Abstract
Attenuated Salmonella Typhimurium is a promising antigen delivery system for live vaccines such as polysaccharides. The length of polysaccharides is a well-known key factor in modulating the immune response induced by glycoconjugates. However, the relationship between the length of Lipopolysaccharide (LPS) O-antigen (OAg) and the immunogenicity of S. Typhimurium remains unclear. In this study, we assessed the effect of OAg length determined by wzzST on Salmonella colonization, cell membrane permeability, antimicrobial activity, and immunogenicity by comparing the S. Typhimurium wild-type ATCC14028 strain to those with various OAg lengths of the ΔwzzST mutant and ΔwzzST::wzzECO2. The analysis of the OAg length distribution revealed that, except for the very long OAg, the short OAg length of 2–7 repeat units (RUs) was obtained from the ΔwzzST mutant, the intermediate OAg length of 13–21 RUs was gained from ΔwzzST::wzzECO2, and the long OAg length of over 20 RUs was gained from the wild-type. In addition, we found that the OAg length affected Salmonella colonization, cell permeability, and antibiotic resistance. Immunization of mice revealed that shortening the OAg length by altering wzzST had an effect on serum bactericidal ability, complement deposition, and humoral immune response. S. Typhimurium mutant strain ΔwzzST::wzzECO2 possessed good immunogenicity and was the optimum option for delivering E. coli O2 O-polysaccharides. Furthermore, the attenuated strain ATCC14028 ΔasdΔcrpΔcyaΔrfbPΔwzzST::wzzECO2-delivered E. coli O2 OAg gene cluster outperforms the ATCC14028 ΔasdΔcrpΔcyaΔrfbP in terms of IgG eliciting, cytokine expression, and immune protection in chickens. This study sheds light on the role of OAg length in Salmonella characteristics, which may have a potential application in optimizing the efficacy of delivered polysaccharide vaccines.
Supplementary Information
The online version contains supplementary material available at 10.1186/s13567-023-01142-4.
Keywords: Salmonella Typhimurium, lipopolysaccharide, O-antigen chain length, Escherichia coli O2, immune response
Introduction
Antimicrobial resistance represents an enormous global health crisis and one of the most serious public health issues today [1]. Salmonella outbreaks linked to backyard poultry in the United States increased during the COVID-19 pandemic in 2020 [2]. Avian pathogenic Escherichia coli (APEC) O2, a predominant serogroup of extraintestinal pathogenic E. coli, causes severe systemic infectious diseases in poultry because multidrug-resistant E. coli can live in chicken respiratory microbiota, which forms competitive exclusion of normal bacteria [3]. As a result, immunization against salmonellosis and colibacillosis is still required in poultry farms.
Because the outer leaflet of the outer membrane is primarily made up of LPS, surface polysaccharides are promising targets for vaccine development [4]. LPS typically consists of three components: lipid A, the core oligosaccharide, and O-antigen. The OAg moiety of LPS has been identified as a significant target for protective immunity against several pathogens based on many biological features of LPS OAg, including the following: (a) it is required for the physiological integrity and functionality of most Gram-negative bacterial outer membranes, which serve as a permeability barrier and contribute significantly to structural integrity; (b) it is a primary surface antigen, one of the most effective stimulators of the host immune system and plays a critical role in bacterial pathogen-host interactions; and (c) antibody specific to the OAg confers pathogen protection and contributes to complement and bactericidal peptide resistance. Throughout the last few decades, some studies have focused on changing the structure of LPS as a technique for developing live-attenuated vaccines [5].
OAg length is a well-known factor that influences the immunological response by altering the immunogenicity of the outer membrane antigen. Thus, changing the OAg length has previously been used to overcome T-independent immune responses [6]. However, the impact of OAg length on polysaccharide vaccine immunogenicity is still being debated. In some cases, low molecular-mass OAg fragments induce significantly higher antibody levels in mice than full-length OAg. For example, Shigella sonnei conjugates with low molecular-mass OAg fragments producing significantly higher antibody levels in mice than full-length OAg (29 RUs) [7]. A synthetic sequence of OAg with 3 RUs from Shigella flexneri serotype 2a conjugated to tetanus toxoid (TT) increases immunogenicity and protective efficacy in mice. While the anti-LPS antibody titers in mice and rabbits increase with OAg length in S. Typhimurium. A glycoconjugate with native OAg provides better protection than a smaller conjugate [8]. Furthermore, according to a recent study, OAg length is not a critical parameter for generalized modules for membrane antigen (GMMA) immunological response [9]. Although OAg length undoubtedly impacts the immunogenicity of polysaccharide (PS) vaccines, the optimal length of attenuated Salmonella vector for oral delivery of OAg has yet to be determined.
The Wzz family of polysaccharide co-polymerases (PCP) acts as a major hub in the OAg elongation process, regulating the degree of repeat unit polymerization (i.e., OAg size) [10]. Wzz proteins confer a wide range of model lengths, from 4 to > 100 RUs [11]. For example, there are three OAg lengths in Salmonella: short (S-OAg, < 15 RUs), long (L-OAg, 16 to 35 RUs), and very long (VL-OAg, > 100 RUs), with wzzST controlling the lower modal length pattern and fepE controlling the high molecular weight (HMW) LPS modal length (> 100 RUs) [12]. In E. coli, however, OAg length was classified as short (7–16 RUs), intermediate (10–18 RUs), and long (16–25 RUs) [13]. In a previous study, we discovered that the OAg lengths of wild-type E. coli O2 and S. Typhimurium differed in silver-stained SDS-PAGE [14]. When O2 OAg was synthesized in S. Typhimurium, the OAg length was controlled by S. Typhimurium WzzST, resulting in an OAg length that differed from that of wild-type E. coli O2. Although it is involved in S. Typhimurium pathogenesis, the role of fepE in immune responses is still unclear [15, 16]. Thus, we would like to alter wzzST to explore the effect of the OAg length on the immunogenicity of both the Salmonella vector and the delivered OAg in the presence of fepE.
This study aimed to investigate how different OAg lengths affect S. Typhimurium immunogenicity and host defense resistance, as well as a promising application in heterologous polysaccharide delivery.
Materials and methods
Bacterial strains, plasmids, and growth conditions
The strains and plasmids used in this study are listed in Table 1. Bacterial strains were grown in Luria–Bertani broth or on agar plates (Sangon Biotech (Shanghai) Co., Ltd) at 37 °C. Diaminopimelic acid (DAP) (50 µg/mL) (Sigma-Aldrich) was added to the Δasd mutant strains for growth in the absence of plasmid complementation. In the allelic exchange experiments, LB agar containing 5% sucrose was used for sacB gene-based counterselection [17]. Chloramphenicol (25 µg/mL) (Sangon Biotech (Shanghai) Co., Ltd) was used to select mutant strains for construction.
Table 1.
Bacterial strains and plasmids used in this study
Generation of suicide vectors and mutant strains
The primers used in this study are listed in Table 2. DNA manipulations were carried out as described previously [18]. The wzz, crp, cya, rfbP, and asd genes were disrupted in S. Typhimurium by allelic exchange with a SacB-based suicide plasmid. The conjugation was then accomplished through an allelic exchange, as previously reported. For an insertion mutation, the ΔwzzST mutant strain was then inserted with heterologous wzz genes from E. coli O2. The CDS sequence of wzzECO2 was fused with the upstream and downstream of the S. Typhimurium wzzST using primer pair wzzECO2-F/wzzECO2-R, which was designed with a homologous sequence with an adjacent fragment and plasmid pRE112. The same methods as described for the deletion mutant were applied to successfully select the ΔwzzST::wzzECO2 substitution mutation, including colony PCR, sequencing, and silver staining.
Table 2.
Primers used in this study
| Primers | Sequence (5′–3′) | Target Gene/host gene | GenBank nnununumbernu number |
|---|---|---|---|
| wzz-1F | TGGCTCCGATAACTTCCGCG | Upstream of wzzST | NC_003197.22 |
| wzz-1R | AGATACCCTAACTAAAAAAAG | ||
| wzz-2F | GCTGCTTTGGCGACGCCAGC | Downstream of wzzST | NC_003197.22 |
| wzz-2R | GCTTCTTTGCCGGATGGTGG | ||
| wzzECO2-F | CATCCTTTTTTTAGTTAGGGTATCTATGCGGACTTGGAAATTTCC | DE17 wzz | CP045206.1 |
| wzzECO2-R | ACCATCCGGCAAAGAAGC TTACTTCGCGTTGTAATTGCG | ||
| Ch-β-actin-F | CACCACAGCCGAGAGAGAAAT | Chicken | L08165.1 |
| Ch-β-actin-R | TGACCATCAGGGAGTTCATAGC | ||
| Ch-IL2-F | GCTAATGACTACAGCTTATGGAGCA | Chicken | GU119890.1 |
| Ch-IL2-R | TGGGTCTCAGTTGGTGTGTAGAG | ||
| Ch-IL4-F | GCGTCAAGATGAACGTGACAGA | Chicken | CP100567.1 |
| Ch-IL4-R | GGAGCTGACGCATGTTGAGG | ||
| Ch-IL10-F | CATGCTGCTGGGCCTGAA | Chicken | LR633956.1 |
| Ch-IL10-R | CGTCTCCTGATCTGCTTGATG | ||
| Ch-IFN-γ-F | CTGGAATCTCATGTCGTTCATCG | Chicken | NM_205149.2 |
| Ch-IFN-γ-R | AGTCGTTCATCGGGAGCTTG |
Ch chicken.
LPS profile analysis
The effect of heterologous wzz on OAg length was confirmed using silver-stained SDS-PAGE and Western blotting. LPS samples were prepared, separated, and visualized in the same manner as previously described [19]. The extracted LPS samples were transferred to PVDF membranes and incubated with Salmonella O4 or antiserum against E. coli O2 (Tianjin Biochip Corporation, Tianjin, China) at a 1:1000 dilution to identify the biosynthesis of S. Typhimurium and E. coli O2 OAg chains.
Complement resistance assay
The serum complement resistance of ATCC14028, ST03, and ST04 with varying wzz was investigated as previously described [13, 20]. In brief, mid-log phase bacteria were washed twice with phosphate-buffered saline (PBS) buffer (pH 7.0), and 50 μL of the bacterial suspension (104 CFU/mL) was mixed with an equal volume of 20% normal rabbit serum (NRS) (Cedarlane) (test group) or heat-inactivated rabbit serum (HIRS) (negative control) and incubated at 37 ℃ for 60 min. The same bacteria incubated in PBS was set as a blank control. The colony-forming units (CFU) produced by each treatment were determined by serial dilutions plated on LB agar medium and incubated at 37 °C overnight till the colony was viable to count. The strains had been tested three times. The survival rates were calculated by comparing the colony numbers that survived in the test group to those in the negative control group. The statistical difference between the wild-type strain and the wzzST mutant strains was compared by t-test using the Graphpad Prism.
MIC and antibiotic sensitivity testing
The minimum inhibitory concentrations (MIC) of polymyxin B and bile salt deoxycholate (DOC) (Sigma-Aldrich) against ATCC14028, ST03, and ST04 were determined as previously described [21]. Along with the 96-well plates, two-fold serial dilutions of DOC (0.39–50 mg/mL) and polymyxin B (0.078–10 µg/mL) were made. Bacteria were grown in LB to an OD600 of 0.8, harvested, washed twice with PBS, and diluted in PBS to 1.0 × 105 CFU/mL. Then, 100 μL of diluted bacteria suspension was added to each well containing an equal amount of antimicrobial substance at a different concentration, and overnight incubation at 37 ℃ was performed. As a negative control, groups with a single polymyxin B/DOC or bacteria were used. The optical density of each culture was determined using a SYNERGYH1 Microplate Reader (BioTek Instrument, Winooski, VT, USA). The threshold of inhibition was 0.1 at OD600. Actual titers were determined by spreading culture dilutions onto LB plates followed by overnight incubation at 37 °C. This test was repeated three times.
Furthermore, antibiotic sensitivity to Sulfamethoxazole (STX), Ampicillin (Amp), Chloramphenicol (Cm), Norfloxacin (NOR), Penicillin (P), and Tetracycline (TE) was detected with antibiotic discs (Hangzhou Microbial Regent Co., Ltd).
Colonization in mice
Six-week-old female BALB/c mice were purchased from Hangzhou Medical College (Zhejiang, China). There are three groups of mice used to detect colonization. Each group of six mice was orally inoculated with 20 μL of (buffered saline with gelatin) BSG, which contained 1 × 109 CFU of ATCC14028, ST03, and ST04, respectively. On days 6 and 9 post-infection, Peyer patches, spleen, and liver samples were collected from three mice of each group. To determine the viable bacteria, samples were homogenized, diluted, and plated onto XTL4, MacConkey, and LB agar.
Cell membrane permeability
Bacteria were cultured overnight in LB broth without shaking. 1 mL of culture was diluted in 19 mL of fresh LB broth and cultivated at 37 °C with stirring until the optical density at 600 nm reached 1.8. 10 mL of cells were harvested by centrifugation at room temperature and washed twice with 50 mM potassium phosphate buffer (pH 7.0) at room temperature. After 20-fold dilution, the cells were resuspended in 0.5 mL of the same buffer, and the optical density was determined. Cells with a total of 0.4 OD600 units were added to the same potassium phosphate buffer (final volume, 2 mL). After the addition of ethidium bromide at a final concentration of 6 μM to the mixture. The fluorescence of the ethidium-nucleic acid complex generated by the influx of ethidium into cells was measured at room temperature using a spectrofluorometer with excitation and emission wavelengths of 545 and 600 nm, respectively [22]. The value was read every 70 s for 30 min, and the test was repeated three times. ATCC14028 cells were suspended in a 50 mM potassium phosphate buffer without Ethidium bromide as a blank control. The positive control was ATCC14028 cells treated with 75% ethanol for 1 h.
Immunoprotection evaluation in mice
To determine the effect of the wzz mutant strains on Salmonella immunogenicity, the wzzST+ and wzzST mutant strains were attenuated by deleting the crp and cya genes from the genome, as the ΔcyaΔcrp mutation strain was a promising Salmonella vector for oral delivery of vaccine antigen [23]. The LPS profile of each attenuated strain was analyzed by silver staining and Western blotting.
Female ICR mice (4–6-week-old) were obtained from Hangzhou Medical College (Zhejiang, China). The ICR mice were randomly divided into four groups (10 per group), and each group was inoculated orally with 20 μL of BSG containing approximately 1 × 109 CFU of ST05, ST06, ST07, and BSG only, respectively. The second immunization was carried out 14 days later with the same dosage. Blood samples of five mice in each group were collected from retro-orbital puncturing seven days after the booster immunization. Then, each group was challenged orally with 5 × 107 CFU of ATCC14028 (~ 100 times LD50) 14 days after the booster injection.
As described previously, serum antibody concentrations were determined using a quantitative enzyme-linked immunosorbent assay (ELISA) [14]. S. Typhimurium LPS was extracted and coated on microtiter plates at a concentration of 1 µg/mL as previously described [24]. The plates were incubated overnight at 4 °C before being blocked for 2 h at room temperature with PBS containing 5% bovine serum albumin (BSA). Then, for the LPS-coated wells, 100 μL of a 1:100 diluted serum was applied in triplicate to individual wells. Goat anti-mouse IgG, IgG1, IgG2a, and IgA (Abcam, Shanghai, China) were sequentially added to the wells, followed by a p-nitrophenyl phosphate substrate (Sigma-Aldrich, St. Louis, MO, USA). Color development was recorded at 405 nm using a SYNERGYH1 microplate reader (BioTek Instrument, Winooski, VT, USA).
Serum bactericidal activity (SBA) and complement deposition detection
The serum samples obtained from mice were inactivated at 56 °C for 30 min, and mid-log phase bacteria were collected for tenfold serial dilution. Sera samples were two-fold serially diluted from 1:25 to 1:100. Then, 10 µL of diluted bacteria (104 CFU/mL) were mixed with 50 µL inactivated serum, 25 µL of rabbit complement (Cedarlane), and 15 µL of PBS and incubated for 1 h at 37 °C. The positive control was a mixture of bacteria and rabbit complement with inactivated rabbit anti-serum against Salmonella O4 (Tianjin Biochip Corporation, Tianjin, China). The blank control was bacteria in PBS buffer, and the negative control was a mixture of bacteria and complement. Then, the mixture was serially ten-fold diluted and spread on LB agar plates. Bacterial counts and survival rates were calculated by comparing the viable count to the blank control, and statistical analysis was performed by the t-test using Graphpad Prism.
The complement deposition ability was detected using inactivated sera. 1 mL of mid-log phase bacterial culture was washed and resuspended in PBS. After that, 50 µL of the bacterial sample was centrifuged and resuspended in 100 µL of 10% complement-inactivated sera for a 30 min incubation at 37 °C. The samples were then washed, resuspended, and incubated for 30 min at 37 °C in PBS containing 30 µL of rabbit complement. After another PBS wash, the samples were stained for 30 min in the dark on ice with 100 µL of FITC-conjugated goat anti-rabbit complement C3 (1:200 dilution, MP Biomedicals), resuspended in 2% formaldehyde, and analyzed by flow cytometry (BD FACSVerse™). The negative control was wild-type S. Typhimurium incubated with non-vaccinated complement-inactivated mouse sera.
Cellular stimulation and cytokine detection in mouse splenic CD4+ T cells
The preparation of single-cell spleens was carried out as previously described [25]. 7 days after the boost immunization, splenocytes were stimulated with S. Typhimurium LPS (50 ng/µL) for 8 h at 37 °C with 5% CO2 in the presence of a protein transport inhibitor mixture (Thermo Fisher). Cytokine expression of CD4+ T cells was measured using rat anti-mouse CD3-Alexa Fluor 700, CD4-FITC, IFNγ-APC/Cy7, and IL-4-Alexa Fluor 647 (eBioscience). The ratio of cytokine-positive cells in the unstimulated sample was subtracted from the antigen-stimulated value of the same mouse to calculate the percentage of antigen-specific cells.
The biosynthesis of E. coli O2 OAg in attenuated Salmonella and chicken immune protection
To determine whether attenuated Salmonella ST09 (ATCC14028 ΔwzzST::wzzECO2ΔasdΔcrpΔcyaΔrfbP), with a medium OAg length (13–21 RUs), was a better choice for E. coli O2 delivery than ST08 (ATCC14028 ΔasdΔcrpΔcyaΔrfbP), with a long OAg length (native RUs), E. coli O2 OAg was biosynthesized in attenuated S. Typhimurium ST08 and ST09, and the immune protection assay in chickens was performed.
One-day-old Xiaoshan chickens were purchased from Hangzhou Xiaoshan Donghai culture Co. Ltd. After the first seven days of free-range raising, the chickens were divided randomly into four groups. The regimens were prime immunized at 7 days of age and boosted with 1 × 108 CFU/100 µL oral gavage at 14 days of age. Ten days after the second immunization, serum was collected from five chickens in each group. The remaining chickens were challenged with 1 × 109 CFU of the APEC O2 strain via injection, and mortality was recorded daily for 2 weeks. Immune responses were measured in the same manner as previously described [26]. Immune sera were collected from the jugular veins and diluted in steps ranging from 1:100 to 1:800. The LPS-specific antibody was detected with goat anti-chicken IgY (Abcam, Shanghai, China). The ELISA titer refers to the highest dilution of sera with an OD405 value exceeding 2.1-fold above the negative control. Furthermore, chickens were weighed once a week during the feeding period.
mRNA level of classic cytokines in chicken spleen
Four genes of IL-2, IL-4, IL-10, and IFN-γ were chosen for qPCR analysis to determine the mRNA levels of those involved in the immune response. Spleens were taken 7 days after the APEC O2 challenge. Total RNA was dissolved in Tris–EDTA (pH 7.5) buffer after extraction with the FastPure Cell/Tissue Total RNA Isolation Kit (Vazyme). The concentration of RNA was determined using the SYNERGYH1 Microplate Reader (BioTek Instrument). cDNA was generated from 1 µg of total RNA using Hiscript III reverse transcriptase (Vazyme). The Hiscript III All-in-one RT SuperMix Perfect for qPCR (Vazyme) was used to examine the mRNA transcripts of IL-2, IL-4, IL-10 and IFN-γ, as well as the housekeeping β-actin. Target gene transcripts were normalized to the housekeeping gene β-actin. The relative expression was calculated using the comparative method of 2−ΔΔCt, where ΔCt = Ct (target gene)-Ct (housekeeping gene), ΔΔCt = ΔCt (test sample)- ΔCt (reference sample).
Histopathological and immunohistochemical staining of the liver and spleen from chickens
Surviving chickens from each group were chosen randomly for histopathological and immunohistochemical staining 7 days after the APEC O2 wild-type strain DE17 challenge. The liver and spleen were collected and fixed in 4% buffered formalin for 24–48 h before being stained with hematoxylin and eosin (HE). Tissue samples from the BSG-immunized group served as negative controls.
Immunohistochemistry was performed on formalin-fixed and paraffin-embedded tissue sections (4 μm). Sections of liver and spleen tissues were immunostained to evaluate the expression and distribution of the E. coli O2 antigen. The primary antibody was rabbit polyclonal against E. coli O2 (Tianjin Biochip Corporation, Tianjin, China) (1:100 dilution), and the secondary antibody was HRP-conjugated goat anti-rabbit (Servicebio) (1:200 dilution). The immunoreactivity was then visualized using 3,3-diaminobenzidine tetra-hydrochloride (DAB). The nucleus was counterstained with hematoxylin and photographed with Leica Microsystems at 200 × and 400 × magnification. Image-pro plus 6.0 was used for image analysis.
Statistical analysis
Data were analyzed using GraphPad Prism 5 software (Graph Software, San Diego, CA, USA) and expressed as the means ± SD. A two-sample t-test was used for comparison between two groups, and ANOVA was used for multi-group comparison. P < 0.05 was considered statistically significant.
Results
Construction and identification of mutant strains
In order to obtain S. Typhimurium with various OAg lengths, the wzzST was first deleted from ATCC14028 by homologous recombination, yielding the ΔwzzST mutant strain namely ST03, then, the wzzECO2 was amplified by primer wzzECO2-F/R, cloned, and inserted into the pRE112 suicide plasmid. After conjugative transfer, organisms containing heterologous wzzECO2 were screened and sequenced. If the inserted sequence was identical to wzz from E. coli O2, the genetic substitution mutant ΔwzzST::wzzECO2 was successfully constructed and named ST04. Silver-stained SDS-PAGE (Figure 1A) and Western blotting (Figure 1B) were used to further examine the LPS profile of each strain. The LPS OAg length was categorized according to the OAg length classification method both in Salmonella and E. coli [13]. ST03 (lane 1) showed an LPS ladder with 2–7 RUs, which was assigned to the short OAg length group (< 15 RUs). ST04 (lane 2), showing an LPS ladder with 13–21 RUs, was assigned to the intermediate OAg length group (15–20 RUs). Wild-type ATCC14028 (lane 3) had a similar LPS ladder with 16–35 RUs, and was assigned to the long OAg length group (20–35 RUs).
Figure 1.
Analysis of LPS profiles from S. Typhimurium with various OAg lengths. A Identification of gene replacement mutants by silver-stained SDS-PAGE. The lower band was unsubstituted lipid A-core, whereas the upper cluster of bands showed LPS with different lengths of OAg. Lane 1, 2 and 3 represents ST03 (ΔwzzST), ST04 (ΔwzzST::wzzECO2) and ATCC14028, respectively. ST03 (ΔwzzST) was assigned into short OAg length group (< 15 RUs), ST04(ΔwzzST::wzzECO2) was assigned into intermediate OAg length group (15–20 RUs), and the RUs of WT strain ATCC14028 was assigned into long OAg length group (20–35 RUs). B Western blotting detection against anti-Salmonella O4 serum. C LPS profiles of attenuated S. Typhimurium with different OAg lengths. D Identification of panel C by Western blotting. Lane 4, 5, 6 represents ST06 (ATCC14028ΔwzzSTΔcrpΔcya), ST07 (ATCC14028ΔwzzST::wzzECO2ΔcrpΔcya) and ST05 (ATCC14028ΔcrpΔcya), respectively. E LPS profiles of E. coli O2 synthesized in S. Typhimurium ST08 (ATCC14028ΔwzzSTΔcrpΔcyaΔasdΔrfbP) and ST09 (ATCC14028ΔwzzST::wzzECO2ΔcrpΔcyaΔasdΔrfbP). Lane 7, 8, 9 represents ATCC14028, E. coli O2, O2-ST08, and O2-ST09, respectively. F Western blotting of LPS with rabbit antiserum against serotype O2 E. coli.
The above strains of ST03, ST04, and ATCC14028 were further attenuated by deleting crp and cya from the genome, generating ATCC14028ΔwzzSTΔcyaΔcrp, ATCC14028 ΔwzzST::wzzECO2ΔcyaΔcrp, and ATCC14028ΔcyaΔcrp. After PCR determination and Sanger sequencing, the attenuated strains were named ST06, ST07 and ST05, respectively. The LPS profile of the attenuated strains was further confirmed by silver staining (Figure 1C) and Western blotting (Figure 1D). The profile shows that bacterial OAg length was not affected after attenuation (Figures 1A and C). The result reveals that the OAg length is independent of crp and cya attenuation.
To deliver E. coli O2 OAg polysaccharide, the balanced-lethal host-vector system based on asd, which encodes diaminopimelic acid (DAP), was further constructed, ensuring the stability of the heterologous plasmid pSL2162 in bacterial hosts without antibiotic pressure. The rfbP gene encodes UDP-phosphate galactose phosphotransferase, which is responsible for the transfer of galactose to the Undpp, rfbP deletion results in the absence of OAg in Salmonella LPS. Thus, the asd and rfbP genes were further deleted from the strains ST05 and ST07, resulting in ST08 (ATCC14028ΔcyaΔcrpΔasdΔrfbP) and ST09 (ATCC14028 ΔwzzST::wzzECO2ΔcyaΔcrpΔasdΔrfbP).
Then the E. coli O2 OAg carried by pSL2162 was electrotransformed into ST08 and ST09, yielding recombinant strains O2-ST08 and O2-ST09. The LPS profiles of O2-ST08 and O2-ST09 with different OAg lengths (lanes 9 and 10) were also detected by silver staining and Western blotting (Figures 1E, F). According to the results, the length of heterologously expressed E. coli O2 OAg length is determined by the Wzz. The O2-ST09 had 13–21 RUs, whereas the O2-ST08 had 16–35 RUs, which were used to evaluate the effect of OAg length on the protective efficacy of E. coli O2 in chickens.
The effect of OAg length on S. Typhimurium colonization in mice, cell membrane permeability, antibiotic resistance and complement resistance
LPS is an essential virulence factor that promotes infection in a mouse model. Therefore, we evaluated the effects of OAg length on bacterial colonization ability in BALB/c mice and discovered that the total bacterial load increased from 6 to 9 days post-infection (dpi). For colonization in intestinal cells (Figure 2A), no statistical difference was observed at 6 dpi, while the ST04 group shows a lower colonization than the WT strain ATCC14028 (P < 0.05) and a higher level than ST03 at 9 dpi (P < 0.01). The ST03 group was attenuated by more than one order of magnitude compared with that at 9 dpi. Thus, the bacterial colonization ability in the intestine in order from high to low is ATCC14028, ST04 and ST03. The same trend was also observed in the spleen (Figure 2B) and liver (Figure 2C) colonization, except for the data at 9 dpi, which shows that ST04 exceeded ATCC14028, as two mice died in the WT group due to high bacterial load (LD50 = 5 × 105 CFU). Overall, the results show that OAg length influenced bacterial colonization ability in mice.
Figure 2.
The impacts of OAg length on bacterial colonization in mice, cell permeability and antibiotic resistance. Colonization of ATCC14028, ST03 and ST04 in mice intestines (A), spleens (B), and livers (C). D Membrane permeability of ATCC14028, ST03 and ST04. The study was performed by recording the fluorescence of Ethidium influx into wzz substitution mutant strains at 600 nm with excitation at 545 nm. Blank control is ATCC14028 suspended in 50 mM potassium phosphate buffer without Ethidium bromide, PC control is ATCC14028 treated with 75% ethanol for 1 h. E Antibiotic sensitivity assay. The inhibitory zone diameter for each strain was measured. Error bars represent the standard deviation of 3 replicate samples.
LPS, the major component of outer membranes, also acts as a permeability barrier. To investigate the effect of OAg length on S. Typhimurium membrane permeability, ethidium bromide was used as a fluorescent probe for outer membrane (OM) bilayer permeability. The membrane permeability tests show that the blank control of ATCC14028 without ethidium bromide had the lowest fluorescence value and the PC control (ethanol-treated strain) had the highest fluorescence value, indicating that the test results were valid. The fluorescence value of the three tested strains, from highest to lowest, were ATCC14028, ST04 and ST03. The fluorescence value of ATCC14028 was more than twice as high as that of ST03 (Figure 2D), indicating that OAg length does impact cell membrane permeability [27].
As cell permeability affects antibiotic resistance, we also measured antibiotic sensitivity to SXT, Amp, Cm, NOR, P, and TE (Figure 2E). The diameters of the tested strains for SXT, from high to low, were ST03, ST04 and ATCC14028. ST04 exhibits greater resistance to SXT than ATCC14028 (P < 0.05). The same trend was also seen in the Amp, Cm, NOR, P and TE sensitivity detection. Although all three detected strains met the criteria for identifying antibiotic sensitivity and resistance, the data show that OAg length modification affected bacterial antibiotic resistance.
In addition, the MIC for DOC (an anionic surfactant) and polymyxin B (a cationic antimicrobial peptide) were also measured. We discovered that the MIC value of wild-type ATCC14028 to polymyxin B was 1.25 µg/mL, while ST03 and ST04 show a MIC value of 0.625 µg/mL, making them more sensitive to polymyxin B than wild-type ATCC14028, suggesting that the wzzST gene contributed to the sensitivity to polymyxin B. Regarding the DOC sensitivity, ST04 has a MIC value of 50 mg/mL, higher than that of ATCC14028 and ST03, with a MIC value of 25 µg/mL (Table 3).
Table 3.
MIC of DOC and Polymyxin B, swimming motility of wild type Salmonella and its derivatives
| Strain | O-antigen length (RUs)a | MIC | Complement resistance (%)c | |
|---|---|---|---|---|
| DOC (mg/mL)b | Polymyxin B (μg/mL) | |||
| ΔrfbP | 0 | 6.25 | 0.625 | 9.54 ± 2.4 |
| ST03 | 2–7 | 25 | 0.625 | 58.48 ± 8.9 |
| ST04 | 13–21 | 50 | 0.625 | 68.18 ± 1.8 |
| S. Typhimurium ATCC14028 | 20–35 | 25 | 1.25 | 116.67 ± 20.4 |
a O-antigen length of S. Typhimurium.
b DOC, deoxycholate.
c The average survival rate (means ± SD).
The length of LPS OAg chains is thought to determine complement resistance [12]. Thus, the complement sensitivities of the wzz mutants to WT were compared. ATCC14028 was discovered to be highly resistant to complement-mediated killing (survival rates of >100% after 1 h incubation). ST03 had about two-fold lower killing susceptibility than the WT, whereas ST04 shows a ranking-conscious complement resistance in between (Table 3).
The above findings show that LPS OAg length affected bacterial colonization, cell permeability, antibiotic resistance, and complement resistance in S. Typhimurium.
The effect of OAg length on humoral immune responses in mice
The immune protective efficacy against Salmonella of the modified delivery vector was first evaluated in a murine model. After serum samples were collected from mice, S. Typhimurium LPS-specific IgG and IgA antibodies were evaluated using an ELISA on LPS-coated plates. Compared to the BSG control group, all strains generated more significant S. Typhimurium LPS-specific IgG (Figure 3A), with ST07 (ATCC14028ΔwzzST::wzzECO2ΔcrpΔcya), eliciting a significantly higher level than ST06 (ATCC14028ΔwzzSTΔcrpΔcya) and a slight increase when compared to the ST05 (ATCC14028ΔcrpΔcya) vaccinated group. Similar trends were also observed in the IgA (Figure 3B), IgG1 (Figure 3C), and IgG2a (Figure 3D) level detections. Meanwhile, all the immunized groups induced a significantly higher level of IgG2a specific to the S. Typhimurium LPS compared to IgG1 was observed in the groups, indicating a predominantly Th1-type response.
Figure 3.
Antibody immune responses induced by S. Typhimurium with variable OAg lengths in mice. Serum IgG (A), IgA (B), IgG1 (C), and IgG2a (D) specific for S. Typhimurium LPS were measured by ELISA. Error bars represent the standard deviation of 5 replicate samples. *P < 0.05, **P < 0.01 assessed by two-way ANOVA. E Serum bactericidal assay. Serum collected from BSG, ST06, ST07, and ST05-immunized groups and commercial rabbit serum against salmonella O4 (PC) were reacted with wild-type ATCC14028 to determine the survival rate of S. Typhimurium. Error bars represent the standard deviation of 3 replicate samples. F Flow cytometry histograms of C3 complement deposition. Antibody deposition on S. Typhimurium in 10% pooled antiserum from each group of attenuated S. Typhimurium differing for OAg length immunized mice. Wild-type S. Typhimurium incubated with sera from the BSG-inoculated group was set as the negative control (black line), incubated with sera from the ST05 (ATCC14028ΔcrpΔcya)-inoculated group was set as the positive control (green-yellow line). The blue line indicates incubation with sera from ST06 (ATCC14028ΔwzzSTΔcrpΔcya)-inoculated group, and the purple line indicates the incubation with sera from mice immunized with ST07 (ATCC14028ΔwzzST::wzzECO2ΔcrpΔcya).
The serum bactericidal activity was also detected to evaluate the humoral immune response. The results show that the percentage of the surviving bacteria increased as the serum concentration was diluted. After being incubated with serum at a dilution of 1:25, the ST07 group had the lowest survival rate, even lower than the positive control (rabbit serum against Salmonella O4) (P < 0.05). When incubated with serum at a dilution of 1:50, the ST07-immunized group had a significantly lower number of surviving bacteria than ST05, ST06 and BSG groups (P < 0.05). When incubated with serum at a dilution of 1:100, the ST07 group had a comparable survival rate to that of the ST06 group (P > 0.05) (Figure 3E). According to the results, the antibodies elicited in the ST07 group possess a powerful capacity for bacterial killing.
The antigen and antibody complex would deposit complement if the bacterial killing was antibody-dependent. Then the complement deposition efficiency was determined by flow cytometry. When incubated with sera from mice immunized with ST07 (ATCC14028ΔcrpΔcyaΔwzzST::wzzECO2) (blue line), the deposition of C3 on the surface of S. Typhimurium was higher than that collected from the ST06 (ATCC14028ΔcrpΔcyaΔwzzST) (purple line) immunized group and even exceeded the positive control of the ST05 group (ATCC14028ΔcrpΔcya) (green-yellow line) (Figure 3F). The result shows that bacterial OAg length was related to antibody level and functional activity in bacterial killing, as well as complement deposition efficacy of sera.
The protective efficacy in mice
To see whether the protective immunity was due to the OAg length-dependent serum activity, mice were challenged with 5 × 107 CFU (~ 100 LD50) of S. Typhimurium 2 weeks after the booster. All the immunized groups conferred 100% protection, more significantly than the BSG-treated group (P < 0.05). This could be attributed to the reason that outer membrane immunogens other than modified LPS played functional roles in eliciting immune protection against S. Typhimurium. A comparable previous study showed that outer membrane vesicles (OMV) from gene deletion implicated in LPS synthesis also induced good protection against S. Typhimurium, which could be a reasonable explanation [28].
The LPS-specific CD4+ T-cell immune response in mice
T-cell immunological responses across these strains were also detected after immunization. IFN-γ was selected to reflect a Th1 immune response, whereas IL-4 is a cytokine that indicates Th2 immunological responses. Flow cytometry tests were used to assess the LPS-specific CD4+ T-cell responses generated by the OAg length variation strains after stimulation of splenocytes in vitro with S. Typhimurium LPS. The result shows that the ST07 (ΔcrpΔcyaΔwzzST::wzzECO2) elicited a similar IFN-γ level to the ST05 (ΔcrpΔcya) and ST06 (ΔcrpΔcyaΔwzzST) (Figure 4A), and a higher IL-4 level than that of ST06 and ST05 without a statistical difference (Figure 4B). The level of IL-4 cytokine was higher than that of IFN-γ, indicating that Th2-type cytokines play a dominant role in response to S. Typhimurium infection of the host immune system.
Figure 4.
Cytokine expression in CD4+ T cells stimulated with S. Typhimurium LPS ex vivo. After immunization in mice, the cytokine stimulation index (SI) was expressed relative to the percentage of IFN-γ (A) or IL-4 (B) cell subsets in the BSG-treated group. Data from two independent experiments were pooled and analyzed (n = 4) by t-test and two-way ANOVA. NS = not significant. Error bars represent the standard deviation of 4 replicate samples.
Immune protection evaluation of recombinant O2-Salmonella in chickens
To determine whether ΔwzzST::wzzECO2 mutant has superior immunization potential in delivering heterologous E. coli O2 OAg polysaccharide, the APEC O2 O-polysaccharide gene cluster carried by plasmid pSL2162 was transformed into ST09 (ATCC14028 ΔwzzST::wzzECO2ΔcrpΔcyaΔrfbPΔasd), resulting in the recombinant strain O2-ST09. The protective efficacy was evaluated in chickens and compared to that of O2-ST08 (ATCC14028ΔasdΔcrpΔcyaΔrfbP). Since humoral immunity is an essential index in evaluating the protection of the APEC vaccine, serum IgY specific to APEC O2 LPS was detected by ELISA seven days after secondary immunization. The serum antibody level of IgG isolated from the O2-ST09 immunized group was 1:400, modestly higher than that elicited in the O2-ST08 immunized group and significantly higher than the BSG and ST08 control groups (Figure 5A). The result indicates that specific immune response against O2 LPS was elicited after immunization with strain O2-ST09, which possess 13–21 RU (Figure 5A).
Figure 5.
Immune protective evaluation in birds. A Antibody level detection, B Survival rate, C mRNA level of cytokines elicited in immunization group, the cytokine stimulation index (SI) was expressed relative to the percentage of IL-2, IL-4, IL-10 and IFN-γ mRNA level in the BSG-treated group. Data were analyzed (n = 5) by t-test. *P < 0.05, **P < 0.01, NS = not significant. Error bars represent the standard deviation of 5 replicate samples.
After the challenge with APEC O2 wild-type strain DE17, the mortality was recorded daily for 15 days. The survival rates of chickens immunized with O2-ST09, O2-ST08, and ST08, were 80.00%, 53.33%, and 26.67%, respectively (Figure 5B). Furthermore, the O2-ST09 immunized group maintains an average weight gain with the O2-ST08 immunized group and the control group (Table 4).
Table 4.
Weight gain of Xiaoshan chickens from 1 to 4 weeks
| Age | Groups (average ± SD) (g) | |||
|---|---|---|---|---|
| BSG | ST08 | O2-ST08 | O2-ST09 | |
| 1st week | 48.66 ± 7.79 | 48.66 ± 7.79 | 48.66 ± 7.79 | 48.66 ± 7.79 |
| 2nd week | 98.59 ± 17.63 | 113.85 ± 11.78 | 116.25 ± 11.47 | 111.51 ± 9.58 |
| 3rd week | 174.28 ± 29.06 | 192.3 ± 23.36 | 197.39 ± 18.69 | 187.7 ± 19.91 |
| 4th week | /a | 195.41 ± 39.76 | 224.48 ± 25.97 | 210.31 ± 26.33 |
a BSG control group, the body weight was not calculated since only one chicken survived until weighing.
The results reveal that E. coli O2 OAg synthesized in S. Typhimurium with 13–21 RU could help trigger better immune protection against E. coli O2, which provides a better way to prevent E. coli O2 infection.
mRNA level of cytokines in chickens
Data from qPCR tests show that the O2-ST09 immunized group had higher mRNA levels of IL-4, IL-2 and IL-10 than the O2-ST08 immunized group and the BSG control group (P < 0.01). There was no significant difference in IFN-γ eliciting (Figure 5C). The increase of IL-2 and IL-4 suggesting that the activation of CD4+ T cell and the differentiation of Th2 cells were promoted. The enhanced secretion of IL-10 may be caused by the promotion of Th2 differentiation.
Histopathological analysis and immunohistochemical staining of the liver and spleen from chickens
Histopathological lesions in chickens were compared in the immunized groups BSG, ST08, O2-ST08 and O2-ST09 after the challenge with the wild-type strain DE17. The BSG control group had liver congestion, inflammatory cell infiltration, spleen congestion, and immune cell disorders, as illustrated in Figure 6. Chickens vaccinated with ST08 showed signs of degeneration and congestion. The O2-ST08 group had a disorganized liver with congestion. The O2-ST09 group showed slight degeneration and congestion of liver cells. No remarkable clinical signs of illness were observed in the spleens of groups vaccinated with O2-ST09, O2-ST08 and ST08. Furthermore, the BSG and ST08 control groups had clinically typical pericarditis and spleen enlargement, but the O2-ST08 and O2-ST09 immunized groups, particularly the O2-ST09 immunized group, had relatively minor clinical lesions (Additional file 1).
Figure 6.
Representative images of histopathological changes in birds. Sections were stained with HE for pathological examination. Gross lesions and immune infiltrate were visually assessed. Scales bars = 50 μm.
We conducted immunohistochemistry using the rabbit anti-E. coli O2 antibody to confirm whether the immunization can confer protection against the E. coli O2 challenge. The brownish-yellow area represents the challenge strains that were not neutralized by antibodies induced by immunization. No significant differences in the brownish-yellow area were observed in liver cells among the investigated groups (Figure 7). In the spleen, the brownish-yellow area was detected in the BSG, ST08 and O2-ST08 immunized groups; no obvious reaction area was found in the splenic cells of the O2-ST09 immunized group (Figure 7).
Figure 7.
Representative images of immunohistochemical staining of E. coli O2 after challenge in birds. Immunohistochemical staining were performed on paraffin-embedded section of chicken liver and spleen tissues. The hematoxylin-stained nucleus are blue, DAB positive expression is brownish yellow. Scales bars = 100 μm.
Discussion
LPS is a common component of cell envelopes, accounting for approximately 70% of gram-negative bacterial outer membranes [29]. The length of the OAg varies the most, ranging from a single repeat unit of 3 to 4 sugars to more than one hundred sugar units, resulting in an efficient extracellular barrier [30]. A previous study has shown that the OAg length influences the magnitude and quality of the immune response elicited by OAg-conjugate vaccines [31]. Because different wzz genes produce different OAg sizes, the wzz can be used to manipulate the polysaccharide length, altering the immunogenicity of the strains [32].
In this study, we assessed the effect of OAg length on S. Typhimurium immunogenicity by expressing the wzz gene from E. coli. All these bacteria depend on the Wzx/Wzy pathway to synthesize LPS. In the following experiment, we used a single variable factor by changing the OAg length determinator wzz without considering the fepE-encoded VL OAg chain length (HMW polysaccharide), generating a series of mutant strains of ΔwzzST, ΔwzzST::wzzECO2. The immune response detection shows that the mutant S. Typhimurium ST07 (ΔcrpΔcyaΔwzzST::wzzECO2) stimulated a slightly higher IgG level in mice than in the other strains that were tested, indicating that ST07 triggered a strong humoral immune response to S. Typhimurium LPS. The recombinant strain O2-ST09 (ΔasdΔcrpΔcyaΔrfbPΔwzzST::wzzECO2) with medium OAg length induced more significant functional IgG antibodies and elicited more robust immune protection than O2-ST08 (ΔasdΔcrpΔcyaΔrfbPΔwzzST) with long OAg length. Early research found that the medium-sized oligosaccharides end-linked to carriers had high immunogenicity efficacy in the protection evaluation of licensed Haemophilus influenzae type b and Neisseria meningitidis glycoconjugates [33]. Additionally, short-chain Vi-polysaccharide induced a more prolonged proliferation of Vi-specific B cells in the spleen than the long-chain Vi-CRM197 conjugate [34]. Our results which were consistent with these findings, show that the Salmonella delivery vector with a medium OAg length has an advantage in eliciting a polysaccharide-specific immune response. Conflicting results, however, have been reported, such as large-sized OAg glycoconjugates (HMW-TT) eliciting a much lower IgG titer than smaller-sized OAg glycoconjugates (LMW-TT) and low-molecular-mass OAg fragment eliciting notably higher antibody levels in mice than full-length OAg [35]. Two hypotheses are being considered, with one explanation being the various vaccine forms. Previous research in Shigella, Francisella tularensis, or S. Typhimurium usually refers to the protein-conjugated polysaccharide vaccine, from which LPS was extracted and conjugated to a carrier protein, such as TT, whereas glycan chain length is affected by various factors and conditions used during glycoconjugate vaccine production [33]. In contrast, the polysaccharide reported here was biosynthesized in a live S. Typhimurium strain, and the extraction methods had no effect on LPS length, affinity, or avidity. Another possibility is that the chain length was defined inconsistently; if the VL OAg length is responsible for HMW and the L OAg length is responsible for LMW, the results obtained here were reached by modifying LMW while keeping HMW rather than directly comparing with HMW and LMW. So, we assume that the classification method is another factor affecting the conclusion reached.
The anti-LPS antibody response profile was dominated by a Th2 immunological response. Exactly, live attenuated Salmonella has the advantage of effectively presenting antigens to dendritic cells and is favored for their ability to trigger a robust humoral immune response. Therefore, the antigen-specific CD4+ T cell immune response was also detected. As expected, ST07 induced a similar IFN-γ and IL-4 level to ST05 in mice, and the CD4+ T cell immune response to S. Typhimurium LPS was not decreased after the mutation of wzzST::wzzECO2. Furthermore, compared to O2-ST08, the O2-ST09 immunized group even elicited a higher mRNA level of IL-2, IL-10 and IL-4 in chickens, each of which is necessary for the proliferation of activated T cells, the regulation of Treg cells and the promotion of Th2 cells, respectively. This suggests that the intermediate OAg length plays a role in the induction of an optimal Th2-biased immune response and is directly related to the immunogenicity of S. Typhimurium, particularly for the delivered polysaccharide.
Previous studies have shown that LPS was chosen as a gateway for antibacterial proteins to disrupt bacterial OM and perform antibacterial actions because of its conserved structure and influence on outer membrane protein behavior and presentation because most antibiotics are currently directed at intracellular processes and must be capable of penetrating the bacterial cell envelope [36]. Moreover, altering these molecules has a significant impact on bacterial sensitivity to various antibiotics as well as drug resistance [37]. Polymyxin B and DOC, for example, are LPS chemotype sensitive [38, 39]. In addition, LPS mutations are responsible for quinolone (e.g., Norfloxacin) and beta-lactam (e.g., Ampicillin, Penicillin) resistance [40]. Thus, we postulated that the antibiotic receptor would be exposed if OAg length shortens, allowing for a lower minimum inhibitory dose of polymyxin B for S. Typhimurium and increasing the sensitivity to NOR, ampicillin, and penicillin. Moreover, the changing of OAg length could alter the OM landscape by influencing inner membrane protein responses for cell envelope stability and colicin secretion, thus influencing bacterial resistance to DOC and tetracycline [41].
Cell membrane permeabilization is one of the best-known mechanisms of antibiotic activity [42]. LPS covers a large portion of the cell surface, creating a permeability barrier that keeps harmful chemicals such as antibiotics and bile salts from entering [43]. We found that decreasing the length of the OAg molecule reduced cell membrane permeability. This change in permeability may aid Salmonella adaptation to specific environmental conditions, which would explain why the bacteria are sensitive to polymyxin B and DOC. It is not known how exactly OAg length reduces membrane permeability. The enterobacterial common antigen (ECA) is a surface antigen related to OAg that plays a role in membrane maintenance [44]. It remains to be seen whether varying the length of the OAg influences ECA and, subsequently, the permeability barrier of the outer membrane (OM).
In addition to chemical warfare, bacteriophage infections and the immune system all rely on the cell membrane as the first line of defense against germs [45]. As a result, we identified the effect of strains with varying OAg lengths on complement-mediated killing and complement resistance deposition. Our data demonstrate that the mutant strain with medium OAg length produced more antibodies involved in the complement-mediated bactericidal activity and complement deposition than strains with either long or short chains. This is partly because strains with long chains produce blocking antibodies to impair complement-mediated bacterial killing, while strains with short-chains create fewer epitopes and blocking antibodies. The results support an earlier finding that S. Typhimurium strains with shorter OAg side chains are more susceptible to serum [21, 46]. In addition, antibodies against long OAg inhibit serum killing [47]. Even the previous study suggested that E. coli O157 strains with medium or long-length OAg chains may be more resistant to serum complement than those with short chains [13]. It is suspected that the phenomenon is because LPS OAg, composed of a variable number of repeat units, containing more than 100 RUs in a single cell, provides a formidable barrier to limit the access of the antibody to the bacterial surface. Changing the length of OAg would modify the chemical and physical structure of LPS OAg and the presentation of specific epitopes within proteinaceous surface antigens [48]. The protective quality of the ΔwzzST::wzzECO2 in complement resistance indicates that the type of OAg repeat presented plays a role as well, confirming that the length of the OAg side chain regulates bacterial resistance to the serum complement system [49]. More research is required to understand how the LPS-specific antibodies interact with the surface of bacteria.
In summary, we provide evidence that the LPS OAg length regulator wzz significantly affects S. Typhimurium. Furthermore, the recombinant strain O2-ST09 derived from ΔwzzST::wzzECO2 contributed to the protective efficacy in chickens. These findings expand our knowledge of the influence of OAg determinant Wzz on Salmonella and the polysaccharide delivered.
Supplementary Information
Additional file 1. Representative images of clinical and autopsy changes. The severity of heart and spleen lesions were assessed to evaluate the immune protective efficacy against APEC O2 challenge. Gross lesions were evaluated visually.
Acknowledgements
The authors thank Dr Xiangan Han and Xinxin Zhao for providing the strains DE17, ATCC14028, and plasmid pRE112 used in this study.
Authors' contributions
HS, CC, YH, and AC conceived and designed the experiments; YH, PL, PW, XC, YC, QC, JX, RZ, JX, SD performed the experiments; YH, PL, and PC analyzed the data; YH, CC wrote the manuscript; HS and HZ substantively revised it. All authors read and approved the final manuscript.
Funding
The study was supported by the National Natural Science Foundation of China 31902280, 31972648, 31872620, 32172849, Natural Science Foundation of Ningbo City 202003N4179 and the Zhejiang A&F University Talent Initiative Project (2019FR041, 2019FR035).
Availability of data and materials
All data generated or analyzed during this study are included in this published article.
Declarations
Ethics approval and consent to participate
Animal care and use protocols were performed in accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals approved by the State Council of the People’s Republic of China. The protocol was approved by the Institutional Animal Care and Use Committee of Zhejiang A & F University (Permit Number: ZJAFU/IACUC_2011-10-25-02).
Competing interests
The authors declare that they have no competing interests.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Yue Han, Ping Luo and Huan Zeng contributed equally to this work
Contributor Information
Changyong Cheng, Email: lamge@zafu.edu.cn.
Houhui Song, Email: songhh@zafu.edu.cn.
References
- 1.Breijyeh Z, Jubeh B, Karaman R. Resistance of gram-negative bacteria to current antibacterial agents and approaches to resolve it. Molecules. 2020;25:1340. doi: 10.3390/molecules25061340. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Nichols M, Gollarza L, Palacios A, Stapleton GS, Basler C, Hoff C, Low M, McFadden K, Koski L, Leeper M, Brandenburg J, Tolar B. Salmonella illness outbreaks linked to backyard poultry purchasing during the COVID-19 pandemic: United States, 2020. Epidemiol Infect. 2021;149:e234. doi: 10.1017/S0950268821002132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Soares BD, de Brito KCT, Grassotti TT, Filho HCK, de Camargo TCL, Carvalho D, Dorneles IC, Otutumi LK, Cavalli LS, de Brito BG. Respiratory microbiota of healthy broilers can act as reservoirs for multidrug-resistant Escherichia coli. Comp Immunol Microbiol Infect Dis. 2021;79:101700. doi: 10.1016/j.cimid.2021.101700. [DOI] [PubMed] [Google Scholar]
- 4.Sun X, Stefanetti G, Berti F, Kasper DL. Polysaccharide structure dictates mechanism of adaptive immune response to glycoconjugate vaccines. Proc Natl Acad Sci U S A. 2019;116:193–198. doi: 10.1073/pnas.1816401115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Stefanetti G, Okan N, Fink A, Gardner E, Kasper DL. Glycoconjugate vaccine using a genetically modified O antigen induces protective antibodies to Francisella tularensis. Proc Natl Acad Sci U S A. 2019;116:7062–7070. doi: 10.1073/pnas.1900144116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Costantino P, Rappuoli R, Berti F. The design of semi-synthetic and synthetic glycoconjugate vaccines. Expert Opin Drug Discov. 2011;6:1045–1066. doi: 10.1517/17460441.2011.609554. [DOI] [PubMed] [Google Scholar]
- 7.Robbins JB, Kubler-Kielb J, Vinogradov E, Mocca C, Pozsgay V, Shiloach J, Schneerson R. Synthesis, characterization, and immunogenicity in mice of Shigella sonnei O-specific oligosaccharide-core-protein conjugates. Proc Natl Acad Sci U S A. 2009;106:7974–7978. doi: 10.1073/pnas.0900891106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Jörbeck HJ, Svenson SB, Lindberg AA. Artificial Salmonella vaccines: Salmonella typhimurium O-antigen-specific oligosaccharide-protein conjugates elicit opsonizing antibodies that enhance phagocytosis. Infect Immun. 1981;32:497–502. doi: 10.1128/iai.32.2.497-502.1981. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Gasperini G, Raso MM, Arato V, Aruta MG, Cescutti P, Necchi F, Micoli F. Effect of O-antigen chain length regulation on the immunogenicity of Shigella and Salmonella generalized modules for membrane antigens (GMMA) Int J Mol Sci. 2021;22:1309. doi: 10.3390/ijms22031309. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Wiseman B, Nitharwal RG, Widmalm G, Högbom M. Structure of a full-length bacterial polysaccharide co-polymerase. Nat Commun. 2021;12:369. doi: 10.1038/s41467-020-20579-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Kalynych S, Ruan X, Valvano MA, Cygler M. Structure-guided investigation of lipopolysaccharide O-antigen chain length regulators reveals regions critical for modal length control. J Bacteriol. 2011;193:3710–3721. doi: 10.1128/JB.00059-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Murray GL, Attridge SR, Morona R. Regulation of Salmonella typhimurium lipopolysaccharide O antigen chain length is required for virulence; identification of FepE as a second Wzz. Mol Microbiol. 2003;47:1395–1406. doi: 10.1046/j.1365-2958.2003.03383.x. [DOI] [PubMed] [Google Scholar]
- 13.Osawa K, Shigemura K, Iguchi A, Shirai H, Imayama T, Seto K, Raharjo D, Fujisawa M, Osawa R, Shirakawa T. Modulation of O-antigen chain length by the wzz gene in Escherichia coli O157 influences its sensitivities to serum complement. Microbiol Immunol. 2013;57:616–623. doi: 10.1111/1348-0421.12084. [DOI] [PubMed] [Google Scholar]
- 14.Han Y, Liu Q, Willias S, Liang K, Li P, Cheng A, Kong Q. A bivalent vaccine derived from attenuated Salmonella expressing O-antigen polysaccharide provides protection against avian pathogenic Escherichia coli O1 and O2 infection. Vaccine. 2018;36:1038–1046. doi: 10.1016/j.vaccine.2018.01.036. [DOI] [PubMed] [Google Scholar]
- 15.Mylona E, Sanchez-Garrido J, Hoang Thu TN, Dongol S, Karkey A, Baker S, Shenoy AR, Frankel G. Very long O-antigen chains of Salmonella Paratyphi A inhibit inflammasome activation and pyroptotic cell death. Cell Microbiol. 2021;23:e13306. doi: 10.1111/cmi.13306. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Liu B, Qian C, Wu P, Li X, Liu Y, Mu H, Huang M, Zhang Y, Jia T, Wang Y, Wang L, Zhang X, Huang D, Yang B, Feng L, Wang L. Attachment of enterohemorrhagic Escherichia coli to host cells reduces O antigen chain length at the infection site that promotes infection. Bio. 2021;12:e0269221. doi: 10.1128/mBio.02692-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Gay P, Le Coq D, Steinmetz M, Berkelman T, Kado CI. Positive selection procedure for entrapment of insertion sequence elements in gram-negative bacteria. J Bacteriol. 1985;164:918–921. doi: 10.1128/jb.164.2.918-921.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Sambrock J, Russel DW (2001) Molecular Cloning: A Laboratory Manual (3rd edition).
- 19.Hitchcock PJ, Brown TM. Morphological heterogeneity among Salmonella lipopolysaccharide chemotypes in silver-stained polyacrylamide gels. J Bacteriol. 1983;154:269–277. doi: 10.1128/jb.154.1.269-277.1983. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Hölzer SU, Schlumberger MC, Jäckel D, Hensel M. Effect of the O-antigen length of lipopolysaccharide on the functions of Type III secretion systems in Salmonella enterica. Infect Immun. 2009;77:5458–5470. doi: 10.1128/IAI.00871-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Kong Q, Yang J, Liu Q, Alamuri P, Roland KL, Curtiss R., III Effect of deletion of genes involved in lipopolysaccharide core and O-antigen synthesis on virulence and immunogenicity of Salmonella enterica serovar typhimurium. Infect Immun. 2011;79:4227–4239. doi: 10.1128/IAI.05398-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Murata T, Tseng W, Guina T, Miller SI, Nikaido H. PhoPQ-mediated regulation produces a more robust permeability barrier in the outer membrane of Salmonella enterica serovar typhimurium. J Bacteriol. 2007;189:7213–7222. doi: 10.1128/JB.00973-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Roland K, Curtiss R, 3rd, Sizemore D. Construction and evaluation of a delta cyadeltacrp Salmonellatyphimurium strain expressing avian pathogenicEscherichia coliO78 LPS as a vaccine to prevent airsacculitis in chickens. Avian Dis. 1999;43:429–441. doi: 10.2307/1592640. [DOI] [PubMed] [Google Scholar]
- 24.Han Y, Han X, Wang S, Meng Q, Zhang Y, Ding C, Yu S. The waaL gene is involved in lipopolysaccharide synthesis and plays a role on the bacterial pathogenesis of avian pathogenic Escherichia coli. Vet Microbiol. 2014;172:486–491. doi: 10.1016/j.vetmic.2014.05.029. [DOI] [PubMed] [Google Scholar]
- 25.Su H, Liu Q, Wang S, Curtiss R, 3rd, Kong Q. Regulated delayed Shigella flexneri 2a O-antigen synthesis in live recombinant Salmonella enterica serovar Typhimurium induces comparable levels of protective immune responses with constitutive antigen synthesis system. Theranostics. 2019;9:3565–3579. doi: 10.7150/thno.33046. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Han Y, Luo P, Chen Y, Xu J, Sun J, Guan C, Wang P, Chen M, Zhang X, Zhu Y, Zhu T, Zhai R, Cheng C, Song H. Regulated delayed attenuation improves vaccine efficacy in preventing infection from avian pathogenic Escherichia coli O78 and Salmonella typhimurium. Vet Microbiol. 2021;254:109012. doi: 10.1016/j.vetmic.2021.109012. [DOI] [PubMed] [Google Scholar]
- 27.Ma P, Hu X, Wang X. The effect of the structure of lipopolysaccharide on the permeability of Escherichia coli cell membranes. J Microbiol China. 2011;08:1307–1315. [Google Scholar]
- 28.Liu Q, Liu Q, Yi J, Liang K, Liu T, Roland KL, Jiang Y, Kong Q. Outer membrane vesicles derived from Salmonella Typhimurium mutants with truncated LPS induce cross-protective immune responses against infection of Salmonella enterica serovars in the mouse model. Int J Med Microbiol. 2016;306:697–706. doi: 10.1016/j.ijmm.2016.08.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Krzyzewska E, Rybka J. Biosynthesis of lipopolysaccharides with different length of the O-specific region as a virulence factor of Gram-negative bacteria. Postepy Higieny I Medycyny Doswiadczalnej. 2018;72:573–586. doi: 10.5604/01.3001.0012.1735. [DOI] [Google Scholar]
- 30.King JD, Berry S, Clarke BR, Morris RJ, Whitfield C. Lipopolysaccharide O antigen size distribution is determined by a chain extension complex of variable stoichiometry in Escherichia coli O9a. Proc Natl Acad Sci U S A. 2014;111:6407–6412. doi: 10.1073/pnas.1400814111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Rana R, Dalal J, Singh D, Kumar N, Hanif S, Joshi N, Chhikara MK. Development and characterization of Haemophilus influenzae type b conjugate vaccine prepared using different polysaccharide chain lengths. Vaccine. 2015;33:2646–2654. doi: 10.1016/j.vaccine.2015.04.031. [DOI] [PubMed] [Google Scholar]
- 32.Hegerle N, Bose J, Ramachandran G, Galen JE, Levine MM, Simon R, Tennant SM. Overexpression of O-polysaccharide chain length regulators in Gram-negative bacteria using the Wzx-/Wzy-dependent pathway enhances production of defined modal length O-polysaccharide polymers for use as haptens in glycoconjugate vaccines. J Appl Microbiol. 2018;125:575–585. doi: 10.1111/jam.13772. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Anish C, Beurret M, Poolman J. Combined effects of glycan chain length and linkage type on the immunogenicity of glycoconjugate vaccines. NPJ Vaccines. 2021;6:150. doi: 10.1038/s41541-021-00409-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Micoli F, Bjarnarson SP, Arcuri M, Aradottir Pind AA, Magnusdottir GJ, Necchi F, Di Benedetto R, Carducci M, Schiavo F, Giannelli C, Pisoni I, Martin LB, Del Giudice G, MacLennan CA, Rappuoli R, Jonsdottir I, Saul A. Short Vi-polysaccharide abrogates T-independent immune response and hyporesponsiveness elicited by long Vi-CRM(197) conjugate vaccine. Proc Natl Acad Sci U S A. 2020;117:24443–24449. doi: 10.1073/pnas.2005857117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Phalipon A, Costachel C, Grandjean C, Thuizat A, Guerreiro C, Tanguy M, Nato F, Vulliez-Le Normand B, Bélot F, Wright K, Marcel-Peyre V, Sansonetti PJ, Mulard LA. Characterization of functional oligosaccharide mimics of the Shigella flexneri serotype 2a O-antigen: implications for the development of a chemically defined glycoconjugate vaccine. J Immunol. 2006;176:1686–1694. doi: 10.4049/jimmunol.176.3.1686. [DOI] [PubMed] [Google Scholar]
- 36.Goode A, Yeh V, Bonev BB. Interactions of polymyxin B with lipopolysaccharide-containing membranes. Faraday Discuss. 2021;232:317–329. doi: 10.1039/D1FD00036E. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Delcour AH. Outer membrane permeability and antibiotic resistance. Biochim Biophys Acta. 2009;1794:808–816. doi: 10.1016/j.bbapap.2008.11.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Moffatt JH, Harper M, Boyce JD. Mechanisms of polymyxin resistance. Adv Exp Med Biol. 2019;1145:55–71. doi: 10.1007/978-3-030-16373-0_5. [DOI] [PubMed] [Google Scholar]
- 39.Ramos-Morales F, Prieto AI, Beuzón CR, Holden DW, Casadesús J. Role for Salmonella enterica enterobacterial common antigen in bile resistance and virulence. J Bacteriol. 2003;185:5328–5332. doi: 10.1128/JB.185.17.5328-5332.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Leying HJ, Büscher KH, Cullmann W, Then RL. Lipopolysaccharide alterations responsible for combined quinolone and beta-lactam resistance in Pseudomonas aeruginosa. Chemotherapy. 1992;38:82–91. doi: 10.1159/000238946. [DOI] [PubMed] [Google Scholar]
- 41.Warr AR, Giorgio RT, Waldor MK. Genetic analysis of the role of the conserved inner membrane protein CvpA in EHEC resistance to deoxycholate. J Bacteriol. 2020;203:e00661–e720. doi: 10.1128/JB.00661-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Wray R, Iscla I, Blount P. Curcumin activation of a bacterial mechanosensitive channel underlies its membrane permeability and adjuvant properties. PLoS Pathog. 2021;17:e1010198. doi: 10.1371/journal.ppat.1010198. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Picken RN, Beacham IR. Bacteriophage-resistant mutants of Escherichia coli K12. Location of receptors within the lipopolysaccharide. J Gen Microbiol. 1977;102:305–318. doi: 10.1099/00221287-102-2-305. [DOI] [PubMed] [Google Scholar]
- 44.Klobucar K, French S, Côté JP, Howes JR, Brown ED. Genetic and chemical-genetic interactions map biogenesis and permeability determinants of the outer membrane of Escherichia coli. MBio. 2020;11:00161–220. doi: 10.1128/mBio.00161-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Caffalette CA, Zimmer J. Cryo-EM structure of the full-length WzmWzt ABC transporter required for lipid-linked O antigen transport. Proc Natl Acad Sci U S A. 2021;118:e2016144118. doi: 10.1073/pnas.2016144118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.MacLennan CA, Gilchrist JJ, Gordon MA, Cunningham AF, Cobbold M, Goodall M, Kingsley RA, van Oosterhout JJ, Msefula CL, Mandala WL, Leyton DL, Marshall JL, Gondwe EN, Bobat S, López-Macías C, Doffinger R, Henderson IR, Zijlstra EE, Dougan G, Drayson MT, MacLennan IC, Molyneux ME. Dysregulated humoral immunity to nontyphoidal Salmonella in HIV-infected African adults. Science. 2010;328:508–512. doi: 10.1126/science.1180346. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Domínguez-Medina CC, Pérez-Toledo M, Schager AE, Marshall JL, Cook CN, Bobat S, Hwang H, Chun BJ, Logan E, Bryant JA, Channell WM, Morris FC, Jossi SE, Alshayea A, Rossiter AE, Barrow PA, Horsnell WG, MacLennan CA, Henderson IR, Lakey JH, Gumbart JC, López-Macías C, Bavro VN, Cunningham AF. Outer membrane protein size and LPS O-antigen define protective antibody targeting to the Salmonella surface. Nat Commun. 2020;11:851. doi: 10.1038/s41467-020-14655-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Wells TJ, Whitters D, Sevastsyanovich YR, Heath JN, Pravin J, Goodall M, Browning DF, O'Shea MK, Cranston A, De Soyza A, Cunningham AF, MacLennan CA, Henderson IR, Stockley RA. Increased severity of respiratory infections associated with elevated anti-LPS IgG2 which inhibits serum bactericidal killing. J Exp Med. 2014;211:1893–1904. doi: 10.1084/jem.20132444. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Porat R, Mosseri R, Kaplan E, Johns MA, Shibolet S. Distribution of polysaccharide side chains of lipopolysaccharide determine resistance of Escherichia coli to the bactericidal activity of serum. J Infect Dis. 1992;165:953–956. doi: 10.1093/infdis/165.5.953. [DOI] [PubMed] [Google Scholar]
- 50.Zhao X, Zeng X, Dai Q, Hou Y, Zhu D, Wang M, Jia R, Chen S, Liu M, Yang Q, Wu Y, Zhang S, Huang J, Ou X, Mao S, Gao Q, Zhang L, Liu Y, Yu Y, Cheng A. Immunogenicity and protection efficacy of a Salmonella enterica serovar Typhimurium fnr, arcA and fliC mutant. Vaccine. 2021;39:588–595. doi: 10.1016/j.vaccine.2020.12.002. [DOI] [PubMed] [Google Scholar]
- 51.Hu J, Zuo J, Chen Z, Fu L, Lv X, Hu S, Shi X, Jing Y, Wang Y, Wang Z, Mi R, Huang Y, Liu D, Qi K, Han X. Use of a modified bacterial ghost lysis system for the construction of an inactivated avian pathogenic Escherichia coli vaccine candidate. Vet Microbiol. 2019;229:48–58. doi: 10.1016/j.vetmic.2018.12.020. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Additional file 1. Representative images of clinical and autopsy changes. The severity of heart and spleen lesions were assessed to evaluate the immune protective efficacy against APEC O2 challenge. Gross lesions were evaluated visually.
Data Availability Statement
All data generated or analyzed during this study are included in this published article.








