Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2023 Jan 19;89(2):e01928-22. doi: 10.1128/aem.01928-22

Insight into the Cold Adaptation Mechanism of an Aerobic Denitrifying Bacterium: Bacillus simplex H-b

Qian Yang a,b, Yi Shi a,b, Yu Xin a,b, Ting Yang c,d, Liang Zhang a,b,✉, Zhenghua Gu a,b,e, Youran Li a,b, Zhongyang Ding a,b, Guiyang Shi a,b
Editor: Marina Lottif
PMCID: PMC9972999  PMID: 36656033

ABSTRACT

Psychrophilic bacteria with aerobic denitrification ability have promising potential for application in nitrogen-contaminated wastewater treatment, especially under cold conditions. A better understanding of the cold adaptation mechanism during aerobic denitrification would be beneficial for the practical application of this type of functional bacterium. In this study, Bacillus simplex H-b with good denitrification performance at 5°C was used to investigate the corresponding cold tolerance mechanism. Transcriptomics and nitrogen removal characterization experiments were conducted at different temperatures (5°C, 20°C, and 30°C). At low temperatures, more nitrogen was utilized for assimilation, accompanied by the accumulation of ATP and extracellular polymeric substances (EPS), rather than transforming inorganic nitrogen in the dissimilation pathway. In addition, the proportion of unsaturated fatty acids was higher in strains cultured at low temperatures. At the molecular level, the adjustment of membrane transport, synthesis of cofactors and vitamins, and transcriptional regulators might contribute to the survival of the strain under cold conditions. Moreover, nucleotide precursor synthesis, translation, and oxidative and temperature stress response mechanisms also enhanced the resistance of strain H-b to low temperatures. The results suggest that combining multiple regulatory mechanisms and synergistic adaptation to cold stress enabled the growth and relatively high nitrogen removal rate (27.22%) of strain H-b at 5°C. By clarifying the mechanism of regulation and cold resistance of strain H-b, a theoretical foundation for enhancing the application potential of this functional bacterium for nitrogen-contaminated wastewater treatment was provided.

IMPORTANCE The newly isolated aerobic denitrifying bacterium Bacillus simplex H-b removed various forms of inorganic nitrogen (nitrate, nitrite, and ammonium) from wastewater, even when the temperature was as low as 5°C. Although this environmentally functional bacterium has been suggested as a promising candidate for nitrogen-contaminated water treatment at low temperatures, understanding its cold adaptation mechanism during aerobic denitrification is limited. In this study, the cold tolerance mechanism of this strain was comprehensively explained. Furthermore, a theoretical basis for the practical application of this type of functional bacterium for nitrogen removal in cold regions is provided. The study expands our understanding of the survival strategy of psychrophilic bacteria and hence supports their further utilization in wastewater treatment applications.

KEYWORDS: cold adaptation mechanism, Bacillus simplex H-b, nitrogen removal, 5°C, transcriptome analysis

INTRODUCTION

Aerobic denitrification is a process by which microorganisms gradually transfer NO3−-N to N2 through a series of reduction reactions under aerobic conditions. As an efficient nitrogen removal method, biological aerobic denitrification plays an important role in the natural nitrogen cycle as well as in the treatment of nitrogen-contaminated wastewater (1, 2). To identify a promising bacterium that could perform nitrogen removal through the above pathway, numerous bacteria with aerobic denitrification ability were screened from various natural habitats and artificial sewage treatment systems (3–5). Most of the isolated bacteria could perform efficient denitrification only at temperatures in the range of 25 to 37°C (6–8). However, aerobic denitrification for wastewater treatment in winter or cold regions would be inhibited due to the cold stress on both the growth and denitrification metabolism of these mesophilic bacteria. To overcome the above limitation, research has suggested that the application of cold-adapted or psychrophilic bacteria in systems that generate cold temperature stress might be an effective solution for improving nitrogen removal efficacy (9, 10). Owing to the possible advantage of cold-adapted denitrifying bacteria in nitrogen wastewater treatment, an increasing number of studies have focused on this aspect. However, studies on these psychrophilic denitrifiers were primarily concentrated on strain screening and the application of bioaugmentation rather than cold-adaptive mechanisms (11, 12). Several studies have provided possible explanations for microorganisms that could maintain activity at low or even subzero temperatures (13–16). Nevertheless, the response of different species to environmental stress has been suggested to vary, and a better characterization and understanding of the cold-adaptive mechanisms of typical aerobic denitrifying bacteria is critical for enhancing their application potential in nitrogen-contaminated wastewater treatment.

At the molecular level, possible metabolic mechanisms for overcoming stress caused by low temperatures have been suggested for bacteria isolated from different habitats. However, limited attention has been paid to cold-adaptive mechanisms in aerobic denitrifying bacteria that can grow and perform nitrogen removal at low temperatures; thus, the understanding of these mechanisms is limited. In specific strains, such as Pseudomonas psychrophila RNC-1, the corresponding driving force for nitrate removal at 10°C was mainly attributed to the overexpression of ABC transporters, energy synthesis, and the formation of cold shock protein (17). Similarly, the enhancement of energy production might contribute considerably to the survival of aerobic denitrifying Pseudomonas indoloxydans YY-1 with ammonium as a substrate at 5°C (18). The expression of cold shock proteins and adjustment of the membrane composition are adaptive mechanisms that might equip anammox bacteria with resistance to low-temperature damage during nitrogen removal (19). For functional aerobic denitrifying bacteria classified into Bacillus species, especially those capable of performing nitrogen removal at low temperatures, however, limited understanding is available regarding their adaptive mechanisms to cold environments. Without comprehensive investigation at the molecular level, it is unclear whether different or unidentified regulatory properties exist in functional Bacillus sp. to cope with low-temperature stress.

In our previous study, a strain named Bacillus simplex H-b was isolated and characterized as having the capability to conduct aerobic denitrification over a wide temperature range (5 to 37°C) with remarkable nitrogen removal performance under cold conditions (5°C and 10°C) (20). As a species belonging to Bacillus sp., B. simplex has been classified as an environmental probiotic and suggested to have potential applications in biocontrol (21, 22). In addition to cold temperature tolerance, the shared advantages of B. simplex H-b and Bacillus sp., such as high reproductive rate, strong stress resistance, sporulation ability, and reliable biosafety performance (23, 24), make it an interesting candidate to investigate and clarify the cold adaptation mechanism of functional strains during aerobic denitrification at the molecular level in this study. We hypothesized that typical aerobic denitrifying Bacillus strains might possess unique and/or common regulatory properties to resist cold conditions. In combination with experimental results obtained from cold adaptation and analysis of transcriptomic data, characterization of strain H-b was performed to provide insights into the cold tolerance mechanism of this functional strain. In addition to molecular information regarding the regulatory mechanisms of cold shock, the results also provide a theoretical basis for the practical application of this functional strain for nitrogen removal in cold regions.

RESULTS AND DISCUSSION

Denitrification efficiency under different temperatures.

In our previous study, we isolated and verified the capability of B. simplex H-b to remove inorganic nitrous compounds via aerobic denitrification. In this study, the strain was characterized with nitrate nitrogen (60 mg/L) removal rates of 27.22%, 84.71%, and 76.22% at 5°C, 20°C, and 37°C, respectively (data not shown). These results suggested a potential to grow and perform aerobic denitrification in cold temperatures; therefore, further serum bottle incubation experiments were carried out to determine the difference in denitrification and nitrogen utilization efficacy over a relatively wide temperature range (5°C, 20°C, and 30°C). The results indicated that although the overall nitrate-nitrogen removal rate was low, the denitrification end product (N2) was still detected even when the strain was aerobically cultivated at 5°C (see Table S1 in the supplemental material). As an energy-requiring process, dissimilation pathways such as nitrogen production have been suggested not to be the preliminary way of nutrient utilization, especially for bacteria encountering environmental stress (16). As shown in Fig. 1, after incubation for 7 days, the nitrogen dissimilatory capacity of the culture at 5°C was lower than that at 20 to 30°C. Specifically, the rate of N2 formation was calculated to be approximately 0.41 mg/mL/day at 5°C, whereas it was similar at 20°C and 30°C (1.40 and 1.43 mg/mL/day). Hence, rather than metabolizing nitrate nitrogen through assimilation and dissimilation pathways parallel to those at 20 to 30°C, strain H-b tended to overcome the stress of low temperature by utilizing a nitrogen source for biomass growth and began to perform denitrification once a certain abundance was generated.

FIG 1.

FIG 1

N2 detection result generated from strain H-b cultivated against different culture temperatures within serum bottles. The graph on the right is the calculated ratio and rate of the assimilation and dissimilation after cultivating for 7 days. Each temperature condition experiment has three parallels. Data are means ± standard deviation (SD) of three replicates. Different letters on the column diagram indicate significant difference at a P value of <0.05.

Transcriptome analysis.

To further explore whether strain H-b could survive or even metabolize inorganic nitrogen via a dissimilar pathway under extreme conditions, the growth and denitrification indicators for the strain cultivated at 0°C were monitored. The results (see Fig. S1 in the supplemental material) suggested the viability of strain H-b under such stressful conditions, albeit without an obvious denitrification potential. Nevertheless, the strain was verified to have a remarkable tolerance to low temperatures, and transcriptome analysis was performed to clarify the molecular mechanism of the cold resistance of this aerobic denitrifier. Three different temperatures, optimal (30°C), mild (20°C), and stressful (5°C), were investigated to explore the differences in functional gene transcription levels between different culture conditions. After confirmation of data quality (see Table S2 in the supplemental material), a pairwise comparison of the transcriptomic data between different culture temperatures (5°C versus 30°C, 5°C versus 20°C, and 20°C versus 30°C) was conducted.

GO (see Fig. S2 in the supplemental material) and KEGG annotations (see Fig. S3 in the supplemental material) were performed to classify the differentially expressed genes (DEGs) according to their metabolic functions. With a specific number of DEGs enriched in the terms shown in Fig. 2, genes involved in the functions of the respiratory electron transport chain, nitrogen metabolism, cell motility and extracellular polymeric substances (EPS) formation, fatty acid metabolism, membrane transport, nucleotide precursor synthesis, translation, cofactor and vitamin synthesis, transcriptional regulators, and oxidative and temperature stress response were suggested to be responsible for the survival and aerobic denitrifying activity of strain H-b at low temperatures. First, combined with the data obtained from cold adaptation characteristic experiments (ATP, the utilization of nitrogen, EPS, and fatty acids), the role of relevant DEGs in the process of resistance of strain H-b to cold stress is presented. The DEGs classified into other functions identified during denitrification at low temperatures are also discussed. A detailed analysis and discussion of these functional genes are provided below.

FIG 2.

FIG 2

Number of DEGs related to the cold resistance mechanism of strain H-b. Number of upregulated genes is above the line and that of downregulated genes is below the line. (A) respiratory electron transport chain; (B) nitrogen metabolism; (C) cell motility and EPS formation; (D) fatty acid metabolism; (E) membrane transport; (F) nucleotide precursor synthesis; (G) translation; (H) cofactor and vitamin synthesis; (I) transcriptional regulators; (J) oxidative stress response; (K) temperature stress response.

Respiratory electron transport chain.

In strain H-b, genes enriched in the respiratory electron transport chain, including NADH dehydrogenase, succinate dehydrogenase, cytochrome c reductase, cytochrome c oxide, and ATPase, were observed with an increase in the corresponding expression level at 5°C compared to that at 30°C (Fig. 3A). For example, the gene expression levels of cytochrome c oxide and FoF1 ATPase in the strain cultivated at 5°C were approximately 4.33 to 4.85 times and 1.58 to 2.33 times higher than those at 30°C, suggesting a potential capability to synthesize more cellular ATP at low temperatures. Consistent with the transcriptome analysis results, the measured intracellular ATP concentration for strain H-b cultivated at different temperatures also indicated that more ATP accumulated with a decrease in the culture temperature from 30°C to 5°C (Fig. 4A). A similar phenomenon was observed in the psychrophilic bacterium Pseudomonas indoloxydans YY-1 (18). Previous studies have shown a positive relationship between intracellular ATP levels and cell activity (25, 26) with the accumulation of ATP; strain H-b was suggested to resist low-temperature stress by enhancing the energy production level.

FIG 3.

FIG 3

Heat map illustrating selected differentially expressed genes identified from grouped transcriptomic data sets based on culture temperature. Column “a” indicated the DEGs of group NO3_60_5-vs-NO3_60_30, column “b” indicated the DEGs of group NO3_60_5-vs-NO3_60_20, and column “c” indicated the DEGs of group NO3_60_20-vs-NO3_60_30. (A) respiratory electron transport chain; (B) nitrogen metabolism; (C) cell motility and EPS formation; (D) fatty acid metabolism.

FIG 4.

FIG 4

The concentration of ATP (A) and EPS (B) and the composition of fatty acids (C) extracted from strain H-b cultivated at 5°C, 20°C, and 30°C during aerobic denitrification process. Three parallels were conducted for each temperature condition. Data are means ± SD of three replicates. Different letters on the column diagram indicated significantly different at P < 0.05.

Nitrogen metabolism.

Figure 3B shows that the expression levels of the nitrate/nitrite transporter (Nrt), assimilatory nitrate reductase (NasAB), nitrite reductase (NADH, NirBD), and ferredoxin-nitrite reductase (NirA) encoding genes were all significantly upregulated when the strain was cultured with NO3−-N as the sole nitrogen source at lower temperatures (5°C and 20°C). A similar trend was observed for other aerobic denitrifying bacteria (Acinetobacter spp. TAC-1), in which increased expression levels of NasA and NirB were observed at cold conditions (27). With an indication of enhanced nitrate transport, dissimilation, and assimilation nitrate reduction at the molecular level, strain H-b was suggested to survive by increasing nitrogen utilization efficiency. Although many Bacillus strains have been identified to have aerobic denitrification capacity, the current understanding of denitrifying functional genes and metabolic pathways of these strains is still limited. Only a few denitrifying Bacillus species have been identified and validated for denitrification genes, such as Bacillus subtilis JD-014, Bacillus azotoformans, Bacillus bataviensis LMG 9581T, and Bacillus licheniformis ATCC 14580 (28–30). However, the specific response of denitrifying functional genes to cold stress is uncertain because there is currently a lack of comprehensive genomic information on denitrification for strain H-b. Further investigation is required to determine the overall response to nitrogen metabolism to low temperatures. Together with the results obtained from the nitrogen balance experiment at different temperatures (Table S1), cold stress was further confirmed as the influencing factor on nitrogen metabolism, and more available nitrous substances were converted into biological nitrogen. Rather than utilizing extra energy for dissimilatory nitrogen metabolism, saving energy for basic physiological activities as a priority for survival might explain these findings.

Cell motility and EPS formation.

In strain H-b, the DEGs enriched in the flagellar assembly and bacterial chemotaxis pathways tend to be downregulated when exposed to low-temperature stress (Fig. 3C). Similar gene regulation strategies have also been observed during spore outgrowth of B. subtilis 168 under high-salinity conditions (31). Contrary to the above regulatory mode, strains such as Shewanella baltica and Acidithiobacillus ferrivorans strain YL15 were found to increase the transcription levels of genes related to cell movement at low temperatures (32, 33). Rather than consuming more energy required for movement away from hostile circumstances, strain H-b used a different strategy and tended to reduce the corresponding bacterial mobility as a coping mechanism at low temperatures. In addition, the DEGs, including epsC, epsM, and epsN encoding EPS biosynthesis, were all upregulated together with an increase in EPS content with the decline in culture temperature (Fig. 4B). Previous research has suggested that EPS could provide shelter for cells separated from external unprivileged conditions by forming a cushion layer between the environment and cell membrane (34, 35). Moreover, EPS formation was related to cell movement, and a decrease in bacterial motility promoted EPS formation and structural stabilization (36). Thus, the results regarding the above two aspects indicate that strain H-b would become tolerant to low temperature with an increased EPS secretion by upregulating the expression level of the EPS biosynthesis encoding genes, while reducing the cell movement to reserve more energy for EPS formation by downregulating the expression level of genes related to flagellar assembly and bacterial chemotaxis.

Fatty acid metabolism.

The difference in culture temperature resulted in a considerable number of DEGs enriched in the fatty acid metabolism pathway (Fig. 3D). The genes involved in fatty acid degradation, including long-chain acyl coenzyme A (acyl-CoA) synthetase, enoyl-CoA hydratase, 3-hydroxyacyl-CoA dehydrogenase, and acetyl-CoA acyltransferase, were all downregulated, indicating a potentially decreased fatty acid degradation rate in strains under cold stress. This phenomenon was also observed in Vibrio parahaemolyticus with a possible explanation that the accumulation of fatty acids would assist the bacteria in adapting to cold conditions (37). To overcome low-temperature stress, bacteria usually maintain suitable membrane fluidity by improving the ratio of unsaturated fatty acids (UFAs) to anteiso-branched chain fatty acids or by decreasing the content of long-chain saturated fatty acids (38, 39). Such regulatory mechanisms have been identified in many cold-tolerant bacteria, such as Bacillus cereus ATCC 14579 and Pseudomonas sp. B14-6 (40, 41), whereas the opposite adjustment mechanism was observed for the extremophile Planococcus halocryophilus strain Or1 (16). In this study, the composition of fatty acids extracted from strain H-b cultured at different temperatures (5°C, 20°C, and 30°C) was further analyzed, and the results confirmed that there was a variation in composition as well as the proportion of fatty acids between these temperatures (see Table S3 in the supplemental material). In general, the relative abundance of long-chain saturated fatty acids (C20:0 to C24:0) was lower for strains cultured at lower temperatures, whereas more UFAs accumulated under cold temperature stress (Fig. 4C). For strain H-b to survive at temperatures as low as 5°C, it was suggested that it has the potential to maintain membrane fluidity and selective permeability by regulating the proportion and composition of UFAs and saturated fatty acids (SFAs), thereby ensuring the possibility of information communication and matter exchange for its normal growth and various metabolic processes at low temperatures.

Membrane transport.

As shown in Fig. 5, substantial DEGs were enriched in membrane transport at low temperatures, especially in the ATP-binding cassette (ABC) transporter. The number of DEGs concentrated in this term was the highest, and the number of DEGs identified in the 30°C versus 5°C and 20°C versus 5°C groups was 153 and 132, respectively. In strain H-b under cold stress, a selective regulation strategy for the expression levels of genes involved in substance transport was observed. For instance, the expression levels of genes encoding transport proteins for sulfate, sulfonate, C4-dicarboxylate, glycine betaine/proline, biotin, cobalt/nickel, and ABC-2 type were increased, whereas those of genes encoding transport proteins for phosphate, branched-chain amino acids, raffinose/stachyose/melibiose, and peptide/nickel were decreased. Among these DEGs, aerobic C4-dicarboxylate transport protein (dctA) was reported to be involved in sodium succinate transport (42), and NitT/TauT family transport protein was reported to assist nitrate transport (43). The increased expression levels of these transporters in strain H-b might allow the supply of carbon and nitrogen sources for growth and concurrent aerobic denitrification at low temperatures with sodium succinate as the carbon substrate. Sulfate is another essential raw material for the synthesis of many functional sulfur-containing compounds, such as methionine, cysteine, lipoic acid, thiamine, and biotin (44, 45). Herein, sulfonate and sulfate transport proteins were upregulated at low temperatures. The low temperatures are speculated to induce the synthesis of sulfur-containing substances, leading to an increased requirement for transport proteins related to sulfonate and sulfate. The phenomenon of a large number of membrane transport protein-encoding genes being regulated under adverse environmental conditions has also been found in some Bacillus strains, such as B. subtilis JD-014 subjected to nitrate stress and Bacillus altitudinis strain HM-12 exposed to high Mn concentrations (46, 47). Overall, the regulation of membrane transport plays a major role in the coping mechanism of strain H-b with cold stress. By adjusting the transport of various materials, the strain maintained normal life activities and optimized the energy and material utilization under low-temperature stress.

FIG 5.

FIG 5

Heat map illustrating differentially expressed genes of membrane transport identified from grouped transcriptomic data sets based on culture temperature. Column “a” indicated the DEGs of group NO3_60_5-vs-NO3_60_30, column “b” indicated the DEGs of group NO3_60_5-vs-NO3_60_20, and column “c” indicated the DEGs of group NO3_60_20-vs-NO3_60_30.

Nucleotide precursor synthesis and translation.

In strain H-b cultured at low temperatures, the transcription levels of genes participating in the DNA and RNA precursor synthesis pathway increased significantly, including dihydroorotase, dihydroorotate dehydrogenase, dihydropyrimidinase, and aspartate carbamoyltransferase (Fig. 6A). Furthermore, Fig. 6B shows that the genes involved in aminoacyl-tRNA biosynthesis were all upregulated, except for the gene encoding leucyl-tRNA synthetase. Transcripts related to ribosomal proteins, translation initiation factor IF-1, and elongation factor P also increased. Based on the above transcriptional data, strain H-b tended to enhance the synthesis of DNA and RNA precursors, as well as protein translation at low temperatures. A similar response strategy to cold stress has also been observed in other cold-adapted bacteria, such as Acinetobacter harbinensis HITLi 7T and Shewanella baltica (33, 48), which can grow at temperatures as low as 2°C and 8°C, respectively. In contrast, extreme psychrophilic bacteria, such as Psychrobacter arcticus 273-4 (49) might adopt a strategy of decreasing the transcription level of genes encoding translation and survive under cold conditions with a reduced metabolic rate, thus suggesting a variation in the way bacteria might adapt to extreme environments.

FIG 6.

FIG 6

Heat map illustrating selected differentially expressed genes identified from grouped transcriptomic data sets based on culture temperature. Column “a” indicated the DEGs of group NO3_60_5-vs-NO3_60_30, column “b” indicated the DEGs of group NO3_60_5-vs-NO3_60_20, and column “c” indicated the DEGs of group NO3_60_20-vs-NO3_60_30. (A) nucleotide precursor synthesis; (B) translation; (C) cofactor and vitamin synthesis; (D) transcriptional regulators; (E) oxidative stress response; (F) temperature stress response.

Cofactor and vitamin synthesis.

Among the DEGs identified in transcripts extracted from strains cultured at different temperatures, a large number of DEGs were found to be involved in the biosynthesis of ubiquinone, other terpenoid-quinone, vitamin B6, lipoic acid, thiamine, nicotinate, nicotinamide, biotin, riboflavin, and vitamin B12. The transcription levels of the genes involved in these cofactor and vitamin biosynthesis pathways significantly increased when the culture temperature was low (Fig. 6C). For example, biotin synthesis-related genes were significantly induced in these three temperature comparison groups. The gene expression level of biotin synthase in the strain cultivated at 5°C was approximately 2.64 times and 7.43 times higher than those at 20°C and 30°C, respectively. In general, cofactors and vitamins are essential for maintaining physiological activities and can also function as coenzymes of various enzymes that widely participate in substance and energy metabolism, electron transport, amino acid metabolism, fatty acid metabolism, protein biosynthesis, etc. (50). In strain H-b, as the general metabolic function might be suppressed under cold conditions, the induction of cofactors and vitamins was suggested to be conducive to the synthesis of enzymes required to overcome the stress caused by low temperatures.

Transcriptional regulators.

Many genes encoding transcriptional regulators showed different expression levels with changes in the culture temperature (shown in Fig. 6D). Distributed widely in the AbrB family, MerR family, Fur family, XRE family, TetR/AcrR family, GntR family, transcriptional activator, transcriptional repressor, LysR family, and sigma factor, these transcriptional regulatory proteins mainly participated in the regulation of various metabolic pathways in the cell, such as nitrogen metabolism, fatty acid metabolism, biofilm formation, purine catabolism, and thiamine synthesis. Furthermore, strain H-b presented an apparent response to lower temperatures with a change in the expression of regulators involved in the stress and heat shock response (CtsR) and regulation of oxidative stress (spx). Similarly, when B. subtilis 168 was cultivated with allicin and diallyl tetrasulfane, substantial amounts of regulators, including PerR, CstR, OhrR, ArsR, and Spx, were markedly upregulated to protect the strain from the damage caused by these antimicrobial compounds (51). In addition, the regulators CstR and hrcA are also induced in B. cereus under a low-pH stress (52). These regulatory strategies indicate that a common self-protective mechanism might exist in these Bacillus strains when coping with different adverse environments. In strain H-b, in addition to regulatory proteins, certain RNA polymerase sigma factors with a function in transcriptional regulation, such as sigma-54 factor, sigma-70 factor, and sigma-B factor, were also induced by low temperature. The sigma-54 factor has been reported to participate in the regulation of nitrogen metabolism, motility, and low-temperature adaptability (53). A substantial number of genes observed with a change in expression in response to cold stress indicated a quick adjustment pattern of regulation in cell metabolism to allow the growth and activity of strain H-b under low-temperature stress.

Oxidative and temperature stress response.

Strain H-b has been suggested to activate oxidative stress response by downregulating the transcription level of a Fur family transcriptional repressor (PerR), which was also a strategy adopted by Streptococcus mutans UA159 (54). In addition, enzymes with antioxidant activity, such as catalase, superoxide dismutase, peroxidase, and alkyl hydroperoxide reductase, were also induced in strain H-b (Fig. 6E). This type of oxidative stress response mechanism is common and is also found in some B. cereus strains that cope with salt stress, such as ATCC 14579, B25, and B26 (55, 56). Overall, strain H-b improved its self-antioxidant ability to overcome oxidative stress linked to low temperatures.

Moreover, lower temperature for each temperature comparison was associated with downregulation of all DEGs belonging to Csps encoding genes and upregulation of all Hsps, including Hsp15, Hsp33, GroES, GroEL, DnaJ, DnaK, GrpE, and Clp protease family encoding genes (Fig. 6F). Although this phenomenon was also observed in other bacteria, such as Psychrobacter arcticus 273-4 (49), the opposite observation was reported to be more common in psychrophilic bacteria (i.e., Shewanella baltica and Acinetobacter harbinensis HITLi 7T), which had an increased expression of Csps with a larger difference in culture temperature (33, 48). Without a constant response strategy, strain H-b seemed to adapt to cold stress by increasing the expression of Hsps, which was suggested to act as a molecular chaperone to assist the folding correction of peptides and transmembrane transport proteins in the cell (57).

In conclusion, a comprehensive transcriptional picture of aerobic denitrifying B. simplex H-b response to low temperature with nitrate nitrogen as the sole nitrous substance was provided. Combining the experimental and transcriptional data, we found that strain H-b mainly regulated the expression levels of genes encoding membrane transport, cofactor and vitamin synthesis, and transcriptional regulators to survive under cold stress. In addition, ATP formation, utilization of nitrous substances, EPS formation, fatty acid composition, nucleotide precursor synthesis, and translation were also adjusted to maintain the normal function of strain H-b at low temperatures. Moreover, the induction of heat shock proteins and antioxidant enzymes was suggested to be another synergetic mechanism employed by strain H-b for resistance to damage caused by low temperatures. Overall, rather than a single or specific response mechanism, several regulatory strategies were adopted by strain H-b, which worked synergistically to maintain growth and perform denitrification at temperatures as low as 5°C. Based on the findings of the current study, a promising strategy for enhancing the adjustment pattern in this type of functional bacterium to external environmental stress can be developed.

MATERIALS AND METHODS

Strain culture conditions.

B. simplex H-b was first activated on a solid LB plate, and the colony was then cultivated in liquid LB medium at 30°C for 12 h. The culture was centrifuged (6,000 × g, 5 min) and washed three times with sterile water before being used as the seed culture solution. It was subsequently inoculated in 100 mL of denitrification medium (DM medium) with 60 mg/L NO3−-N as the nitrogen source and sodium succinate as the carbon source, with a C:N ratio of 10. The composition of the DM medium (g/L) was as follows: NaNO3, 0.38; sodium succinate, 3.55; MgSO4·7H2O, 0.2; KH2PO4, 1.5; Na2HPO4, 4; trace element solution, 2 mL; pH 7.2. The components of the trace-element solution (g/L) were as follows: CaCl2, 5.5; CuSO4·5H2O, 1.57; ZnSO4·7H2O, 3.92; (NH4)6Mo7O2·4H2O, 1.1; EDTA·2Na, 50; MnCl2·4H2O, 5.06; FeSO4·7H2O, 5.0; and CoCl2·6H2O, 1.61. The culture shaking speed was set to 200 rpm in all experiments.

Nitrate removal efficiency at different temperatures.

To understand the nitrate removal efficiency of strain H-b at different temperatures, a serum-bottle experiment was conducted. The seed culture solution was inoculated into serum bottles with 100 mL DM medium and further filled with a mixture of gas (O2:He = 21:79, %). A system without inoculation was used as a control. Three different temperatures were set (5°C, 20°C, and 30°C), and three replicates were performed for each temperature condition. Gas samples were taken from each experimental condition for composition measurement using a gas chromatograph equipped with a thermal conductivity detector (TCD) at different cultivation time intervals. Nitrogen compounds (NO3−-N, NO2−-N, NH4+-N, total nitrogen, and biomass nitrogen) were determined using a previously described method (7). The biomass nitrogen content was calculated as the difference in total nitrogen (TN) between the measured result from noncentrifuged bacterial culture and that in suspension after centrifugation. The amount of N2 produced during cultivation was calculated by applying the ideal gas law according to a previous study (58).

Transcriptome analysis.

Strain H-b was cultivated in flasks with 100 mL DM medium at different temperatures (5°C, 20°C, and 30°C) until it reached the middle of the logarithmic growth phase under each temperature condition. Three replicates were performed for each culture condition. The culture was centrifuged at 8,000 × g at 4°C for 10 min, frozen immediately in liquid nitrogen, and the cells were collected for further experiments. Total RNA was isolated from the samples using TRIzol reagent (Invitrogen) following the manufacturer’s instructions. The quality and concentration of the extracted RNA were analyzed using a bioanalyzer (Agilent 2100 and NanoDrop). Transcriptome sequencing, including library construction and alignment, was performed at Huada Gene Technology Co. Ltd., Shenzhen, China. Briefly, mRNA obtained by mRNA enrichment or rRNA depletion was used for the construction of the mRNA library and subsequent sequencing via the DNBSEQ platform. The raw reads were quality filtered using SOAPnuke software (v1.4.0). The filtered data (clean reads) were aligned to the reference genome and reference gene using the HISAT (v2.1.0) and Bowtie 2 (v2.2.5) software, respectively. The gene expression level of each sample was then calculated using RSEM (v1.2.8) and further used for the analysis of DEGs by the DEseq2 method and false-discovery rate (FDR) correction of P value with the q value of ≤0.05. The results were further processed for GO and KEGG pathway analyses to classify the DEGs according to their functions. To verify the results of the transcriptomic data, six DEGs were randomly selected for reverse transcription-quantitative PCR (qRT-PCR) analysis (results shown in Fig. S4 in the supplemental material). Primers used in this study are listed in Table 1. The relative expression level of the gene was calculated using the 2−ΔΔCT method, with 16S rRNA as the internal reference gene.

TABLE 1.

The primers used for qRT PCR analysis in this study

Gene name Primer Primer sequence (5′–3′) Length (bp)
16S rRNA 16S-F TAACTTCGGGAAACCGGAGC 137
16S-R GCCTTGGTGAGCCATTACCT
pyrC pyrC-F CCCGGGATATCCTTCTTGCC 95
pyrC-R TTTGGCATCCCTTACCGTCC
bioB bioB-F GGGAGGTCAATCTCCGTTCC 94
bioB-R GGTTCTTGACCAGCTGTCGT
cbiD cbiD-F ATCACTGGTCGGCATGATGG 114
cbiD-R ACGCTTTGGGCTATTTCCGA
scoB scoB-F ATGGGCTCCTTGGAGTAGGT 150
scoB-R CAATATGTCCGCCGCGAATC
ord ord-F CCTTGGCATCGCTACCCTTT 92
ord-R CCTGGATTGATTCCGGTCCC
glcB glcB-F CGGAAACGGGAAGATGTCCA 134
glcB-R CCTCTGCCGCTTAACCATGA

ATP and EPS assay.

To provide comparable characterization data with transcriptomic sequencing analysis, strain H-b was cultivated under the same culture conditions (5°C, 20°C, and 30°C) for the determination of ATP and EPS content or composition. The intracellular ATP content of the bacteria was measured according to the instructions of the ATP assay kit (Beyotime Biotechnology; S0026). The EPS of cultures was first extracted by differential centrifugation and ultrasonication and further characterized to quantify the main composition (protein and polysaccharide). The phenol-sulfuric acid method was used to determine the polysaccharide concentration of the samples, and the protein content was measured using the Bradford method (59, 60).

Fatty acid analysis.

To investigate differences in fatty acid composition between strains cultivated at different temperatures, strain H-b was cultured under the same culture conditions (5°C, 20°C, and 30°C) as those used for transcriptome analysis. After reaching the exponential growth phase on incubating for 190, 60, and 30 h, cells cultured at different temperatures were harvested, washed, and vacuum freeze-dried. Fatty acids were extracted from the samples, and fatty acid methyl esters (FAMEs) were prepared according to the method described by El Razak et al. (61) with some modifications. Briefly, 200 mg of freeze-dried powder was mixed with 8 mL of 5% H2SO4-methanol (vol/vol) in glass tubes and incubated at 75°C for 15 min. The tubes were cooled immediately after the reaction. Subsequently, 1 mL of ultrapure water and 1 mL n-hexane were added, and the tubes were shaken violently and placed statically until the formation of the two phases. The upper phase was then transferred and filtered through a 0.22-μm filter membrane for gas chromatography (GC) assay. The detailed GC detection process could refer to the literature with some modification (62). In this study, the split ratio was set to 10:1, and the relative retention time and relative peak area of every characteristic fatty acid were calculated using certified material as the reference peak (mixture of 37 FAMEs, C4-C24, 18919-1AMP; Supelco, Sigma). The proportion of each fatty acid is expressed as the relative peak area percentage of the total peak area.

Statistical analysis.

Significance analysis of the content of ATP and EPS and the ratio of nitrogen assimilation and dissimilation by strain H-b was performed by one-way analysis of variance (ANOVA) with Tukey’s honestly significant difference (HSD) test using IBM SPSS Statistics 24. Statistical significance was set at a P value of <0.05. The figures included herein were prepared using Origin 8.0, Adobe Illustrate CS6, and GraphPad Prism 7.0.

Data availability.

All data obtained during this study are included in the manuscript or supplemental material. All clean reads of the transcriptome sequence in this study have been submitted to the NCBI Sequence Read Archive (SRA) database (https://submit.ncbi.nlm.nih.gov/subs/sra/) and assigned to BioProject accession number PRJNA892303.

ACKNOWLEDGMENTS

This research was supported by the National Key Research and Development Program of China (2018YFA0900300 and 2021YFC2100300), Natural Science Foundation of Jiangsu Province (BE2018055), Fishery Science and Technology Projects in Jiangsu Province (Y2018-26), Wuxi Science and Technology Project (CLE02N1713), and China Postdoctoral Science Foundation (2020M671330).

Footnotes

Supplemental material is available online only.

Supplemental file 1
Tables S1 to S3 and Fig. S1 to S4. Download aem.01928-22-s0001.pdf, PDF file, 0.7 MB (705.6KB, pdf)

Contributor Information

Liang Zhang, Email: zhangl@jiangnan.edu.cn.

Marina Lotti, University of Milano-Bicocca.

REFERENCES

  • 1.Feng Y, Feng J, Shu QL. 2018. Isolation and characterization of heterotrophic nitrifying and aerobic denitrifying Klebsiella pneumoniae and Klebsiella variicola strains from various environments. J Appl Microbiol 124:1195–1211. 10.1111/jam.13703. [DOI] [PubMed] [Google Scholar]
  • 2.Ji B, Yang K, Zhu L, Jiang Y, Wang HY, Zhou J, Zhang HN. 2015. Aerobic denitrification: a review of important advances of the last 30 years. Biotechnol Bioprocess Eng 20:643–651. 10.1007/s12257-015-0009-0. [DOI] [Google Scholar]
  • 3.Chen JL, Xu J, Zhang SN, Liu F, Peng JW, Peng YX, Wu JS. 2021. Nitrogen removal characteristics of a novel heterotrophic nitrification and aerobic denitrification bacteria, Alcaligenes faecalis strain WT14. J Environ Manage 282:111961. 10.1016/j.jenvman.2021.111961. [DOI] [PubMed] [Google Scholar]
  • 4.Su JF, Zhang H, Xue L, Zhang YM. 2020. Characterization of simultaneous aerobic denitrification and dephosphorization strain Cupriavidus sp. H29 and its application on cadmium-removing. Geomicrobiol J 37:426–436. 10.1080/01490451.2019.1711466. [DOI] [Google Scholar]
  • 5.Wei R, Hui C, Zhang YP, Jiang H, Zhao YH, Du LN. 2021. Nitrogen removal characteristics and predicted conversion pathways of a heterotrophic nitrification–aerobic denitrification bacterium, Pseudomonas aeruginosa P-1. Environ Sci Pollut Res Int 28:7503–7514. 10.1007/s11356-020-11066-7. [DOI] [PubMed] [Google Scholar]
  • 6.Ren JL, Bai XY, Liu YC, Huang X. 2021. Simultaneous nitrification and aerobic denitrification by a novel isolated Ochrobactrum anthropi HND19. Bioresour Technol 340:125582. 10.1016/j.biortech.2021.125582. [DOI] [PubMed] [Google Scholar]
  • 7.Yang T, Xin Y, Zhang L, Gu ZH, Li YR, Ding ZY, Shi GY. 2020. Characterization on the aerobic denitrification process of Bacillus strains. Biomass Bioenergy 140:105677. 10.1016/j.biombioe.2020.105677. [DOI] [Google Scholar]
  • 8.Zhang DY, Li WG, Huang XF, Qin W, Liu M. 2013. Removal of ammonium in surface water at low temperature by a newly isolated Microbacterium sp. strain SFA13. Bioresour Technol 137:147–152. 10.1016/j.biortech.2013.03.094. [DOI] [PubMed] [Google Scholar]
  • 9.Zou SQ, Yao S, Ni JR. 2014. High-efficient nitrogen removal by coupling enriched autotrophic-nitrification and aerobic-denitrification consortiums at cold temperature. Bioresour Technol 161:288–296. 10.1016/j.biortech.2014.03.066. [DOI] [PubMed] [Google Scholar]
  • 10.Ikeda-Ohtsubo W, Miyahara M, Kim SW, Yamada T, Matsuoka M, Watanabe A, Fushinobu S, Wakagi T, Shoun H, Miyauchi K, Endo G. 2013. Bioaugmentation of a wastewater bioreactor system with the nitrous oxide-reducing denitrifier Pseudomonas stutzeri strain TR2. J Biosci Bioeng 115:37–42. 10.1016/j.jbiosc.2012.08.015. [DOI] [PubMed] [Google Scholar]
  • 11.Ren HJ, Su Y, Wang C, Hou ZM, Zhou Y, Zhou R. 2018. Application of response surface methodology to optimize nitrate removal at low temperature by aerobic denitrificator Pseudomonas strain An-1. Water Environ J 32:235–241. 10.1111/wej.12319. [DOI] [Google Scholar]
  • 12.Zheng ZJ, Zhang DY, Li WG, Qin W, Huang XF, Lv LY. 2018. Substrates removal and growth kinetic characteristics of a heterotrophic nitrifying-aerobic denitrifying bacterium, Acinetobacter harbinensis HITLi7T at 2°C. Bioresour Technol 259:286–293. 10.1016/j.biortech.2018.03.065. [DOI] [PubMed] [Google Scholar]
  • 13.Wang Z, Li Y, Lin XZ. 2017. Transcriptome analysis of the Antarctic psychrotrophic bacterium Psychrobacter sp. G in response to temperature stress. Acta Oceanol Sin 36:78–87. 10.1007/s13131-016-0956-0. [DOI] [Google Scholar]
  • 14.Xie Z, Jian HH, Jin Z, Xiao X. 2018. Enhancing the adaptability of the deep-sea bacterium Shewanella piezotolerans WP3 to high pressure and low temperature by experimental evolution under H2O2 stress. Appl Environ Microbiol 84:e02342-17. 10.1128/aem.02342-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Rong JC, Liu Y, Yu S, Xi L, Chi NY, Zhang QF. 2020. Complete genome sequence of Paenisporosarcina antarctica CGMCC 1.6503T, a marine psychrophilic bacterium isolated from Antarctica. Mar Genomics 49:100690. 10.1016/j.margen.2019.05.005. [DOI] [Google Scholar]
  • 16.Mykytczuk NCS, Foote SJ, Omelon CR, Southam G, Greer CW, Whyte LG. 2013. Bacterial growth at −15°C; molecular insights from the permafrost bacterium Planococcus halocryophilus Or1. ISME J 7:1211–1226. 10.1038/ismej.2013.8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Zhao YY, Min HC, Luo KY, Zhang RJ, Chen Q, Chen ZB. 2022. Transcriptomics and proteomics revealed the psychrotolerant and antibiotic-resistant mechanisms of strain Pseudomonas psychrophila RNC-1 capable of assimilatory nitrate reduction and aerobic denitrification. Sci Total Environ 820:153169. 10.1016/j.scitotenv.2022.153169. [DOI] [PubMed] [Google Scholar]
  • 18.Guo Y, Wang YY, Zhang ZJ, Huang FY, Chen SH. 2018. Physiological and transcriptomic insights into the cold adaptation mechanism of a novel heterotrophic nitrifying and aerobic denitrifying-like bacterium Pseudomonas indoloxydans YY-1. Int Biodeterior Biodegrad 134:16–24. 10.1016/j.ibiod.2018.08.001. [DOI] [Google Scholar]
  • 19.Kouba V, Vejmelkova D, Zwolsman E, Hurkova K, Navratilova K, Laureni M, Vodickova P, Podzimek T, Hajslova J, Pabst M, van Loosdrecht M, Bartacek J, Lipovova P, Weissbrodt D. 2021. Adaptation of anammox bacteria to low temperature via gradual acclimation and cold shocks: distinctions in protein expression, membrane composition and activities. Water Res 209:117822. 10.1016/j.watres.2021.117822. [DOI] [PubMed] [Google Scholar]
  • 20.Yang Q, Yang T, Shi Y, Xin Y, Zhang L, Gu ZH, Li YR, Ding ZY, Shi GY. 2021. The nitrogen removal characterization of a cold-adapted bacterium: Bacillus simplex H-b. Bioresour Technol 323:124554. 10.1016/j.biortech.2020.124554. [DOI] [PubMed] [Google Scholar]
  • 21.Allioui N, Driss F, Dhouib H, Jlail L, Tounsi S, Frikha-Gargouri O. 2021. Two novel Bacillus strains (subtilis and simplex species) with promising potential for the biocontrol of Zymoseptoria tritici, the causal agent of septoria tritici blotch of wheat. Biomed Res Int 2021:6611657. 10.1155/2021/6611657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Khan N, Martínez-Hidalgo P, Ice TA, Maymon M, Humm EA, Nejat N, Sanders ER, Kaplan D, Hirsch AM. 2018. Antifungal activity of Bacillus species against Fusarium and analysis of the potential mechanisms used in biocontrol. Front Microbiol 9:2363. 10.3389/fmicb.2018.02363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kuebutornye FKA, Abarike ED, Lu Y. 2019. A review on the application of Bacillus as probiotics in aquaculture. Fish Shellfish Immunol 87:820–828. 10.1016/j.fsi.2019.02.010. [DOI] [PubMed] [Google Scholar]
  • 24.Elshaghabee FMF, Rokana N, Gulhane RD, Sharma C, Panwar H. 2017. Bacillus as potential probiotics: status, concerns, and future perspectives. Front Microbiol 8:1490. 10.3389/fmicb.2017.01490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Jiang M, Feng LY, Zheng X, Chen YG. 2020. Bio-denitrification performance enhanced by graphene-facilitated iron acquisition. Water Res 180:115916. 10.1016/j.watres.2020.115916. [DOI] [PubMed] [Google Scholar]
  • 26.Jiang M, Zheng X, Chen YG. 2020. Enhancement of denitrification performance with reduction of nitrite accumulation and N2O emission by Shewanella oneidensis MR-1 in microbial denitrifying process. Water Res 169:115242. 10.1016/j.watres.2019.115242. [DOI] [PubMed] [Google Scholar]
  • 27.Zhao TT, Chen PP, Zhang LJ, Zhang L, Gao YH, Ai S, Liu H, Liu XY. 2021. Heterotrophic nitrification and aerobic denitrification by a novel Acinetobacter sp. TAC-1 at low temperature and high ammonia nitrogen. Bioresour Technol 339:125620. 10.1016/j.biortech.2021.125620. [DOI] [PubMed] [Google Scholar]
  • 28.Yang T, Yang Q, Shi Y, Xin Y, Zhang L, Gu ZH, Shi GY. 2021. Insight into the denitrification mechanism of Bacillus subtilis JD-014 and its application potential in bioremediation of nitrogen wastewater. Process Biochem 103:78–86. 10.1016/j.procbio.2021.02.007. [DOI] [Google Scholar]
  • 29.Jiang M, Li QX, Hu SY, He PH, Chen YG, Cai DB, Wu YT, Chen SW. 2022. Enhanced aerobic denitrification performance with Bacillus licheniformis via secreting lipopeptide biosurfactant lichenysin. Chem Eng J 434:134686. 10.1016/j.cej.2022.134686. [DOI] [Google Scholar]
  • 30.Heylen K, Keltjens J. 2012. Redundancy and modularity in membrane-associated dissimilatory nitrate reduction in Bacillus. Front Microbiol 3:371. 10.3389/fmicb.2012.00371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Nagler K, Krawczyk AO, De Jong A, Madela K, Hoffmann T, Laue M, Kuipers OP, Bremer E, Moeller R. 2016. Identification of differentially expressed genes during Bacillus subtilis spore outgrowth in high-salinity environments using RNA sequencing. Front Microbiol 7:1564. 10.3389/fmicb.2016.01564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Peng TJ, Ma LY, Feng X, Tao JM, Nan MH, Liu YD, Li JK, Shen L, Wu XL, Yu RL, Liu X, Qiu G, Zeng W. 2017. Genomic and transcriptomic analyses reveal adaptation mechanisms of an Acidithiobacillus ferrivorans strain YL15 to alpine acid mine drainage. PLoS One 12:e0178008. 10.1371/journal.pone.0178008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Kloska A, Cech GM, Sadowska M, Krause K, Szalewska-Pałasz A, Olszewski P. 2020. Adaptation of the marine bacterium Shewanella baltica to low temperature stress. Int J Mol Sci 21:4338. 10.3390/ijms21124338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Izadi P, Izadi P, Eldyasti A. 2021. Holistic insights into extracellular polymeric substance (EPS) in anammosx bacterial matrix and the potential sustainable biopolymer recovery: a review. Chemosphere 274:129703. 10.1016/j.chemosphere.2021.129703. [DOI] [PubMed] [Google Scholar]
  • 35.Wang S, Zhi LL, Shan W, Lu H, Xu Q, Li J. 2020. Correlation of extracellular polymeric substances and microbial community structure in denitrification biofilm exposed to adverse conditions. Microb Biotechnol 13:1889–1903. 10.1111/1751-7915.13633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Guttenplan SB, Kearns DB. 2013. Regulation of flagellar motility during biofilm formation. FEMS Microbiol Rev 37:849–871. 10.1111/1574-6976.12018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Xie TF, Pang R, Wu QP, Zhang JM, Lei T, Li YP, Wang J, Ding Y, Chen MT, Bai JL. 2019. Cold tolerance regulated by the pyruvate metabolism in Vibrio parahaemolyticus. Front Microbiol 10:178. 10.3389/fmicb.2019.00178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Hassan N, Anesio AM, Rafiq M, Holtvoeth J, Bull I, Haleem A, Shah AA, Hasan F. 2020. Temperature driven membrane lipid adaptation in glacial psychrophilic bacteria. Front Microbiol 11:824. 10.3389/fmicb.2020.00824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Saunders LP, Sen S, Wilkinson BJ, Gatto C. 2016. Insights into the mechanism of homeoviscous adaptation to low temperature in branched-chain fatty acid-containing bacteria through modeling FabH kinetics from the foodborne pathogen Listeria monocytogenes. Front Microbiol 7:1386. 10.3389/fmicb.2016.01386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Choi TR, Park YL, Song HS, Lee SM, Park SL, Lee HS, Kim HJ, Bhatia SK, Gurav R, Lee YK, Sung C, Yang YH. 2020. Effects of a Δ-9-fatty acid desaturase and a cyclopropane-fatty acid synthase from the novel psychrophile Pseudomonas sp. B14-6 on bacterial membrane properties. J Ind Microbiol Biotechnol 47:1045–1057. 10.1007/s10295-020-02333-0. [DOI] [PubMed] [Google Scholar]
  • 41.Cifré LC, Alemany M, de Mendoza D, Altabe S. 2013. Exploring the biosynthesis of unsaturated fatty acids in Bacillus cereus ATCC 14579 and functional characterization of novel acyl-lipid desaturases. Appl Environ Microbiol 79:6271–6279. 10.1128/AEM.01761-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Li B, Lv R, Xiao Y, Hu W, Mai YL, Zhang JW, Lin L, Hu XY. 2019. A novel nitrite-base aerobic denitrifying bacterium Acinetobacter sp. YT03 and its transcriptome analysis. Front Microbiol 10:2580. 10.3389/fmicb.2019.02580. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Zou DY, Wan R, Han LL, Xu MN, Liu Y, Bin Liu H, Kao S-J, Li M. 2020. Genomic characteristics of a novel species of ammonia-oxidizing archaea from the Jiulong river estuary. Appl Environ Microbiol 86:e00736-20. 10.1128/AEM.00736-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Kawano Y, Suzuki K, Ohtsu I. 2018. Current understanding of sulfur assimilation metabolism to biosynthesize L-cysteine and recent progress of its fermentative overproduction in microorganisms. Appl Microbiol Biotechnol 102:8203–8211. 10.1007/s00253-018-9246-4. [DOI] [PubMed] [Google Scholar]
  • 45.Hicks JL, Mullholland CV. 2018. Cysteine biosynthesis in Neisseria species. Microbiology (Reading) 164:1471–1480. 10.1099/mic.0.000728. [DOI] [PubMed] [Google Scholar]
  • 46.Yang T, Shi Y, Yang Q, Xin Y, Gu ZH, Zhang L. 2021. A novel regulator participating in nitrogen removal process of Bacillus subtilis JD-014. Int J Mol Sci 22:6543. 10.3390/ijms22126543. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Huo YL, Mo JR, He YY, Twagirayezu G, Xue LG. 2022. Transcriptome analysis reveals manganese tolerance mechanisms in a novel native bacterium of Bacillus altitudinis strain HM-12. Sci Total Environ 846:157394. 10.1016/j.scitotenv.2022.157394. [DOI] [PubMed] [Google Scholar]
  • 48.Ma YP, Zhang SM, Meng LQ, Li WG. 2019. Transcriptomic responses of Acinetobacter harbinensis HITLi 7T at low temperatures. Biomed Environ Sci 32:371–375. 10.3967/bes2019.049. [DOI] [PubMed] [Google Scholar]
  • 49.Bergholz PW, Bakermans C, Tiedje JM. 2009. Psychrobacter arcticus 273-4 uses resource efficiency and molecular motion adaptations for subzero temperature growth. J Bacteriol 191:2340–2352. 10.1128/JB.01377-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Jaehme M, Slotboom DJ. 2015. Diversity of membrane transport proteins for vitamins in bacteria and archaea. Biochim Biophys Acta 1850:565–576. 10.1016/j.bbagen.2014.05.006. [DOI] [PubMed] [Google Scholar]
  • 51.Chi BK, Huyen NTT, Van Loi V, Gruhlke MCH, Schaffer M, Mäder U, Maaß S, Becher D, Bernhardt J, Arbach M, Hamilton CJ, Slusarenko AJ, Antelmann H. 2019. The disulfide stress response and protein S-thioallylation caused by allicin and diallyl polysulfanes in Bacillus subtilis as revealed by transcriptomics and proteomics. Antioxidants 8:605 10.3390/antiox8120605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Mols M, Abee T. 2011. Bacillus cereus responses to acid stress. Environ Microbiol 13:2835–2843. 10.1111/j.1462-2920.2011.02490.x. [DOI] [PubMed] [Google Scholar]
  • 53.Hayrapetyan H, Tempelaars M, Groot MN, Abee T. 2015. Bacillus cereus ATCC 14579 RpoN (Sigma 54) is a pleiotropic regulator of growth, carbohydrate metabolism, motility, biofilm formation and toxin production. PLoS One 10:e0134872. 10.1371/journal.pone.0134872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Kajfasz JK, Zuber P, Ganguly T, Abranches J, Lemos JA. 2021. Increased oxidative stress tolerance of a spontaneously occurring perR gene mutation in streptococcus mutans UA159. J Bacteriol 203:e00535-20. 10.1128/JB.00535-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Xu ZB, Xie JH, Liu JY, Ji LL, Soteyome T, Peters BM, Chen DQ, Li B, Li L, Shirtliff ME. 2017. Whole-genome resequencing of Bacillus cereus and expression of genes functioning in sodium chloride stress. Microb Pathog 104:248–253. 10.1016/j.micpath.2017.01.040. [DOI] [PubMed] [Google Scholar]
  • 56.den Besten HMW, Mols M, Moezelaar R, Zwietering MH, Abee T. 2009. Phenotypic and transcriptomic analyses of mildly and severely salt-stressed Bacillus cereus ATCC 14579 cells. Appl Environ Microbiol 75:4111–4119. 10.1128/AEM.02891-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Shan Q, Ma FT, Wei JY, Li HY, Ma H, Sun P. 2020. Physiological functions of heat shock proteins. Curr Protein Pept Sci 21:751–760. 10.2174/1389203720666191111113726. [DOI] [PubMed] [Google Scholar]
  • 58.Su JJ, Liu BY, Liu CY. 2001. Comparison of aerobic denitrification under high oxygen atmosphere by Thiosphaera pantotropha ATCC 35512 and Pseudomonas stutzeri SU2 newly isolated from the activated sludge of a piggery wastewater treatment system. J Appl Microbiol 90:457–462. 10.1046/j.1365-2672.2001.01265.x. [DOI] [PubMed] [Google Scholar]
  • 59.Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254. 10.1006/abio.1976.9999. [DOI] [PubMed] [Google Scholar]
  • 60.Felz S, Vermeulen P, Van Loosdrecht MCM, Lin YM. 2019. Chemical characterization methods for the analysis of structural extracellular polymeric substances (EPS). Water Res 157:201–208. 10.1016/j.watres.2019.03.068. [DOI] [PubMed] [Google Scholar]
  • 61.El Razak AA, Ward AC, Glassey J. 2014. Screening of marine bacterial producers of polyunsaturated fatty acids and optimisation of production. Microb Ecol 67:454–464. 10.1007/s00248-013-0332-y. [DOI] [PubMed] [Google Scholar]
  • 62.Xie LL, Zhang T, Zheng LY, Xie D, Jin J, Wang XG, Jin QZ. 2021. Chemical compositions and oxidative stabilities of Ginkgo biloba kernel oils from four cultivated regions in China. J Am Oil Chem Soc 98:541–550. 10.1002/aocs.12474. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1

Tables S1 to S3 and Fig. S1 to S4. Download aem.01928-22-s0001.pdf, PDF file, 0.7 MB (705.6KB, pdf)

Data Availability Statement

All data obtained during this study are included in the manuscript or supplemental material. All clean reads of the transcriptome sequence in this study have been submitted to the NCBI Sequence Read Archive (SRA) database (https://submit.ncbi.nlm.nih.gov/subs/sra/) and assigned to BioProject accession number PRJNA892303.


Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES