samples were pre-enriched in buffered peptone water (Lab M, UK) and incubated aerobically at 37°C for 24 h. A loopful of the broth culture was inoculated onto MacConkey agar (Neogen, US) and eosin methylene blue agar (Lab M) plates, which were incubated at 37°C for 24 h. The isolated colonies were identified morphologically and biochemically (oxidase strips and triple sugar iron agar were from Oxoid, UK; urea, Simmons’ citrate agar, and peptone water were from Lab M; and Kovacs reagent was from HiMedia, India) [1]. In addition, antisera against somatic (O) antigens (Denka Seiken Co., Tokyo, Japan) were used for serotyping isolated E. coli following the manufacturer’s instructions.

Antimicrobial sensitivity test (AST)

An AST was conducted for all isolates using a disk diffusion test, as previously described [35] against 18 antibiotics (HiMedia®), which were amoxicillin-clavulanate (AMC, 30 μg), ampicillin (AMP, 10 μg), ciprofloxacin (CIP, 5 μg), cefotaxime (CTX, 30 μg), chloramphenicol (C, 30 μg), danofloxacin (DFX 5 μg), doxycycline (DOX 30, μg), fosfomycin (FOS 200 μg), levofloxacin (LEV, 5 μg), Penicillin (P 10 μg), enrofloxacin (ENR 5 μg), colistin sulfate (CT, 10–25 μg), imipenem (IMP, 10 μg), nalidixic acid (NA, 30 μg), norfloxacin (NX, 10 μg), streptomycin (S, 10 μg), sulfamethoxazole-trimethoprim (SXT, 25 μg), and tetracycline (T, 30 μg). The results were and interpreted according to CLSI [36]. The susceptibility of E. coli isolates to individual antimicrobial agents was determined and interpreted following aerobic incubation at 37°C for 18–24 h, according to the Clinical and Laboratory Standard Institute guidelines [36]. The antimicrobial susceptibility of colistin was determined using disk diffusion susceptibility testing using colistin disks (Oxoid) containing 10 μg of antibiotic. The disk zone diameters were interpreted according to a previous report [37]. Resistant and intermediately resistant isolates were collectively referred to as non-susceptible, as previously described [38]. Isolates were considered to be MDR strains when found to be non-susceptible to at least one agent in three or more antimicrobial different classes of antimicrobial agents.

Molecular assessment

The 28 selected E. coli isolates from 2018 to 2020 were further tested using polymerase chain reaction (PCR) for the presence of blaTEM, blaSHV, blaCTX-M, mcr-1, qnrA, qnrB, papC, integron, and iss genes.

DNA was extracted from culture broth using a QIAamp DNA Mini Kit (Qiagen, Germany, GmbH Catalogue No. 51304). The extracted DNA was used in subsequent PCR assays for species confirmation and to detect genes responsible for virulence and antimicrobial agent resistance. The polymerase chain reaction was performed in a final volume of 25 μL that contained 12.5 μL of EmeraldAmp MAX PCR Master Mix (EmeraldAmp GT [2× premix], Japan), 1 μL of each primer (20 pmol), 4.5 μL of diethyl pyrocarbonate water, and 6 μL of the DNA template. The reaction was performed in a Biometra thermal cycler, T3000 (Germany). The oligonucleotide primers (Table-1) [39–45] were supplied by Metabion, Germany.

Table-1.

Primers used for antibiotic resistance genes and virulence detection.

Primer Sequence Amplicon size Reference

(5’-3’)
Beta-lactams
 blaSHV AGGATTGACTGCCTTTTTG 392 bp [39]
ATTTGCTGATTTCGCTCG
 blaTEM ATCAGCAATAAACCAGC 516 bp
CCCCGAAGAACGTTTTC
 blaCTX-M ATG TGC AGY ACC AGT AAR GTK ATG GC 593 bp [40]
TGG GTR AAR TAR GTS ACC AGA AYC AGC GG
Colistin resistance gene
 Mcr1 CGGT CAGTCCGTTTGTTC 308 bp [41]
CTTGGTCGGTCTGTAGGG
Quinolone resistance
 qnrA ATTTCTCACGCCAGGATTTG 516 bp [42]
GATCGGCAAAGGTTAGGTCA
 qnrB GATCGTGAAAGCCAGAAAGG 469 bp
ACGATGCCTGGTAGTTGTCC
Integron
 hep TGCGGGTYAARGATBTKGATTT 491 bp [43]
CARCACATGCGTRTARAT
Virulence genes
 papC TGTATCACGCAGTCAGTAGC 501 bp [44]
CCGGCCATATTCACATAA
 ISS ATGTTATTTTCTGCCGCTCTG 266 bp [45]
CTATTGTGAGCAATATACCC

Polymerase chain reaction products were separated by electrophoresis [46] on a 1% agarose gel (AppliChem, Germany, GmbH) in 1× TBE buffer at room temperature (23°C to 27°C) using a gradient of 5 V/cm. Each well was loaded with 15 μL of the PCR product. A GelPilot 100 bp (Qiagen) ladder was used to determine the fragment sizes. The gel was photographed using a gel documentation system (Biometra BDA digital, Germany), and the data were analyzed using gel documentation (Alpha Innotech, Biometra, Germany) and specific software (automatic image capture software, Protein Simple, formerly Cell Bioscience, USA). The amplification conditions of the primers during PCR are shown in Table-2.

Table-2.

Cycling conditions of the primers during PCR.

Gene Primary denaturation Secondary denaturation Annealing Extension No. of cycles Final extension
Beta-lactams
 blaSHV 94°C 5 min 94°C 30 s 54°C 40 s 72°C 40 s 35 72°C 10 min
 blaCTX-m blaTEM 94°C 5 min 94°C 30 s 54°C 40 s 72°C 45 s 35 72°C 10 min
Colistin resistance gene
 Mcr1 94°C 5 min 94°C 30 s 55°C 40 s 72°C 45 s 35 72°C 10 min
Quinolone resistance
 QnrA 94°C 5 min 94°C 30 s 55°C 45 s 72°C 45 s 35 72°C 10 min
 QnrB 94°C 5 min 94°C 30 s 55°C 45 s 72°C 45 s 35 72°C 10 min
Integron
 hep 94°C 5 min 94°C 30 s 55°C 40 s 72°C 45 s 35 72°C 10 min
Virulence genes
 papC 94°C 5 min 94°C 30 s 58°C 40 s 72°C 45 s 35 72°C 10 min
 Iss 94°C 5 min 94°C 30 s 54°C 30 s 72°C 30 s 35 72°C 10 min

PCR=Polymerase chain reaction

The amplification efficiency was verified for positive field samples that may contain the tested genes, which were previously examined in a Veterinary Quality Control Reference Laboratory for Poultry Production, Animal Health Research Institute, Egypt.

Results

Escherichia coli isolation, identification, and serotyping

Escherichia coli was isolated from 675/938 (72%) examined poultry farms between 2014 and 2020. The highest prevalence of E. coli was 98.3% in 2016 and the lowest prevalence of E. coli was 45.8% in 2017, while in other years, the prevalence ranged from 63.6% to 73.9%, as shown in Table-3 and Figure-1. The highest prevalence of E. coli among poultry farms in Egyptian governorates was 98.3% in 2016 (175/178), as shown in Table-4.

Table-3.

Prevalence of E. coli isolated from poultry farms in period (2014–2020).

Year/No. of examined samples E. coli

No. of positive samples %
2014 (n = 134) 99 73.9
2015 (n = 118) 85 72
2016 (n = 178) 175 98.3
2017 (n = 83) 38 45.8
2018 (n = 144) 99 68.8
2019 (n = 138) 88 63.8
2020 (n = 143) 91 63.6
Total (n = 938) 675 72

E. coli=Escherichia coli

Figure-1.

Figure-1

Prevalence of Escherichia coli isolated from 2014 to 2020.

Table-4.

Summary about investigated poultry farms in different governorates.

Governorate 2016 2017 2018 2019 2020





Tested farms Positive farms Tested farms Positive farms Tested farms Positive farms Tested farms Positive farms Tested farms Positive farms
Al Bahr Al Ahmar 1 1 2 0 1 1 NA NA NA NA
Al Beheira 55 55 7 2 61 57 4 2 4 2
Al Dakahlia 13 12 10 7 16 9 34 27 34 27
Al Fayoum 4 3 2 2 NA NA NA NA 4 2
Al Gharbia 1 1 4 4 3 2 NA NA NA NA
Al Giza 9 6 13 7 9 4 56 29 56 29
Al Minia 2 2 NA NA NA NA NA NA NA NA
Al Monofiya 1 1 10 3 NA NA 5 2 5 2
Al Qahera 14 8 1 1 4 3 9 5 9 5
Al Qalyubia 7 4 9 4 2 1 6 4 6 4
Al Sharqiya 6 6 10 1 18 0 6 4 6 4
Alexandria 3 3 2 1 4 2 9 8 9 8
Beni Suef 2 2 4 1 1 0 NA NA NA NA
Ismailia 23 19 4 1 NA NA 7 6 7 6
Luxor 26 25 1 1 8 7 NA NA NA NA
Qena 6 6 1 1 13 12 NA NA NA NA
Kafer El Sheikh 2 2 NA NA NA NA 1 0 1 0
Suez NA NA NA NA NA NA NA NA NA NA
Mersa Matruh NA NA NA NA 1 0 NA NA NA NA
North Sinai 1 1 NA NA NA NA 1 1 1 1
South Sinai NA NA 1 0 NA NA NA NA NA NA
Port Said NA NA NA NA NA NA NA NA NA NA
Aswan NA NA 1 1 1 1 NA NA NA NA
Sohag NA NA 1 1 2 0 NA NA 1 1
Asyut NA NA NA NA NA NA NA NA NA NA
Total 178 175 83 38 144 99 138 88 143 91
Positivity rate 98.3% 45.8% 68.8% 63.8% 63.6%

NA=Not applicable , E. coli=Escherichia coli

The selected E coli isolates from the most recent years (2018–2020) were serotyped into 13 different serotypes. The isolate with the highest prevalence was O125 (n = 8) followed by 0111 (n = 5) and then the remaining serotypes: O55 (n = 3), O15 (n = 2), O157 (n = 2), O 55 (n = 1), O6 (n = 1), O151 (n = 1), O 127 (n = 1), O166 (n = 1), O 143 (n = 1), O86 (n = 1), and O151 (n = 1).

Antimicrobial susceptibility patterns of the isolated E. coli

Escherichia coli isolates were tested for their susceptibility using the disk diffusion technique against 18 antibiotics: AMP, C, CIP, DFX, DOX, FOS, LEV, NA, NX, P, S, T, trimethoprim, ENR, CTX, IMP, AMC + clav, and CT. Most E. coli isolates showed the highest resistance percentage to AMP, P, T, and NA, while the lowest resistance percentage (49%) was shown with CT. Resistance to other antibiotics ranged from 88.5% to 69.7% during the period from 2014 to 2020, as shown in Table-5 and Figure-2. These results show that all E. coli isolates were considered as MDR strains (Table-6).

Table-5.

Antibiotics resistance profile of E. coli isolates from 2014 to 2020.

Antibiotics 2014 (n = 99) 2015 (n = 85) 2016 (n = 175) 2017 (n = 38) 2018 (n = 99) 2019 (n = 88) 2020 (n = 91) Total (n = 496)
Ampicillin 94% 96.5% 99% 100% 95% 100 100 97.8%
Chloramphenicol 74% 71.4% 83% 80% 78% 80 100 80.9%
Ciprofloxacin 46% 71% 77% 87.5% 76% 100 57 73.5%
Danofloxacin 91% 100% 100% 100% 79.5% NA NA 84.3%
Doxycycline 83% 90% 87.5% 60% 91% NA NA 85.5%
Fosfomycin 95% 40% 100% 100% 84% NA NA 85.5%
Levofloxacin 74% 68% 69% 62.5% 71% NA NA 69.7%
Nalidixic acid 87% 100% 91% 88% 93.5% 100 86 92.2%
Norfloxacin 83% 68.5% 78% 77% 86% 100 57 73.2%
Penicillin 83% 100% 100% 100% 100% NA NA 95%
Streptomycin 100% 82.8% 96.5% 58% 96.5% 80 64 82.5%
Tetracycline 91% 91.4% 99% 93% 89% 100 100 94.8%
Sulfamethoxazole-trimethoprim 91% 87.2% 83.5% 84% 88% 100 86 88.5%
Enrofloxacin 91% 80% 80% 64% 86% NA NA 82.4%
Cefotaxime NA NA NA NA 100% 60% 100% 86.7%
Imipenem NA NA NA NA 100% 40% 78.5% 72.8%
Amoxicillin - clavulanate NA NA NA NA 67% 100% 100% 89%
Colistin sulfate NA NA NA NA 67% 60% 21.5% 49.3%

NA=Not applicable, E. coli=Escherichia coli

Figure-2.

Figure-2

Antibiotics resistance profile of Escherichia coli isolated from 2014 to 2020.

Table-6.

Phenotypic resistance, resistance determinants and virulence genes found in E. coli isolates.

No. of strain Serotype Year Phenotypic antibiotic resistance Resistance genes identified Virulence genes
1 O6 2018 AMC30, AMP10, CTX30, CIP5, NX10, NA10, TE30, SXT CTX, TEM, mcr-1, hep ISS
2 O151 2018 AMP10, IMP10, NA10, TE30, SXT TEM, hep ISS, papC
3 O143 2018 AMP10, IMP10, NA10, TE30, SXT TEM, mcr-1, hep ISS
4 O125 2018 AMP10, CTX30, IMP10, NA10, TE30, SXT TEM, SHV, hep ISS
5 O151 2018 AMP10, IMP10, NA10, TE30, SXT TEM ISS papC
6 O15 2018 AMC30, AMP10, CTX30, IMP10, C30, CIP5, NX10, NA10, TE30, SXT, S10 CTX, TEM, Qrna, hep ISS papC
7 O125 2018 AMC30, AMP10, CTX30, IMP10, C30, CIP5, NX10, NA10, TE30, SXT, S10 CTX, TEM, mcr-1, hep ISS
8 O15 2018 AMC30, AMP10, CTX30, IMP10, C30, CIP5, NA10, TE30, SXT, S10 CTX, TEM, Qrna, hep ISS, papC
9 O 125 2018 AMP10, CTX30, IMP10, NA10, TE30, SXT, S10 TEM, hep ISS, papC
10 O125 2019 AMC30, AMP10, CTX30, IMP10, C30, CIP5, NX10, NA10, TE30, SXT, S10 TEM, hep ISS
11 O125 2019 AMC30, AMP10, CTX30, C30, CIP5, NX10, NA10, TE30, SXT, S10 CTX, TEM, SHV, MCR-1, hep ISS, papC
12 O125 2019 AMC30, AMP10, CTX30, C30, CIP5, NA10, TE30, SXT, S10 TEM, MCR-1, hep ISS, papC
13 O125 2019 AMC30, AMP10, IMP10, C30, CIP5, NX10, NA10, TE30, SXT, S10 TEM, MCR-1, hep ISS, papC
14 O 55 2019 AMC30, AMP10, CTX30, CIP5, NX10, NA10, TE30, SXT TEM, MCR-1, hep ISS
15 O125 2020 AMC30, AMP10, CTX30, C30, CIP5, NX10, NA10, TE30, SXT CTX, TEM, MCR-1, hep ISS
16 O125 2020 AMC30, AMP10, C30, TE30, S10 MCR-1 ISS
17 O111 2020 AMC30, AMP10, CTX30, C30, CT, CIP5, NX10, NA10, TE30, SXT CTX, TEM, SHV, MCR-1, hep ISS
18 O111 2020 AMC30, AMP10, CTX30, NX10, NA10, TE30, SXT, S10 CTX, TEM, SHV, MCR-1, hep ISS
19 O111 2020 AMC30, AMP10, CTX30, C30, NA10, TE30, S10 CTX, TEM, MCR-1, hep ISS
20 O111 2020 AMC30, AMP10, CTX30, C30, NA10, TE30, SXT, S10 CTX, TEM, MCR-1, hep ISS
21 O111 2020 AMC30, AMP10, CTX30, C30, NA10, TE30, SXT, S10 CTX, TEM, SHV, hep
22 O127 2020 AMC30, AMP10, CTX30, IMP10, C30, NA10, TE30, SXT, S10 CTX, TEM, SHV, hep
23 O157 2020 AMC30, AMP10, CTX30, IMP10, C30, NA10, TE30, S10 TEM, SHV, MCR-1, hep ISS
24 O55 2020 AMC30, C30, NA10, TE30, SXT, S10 hep ISS, PAPC
25 O166 2020 AMC30, AMP10, CTX30, NA10, SXT TEM, SHV, MCR-1, hep ISS
26 O86 2020 AMC30, AMP10, CTX30, IMP10, C30, TE30, S10 TEM, SHV, MCR-1, hep ISS
27 O55 2020 AMC30, AMP10, CTX30, C30, CIP5, NX10, NA10, TE30, S10 CTX, TEM, SHV, MCR-1, hep ISS
28 O157 2020 AMC30, AMP10, C30, NA10, TE30, SXT, S10 TEM, MCR-1, hep ISS

E. coli=Escherichia coli, AMC=Amoxicillin-clavulanate, AMP=Ampicillin, CIP=Ciprofloxacin, CTX=Cefotaxime, C=Chloramphenicol, CT=Colistin sulfate, IMP=Imipenem, NA=Nalidixic acid, NX=Norfloxacin, S=Streptomycin, SXT=Sulfamethoxazole-trimethoprim, T=Tetracycline

Molecular characterization of several virulences and antimicrobial resistance genes of E. coli isolates

Several resistance genes were identified in 28 phenotypically resistant E. coli isolates using PCR. A total of 26/28 E. coli isolates (93%) harbored one or more ESBLs. BlaTEM was found in 26 E. coli isolates (93%), followed by blaCTX-M and blaSHV (46.5% and 35.7%, respectively), as shown in Table-7 and Figure-3.

Table-7.

The positive percentage of different examined antibiotic-resistant genes for isolated E. coli strains.

Results Colistin (mrc1) blaCTX-m blaTEM blaSHV Qnra Qnrb Integron (hep)
No. of positive 18 13 26 10 2 0 26
Percentage (n = 28) 64.3 46.5 93 35.7 7 0 93

E. coli=Escherichia coli

Figure-3.

Figure-3

Percentage of the different antibiotic-resistant genes of isolated Escherichia coli strains.

In this study, two E. coli isolates harbored the qnrA gene while no isolate possessed the qnrB gene associated with quinolone resistance. The mcr-1 gene associated with CT resistance was detected in 18 E. coli isolates (Table-6). The correlation between the genotypic and phenotypic antimicrobial resistance of E. coli is shown in Table-6. A high prevalence of the iss gene (93%) was found, while that of the other virulence gene papC was much lower (32%).

Discussion

Escherichia coli is one of the most widely distributed bacterial pathogens worldwide and causes severe economic losses in the poultry industry because of mortalities and costs expended on treatment. In addition, the emergence of MDR E. coli adds a further threat to the poultry industry because of the uncontrolled usage of antibiotics. Furthermore, MDR E. coli can spread to humans through food chains causing major public health dangers [47].

In total, E. coli was detected in 675/938 farms (72%). These results agreed with the previous report that demonstrated a high prevalence of E. coli in Egyptian poultry farms [2], where E. coli was isolated from 70% of chickens. Previous studies [48, 49] have also isolated E. coli in 34% and 26.7%, respectively, from chickens in Egypt. Conversely, in the results obtained here for 2017, the prevalence of E. coli was low (45.8%), which agrees with a prior report [50], which isolated E. coli from only 35% of chickens in Egypt. A higher isolation percentage of E. coli (88%) has been reported from poultry in the USA [19]. Furthermore, although the observed prevalence of E. coli in 2016 in our study was 98.3%, however previous studies [51, 52] reported E. coli isolation at very low percentages (13.4% and 11%) from poultry farms in Egypt and Ethiopia, respectively.

Our data showed that E. coli isolates could be serotyped into 13 serotypes, of which O125 (n = 8) and O111 (n = 5) were most prevalent. These results are similar to a previous study conducted by Badr et al. [53] but disagree with the prevalence of serotypes (O1, O2, O25, and O78) isolated in Jordan [54].

In our study, we tested E. coli strains for antimicrobial resistance against 18 different antibiotics. The highest antimicrobial resistance rates in this study ranged from 95% to 86.7% for AMP, P, NA, T, AMC + clavulanic acid, DOX, CTX, FOS, and trimethoprim. In contrast, the percentage of resistance for C, DFX, CIP, NX, LEV, ENR, S, and IMP ranged from 85.5% to 69.7%. The CT showed the lowest resistance percentage (49.7%). These phenotypic resistance rates have been previously reported [48, 49], although lower percentage rates for those phenotypic resistances have also been described [2, 51].

Most of the phenotypically antibiotic-resistant E. coli isolates harbor antibiotic resistance genes associated with resistance to colistin, β-lactams, and quinolones. The mcr-1 gene is associated with colistin resistance and is widely found in different bacteria belonging to Enterobacteriaceae isolated from various sources [55]. Although only one of E. coli isolates was phenotypically resistant to CT, the mcr-1 gene was detected in 18 (64.3%) of all tested E. coli isolates. The overall percentage of phenotypic resistance to CT reached 49.3%. This result agrees with a previous report [25], which reported mcr-1 gene detection at a prevalence of 41.83%. These findings suggest that poultry farms might be a source of colistin-resistant E. coli. However, this percentage was lower than in E. coli isolates from chicken meat samples (19.5%) [56] and 8% (8/100) of E. coli isolates from healthy broilers in Pakistan [57]. Therefore, the emergence and spread of colistin-resistant E. coli in animals and animal by-products, such as chicken meat, may become a serious public health problem as quinolones and β-lactamases are extensively used to treat many infectious diseases [58].

Extended-spectrum β-lactamases have a global distribution [59]. In this study, the overall resistance to CTX, a member of the β-lactamase group, was 86.7%. However, the detection of the genes responsible for antimicrobial resistance for the β-lactamase group (blaCTX-M, blaTEM, and blaSHV) was 46.5%, 93%, and 35.7%, respectively. Certainly, all the strains isolated here showed phenotypic resistance patterns to several antimicrobials related to β-lactamases. New ESBL-encoding genes (such as blaCTX-M, blaGES, or blaVEB-1) are usually located on integron-like structures [60].

Recent studies reported that a higher rate of integrons could lead to significant antibiotic resistance and, consequently, the emergence of ESBL and MDR isolates, which could be a serious risk to healthcare systems as well as the livestock and poultry industries [61, 62]. The blaTEM and blaSHV genes were detected in E. coli isolated from broilers suffering from septicemia in Egypt [63]. In this study, the blaTEM resistance gene was detected in 93% of E. coli isolates, which is lower than that detected in E. coli isolates from healthy broilers in Egypt (20.6%) [51]. Furthermore, a previous study revealed a high prevalence of integron 1 in E. coli isolates from different animal sources in Iraq [64].

Quinolones are mostly used for controlling infections, including those of Gram-negative bacteria such as Enterobacteriaceae. Fluoroquinolones have a broad-spectrum intrinsic activity that is greater than that of quinolones [65]. Plasmid quinolone resistance genes harbor many qnr alleles, which have been found on plasmids or bacterial chromosomes that are mainly associated with Enterobacteriaceae and are grouped into five distinct families: qnrA, qnrB, qnrC, qnrD, and qnrS [66, 67].

Resistance to the antimicrobials NX, CIP, LEV, and NZ, and the isolates were present in 73.2%, 73.5%, 69.7%, and 92.2% of the isolates, respectively. The same examined strains showed low percentages of 7% and 0% for qnrA and qnrB, respectively, but this may be because quinolone resistance is controlled by another group of genes, such as integrons, which were detected in 93% of isolates. These findings are lower than those described previously by Belotindos et al. [18], who detected the Qnr family (qnrA1, qnrB4, and qnrS1) in all tested isolates.

Integrons were detected in 93% of E. coli isolates in this study, which disagrees with a previous study by Moawad et al. [68], who did not record integrons in E. coli isolates from raw chicken samples in Egypt.

Avian pathogenic E. coli (APEC) isolates carry a wide range of virulence genes, such as adhesions, toxins, siderophores, iron transport systems, and invasions that increase pathogenicity in avian colibacilloses [50, 69]. Several virulence genes, including papC, are important in adherence [69]. A high percentage (93%) of the isolates contained the iss gene, as shown in Figure-4, although the papC gene was present at a lower percentage (32%). A previous study conducted by Sedeek et al. [70] reported that there is neither a uniform nor an absolute combination of the virulence genes that can distinguish between APEC and non-APEC strains of E. coli.

Figure-4.

Figure-4

The percentage of the presence of the two examined virulence genes among Escherichia coli strains.

Furthermore, detecting the iss, tsh, and papC genes exclusively in the APEC strains could be consistent as important colibacillosis virulent factors [71, 72]. Our findings were similar to those previously reported by Johar et al. [73] for examination of different virulence genes from healthy and unhealthy chickens in Qatar, where the iss gene was more predominant in APEC in healthy birds (97%) than among unhealthy ones (16%).

In 2006, Avian Influenza outbreak occurred in Egypt, and consequently, all efforts were made to confront this at the expense of other diseases. Furthermore, a repeated problem is a lack of control and monitoring of indiscriminate use of antibiotics in treatment or as growth promoters to increase productivity, which all contribute to the high percentage of antimicrobial resistance [74].

Conclusion

The high prevalence of E. coli in poultry farms in Egypt and the development of MDR E. coli are of considerable concern which has been developed from the uncontrolled usage of antimicrobials. Furthermore, the detection of different antibiotic resistance genes, such as colistin resistance, poses a significant threat to public health. Consequently, additional investigation and surveillance programs are required to focus on the development of antimicrobial resistance in the field, which facilitates its transmission to humans through the food chain. Improved regulatory control of administration of these antibiotics to avoid the generation of antibiotic-resistant strains is needed to protect public health.

Authors’ Contributions

MAAA, HR, HB, EAH, MFA, HKS, and WMH: Designed the study, collected the samples, analyzed the data and conducted the bacterial isolation and the biochemical and antimicrobial susceptibility tests. AGS and AAM: Perform the PCR assays. MAAA, MAS, AGS, and EAH: Wrote the manuscript. All authors have read and approved the final manuscript.

Acknowledgments

The authors would like to thank RLQP Egypt for providing the infrastructure for the study. The authors are also thankful to Dr. Marwa A. Abdelmagid, RLQP, AHRI, ARC, Egypt, for her support in collection of the data. The authors did not receive any funds for this study.

Competing Interests

The authors declare that they do not have competing interests.

Publisher’s Note

Veterinary World remains neutral with regard to jurisdictional claims in published institutional affiliation.

References

  • 1.Nolan L.K, Vaillancourt J.P, Barbieri N.L, Logue C.M. Colibacillosis. In: Swayne D, editor. Diseases of Poultry. 14th ed. Hoboken, NJ, USA: Wiley-Blackwell; 2020. pp. 770–830. [Google Scholar]
  • 2.Khalaf H.A, Aml B, Awd A. Antimicrobial resistance genes of E. coli isolated from broiler chickens in upper Egypt. Anim. Vet. Sci. 2020;8(1):19–28. [Google Scholar]
  • 3.Amer M.M, Mekky H.M, Fedawy H.S, El-Shemy A, Bosila M.A, Elbayoumi K.M. Molecular identification, genotyping of virulence-associated genes, and pathogenicity of cellulitis-derived Escherichia coli. Vet. World. 2020;13(12):2703–2712. doi: 10.14202/vetworld.2020.2703-2712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Theyazan A.Q, Aboueisha A, Fadel H, Youssef A. Zoonotic potential of Escherichia Coli in poultry intestinal contents in Ismailia city, Egypt with special reference to Shiga toxin-producing (STEC) strains. Suez Canal Vet. Med. J. 2021;26(1):219–241. [Google Scholar]
  • 5.Aarestrup F.M, Wegener H.C, Collignon P. Resistance in bacteria of the food chain:Epidemiology and control strategies. Expert Rev. Anti Infect. Ther. 2008;6(5):733–750. doi: 10.1586/14787210.6.5.733. [DOI] [PubMed] [Google Scholar]
  • 6.Adelowo O.O, Fagade O.E, Agersø Y. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, Southwest Nigeria. J. Infect. Dev. Ctries. 2014;8(9):1103–1112. doi: 10.3855/jidc.4222. [DOI] [PubMed] [Google Scholar]
  • 7.Enany M.E, Algammal A.M, Nasef S.A, Abo-Eillil S.A.M, Bin-Jumah M, Taha A.E, Allam A.A. The occurrence of multidrug resistance (MDR) and the prevalence of virulence genes and QACs resistance genes in E. coli isolated from environmental and avian sources. AMB Express. 2019;9(1):192. doi: 10.1186/s13568-019-0920-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Raza B, Shahzad F, Shahid S, Khalid M.U, Sajid T, Shaukat M, Naqvi S.M.R, Tariq H.A, Ahmad M, Rehman A. Detection of antibiotic-resistant Escherichia coli from poultry meat retail shops in Lahore. Life Sci. J. 2021;18(2):29–38. [Google Scholar]
  • 9.Hammerum A.M, Heuer O.E. Human health hazards from antimicrobial-resistant Escherichia coli of animal origin. Clin. Infect. Dis. 2009;48(7):916–921. doi: 10.1086/597292. [DOI] [PubMed] [Google Scholar]
  • 10.Álvarez-Fernández E, Cancelo A, Díaz-Vega C, Capita R, Alonso-Calleja C. Antimicrobial resistance in E. coli isolates from conventionally and organically reared poultry:A comparison of agar disc diffusion and sensitivity test gram-negative methods. Food Control. 2013;30:227–234. [Google Scholar]
  • 11.Davis G.S, Waits K, Nordstrom L, Grande H, Weaver B, Papp K, Horwinski J, Koch B, Hungate B.A, Liu C.M, Price L.B. Antibiotic-resistant Escherichia coli from retail poultry meat with different antibiotic use claims. BMC Microbiol. 2018;18(1):174. doi: 10.1186/s12866-018-1322-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Beceiro A, Tomás M, Bou G. Antimicrobial resistance and virulence:A successful or deleterious association in the bacterial world? Clin. Microbiol. Rev. 2013;26(2):185–230. doi: 10.1128/CMR.00059-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Pitout J.D.D, Laupland K.B. Extended-spectrum beta-lactamase-producing Enterobacteriaceae:An emerging public health concern. Lancet Infect. Dis. 2008;8(3):159–166. doi: 10.1016/S1473-3099(08)70041-0. [DOI] [PubMed] [Google Scholar]
  • 14.Cantón R, Novais A, Valverde A, Machado E, Peixe L, Baquero F, Coque T.M. Prevalence and spread of extended-spectrum beta-lactamase-producing Enterobacteriaceae in Europe. Clin. Microbiol. Infect. 2008;14(Suppl 1):144–153. doi: 10.1111/j.1469-0691.2007.01850.x. [DOI] [PubMed] [Google Scholar]
  • 15.Bush K, Jacoby G.A. Updated functional classification of beta-lactamases. Antimicrob. Agents Chemother. 2010;54(3):969–976. doi: 10.1128/AAC.01009-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Gundran R.S, Cardenio P.A, Villanueva M.A, Sison F.B, Benigno C.C, Kreausukon K, Pichpol D, Punyapornwithaya V. Prevalence and distribution of blaCTX-M, blaSHV, blaTEM genes in extended-spectrum β-lactamase-producing E. coli isolates from broiler farms in the Philippines. BMC Vet. Res. 2019;15(1):227. doi: 10.1186/s12917-019-1975-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Aldred K.J, Kerns R.J, Osheroff N. Mechanism of quinolone action and resistance. Biochemistry. 2014;53(10):1565–1574. doi: 10.1021/bi5000564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Belotindos L, Villanueva M, Miguel J, Jr, Bwalya P, Harada T, Kawahara R, Nakajima C, Mingala C, Suzuki Y. Prevalence and characterization of quino-lone resistance determinants in Escherichia coli isolated from food-producing animals and animal-derived food in the Philippines. Antibiotics (Basel) 2021;10(4):413. doi: 10.3390/antibiotics10040413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Liu Y.Y, Wang Y, Walsh T.R, Yi L.X, Zhang R, Spencer J, Doi Y, Tian G, Dong B, Huang X, Yu L.F, Gu D, Ren H, Chen X, Lv L, He D, Zhou H, Liang Z, Liu J.H, Shen J. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China:A microbiological and molecular biological study. Lancet Infect. Dis. 2016;16(2):161–168. doi: 10.1016/S1473-3099(15)00424-7. [DOI] [PubMed] [Google Scholar]
  • 20.Poirel L, Jayol A, Nordmann P. Polymyxins:Antibacterial activity, susceptibility testing, and resistance mechanisms encoded by plasmids or chromosomes. Clin. Microbiol. Rev. 2017;30(2):557–596. doi: 10.1128/CMR.00064-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Li B, Ke B, Zhao X, Guo Y, Wang W, Wang X, Zhu H. Antimicrobial resistance profile of mcr-1 positive clinical isolates of Escherichia coli in China from 2013 to 2016. Front. Microbiol. 2018;9:2514. doi: 10.3389/fmicb.2018.02514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Gao R, Hu Y, Li Z, Sun J, Wang Q, Lin J, Ye H, Liu F, Srinivas S, Li D, Zhu B, Liu Y.H, Tian G.B, Feng Y. Dissemination and mechanism for the MCR-1 colistin resistance. PLoS Pathog. 2016;12(11):e1005957. doi: 10.1371/journal.ppat.1005957. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Hinchliffe P, Yang Q.E, Portal E, Young T, Li H, Tooke C.L, Carvalho M.J, Paterson N.G, Brem J, Niumsup P.R, Tansawai U, Lei L, Li M, Shen Z, Wang Y, Schofield C.J, Mulholland A.J, Shen J, Fey N, Walsh T.R, Spencer J. Insights into the mechanistic basis of plasmid-mediated colistin resistance from crystal structures of the catalytic domain of MCR-1. Sci. Rep. 2017;7:39392. doi: 10.1038/srep39392. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Yang Q, Li M, Spiller O.B, Andrey D.O, Hinchliffe P, Li H, MacLean C, Niumsup P, Powell L, Pritchard M, Papkou A, Shen Y, Portal E, Sands K, Spencer J, Tansawai U, Thomas D, Wang S, Wang Y, Shen J, Walsh T. Balancing mcr-1 expression and bacterial survival is a delicate equilibrium between essential cellular defence mechanisms. Nat. Commun. 2017;8(1):2054. doi: 10.1038/s41467-017-02149-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Aklilu E, Raman K. MCR-1 gene encoded colistin-resistant Escherichia coli in raw chicken meat and bean sprouts in Malaysia. Int. J. Microbiol. 2020;2020:8853582. doi: 10.1155/2020/8853582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Rebelo A.R, Bortolaia V, Kjeldgaard J.S, Pedersen S.K, Leekitcharoenphon P, Hansen I.M, Guerra B, Malorny B, Borowiak M, Hammerl J.A, Battisti A, Franco A, Alba P, Perrin-Guyomard A, Granier S.A, Escobar C.D.F, Malhotra-Kumar S, Villa L, Carattoli A, Hendriksen R.S. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Euro. Surveill. 2018;23(6):17–00672. doi: 10.2807/1560-7917.ES.2018.23.6.17-00672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Stalder T, Barraud O, Casellas M, Dagot C, Ploy M.C. Integron involvement in environmental spread of antibiotic resistance. Front. Microbiol. 2012;9(3):119. doi: 10.3389/fmicb.2012.00119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Gillings M.R. Class 1 integrons as invasive species. Curr. Opin. Microbiol. 2017;38:10–15. doi: 10.1016/j.mib.2017.03.002. [DOI] [PubMed] [Google Scholar]
  • 29.Canal N, Meneghetti K.L, de Almeida C.P, Bastos M.D.R, Otton L.M, Corção G. Characterization of the variable region in the class 1 integron of antimicrobial-resistant Escherichia coli isolated from surface water. Braz. J. Microbiol. 2016;47(2):337–344. doi: 10.1016/j.bjm.2016.01.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kheiri R, Akhtari L. Antimicrobial resistance and integron gene cassette arrays in commensal Escherichia coli from human and animal sources in IRI. Gut Pathog. 2016;8(1):40. doi: 10.1186/s13099-016-0123-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Guastalli E.A.L, Guastalli B.H.L, Soares N.M, Leite D.S, Ikuno A.A, Maluta R.P, Cardozo M.V, Beraldo L.G, Borges C.A, Avila F.A. Virulence characteristics of Escherichia coli isolates obtained from commercial one-week-old layer chicks with diarrhea. Afr. J. Microbiol. Res. 2013;7(47):5306–5313. [Google Scholar]
  • 32.Kemmett K, Williams N.J, Chaloner G, Humphrey S, Wigley P, Humphrey T. The contribution of systemic Escherichia coli infection to the early mortalities of commercial broiler chickens. Avian Pathol. 2014;43(1):37–42. doi: 10.1080/03079457.2013.866213. [DOI] [PubMed] [Google Scholar]
  • 33.Karch H, Tarr P.I, Bielaszewska M. Enterohaemorrhagic Escherichia coli in human medicine. Int. J. Med. Microbiol. 2005;295(6–7):405–418. doi: 10.1016/j.ijmm.2005.06.009. [DOI] [PubMed] [Google Scholar]
  • 34.Sarowska J, Futoma-Koloch B, Jama-Kmiecik A, Frej-Madrzak M, Ksiazczyk M, Bugla-Ploskonska G, Choroszy-Krol I. Virulence factors, prevalence and potential transmission of extraintestinal pathogenic Escherichia coli isolated from different sources:Recent reports. Gut Pathog. 2019;11:10. doi: 10.1186/s13099-019-0290-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.World Health Organization. Manual for the Laboratory Identification and Antimicrobial Susceptibility Testing of Bacterial Pathogens of Public Health Importance in the Developing World. Geneva, Switzerland: World Health Organization; 2003. [Google Scholar]
  • 36.Clinical and Laboratory Standards Institute. In:27th Informational Supplement Document M100-S27. Vol. 37. Wayne: Clinical and Laboratory Standards Institute; 2017. Performance standards for antimicrobial susceptibility testing. [Google Scholar]
  • 37.Maalej S.M, Meziou M.R, Rhimi F.M, Hammami A. Comparison of disc diffusion, etest and agar dilution for susceptibility testing of colistin against Enterobacteriaceae. Lett. Appl. Microbiol. 2011;53(5):546–551. doi: 10.1111/j.1472-765X.2011.03145.x. [DOI] [PubMed] [Google Scholar]
  • 38.Magiorakos A.P, Srinivasan A, Carey R.B, Carmeli Y, Falagas M.E, Giske C.G, Harbarth S, Hindler J.F, Kahlmeter G, Olsson-Liljequist B, Paterson D.L, Rice L.B, Stelling J, Struelens M.J, Vatopoulos A, Weber J.T, Monnet D.L. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria:An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012;18(3):268–281. doi: 10.1111/j.1469-0691.2011.03570.x. [DOI] [PubMed] [Google Scholar]
  • 39.Colom K, Pérez J, Alonso R, Fernández-Aranguiz A, Lariño E, Cisterna R. Simple and reliable multiplex PCR assay for detection of blaTEM, blaSHV and blaOXA-1 genes in Enterobacteriaceae. FEMS Microbiol. Lett. 2003;223(2):147–151. doi: 10.1016/S0378-1097(03)00306-9. [DOI] [PubMed] [Google Scholar]
  • 40.Archambault M, Petrov P, Hendriksen R.S, Asseva G, Bangtrakulnonth A, Hasman H, Aarestrup F.M. Molecular characterization and occurrence of extended-spectrum beta-lactamase resistance genes among Salmonella enterica serovar Corvallis from Thailand, Bulgaria, and Denmark. Microb. Drug Resist. 2006;12(3):192–198. doi: 10.1089/mdr.2006.12.192. [DOI] [PubMed] [Google Scholar]
  • 41.Newton-Foot M, Snyman Y, Maloba M.R.B, Whitelaw A.C. Plasmid-mediated mcr-1 colistin resistance in Escherichia coli and Klebsiella spp. Clinical isolates from the Western Cape region of South Africa. Antimicrob. Resist. Infect. Control. 2017;6(3):78. doi: 10.1186/s13756-017-0234-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Robicsek A, Strahilevitz J, Jacoby G.A, Macielag M, Abbanat D, Park C.H, Bush K, Hooper D.C. Fluoroquinolone-modifying enzyme:A new adaptation of a common aminoglycoside acetyltransferase. Nat. Med. 2006;12(1):83–88. doi: 10.1038/nm1347. [DOI] [PubMed] [Google Scholar]
  • 43.White P.A, McIver C.J, Deng Y, Rawlinson W.D. Characterisation of two new gene cassettes, aadA5 and dfrA17. FEMS Microbiol. Lett. 2000;182(2):265–269. doi: 10.1111/j.1574-6968.2000.tb08906.x. [DOI] [PubMed] [Google Scholar]
  • 44.Jin W, Zheng Z, Zhang Y, Qin A, Shao H, Liu Y, Wang J, Wang Q. Distribution of virulence-associated genes of avian pathogenic Escherichia coli isolates in China. Agric. Sci. China. 2008;7(12):1511–1515. [Google Scholar]
  • 45.Yaguchi K, Ogitani T, Osawa R, Kawano M, Kokumai N, Kaneshige T, Noro T, Masubuchi K, Shimizu Y. Virulence factors of avian pathogenic Escherichia coli strains isolated from chickens with colisepticemia in Japan. Avian Dis. 2007;51(3):656–662. doi: 10.1637/0005-2086(2007)51[656:VFOAPE]2.0.CO;2. [DOI] [PubMed] [Google Scholar]
  • 46.Sambrook J, Fritscgh E.F, Mentiates T. A Laboratory Manual. Vol. 3. New York: Laboratory Press, Cold Spring Harbor; 1989. Molecular Cloning; pp. 55–57. [Google Scholar]
  • 47.Al Azad M.A.R, Rahman M.M, Amin R, Begum M.I.A, Fries R, Husna A, Khairalla A.S, Badruzzaman A.T.M, El Zowalaty M.E, Lampang K.N, Ashour H.M, Hafez H.M. Susceptibility and multidrug resistance patterns of Escherichia coli isolated from Cloacal swabs of live broiler chickens in Bangladesh. Pathogens. 2019;8(3):118. doi: 10.3390/pathogens8030118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Ibrahim W.A, Marouf S.A, Erfan A.M, Nasef S.A, Jakee J.K.E. The occurrence of disinfectant and antibiotic-resistant genes in Escherichia coli isolated from chickens in Egypt. Vet. World. 2019;12(1):141–145. doi: 10.14202/vetworld.2019.141-145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Radwan I, El-Halim M.A, Abed A.H. Molecular characterization of antimicrobial-resistant Escherichia coli isolated from broiler chickens. J. Vet. Med. Res. 2020;27(2):128–142. [Google Scholar]
  • 50.Amer M.M, Mekky H.M, Amer A.M, Fedawy H.S. Antimicrobial resistance genes in pathogenic Escherichia coli isolated from diseased broiler chickens in Egypt and their relationship with the phenotypic resistance characteristics. Vet. World. 2018;11(8):1082–1088. doi: 10.14202/vetworld.2018.1082-1088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Moawad A.A, Hotzel H, Neubauer H, Ehricht R, Monecke S, Tomaso H, Hafez H. M, Roesler U, El-Adawy H. Antimicrobial resistance in Enterobacteriaceae from healthy broilers in Egypt:Emergence of colistin-resistant and extended-spectrum β-lactamase-producing Escherichia coli. Gut Pathog. 2018;10:39. doi: 10.1186/s13099-018-0266-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Shecho M, Thomas N, Kemal J, Muktar Y. Cloacael carriage and multidrug-resistant Escherichia coli O157:H7 from poultry farms, Eastern Ethiopia. J. Vet. Med. 2017;2017:8264583. doi: 10.1155/2017/8264583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Badr H, Samir A, El-Tokhi E. I, Shahein M.A, Rady F.M, Hakim A.S, Fouad E.A, El-Sady E.F, Ali S.F. Phenotypic and genotypic screening of colistin resistance associated with emerging pathogenic Escherichia coli isolated from poultry. Vet. Sci. 2022;9(6):282. doi: 10.3390/vetsci9060282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Ibrahim R.A, Cryer T.L, Lafi S.Q, Basha E.A, Good L, Tarazi Y.H. Identification of Escherichia coli from broiler chickens in Jordan, their antimicrobial resistance, gene characterization and the associated risk factors. BMC Vet. Res. 2019;15(1):159. doi: 10.1186/s12917-019-1901-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Wang X, Liu Y, Qi X, Wang R, Jin L, Zhao M, Zhang Y, Wang Q, Chen H, Wang H. Molecular epidemiology of colistin-resistant Enterobacteriaceae in inpatient and avian isolates from China:High prevalence of mcr-negative Klebsiella pneumoniae. Int. J. Antimicrob. Agents. 2017;50(4):536–541. doi: 10.1016/j.ijantimicag.2017.05.009. [DOI] [PubMed] [Google Scholar]
  • 56.Monte D.F, Mem A, Fernandes M.R, Cerdeira L, Esposito F, Galvão J.A, Franco B.D.G, Lincopan N, Landgraf M. Chicken meat as a reservoir of Colistin-resistant Escherichia coli strains carrying mcr-1 genes in South America. Antimicrob. Agents Chemother. 2017;61(5):e02718–16. doi: 10.1128/AAC.02718-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Lv J, Mohsin M, Lei S, Srinivas S, Wiqar R.T, Lin J, Feng Y. Discovery of mcr-1-bearing plasmid in commensal colistin-resistant Escherichia coli from healthy broilers in Faisalabad, Pakistan. Virulence. 2018;9(1):994–999. doi: 10.1080/21505594.2018.1462060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Adriaenssens N, Coenen S, Versporten A, Muller A, Minalu G, Faes C, Vankerckhoven V, Aerts M, Hens N, Molenberghs G, Goossens H ESAC Project Group. European surveillance of antimicrobial consumption (ESAC):Outpatient antibiotic use in Europe (1997–2009) J. Antimicrob. Chemother. 2011;66(Suppl 6):vi3–vi12. doi: 10.1093/jac/dkr453. [DOI] [PubMed] [Google Scholar]
  • 59.Hawkey P.M. Prevalence and clonality of extended-spectrum beta-lactamases in Asia. Clin. Microbiol. Infect. 2008;14(Suppl 1):159–165. doi: 10.1111/j.1469-0691.2007.01855.x. [DOI] [PubMed] [Google Scholar]
  • 60.Bonnet R. Growing group of extended-spectrum beta-lactamases:The CTX-M enzymes. Antimicrob. Agents Chemother. 2004;48(1):1–14. doi: 10.1128/AAC.48.1.1-14.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Faghri J, Nouri S, Jalalifar S, Zalipoor M, Halaji M. Correction to:Investigation of antimicrobial susceptibility, class I and II integrons among Pseudomonas aeruginosa isolates from hospitalized patients in Isfahan, Iran. BMC Res. Notes. 2019;12(1):79. doi: 10.1186/s13104-018-3901-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Falgenhauer L, Imirzalioglu C, Oppong K, Akenten C.W, Hogan B, Krumkamp R, Poppert S, Levermann V, Schwengers O, Sarpong N, Owusu-Dabo E, May J, Eibach D. Detection and characterization of ESBL-producing Escherichia coli from humans and poultry in Ghana. Front. Microbiol. 2019;9:3358. doi: 10.3389/fmicb.2018.03358. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Ahmed A.M, Shimamoto T, Shimamoto T. Molecular characterization of multidrug-resistant avian pathogenic Escherichia coli isolated from septicemic broilers. Int. J. Med. Microbiol. 2013;303(8):475–483. doi: 10.1016/j.ijmm.2013.06.009. [DOI] [PubMed] [Google Scholar]
  • 64.Dehkordi M.K, Halaji M, Nouri S. Prevalence of class 1 integron in Escherichia coli isolated from animal sources in Iran:A systematic review and meta-analysis. Trop. Med. Health. 2020;48:16. doi: 10.1186/s41182-020-00202-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Seo K.W, Lee Y.J. Molecular characterization of fluoroquinolone-resistant Escherichia coli from broiler breeder farms. Poult. Sci. 2021;100(8):101250. doi: 10.1016/j.psj.2021.101250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Strahilevitz J, Jacoby G.A, Hooper D.C, Robicsek A. Plasmid-mediated quinolone resistance:A multifaceted threat. Clin. Microbiol. Rev. 2009;22(4):664–689. doi: 10.1128/CMR.00016-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Nordmann P, Poirel L. Emergence of plasmid-mediated resistance to quinolones in Enterobacteriaceae. J. Antimicrob. Chemother. 2005;56(3):463–469. doi: 10.1093/jac/dki245. [DOI] [PubMed] [Google Scholar]
  • 68.Moawad A.A, Hotzel H, Awad O, Tomaso H, Neubauer H, Hafez H.M, El-Adawy H. Occurrence of Salmonella enterica and Escherichia coli in raw chicken and beef meat in northern Egypt and dissemination of their antibiotic resistance markers. Gut Pathog. 2017;9:57. doi: 10.1186/s13099-017-0206-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Borzi M.M, Cardozo M.V, de Oliveira E.S, de Pollo A.S, Guastalli E.A.L, Santos L.F.D, Ávila F.A.D. Characterization of avian pathogenic Escherichia coli isolated from free-range helmeted guineafowl. Braz. J. Microbiol. 2018;49(Suppl 1):107–112. doi: 10.1016/j.bjm.2018.04.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Sedeek D.M, Rady M.M, Fedawy H.S, Rabie N.S. Molecular epidemiology and sequencing of avian pathogenic Escherichia coli APEC in Egypt. Adv. Anim. Vet. Sci. 2020;8(5):499–505. [Google Scholar]
  • 71.Mohamed L, Ge Z, Yuehua L, Yubin G, Rachid K, Mustapha O, Junwei W, Karine O. Virulence traits of avian pathogenic (APEC) and fecal (AFEC) E. coli isolated from broiler chickens in Algeria. Trop. Anim. Health Prod. 2018;50(3):547–553. doi: 10.1007/s11250-017-1467-5. [DOI] [PubMed] [Google Scholar]
  • 72.Subedi M, Luitel H, Devkota B, Bhattarai R.K, Phuyal S, Panthi P, Shrestha A, Chaudhary D.K. Antibiotic resistance pattern and virulence genes content in avian pathogenic Escherichia coli (APEC) from broiler chickens in Chitwan, Nepal. BMC Vet. Res. 2018;14(1):113. doi: 10.1186/s12917-018-1442-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Johar A, Al-Thani N, Al-Hadidi S.H, Dlissi E, Mahmoud M.H, Eltai N.O. Antibiotic resistance and virulence gene patterns associated with avian pathogenic Escherichia coli (APEC) from broiler chickens in Qatar. Antibiotics (Basel) 2021;10(5):564. doi: 10.3390/antibiotics10050564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.El-Sharkawy H, Tahoun A, El-Gohary A.E.G, El-Abasy M, El-Khayat F, Gillespie T, Kitade Y, Hafez HM, Neubauer H, El-Adawy H. Epidemiological, molecular characterization and antibiotic resistance of Salmonella enterica serovars isolated from chicken farms in Egypt. Gut Pathog. 2017;10(9):8. doi: 10.1186/s13099-017-0157-1. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Veterinary World are provided here courtesy of Veterinary World

RESOURCES