Listeria InlB Expedites Vacuole Escape and Intracellular Proliferation by Promoting Rab7 Recruitment via Vps34

Robert J Cain; Mariela Scortti; Héctor J Monzó; José A Vázquez-Boland

doi:10.1128/mbio.03221-22

. 2023 Jan 19;14(1):e03221-22. doi: 10.1128/mbio.03221-22

Listeria InlB Expedites Vacuole Escape and Intracellular Proliferation by Promoting Rab7 Recruitment via Vps34

Robert J Cain ^a, Mariela Scortti ^a, Héctor J Monzó ^a,^*, José A Vázquez-Boland ^a,^✉

Editor: Scott J Hultgren^b

PMCID: PMC9973280 PMID: 36656016

ABSTRACT

Rapid phagosomal escape mediated by listeriolysin O (LLO) is a prerequisite for Listeria monocytogenes intracellular replication and pathogenesis. Escape takes place within minutes after internalization from vacuoles that are negative to the early endosomal Rab5 GTPase and positive to the late endosomal Rab7. Using mutant analysis, we found that the listerial invasin InlB was required for optimal intracellular proliferation of L. monocytogenes. Starting from this observation, we determined in HeLa cells that InlB promotes early phagosomal escape and efficient Rab7 acquisition by the Listeria-containing vacuole (LCV). Recruitment of the class III phosphoinositide 3-kinase (PI3K) Vps34 to the LCV and accumulation of its lipid product, phosphatidylinositol 3-phosphate (PI3P), two key endosomal maturation mediators, were also dependent on InlB. Small interfering RNA (siRNA) knockdown experiments showed that Vps34 was required for Rab7 recruitment and early (LLO-mediated) escape and supported InlB-dependent intracellular proliferation. Together, our data indicate that InlB accelerates LCV conversion into an escape-favorable Rab7 late phagosome via subversion of class III PI3K/Vps34 signaling. Our findings uncover a new function for the InlB invasin in Listeria pathogenesis as an intracellular proliferation-promoting virulence factor.

KEYWORDS: Listeria monocytogenes, Listeria virulence, internalins, InlB, intracellular parasitism, intracellular survival, intracellular proliferation, endocytic trafficking, phagosome maturation, Listeria-containing vacuole, vacuole escape, subversion of phosphoinositide metabolism, phosphoinositide 3-kinase, class III PI3K, Vps34, phosphatidylinositol 3-phosphate, Rab5, Rab7

INTRODUCTION

The Gram-positive pathogen Listeria monocytogenes is the causative agent of listeriosis, an invasive foodborne infection with severe clinical manifestations, including meningoencephalitis, septicemia, stillbirth, and neonatal sepsis (1). Listeria virulence depends on the ability of these bacteria to proliferate within macrophages and a variety of nonphagocytic cells. In contrast to other major intracellular pathogens, such as Mycobacterium tuberculosis or Salmonella, Listeria replicates in the cytosol and not in a membrane-bound vacuole (2, 3).

Within 30 min of cell entry, Listeria bacteria escape from acidified vesicles (4) bearing characteristics of late endosomes prior to fusion with lysosomes (Rab5 negative, Rab7 positive, and lysosomal-associated membrane protein 1 [LAMP1] negative) (5). This process is mediated by the listerial hly gene product, the pore-forming toxin listeriolysin O (LLO), upon its activation at acidic pH (5.5 to 6.0), aided by phospholipases PlcA and PlcB (6). Rapid multiplication ensues, fueled by hexose phosphates, which Listeria take up from the cytosol via the Hpt permease (7). After replication, the listerial actin-polymerizing protein ActA induces actin-based motility and cell-to-cell spread (8), allowing cytosolic Listeria to escape from autophagy (9) and to disseminate throughout host tissues while remaining protected from extracellular defenses (10). InlC, a member of the listerial internalin family (11), cooperates with ActA in cell-to-cell spread (12) while dampening innate immunity by inhibiting NF-κB responses (13).

Active invasion of epithelial and other normally nonphagocytic cells is critical for host barrier translocation and parenchymal tissue colonization by Listeria. Entry into these cells is mediated by the products of the L. monocytogenes inlAB operon, the surface-associated internalins InlA and InlB (14). InlA and InlB interact with specific host cell ligands, the junctional adhesion protein E-cadherin (15, 16) and the hepatocyte growth factor (HGF) receptor Met (17, 18), respectively, triggering phagocytosis. While both internalins synergize and are required for full L. monocytogenes invasiveness, InlA is thought to be specifically important for internalization into certain human epithelial cell subpopulations, whereas InlB promotes entry into a broader range of cell types (19, 20). The entry process begins with the ubiquitination of the InlA and InlB receptors, followed by recruitment of the actin cytoskeleton at clathrin-coated bacterial adhesion sites, with myosin VI providing the force for internalization (21 –23). Subsequently, InlB reinforces the cortical actin polymerization cascade via activation of class I phosphoinositide 3-kinase (PI3K) downstream of Met (24), with accumulation of phosphatidylinositol 3,4,5-triphosphate (PI[3,4,5]P₃) in the cell membrane, local recruitment of small Rho family GTPases and actin-binding proteins, and phagosome formation (reviewed in reference 25).

The Listeria intracellular survival-promoting determinants (LLO, PlcA, PlcB, Hpt, ActA, InlC) are coordinately regulated by the transcriptional activator PrfA (26). Consistent with their primary intracellular function, PrfA-regulated genes are weakly expressed extracellularly and selectively activated within host cells (27). Interestingly, although having an established role in cell entry, the inlAB locus is also controlled by PrfA (28) and its expression is activated during intracellular infection (29, 30; our unpublished results), suggesting a potential function following internalization. We investigated the possible involvement of the inlAB products in L. monocytogenes intracellular proliferation in human epithelial cells. Here, we report that the invasin InlB promotes early phagosomal escape, and hence bacterial intracellular proliferation, by accelerating the formation of a late-endosomal Rab7-positive compartment via subversion of class III PI3K signaling.

RESULTS

InlB is required for efficient intracellular proliferation.

Isogenic L. monocytogenes in-frame inlA and inlB deletion mutants were tested in human epithelial HeLa cells using gentamicin protection assays. Since the intracellular population at a given time point depends directly on the initial number of internalized bacteria, the multiplicity of infection (MOI) was adjusted such that each strain had comparable intracellular numbers at t = 0 (average of ~5 × 10⁴ colony forming units [CFU]/well). In addition, the intracellular proliferation data were normalized to the bacterial counts at t = 0 using an intracellular growth coefficient (IGC) (27) (see Materials and Methods).

As shown in Fig. 1A, while the ΔinlA mutant behaved as the wild type (WT), a distinct intracellular growth defect was observed for the ΔinlB mutant. This was reproduced in other cell lines (human intestinal Caco-2 cells, murine J774 macrophages) (see Fig. S1 in the supplemental material) and corroborated early observations in mouse hepatocytes (31). The effect was not attributable to impaired bacterial fitness, since the ΔinlB mutant showed no growth defect in broth (Fig. S1B). Complementation of ΔinlB with the inlB gene on a plasmid, but not empty vector, rescued InlB production (Fig. S1C), normal cell entry (Fig. S1D), and WT intracellular proliferation (Fig. 1A), linking the observed phenotype to InlB.

FIG S1

(A) Defective intracellular proliferation of the L. monocytogenes ΔinlB mutant in human intestinal cells and murine macrophages. Like in HeLa cells, InlB, but not InlA, is required for efficient intracellular proliferation in (top panel) human Caco-2 enterocytes and (bottom panel) mouse J774 macrophages. IGC, intracellular growth coefficient (see the legend to Fig. 1 and Materials and Methods). *, statistically significant differences from WT (P < 0.01). (B to D) Characterization of the L. monocytogenes ΔinlB mutant. (B) The growth rate (μ parameter) and maximum growth (A parameter) of the L. monocytogenes ΔinlB mutant do not differ significantly from WT. Values were estimated from OD₆₀₀ units in BHI at 37°C, determined every 30 min in a 96-well microplate reader (FluoStar Omega apparatus) using a logistic growth model in Prism software (GraphPad, v.9.4.1). Values are mean ± standard error of the mean (SEM) of results from four experiments. P > 0.05 (t test). (C) Detection of InlB by Western immunoblotting in extracts of L. monocytogenes WT and isogenic ΔinlB mutant before and after complementation with inlB (ΔinlB+inlB) or empty vector (ΔinlB+vector). The blots were also processed with an anti-InlA antibody as a control. (D) Invasion efficiency of bacteria in panel A and Fig. 1A. *, statistically significant difference (P < 0.05). Download FIG S1, TIF file, 0.9 MB^{(931.4KB, tif)}.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

L. monocytogenes proliferation in a cell monolayer is dependent on both successful escape to the cytosol and actin-based spreading to adjacent cells. The contribution of cell-to-cell spread to the ΔinlB proliferation defect can be tested using a strain lacking ActA (8). While, as expected, overall proliferation was generally reduced in the absence of ActA due to the spread deficiency, intracellular growth was significantly diminished in a ΔactA ΔinlB double mutant compared to the ΔactA single mutant. Again, complementation with inlB, but not empty vector, reverted the proliferation defect (Fig. 1B). Together, these data indicated that the absence of InlB impairs L. monocytogenes intracellular proliferation due to effects upstream of cell-to-cell spread.

InlB promotes early vacuole escape.

The ΔinlB phenotype could be due either to a reduced ability to replicate within the cytoplasm or to an earlier defect in vacuole escape. To test this, the proportion of vacuole-associated and cytosolic bacteria was monitored over a 90-min infection time course in HeLa cells using two separate microscopy-based assays. Vacuole-associated bacteria were identified by colocalization with FM 1-43FX, a fluorescent membrane probe that constitutively labels endosomes and phagosomes (32, 33). The vacuole marker was associated as early as 10 min after infection with WT L. monocytogenes, with a peak at 20 to 30 min before rapidly dropping to ~20% of the bacterial population by 90 min (Fig. 2A and B). Although entering in fewer numbers (Fig. S2B), the ΔinlB bacteria that successfully invaded the monolayer showed similar FM 1-43FX colocalization dynamics during the first 30 to 45 min of infection. Subsequently, however, the ΔinlB mutant remained membrane associated in high numbers, the percentage only dropping by 20% over the rest of the time course (Fig. 2A and Fig. S2A). To quantify the phenotype while controlling for variations in cell entry rate, vacuolar persistence (VP) was calculated based on the length of time between 50% initial bacterial association and 50% dissociation with the membrane probe relative to peak values. The VP values were 34.2 ± 8.0 and 69.6 ± 5.0 min for the WT and ΔinlB mutant, respectively (Fig. 2A, right), suggesting the latter had a vacuole escape defect. In parallel, cytosolic bacteria were identified both through ActA-mediated F-actin accumulation (8) and decoration with a transfected fluorescent probe that binds to Listeria after escape to the cytosol (CBD, a listeriophage endolysin cell wall-binding domain fused to yellow fluorescent protein [YFP]) (5). Consistent with the vacuole association data, significant decoration with the CBD probe was observed later for the ΔinlB mutant than the WT. The dynamics of actin accumulation around bacteria mirrored the CBD probe data (Fig. 2C and D). With both approaches, the mutant phenotype reverted to WT in the inlB-complemented ΔinlB mutant (Fig. 2A and C and Fig. S2A and B). These data indicated that InlB is required for efficient vacuole escape in HeLa cells.

FIG S2

(A) InlB promotes early vacuole escape (complete image composite of Fig. 2B). Representative fluorescence micrographs illustrating association of L. monocytogenes WT, ΔinlB mutant, and inlB-complemented ΔinlB (ΔinlB+inlB) with phagosomes over a 90-min infection time course as determined using the constitutive endosomal membrane probe FM 1-43FX. DAPI was also used to visualize bacteria and cell nuclei. (Top panels) Wide-field ×630 merged image of the two dyes (size bar, 10 μm); (middle panels), DAPI stain alone; (bottom panels), ×2.5 magnification of the boxed areas from the top panel in color (red, FM 1-43FX-stained phagosomes; blue, DAPI-stained bacteria and cell nuclei). The inset in the bottom panel shows a further ×2.5 magnification of specific intracellular bacteria (approximate total magnification, ×4,000). Examples of vacuolar bacteria and cytosolic bacteria are indicated by arrowheads and arrows, respectively. (B) The L. monocytogenes ΔinlB mutant shows delayed escape to the cytosol (complete image composite of Fig. 2D). Representative fluorescence micrographs illustrate the association of L. monocytogenes WT, ΔinlB mutant, and inlB-complemented ΔinlB (ΔinlB+inlB) with the CBD cystosolic probe (green) over a 90-min infection time course. Samples were additionally stained with Alexa Fluor 568-conjugated phalloidin to visualize F-actin (red) and DAPI to visualize cell nuclei and bacteria (blue). (Top panels) Wide-field ×630 merged image of the three dyes in color; the size bar indicates 10 μm. Permeation of the fluorescent CBD probe (5) combined with a thicker section of the cell in the nucleus area compared to the periphery makes some nuclei show a bright CBD signal. Boxed areas of interest are shown in the bottom panel at ×2.5 magnification. Examples of CBD/F-actin-associated bacteria and nonassociated bacteria are indicated by arrowheads and arrows, respectively. Download FIG S2, TIF file, 2.6 MB^{(2.6MB, tif)}.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

InlB promotes Rab7 recruitment to the Listeria-containing vacuole (LCV).

To explore the mechanism of ΔinlB’s delayed escape, different endosomal trafficking markers were probed over the infection time course in HeLa cells. Consistent with previous findings in macrophages (5), the key regulator of early to late endosome maturation, Rab5 (34, 35), was not found to localize to WT LCVs, and the same was observed for ΔinlB (Fig. S3A). A positive signal was clearly visible on control bacteria-containing vacuoles known to associate with Rab5 (Rhodococcus equi and Staphylococcus aureus) (Fig. S4A), excluding a technical issue with the antibody. Early endosomal antigen-1 (EEA1) (36) could be seen for both WT and ΔinlB bacteria, but only at 10 min after infection and for a small proportion of LCVs (~10%) (Fig. 3A, left, and Fig. S3B). Thus, EEA1 might have a role during the initial stages of Listeria endocytosis, as previously observed (25), but apparently only transient and independent of InlB.

FIG 3 — Transient recruitment of EEA1 and InlB-promoted accumulation of Rab7. (A) Percentage of EEA1- and Rab7-positive WT, Δ*inlB* and *inlB*-complemented Δ*inlB* LCVs. *, significant differences from WT (P < 0.05). (B) Representative fluorescence micrographs showing LCV association with Rab7 (for EEA1 see Fig. S3B). Shown are merged and individual channels for Rab7 (anti-Rab7 primary antibody and Alexa Fluor 568-conjugated anti-rabbit secondary antibodies [red]), F-actin (Alexa Fluor 488-conjugated phalloidin [green]), and bacteria/cell nuclei (DAPI [blue]). Shown are ×2.5 enlarged areas of interest of images originally captured at ×630 (complete image composite in Fig. S4B). Examples of Rab7-associated and nonassociated LCVs are indicated by arrowheads and arrows, respectively.

FIG S3

Rab5, EEA1, and LAMP1 endosomal markers. Shown are illustrative fluorescence micrographs of HeLa cells infected with L. monocytogenes WT, ΔinlB mutant, and inlB-complemented ΔinlB (ΔinlB+inlB) and stained with antibody to (A) Rab5 (10 min after infection), (B) EEA1 (10 and 30 min after infection [see Fig. 3A, left panel, for quantifications]) and (C) LAMP1 (20 min after infection for WT and ΔinlB+inlB and 45 min after infection for ΔinlB). After the primary antibody, Alexa Fluor 568-conjugated anti-rabbit or anti-mouse secondary antibodies were used to visualize the vacuole markers (red) followed by Alexa Fluor 488-conjugated phalloidin for F-actin (green) and DAPI for cell nuclei and bacteria (blue). (Top panels) Wide-field ×630 merged images of the three dyes. Size bar, 10 μm. Boxed areas of interest are shown in the bottom panels at ×2.5 magnification. In panel B, examples of EEA1-associated bacteria and nonassociated bacteria are indicated by arrowheads and arrows, respectively. Download FIG S3, TIF file, 2.6 MB^{(2.7MB, tif)}.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S4

(A) Rab5 detection on Staphylococcus aureus- and Rhodococcus equi-containing vacuoles. S. aureus and R. equi are examples of bacteria whose phagosomes typically associate with Rab5 soon after phagocytosis (80, 81). S. aureus USA300 infection of HeLa cells and R. equi 103S infection of J774 macrophages were allowed to proceed for 10 min before fixation and processing for fluorescence microscopy. Coverslips were incubated with anti-Rab5 primary and Alexa Fluor 568-conjugated anti-rabbit secondary antibodies (red). S. aureus-infected cell monolayers were additionally stained with DAPI to visualize bacteria and cell nuclei (blue); DAPI stains R. equi poorly, so bacteria were visualized in these samples by phase-contrast microscopy. Examples of Rab5-positive bacteria-containing vacuoles are indicated by arrowheads. (Left) S. aureus-infected HeLa cells. (Top panels) Wide-field ×630 images. A number of bacteria (blue) can clearly be seen associating with Rab5 (red) in the merged panel (far right). (Bottom panels) Magnified ×5 areas of interest (bottom). (Right) R. equi-infected J774 cells. Wide-field ×1,000 images are shown on the far left. Two areas of interest, labeled a and b, are shown as ×5 enlarged panels on the right. Large vacuoles containing R. equi bacteria (phase dark) can clearly be seen associating with Rab5 (red). (B) Rab7 recruitment to the Listeria vacuole (complete image composite of Fig. 3B). Representative fluorescence micrographs illustrating association of L. monocytogenes WT, ΔinlB mutant, and inlB-complemented ΔinlB (ΔinlB+inlB) with Rab7 over a 90-min infection time course. Samples were stained with anti-Rab7 primary antibody and Alexa Fluor 568-conjugated anti-rabbit secondary antibodies (red), and additionally with Alexa Fluor 488-conjugated phalloidin to visualize F-actin (green) and DAPI to visualize cell nuclei and bacteria (blue). (Top panels) Wide-field ×630 merged image of the three dyes; bar indicates 10 μm. Boxed areas are shown in the bottom panel at ×2.5 magnification. Examples of Rab7-associated and nonassociated LCVs are indicated by arrowheads and arrows, respectively. Download FIG S4, TIF file, 2.7 MB^{(2.8MB, tif)}.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

Differences between the WT and ΔinlB mutant were evident, however, for the Rab7 late endosomal marker. Rab7 associated with WT LCVs soon after internalization, as previously seen in macrophages (5). The Rab7 GTPase was detected on a large proportion of phagosomes 10 min after infection, with a peak at 20 min, while it was absent 25 min later, coinciding with vacuole escape. In contrast, ΔinlB LCVs showed late acquisition of Rab7, with a flatter peak at 30 min followed by prolonged association up to 90 min. The phenotype could be rescued using the inlB-complemented mutant, indicating that it was due to InlB expression (Fig. 3A, right, and Fig. S4B). This echoed the vacuole escape experiments showing that the ΔinlB mutant reached the cytoplasm much later than WT (Fig. 2). ΔinlB was not found to colocalize with the lysosomal-associated membrane protein 1 (LAMP1), implying that although delayed in escape, the mutant was still able to avoid lysosomal fusion (Fig. S3C). Collectively, these data indicated that InlB promotes Rab7 recruitment to the LCV, and this correlated with InlB-dependent early vacuole escape.

InlB-dependent PI3P accumulation and class III PI3K (Vps34) recruitment.

The phosphoinositide PI3P plays a key role in the conversion of early endosomes/phagosomes into Rab7-positive vesicles (37, 38) and was previously detected in the LCV of macrophages (5). To determine whether InlB had an effect on PI3P levels in HeLa LCVs, infection time course experiments were conducted in cells expressing a fluorescent PI3P probe (GFP-PX, consisting of the PI3P-binding PX domain from the vacuolar NADPH oxidase subunit, p40^phox, tagged with green fluorescent protein) (39). Accumulation of PI3P was observed after only 10 min in WT LCVs, with a peak by 20 min, declining by 30 min, and almost complete disappearance by 45 min after infection. In marked contrast, PI3P remained undetectable in ΔinlB LCVs during the 90-min time course. This again reverted to WT upon inlB complementation, indicating that, as for Rab7, PI3P accumulation was linked to InlB (Fig. 4A, left, Fig. 4B, and Fig. S5A). PI3P is primarily generated in endosomes and phagosomes by vacuolar protein sorting-34 (Vps34), the sole mammalian class III PI3K isoform (40, 41). Parallel experiments in which HeLa cells were stained with a Vps34 antibody showed Vps34 localizing to WT and inlB-complemented ΔinlB LCVs as early as 10 min after infection, while remaining absent from ΔinlB LCVs (Fig. 4A, right, Fig. 4C, Fig. S5B). This pattern mirrored the PI3P data, consistent with the absence of PI3P being due to a lack of Vps34 recruitment. Thus, the phagosomal escape deficiency caused by absence of InlB was associated with a lack of effective Vps34 recruitment and accumulation of its lipid product on the LCV.

FIG S5

InlB-dependent PI3P and Vps34 accumulation around the Listeria vacuole (complementary image composite for Fig. 4B and C). Representative fluorescence micrographs illustrate the association of L. monocytogenes WT, ΔinlB, and inlB-complemented ΔinlB (ΔinlB+inlB) over a 90-min infection time course with (A) PI3P (transfected PI3P-binding GFP-PX probe [green]) or (B) Vps34 (monoclonal primary- and Alexa Fluor 568-conjugated secondary antibodies [red]). All samples were additionally stained with either Alexa Fluor 568- or Alexa Fluor 488-conjugated phalloidin to visualize F-actin and DAPI to visualize cell nuclei and bacteria (blue). (Larger panels) Wide-field ×630 merged images of the three dyes. Size bar, 10 μm. Boxed areas of interest are shown on the right at ×2.5 magnification. Examples of PI3P/Vps34-associated and nonassociated bacteria are indicated by arrowheads and arrows, respectively. Download FIG S5, TIF file, 2.6 MB^{(2.7MB, tif)}.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

Vps34 supports InlB-dependent intracellular proliferation but not entry.

If InlB-dependent intracellular proliferation involves class III PI3K Vps34 activity, a pan-PI3K inhibitor such as wortmannin (42) should abolish it. Wortmannin treatment of preinfected HeLa cells inhibited L. monocytogenes intracellular proliferation to an extent similar to that seen in the absence of InlB. The effect was clearly dependent on InlB, as wortmannin did not affect the intracellular proliferation of the ΔinlB mutant, while significant inhibition was observed with the inlB- but not mock-complemented mutant (Fig. 5A, left). Wortmannin had a similar InlB-dependent inhibitory effect in Caco-2 cells and J774 macrophages (Fig. S6A).

FIG 5 — Vps34 supports InlB-dependent intracellular proliferation and vacuole escape. (A) Intracellular proliferation of WT, Δ*inlB*, and *inlB*-complemented Δ*inlB* *L. monocytogenes* in (left) wortmannin-treated HeLa cells (100 nM, nontreated cells with a corresponding amount of DMSO vehicle added; mean CFU/well at t = 0 [×10⁴]: 3.4 ± 1.3 to 8.9 ± 3.6) or (right) cells treated with control or Vps34-specific siRNA (mean CFU/well at t = 0 [×10⁴]: 1.7 ± 0.31 to 6.1 ± 0.47). IGC, intracellular growth coefficient. *, significant difference (P < 0.05). (B) Vacuole escape dynamics of *L. monocytogenes* WT in cells treated with control or Vps34-specific siRNA determined using FM 1-43FX membrane probe (vacuole-associated bacteria [line graph]) and F-actin staining (cytosolic bacteria [bars]). *, P < 0.01. Illustrative fluorescence micrographs are shown in Fig. S7A. (C) Same as panel B for Rab7 association (Fig. S7B).

FIG S6

(A) InlB-dependent inhibion of L. monocytogenes intracellular proliferation in Caco-2 and J774 cells by wortmannin. As observed in HeLa cells, efficient intracellular proliferation in human Caco-2 enterocytes and murine J774 macrophages requires PI3K activity. IGC, intracellular growth coefficient. *, statistically significant differences from the WT (P < 0.05). (B to D) Wortmannin but not class I PI3K inhibitors impairs L. monocytogenes intracellular proliferation. (B) PI3K inhibitor efficacy determined by Akt phosphorylation. Lysates from cells treated with the pan-PI3K inhibitor wortmannin (100 nM) or different class I PI3K isoform-specific inhibitors (PIK-75, 100 nM; PI-103, 250 nM; TGX-221, 500 nM; AS252524, 5 μM) were immunoblotted with antibodies to phosphorylated Akt (pAktS473) and to Akt and GAPDH as loading controls. Wortmannin, PIK75 (class IA-α), and PI-103 (class IA) all showed strong inhibition of pAktS473. Total Akt levels remained unchanged, indicating this was a phosphorylation-specific effect. Such inhibition was not observed with TGX-221 (class IA-β) and AS252524 (class IB), likely due to a lower contribution to overall pAkt levels by the corresponding PI3K isoforms in HeLa cells (PI3Kα is the predominant isoform in HeLa cells, while PI3Kγ is primarily expressed in cells of the immune system) (51, 82). (C) Intracellular proliferation of L. monocytogenes in HeLa cells treated with the PI3K inhibitors described in panel B. IGC, intracellular growth coefficient (see the legend to Fig. 1 and Materials and Methods). *, statistically significant differences from the untreated control (P < 0.05). (D to F) siRNA knockdown of class III, but not class I or II, PI3K inhibits L. monocytogenes intracellular proliferation. (D) SDS-PAGE Western immunoblotting showing specific depletion of class I (p85), class II and class III PI3K isoforms by siRNAs using specific antibodies. Depletion of class I isoforms was also measured by Akt phosphorylation (pAktS473 antibody). GAPDH was used as a loading control. (E) Invasion efficiency of L. monocytogenes in HeLa cells depleted of different PI3K isoforms. Results are expressed as a percentage of the control. Entry into HeLa cells is mainly InlB dependent (Fig. S2B), and siRNA knockdown of the InlB signaling receptor for internalization (17) was used as a positive control. *, statistically significant differences from control siRNA-treated cells (P < 0.01). (F) Intracellular proliferation of L. monocytogenes in HeLa cells depleted of different PI3K isoforms, corrected for differences in entry rate by intracellular CFU normalization using an IGC (see the legend to Fig. 1 and Materials and Methods). *, statistically significant differences from control siRNA-treated cells (P < 0.05). Download FIG S6, TIF file, 1.3 MB^{(1.3MB, tif)}.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S7

siRNA knockdown of Vps34 inhibits phagosomal escape and accumulation of Rab7 around the LCV. Representative immunofluorescence micrographs illustrating association of L. monocytogenes WT with (A) phagosomal membranes or (B) Rab7 over a 90-min infection time course in control or Vps34 siRNA-treated HeLa cells (quantifications shown in Fig. 5B and C, respectively). Cells were either treated with the constitutive fluorescent membrane probe FM 1-43FX to visualize phagosomes (red [A]) or incubated with anti-Rab7 primary and Alexa Fluor 568-conjugated secondary antibodies (red [B]) plus Alexa Fluor 488-conjugated phalloidin to visualize F-actin (green) and DAPI to visualize bacteria/cell nuclei (blue). The larger top panels are wide-field ×630 merged images of the three dyes. Size bar, 10 μm. Boxed areas of interest are shown below at ×2.5 magnification. Examples of phagosome membrane- (A) or Rab7- (B) associated bacteria indicated by arrowheads, of F-actin-associated (cytosolic) (A) or non-Rab7-associated (B) bacteria by arrows. Download FIG S7, TIF file, 2.8 MB^{(2.9MB, tif)}.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

To pinpoint the specific PI3K isoform involved, we first used isoform-specific drugs that inhibit class I PI3K. HeLa cells were treated with PIK75 (PI3Kα), TGX-221 (PI3Kβ), AS252524 (PI3Kγ) and PI-103 (PI3Kα,β,δ) (42 –44), and PI3K inhibition efficacy was confirmed by Western blotting for pAktS473 (45) (Fig. S6B). None of these inhibitors significantly affected Listeria proliferation (Fig. S6C), indicating that the effect caused by wortmannin might be linked to non-class I PI3K. We next tested the involvement of class II and class III PI3K using small interfering RNA (siRNA) knockdown experiments. The siRNA treatments resulted in effective depletion of class II (PIKC2α and PIK3C2β; PIK3C2γ did not appear to be expressed in HeLa) and class III (Vps34) PI3K. Similar targeting of the class I PI3K regulatory subunit PIKR1 as a control resulted in a partial knockdown of p85 and a complete loss of class I PI3K activity as determined by pAktS473 Western blotting (Fig. S6D). Transfection with siRNA to the Met receptor required for InlB-mediated entry (17) was also used as an additional control. Both Listeria invasion and intracellular proliferation were investigated in the siRNA-transfected HeLa cells. While as expected (17, 24), both siPIKR1 and siMet significantly reduced cell invasion (60% and 80%, respectively), siRNAs to class II and class III PI3Ks had no effect, indicating they were not involved in the entry process (Fig. S6E). Conversely, in Vps34-, but not class I or class II PI3K-depleted cells, intracellular proliferation was significantly impaired for WT Listeria (Fig. 5A, right, and Fig. S6F), indicating that class III PI3K did indeed have a role in cell infection downstream entry. None of the siRNAs, including siVps34, had any effect on the already reduced intracellular proliferation of the ΔinlB mutant. As seen with wortmannin, complementation with inlB rescued the proliferation inhibition by siVps34 (Fig. 5A, right). Overall, these data indicated that Vps34 required InlB to exert its effect, suggesting that InlB and the class III PI3K act together to promote Listeria intracellular proliferation.

Vps34 is required for Rab7 recruitment and efficient vacuole escape.

To establish whether the (InlB-dependent) effect of Vps34 on intracellular proliferation was linked to vacuole escape efficiency, siVps34- or control siRNA-treated HeLa cells were infected with WT L. monocytogenes and LCVs were monitored over 90 min using either FM 1-43FX or Rab7 antibody. Whereas bacteria appeared to rapidly disengage with LCVs in control cells (as determined by dissociation with the membrane probe and association with F-actin), they remained membrane associated for up to 90 min after infection in Vps34-depleted cells (Fig. 5B and Fig. S7A). Additionally, in contrast to control cells, no Rab7 could be seen around LCVs at any time point in siVps34-treated cells (Fig. 5C and Fig. S7B). These effects were essentially similar to, albeit more severe than, those observed with the L. monocytogenes ΔinlB mutant (Fig. 3A, right, and Fig. 3B), supporting the notion that InlB promotes vacuole escape by subverting LCV membrane trafficking via Vps34. These data also demonstrated the importance of Vps34 in Rab7 recruitment to the Listeria phagosome.

Rapid escape requires Rab7 and is not hindered by Rab5 inhibition.

Listeriae appear to escape from Rab7-positive phagosomes (see reference 5 and data herein), and InlB/Vps34-promoted vacuole escape correlated with Rab7 recruitment to the LCV (this study). To test the role of Rab7 in InlB-facilitated escape, HeLa cells were transfected with control or Rab7-specific siRNAs and infected with WT or ΔinlB L. monocytogenes (Fig. 6A to E). Since the acidic pH of the maturing Rab7-positive phagosome is thought to be critical for efficient LCV disruption by LLO (5, 6), an isogenic Δhly mutant was also included to determine whether Rab7 recruitment is linked to LLO-mediated escape. Although inefficiently, escape may occur in human epithelial cells in the absence of LLO, resulting in LLO-independent intracellular growth (46). We therefore verified that LLO was required for rapid vacuole escape under our conditions during the infection time course experiments in HeLa cells (Fig. 6A to D and Fig. S8A and B).

FIG S8

(Left panels) Rab7 is required for efficient Listeria phagosomal escape (representative micrographs for Fig. 6B). Association of WT and Δhly L. monocytogenes with phagosomes in control or Rab7 siRNA-treated HeLa cells over a 90-min infection time course (with images for the ΔinlB mutant omitted as representative micrographs equivalent to control conditions are shown in Fig. S2A). Phagosomes were visualized with the constitutive membrane probe FM 1-43FX and bacteria/cell nuclei with DAPI. (Top panels) Wide-field ×630 merged color image of the two dyes (size bar, 10 μm); (middle panels) DAPI channel; (bottom panels) ×2.5 magnification of the boxed areas from the top panel (red, FM 1-43FX-stained phagosomes; blue, DAPI-stained bacteria and cell nuclei). The inset in the bottom panel shows a further ×2.5 magnification of specific intracellular bacteria (approximate total magnification, ×4,000). Examples of vacuolar membrane-associated and nonassociated bacteria indicated by arrowheads and arrows, respectively. (Right panels) Rab7 is required for efficient Listeria vacuole escape (representative micrographs for Fig. 6C and D). Association of WT and Δhly L. monocytogenes with Rab7 in control or Rab7-treated HeLa cells over a 90-min infection time course (with images for the ΔinlB mutant omitted as representative micrographs equivalent to control conditions are shown in Fig. S4B). Samples were stained with anti-Rab7 primary and Alexa Fluor 568-conjugated secondary antibodies (red), Alexa Fluor 488-conjugated phalloidin to visualize F-actin (green), and DAPI to visualize bacteria/cell nuclei (blue). (Top panels) Wide-field ×630 merged images of the three dyes. Size bar, 10 μm. Boxed areas of interest are shown below at a ×2.5 magnification. Examples of Rab7-associated and -nonassociated bacteria are indicated by arrowheads and arrows, respectively. Download FIG S8, TIF file, 2.9 MB^{(2.9MB, tif)}.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S9

(A and B) Expression of a dominant-negative Rab5 mutant does not affect Listeria intracellular proliferation. (A) SDS-PAGE Western immunoblotting showing expression of the Rab5-S34N dominant-negative construct in HeLa cells. GAPDH was used as a loading control. (B) Intracellular numbers of L. monocytogenes WT and isogenic ΔinlB mutant in Rab5-S34N-expressing or control (empty vector) HeLa cells, normalized at each time point to the internalized bacteria at t = 0 using an intracellular growth coefficient (IGC) (see the legend to Fig. 1 and Materials and Methods). Internalization was not affected by Rab5 inhibition (not shown). *, statistically significant differences (P < 0.05). (C and D) Rab5 depletion does not impede Listeria vacuole escape or Rab7 association with the LCV. (C) Representative fluorescence micrographs illustrating association of L. monocytogenes WT with phagosomes in control or Rab5 siRNA-treated HeLa cells over a 90-min infection time course (quantifications in Fig. 6G). Phagosomes were visualized with the constitutive membrane probe FM 1-43FX (red) and bacteria/cell nuclei with DAPI (blue). (Top panels) Wide-field ×630 merged color image of the two dyes (size bar, 10 μm); (bottom panels) ×2.5 magnification of the boxed areas from the top panel. The inset in the bottom panel shows a further ×2.5 magnification of specific intracellular bacteria (approximate total magnification, ×4,000). Examples of vacuolar membrane-associated and nonassociated bacteria are indicated by arrowheads and arrows, respectively. (D) Same as in panel C, but coverslips were stained with anti-Rab7 primary and Alexa Fluor 568-conjugated anti-rabbit secondary antibodies (red) and Alexa Fluor 488-conjugated phalloidin (green) to visualize association of Listeria with Rab7 and F-actin, respectively (quantifications in Fig. 6H and I). DAPI was additionally used to visualize bacteria/cell nuclei (blue). (Top panels) Wide-field ×630 merged image of the three dyes. Size bar, 10 μm. Boxed areas are shown in the bottom panel at ×2.5 magnification. Arrowheads and arrows indicate examples of Rab7- and F-actin-associated bacteria, respectively. Download FIG S9, TIF file, 2.6 MB^{(2.6MB, tif)}.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

Rab7 depletion correlated with significantly reduced intracellular growth of WT L. monocytogenes (Fig. 6A), while it did not affect internalization (not shown). Similarly reduced intracellular growth was observed for both ΔinlB and Δhly mutants in control cells, with no significant further change in Rab7-depleted cells (Fig. 6A). Proliferation defects correlated with significantly impaired vacuole escape, as determined by fluorescence microscopy using FM 1-43FX (Fig. 6B) and F-actin staining (Fig. 6C). As expected, Rab7 was not detected in siRab7-treated cells, while in control cells, the Rab7 acquisition pattern of WT and ΔinlB LCVs reproduced our previous results (Fig. 6D; see also Fig. 3A, right). No defect in Rab7 acquisition, but rather a general increase, was observed for Δhly LCVs, followed by a protracted association consistent with a vacuole escape deficiency (Fig. 6D). Together, these data suggest that the effects of InlB on intracellular proliferation depend on Rab7 recruitment, in turn promoting rapid, LLO-mediated vacuole escape.

Although acquisition of the early endosomal Rab GTPase Rab5 normally precedes that of Rab7 in the endosome/phagosome maturation sequence (34, 37), Rab5 could not be recognized on HeLa (our data) or mouse macrophage (5) LCVs even immediately after infection. While this may reflect only poor or transient recruitment, evidence in macrophages suggested that Rab5 might be excluded from the LCV (5). We therefore explored in a final set of experiments the role of Rab5 in Listeria intracellular infection. Rab5 was inhibited in HeLa cells prior to infection either by transfection with Rab5-S34N, a dominant-negative mutant in which the GTPase is locked in GDP-bound inactive form (47), or by using an siRNA pool targeting Rab5 isoforms A, B, and C (Fig. 6J and Fig. S9A). Proliferation of WT L. monocytogenes was not impaired, suggesting that entry into the cytosol was not significantly affected when Rab5 function was perturbed. The defective proliferation phenotype of the ΔinlB mutant also remained unaffected by Rab5 inhibition (Fig. 6F and Fig. S9B). Microscopic analysis of siRNA-treated cells confirmed that vacuole escape was not delayed in Rab5-depleted cells (Fig. 6G and H). Furthermore, no interference with Rab7 recruitment was observed in siRab5-treated cells (Fig. 6I), indicating that Rab5 does not seem to play a significant role in LCV’s maturation to the Rab7-positive stage.

DISCUSSION

The InlB protein is a well-known Listeria invasin that promotes entry into nonphagocytic cells via hijacking of the ligand-dependent Met receptor endocytic pathway and downstream activation of type I PI3K (18, 24, 25, 48). Here, we provide evidence in HeLa cells that InlB has an additional key function at later stages of intracellular infection, accelerating vacuole escape, presumably through subversion of class III PI3K signaling. InlB is sufficient to mediate this process, as shown using gene complementation analysis and pharmacological and siRNA inhibition studies. The role of InlB in LCV maturation and vacuole escape is not unique to HeLa cells as similar effects were observed in Caco-2 human enterocytes (see Fig. S10). InlB has been reported to support Listeria infection in epithelial cells by modulating transcriptional host cell responses via SIRT2-mediated histone H3K18 deacetylation (49). Recently, InlB-induced c-Met/class I PI3K (PI3Kα) signaling has been also found to facilitate L. monocytogenes in vivo persistence and invasive (e.g., brain) infection by inhibiting Fas-mediated killing of infected macrophages (50). Together with these studies, our findings highlight the growing evidence that bacterial virulence factors are multifunctional, encapsulating multiple key host-cell modulatory activities to support infection.

Cell invasion permits Listeria to evade extracellular host defenses while vacuolar escape is essential for intracellular survival (3, 6). Since cytosolic replication relies on successful vacuole escape, optimization of the latter by InlB maximizes listerial intracellular proliferation. In vivo survival also crucially depends on the ability of L. monocytogenes to avoid autophagy and the cytotoxic immune response directed against infected cells via a “runaway” strategy involving ActA-mediated actin-based cell-to-cell spread after cytosolic replication (3, 10). The rapid amplification of the bacterial load is clearly an essential component of this strategy because it increases the chances of spreading before the infected cell is targeted by host defenses. Indeed, L. monocytogenes possesses a dedicated virulence factor to promote rapid intracellular replication, the hexose phosphate transporter Hpt (7). The vacuolar escape-accelerating activity of InlB here identified (together with its recently reported role in protecting infected monocytes from CD8⁺-mediated killing) (50) can therefore be seen as contributing, alongside Hpt, to provide L. monocytogenes a competitive edge against host immunity.

Strikingly, InlB targets both extracellularly and intracellularly the endocytic pathway through interference with PI3K signaling. It seems unlikely that InlB-dependent class III PI3K (Vps34)-promoted escape is directly linked to the stimulatory effect of InlB on class I PI3K during entry because Vps34 is not known to be downstream of the Met receptor. Indeed, our data show that Vps34 supports InlB-dependent intracellular proliferation but not entry. Moreover, InlB/Vps34-promoted vacuole escape was resistant to class I PI3K isoform inhibition. Rather, these two distinct InlB functions appear to be spatiotemporally coordinated, since the hijacking of the endocytic pathway occurs at two sequential levels involving stage-specific PI3K isoforms (51) coincident with consecutive steps in Listeria intracellular pathogenesis. After Met/class I PI3K-mediated internalization and phagocytic cup closure, a receptor-free fraction of InlB, or InlB in complex with Met before sorting for lysosomal degradation (21, 52), might direct Vps34 recruitment to the early LCV. Cotransfection experiments demonstrated colocalization of Vps34 and PI3P in InlB-positive vesicles, but we could not detect binding between InlB and Vps34 by immunoprecipitation (data not shown). This may reflect either an interaction too weak to be captured or that InlB acts upstream of Vps34.

The catalytic subunit of class III PI3K Vps34 is an effector of the small GTPase Rab5 in the endocytic pathway and localizes to nascent endosomes in complex with several regulatory subunits through interaction with membrane-bound GTP-Rab5 (41, 51). Via Vps34, Rab5 controls recruitment of PI3P-binding proteins necessary for early endosome sorting and progression to the Rab7 late endosome stage (35, 41, 51, 53, 54). Intriguingly, however, although Vsp34 was obviously present, we could not detect Rab5 in the HeLa LCVs, recapitulating previous observations in macrophages (5). The FYVE-domain (PI3P-binding) Rab5 effector EEA1 requires not only PI3P but also corecognition by GTP-Rab5 for targeting to early endosomes (35, 51, 55). EEA1 was barely detectable in the Listeria phagosomes regardless of significant PI3P accumulation, consistent with Rab5 being only transiently or poorly recruited to the LCV. Indeed, in contrast to Vps34 knockdown, inhibition of Rab5 did not impede Rab7 acquisition by the LCV (or Listeria escape/intracellular proliferation), suggesting that Rab5 has a marginal or accessory role in the process.

Our findings do not seem to support the previous proposition that L. monocytogenes actively recruits and inhibits Rab5 to block LCV maturation and delay phagolysosome fusion (56, 57). Indeed, the late endosomal marker Rab7 is rapidly recruited to the LCV after Listeria entry in human epithelial cells (our data) and murine macrophages (5), inconsistent with phagocytic vacuole maturation being arrested. On the contrary, L. monocytogenes appears to expedite the process via InlB-promoted recruitment of Vps34, driving LCVs to a Rab7-positive, prelysosome (LAMP1-negative) stage. This might be facilitated by diminished Rab5 levels/EEA1-mediated fusion with other (bacterium-free, Rab5-loaded) early endosomes (34, 54, 58), as this would contribute to isolating LCVs from normal endosomal traffic. The experiments using inlB and hly mutants in Rab7-depleted cells indicated that rapid (InlB-promoted) escape takes place from Rab7-positive vacuoles and that Rab7 facilitates LLO-mediated escape, likely because of the acidified intraluminal environment of the maturing endosome (6). Consequently, InlB could be seen as acting intracellularly in concert with the low-pH-activated LLO toxin to achieve efficient vacuole escape and avoid lysosomal killing.

The apparent lack of Rab5 recruitment to the LCV is puzzling, as the coordinated replacement of Rab5 by Rab7 appears to be key in the early-to-late endosome conversion process (34, 54, 59, 60). According to the current model, upon accumulation of PI3P, the Mon1/Sand1-Ccz1 protein complex displaces the Rab5-activating guanine nucleotide exchange factor (GEF) Rabex5, causing membrane dissociation of Rab5, and recruits/activates Rab7 through interaction with the HOPS (homotypic fusion and vacuole protein sorting) complex in association with the Rab7 GEF, Ccz1 (38, 54, 59, 61). Although GTP-Rab5 interacts with Mon1 and HOPS components (34, 38, 62), it is unclear whether Rab5 is strictly needed in the process once PI3P is generated by its downstream effector Vps34, because the Mon1-Ccz1 complex binds to PI3P (63, 64). Conceivably, therefore, L. monocytogenes might directly promote Rab7 accumulation without a sustained Rab5 input via InlB-modulated Vps34 recruitment and concomitant PI3P generation (Fig. 7). It is worth noting, however, that even in the absence of InlB, and thus of detectable Vps34 and PI3P accumulation, Rab7 acquisition still occurred in the LCV, albeit more slowly. This observation is consistent with previous data showing significant Rab7 recruitment to phagosomes in wortmannin-treated cells (37), implying that the phagosome maturation process can be, at least partially, independent of Vps34 activity (65). Nevertheless, our siRNA experiments support a crucial role for Vps34 because its depletion appeared to prevent Rab7 recruitment to the LCV. Since via a regulatory loop Vps34 negatively regulates Rab5 during endosome maturation (66), InlB-promoted Vps34 recruitment itself might have a role in the lack of detection of Rab5 in the LCV. Multiple mediators and interactors are involved in the intricate regulation of endosome trafficking (41, 51, 54, 59, 60), and further research is needed to clarify the mechanism underlying the apparent Rab5 exclusion and how InlB promotes Vps34 and Rab7 recruitment in the LCV.

FIG 7 — Model of sequential PI3K subversion by *L. monocytogenes* InlB along the endocytic pathway. At the cell surface, InlB first induces Met receptor-dependent class I PI3K activation by mimicking the natural role of HGF, leading to phagosome formation. The process involves InlB-induced autophosphorylation of the Met tyrosine kinase receptor, recruitment of adaptor proteins involved in class I PI3K recruitment/activation (Gab1, Shc, CrkII), and local accumulation of PI(3,4,5)P₃ leading to Rac1 activation, recruitment of actin polymerization promoting proteins (Ena/VASP, WAVE, N-WASP), and activation of the Arp2/3 actin-polymerizing complex (reviewed in reference 25). After entry, InlB next modulates endosomal trafficking via activation of class III PI3K (Vps34) signaling to accelerate LLO-mediated phagosome disruption, promoting intracellular bacterial survival and proliferation. Depicted on the left is the canonical endocytic pathway leading to an acidified late endosome via recruitment of the vATPase proton pump and fusion with LAMP1-positive lysosomes; on the right is depicted the “*Listeria* pathway” with the different steps of the intracellular infection cycle. (a) InlB-dependent entry. (b) Formation of a *Listeria*-containing vacuole (LCV), typically Rab5-negative, Rab7-positive, and LAMP1-negative. Lack of detection of Rab5 in the LCV, due to either defective/transient recruitment or active exclusion (5) by unknown mechanisms, impairs EEA1 acquisition and EEA1-mediated tethering and fusion with early endosomes, contributing to isolate the LCV from normal endocytic traffic. InlB bypasses the regulatory role of Rab5 in phagosome maturation by promoting the recruitment of the Rab5 downstream effector Vps34 (class III PI3K). (c) Accumulation of the Vps34 product PI3P promotes the rapid conversion of the LCV into an acidified Rab7 late endosome-like compartment in which the pore-forming toxin LLO becomes active (LLO*). (d) Vacuole disruption occurs followed by (e) rapid bacterial proliferation in the cytosol (e) and actin-based cell-to-cell spread (f). InlB-stimulated effects are indicated in green.

Avoidance of lysosomal killing by vacuolar pathogens often involves interference with class III PI3K/PI3P signaling, but the specific underlying mechanism differs for each pathogen (67, 68). M. tuberculosis, for example, causes early phagosome maturation arrest through depletion of PI3P by the secreted SapM phosphatase as well as inhibition of Vps34 by mycobacterial cell envelope components. Rab5 is retained, but EEA1 and Rab7 are excluded, blocking acquisition of the acidifying vacuolar proton pump ATPase and lysosomal fusion (69 –72). Salmonella, in contrast, promotes homotypic fusion of PI3P-enriched, Rab5- and EEA1-positive vesicles to form a large vacuole in which the bacteria proliferate. This is mediated by the type III secreted effector SopB, which promotes PI3P generation by dephosphorylating phosphatidylinositol di- and triphosphates and through recruitment of Rab5 and Vps34 activation (73, 74). Here, we show that L. monocytogenes, via InlB, promotes the recruitment of Vps34 and induces PI3P generation on the LCV, boosting the formation of an escape-favorable Rab7 late phagosome. Our data offer a novel example of bacterial modulation of endosomal trafficking, unexpectedly in a cytosolically replicating pathogen that only very transiently interacts with the phagocytic vacuole after internalization.

MATERIALS AND METHODS

Bacteria, plasmids, antibodies, and reagents.

Isogenic derivatives of L. monocytogenes serovar 4b clinical isolate P14 with constitutive in vivo-like virulence gene expression (75) were used in this study. The construction of ΔinlA and ΔinlB in-frame deletion mutants is described below, the ΔactA and Δhly mutants have been reported elsewhere (27, 76). The R. equi 103S and S. aureus USA300 strains used as controls for Rab5 detection in bacterial phagosomes were from our bacterial isolate collection and R. Fitzgerald’s laboratory (Roslin Institute, University of Edinburgh), respectively. Mammalian expression plasmids pEYFP-CBD, encoding the Listeria cell wall-binding cytosolic probe, and pGFP-iPX, encoding the PI3P-binding probe, were kindly provided by J. Swanson’s lab (University of Michigan Medical School, Ann Arbor, MI, USA) and the L. Stephen/P. Hawkins’s lab (Babraham Institute, Cambridge, United Kingdom), respectively (5, 39). The plasmid pHinlB used for complementation of the ΔinlB mutant is a derivative of the E. coli Gram-positive shuttle vector pHPS9 (77) containing the inlB gene. The insert was prepared by PCR amplification of inlB and upstream inlAB operon regulatory regions from L. monocytogenes PAM14 ΔinlA genomic DNA using oligonucleotides mainl13SalI13 (ACGCGTCGACGAACATAAAGGGTAGAGG) and inlBBamHI (CGGGATCCCGATTCTTGCTAGACCACC), which carry SalI and BamHI restriction sites (underlined), respectively. After cloning into the pTOPO cloning T-vector (Invitrogen), the SalI/BamHI insert was transferred to pHPS9.

Reagents, antibodies, and oligonucleotides.

Chemicals were from Sigma-Aldrich unless stated otherwise. Class I PI3K inhibitors PIK-75, TGX-221, AS-604850, and PI-103 were from Cayman Chemicals. FM 1-43FX membrane probe was from Life Technologies. Antibodies to Akt, pAktS473, Rab7, Rab5, EEA1, and Vps34 were from Cell Signaling Technology, GAPDH (glyceraldehyde-3-phosphate dehydrogenase) from Chemicon, p85 from Millipore, PI3KC2α and PI3KC2β from BD Biosciences, PI3KC2γ from Abgent, LAMP1 (H4A3) from Santa Cruz, and horseradish peroxidase (HRP)-conjugated-mouse and rabbit antibodies from Amersham. Specific antibodies to InlA and InlB were kindly provided by P. Cossart, Institut Pasteur, Paris, France. Oligonucleotides for siRNA knockdowns were from Dharmacon. Pools of four individual siRNA oligonucleotides were used to target each of the human PI3K genes PIK3R1 (D-003020-10, D-003020-11, D-003020-26, D-003020-27) PIK2CA (D-006677-01, D-006771-02, D-006771-03, D-006771-04), PIK2CB (D-006772-01, D-006772-02, D-006772-03, D-006772-04), PIK2CG (D-006773-01, D-006773-02, D-006773-03, D-006773-04) and PIK3C3 (D-005250-01, D-005250-02, D-005250-03, D-005250-04). Pools of four oligonucleotides were also used for Rab5A (D-004009-01, D-004009-02, D-004009-03 D-004009-04), Rab5B (D-004010-1, D-004010-2, D-004010-3, D-004010-4), Rab5C (D-004011-1, D-004011-2, D-004011-3, D-004011-4), and Rab7 (D-010388-01, D-010388-02, D-010388-03, D-010388-04), while the HGF receptor Met was targeted with oligonucleotide D-003156-13. Oligonucleotide primers for PCR or genetic constructs were purchased from Sigma or Metabion (Martinsried, Germany).

General DNA techniques.

Restriction enzymes were used according to the manufacturer’s instructions (Promega and NEB). Chromosomal DNA from Listeria was extracted and purified as previously described (75). Plasmid DNA was extracted from E. coli using the Qiagen plasmid purification kit and was introduced into E. coli or L. monocytogenes by electroporation using a GenePulserXcell apparatus (Bio-Rad). PCR was carried out with Taq DNA polymerase (Biotools, Madrid, Spain) for detection/mapping purposes or high-fidelity ProofStart DNA polymerase (Qiagen) for plasmid or mutant constructions. The reaction mixtures contained 100 ng of DNA template, 200 μM deoxynucleoside triphosphates (dNTPs), 0.25 μg oligonucleotide primers, 2.5 mM MgCl₂, a suitable amount of polymerase buffer, and 1 U of polymerase per kb in a 25-μL volume. The standard amplification program was 3 min at 94°C, followed by 30 cycles of 15 s at 95°C, 30 to 60 s at 48 to 58°C, and 1 to 3 min at 72°C, and a final 3 min at 72°C. PCR products were purified with the Qiagen PCR purification kit. DNA sequences were determined on both strands.

Construction of L. monocytogenes inlA and inlB in-frame deletion mutants.

Chromosomal gene deletions were generated by allelic exchange via homologous recombination as previously described (76). For the ΔinlA mutant, the recombinogenic plasmid was constructed by in-frame ligation of two PCR fragments containing small portions of the 5′- and 3′-terminal regions of the inlA gene plus part of the upstream and downstream flanking regions, respectively. Oligonucleotides inlA1 (ATTTGGATCCTAAAGGGTAGAGG) and inlA2 (CATACCCCGGGGCCAAATACT) carrying BamHI and XmaI/SmaI sites, respectively (underlined), were used to PCR amplify a 643-bp fragment from the 5′ region of inlA, including the first 72 bp of the gene. Similarly, oligonucleotides inlA3 (TCACCCGGGAATTCAGCTAGC) and inlA4 (TGAACGGATCCAATATCACTATTAT) carrying XmaI/SmaI and BamHI sites, respectively, were used to amplify a 709-bp fragment from the 3′ region of inlA, including the last 174 nucleotides of the gene. The two PCR products were digested with XmaI and ligated, and the ligation product was used as a template for PCR amplification with oligonucleotides inlA1 and inlA4. The resulting amplicon was inserted into the pTOPO T-vector (Invitrogen) and then the BamHI fragment containing the ΔinlA construct was transferred to the thermosensitive shuttle vector pMAD (78) to give the recombinogenic plasmid pMΔinlA. The in-frame-deleted allele for the ΔinlB mutant was generated by “recombinant PCR” (79). Oligonucleotide primers inlB1 (TCCTGTGGATCCACCAACAACT) and inlB2R (TACCGGAACTTTTGTCACTAGATCCGTCACAC) amplified a 573-bp fragment from the 5′ region of inlB, including the first 213 bp of the gene, and primers inlB3R (GATCTAGTGACAAAGTTCCGGTAGTAGATAGC) and inlB4 (GTGATGGATCCCACATTTTGGC) were used to amplify the 3′ region of inlB. Primers inlB1 and inlB4 carried BamHI sites, and primers inlB2R and inlB3R had complementary sequences (underlined). The two PCR products were fused by splicing overlap extension using oligonucleotides inlB1 and inlB4, and the recombinant PCR product was processed as described above to produce the pMAD-based recombinogenic plasmid pMΔinlB.

Mammalian cell cultures and transfections.

HeLa cells (and Caco-2 and J774 cells for some control experiments) were sourced from ATCC, passaged at no more than 70% confluence, and used between passages 3 and 15. Cells were cultured in 24-well plates or on 13-mm glass coverslips at 37°C under 5% CO₂ in DMEM (Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum [FCS] and l-glutamine [Invitrogen]) without antibiotics, as previously described (45). HeLa cells were seeded at a density of 3.5 × 10⁴ or 5 × 10⁴ cells per well (24-well plates) or coverslip 24 h prior to transfection with siRNA or plasmid, respectively. Plasmid DNA or siRNAs diluted in optiMEM without FCS were premixed with optiMEM-diluted Lipofectamine 2000 reagent (Invitrogen) as per the manufacturer’s instructions. Cells were transfected for 12 h in 1 mL DMEM, giving a final concentration of 80 to 200 nM oligonucleotide or 1 to 5 μg/mL plasmid DNA. Transfected cells were incubated for 24 h prior to infection, fixation for immunofluorescence microscopy, or production of cell lysates. Plasmid transfection efficiency was typically >85%.

Cell infections.

Culture plates containing ≈1 × 10⁵ cells per well were inoculated with bacterial suspensions in DMEM and immediately centrifuged (180 × g, 3 min) to synchronize infection. Internalization and intracellular proliferation assays were carried out using a gentamicin protection assay as previously described (27). After centrifugation, inoculated plates were incubated for 30 min (15 min for J774 macrophages) and washed several times with Dulbecco’s phosphate-buffered saline (DPBS) (Invitrogen) followed by a further incubation in DMEM containing 100 μg/mL gentamicin for 30 min to kill the remaining extracellular bacteria. Samples were taken at this point to determine invasion (t = 0), and medium was replaced with fresh medium containing 10 μg/mL gentamicin to prevent extracellular bacterial growth. Where applicable, PI3K inhibitors were added at this stage diluted in 0.1% dimethyl sulfoxide (DMSO). At the sampling time points, cells were washed in DPBS, lysed in 10 mM Tris-HCl (pH 7.4), 1% Triton X-100, and viable bacteria plate counted. Intracellular proliferation data were normalized using an intracellular growth coefficient to correct for variation in cell entry using the formula IGC = (CFU_t_n − CFU_t₀)/CFU_t₀ (27).

Western blotting.

HeLa cells were processed for immunoblotting as detailed by Cain et al. (45), and bacterial proteins were prepared as previously described (76). Immunoreactive proteins were visualized using the ECL enhanced chemiluminescence detection system (Amersham).

Fluorescence microscopy.

Coverslips for time course quantifications were collected 10, 20, 30, 45, and 90 min after plate centrifugation, thoroughly washed four times in warm PBS to remove extracellular bacteria, fixed with 3.7% (wt/vol) paraformaldehyde, and processed as described by Cain et al. (45). For time points 45 and 90 min, 100 μg/mL gentamicin was added to the medium 30 min after infection to prevent extracellular growth. Alexa Fluor 488- or 568-conjugated anti-rabbit or anti-mouse IgG secondary antibodies (1 h) were used for immunofluorescence staining, followed by Alexa Fluor 568- or 488-conjugated phalloidin (Invitrogen) and DAPI (4′,6-diamidino-2-phenylindole) (Sigma) (20 min) to visualize F-actin and bacterial DNA/cell nuclei, respectively. To determine vacuole-associated bacteria, cells were incubated with 2 μM of the fixable fluorescent membrane probe FM 1-43FX (Life Technologies) in DMEM for 45 min, washed twice, and incubated with fresh DMEM for 30 min before infection. Bacteria that escaped from the vacuole were identified based on their association with either F-actin (46) or a transfected listerial cell wall-binding fluorescent cytosolic probe (yellow fluorescent protein [YFP]-CBD) (5). Images were acquired at room temperature using a Leica CTR-6000 fluorescence microscope with a 63× oil immersion objective, collecting data as a z-stack, which were later flattened by deconvolution. Images were processed using Leica LAF software (Leica) and ImageJ (NIH; http://rsbweb.nih.gov/ij/), and figures were assembled using Adobe Photoshop.

Statistics.

In all cases, data are shown as the mean ± standard error of the mean (SEM) of values from a minimum of three independent experiments performed in triplicate. Data for image-based quantifications were collected from 60 to 70 bacteria/vacuoles across five randomly selected microscopic fields per time point per condition in each of three independent experiments. The statistical significance of data was determined by Student t tests using Prism software (http://www.graphpad.com/scientific-software/prism/).

FIG S10

InlB promotes Vps34 recruitment and early vacuole escape in human Caco-2 enterocytes (see also Fig. S1A). (A) Association of L. monocytogenes WT and ΔinlB mutant with Vps34, Rab7, and F-actin over a 90-min infection time course. *, statistically significant differences from WT (P < 0.05). (B) Representative fluorescence micrographs for Vps34 association. Staining was with monoclonal anti-Vps34- and Alexa Fluor 568-conjugated secondary antibodies (red), Alexa Fluor 488-conjugated phalloidin (F-actin [green]), and DAPI (bacteria/cell nuclei [blue]). (Top panels) Wide-field ×630 merged images of the three stains. Size bar, 10 μm. Boxed areas are shown below at ×2.5 magnification (merge and individual channels). Arrowheads and arrows indicate examples of Vps34-associated and -nonassociated bacteria, respectively. (C) Representative fluorescence micrographs for Rab7 and F-actin association. Coverslips were processed as in panel B, except that anti-Rab7 primary antibody was used. Arrowheads and arrows indicate examples of Rab7-associated and nonassociated bacteria, respectively. Note among the latter that at 90 min after infection, most WT L. monocytogenes cells are surrounded by F-actin rings, indicating cytosolic location after vacuole escape; in contrast, only a small proportion of ΔinlB bacteria are F-actin associated, consistent with a delayed escape. Download FIG S10, TIF file, 2.8 MB^{(2.9MB, tif)}.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

ACKNOWLEDGMENTS

We thank J. Swanson for kindly providing the CBD probe, P. Hawkins for the pGFP-iPX plasmid, R. Fitzgerald for the S. aureus US300 strain, and P. Cossart and E. Gouin for InlA and InlB antibodies.

This work was funded by the Wellcome Trust (program grant WT074020MA to J.V.-B).

Footnotes

This article is a direct contribution from Jose A. Vazquez-Boland, a Fellow of the American Academy of Microbiology, who arranged for and secured reviews by Anna Oevermann, University of Bern, Switzerland, and Si Ming Man, The Australian National University.

Contributor Information

José A. Vázquez-Boland, Email: v.boland@ed.ac.uk.

Scott J. Hultgren, Washington University School of Medicine

REFERENCES

1.Koopmans MM, Brouwer MC, Vázquez-Boland JA, van de Beek D. 2022. Human listeriosis. Clin Microbiol Rev doi: 10.1128/cmr.00060-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Cossart P. 2011. Illuminating the landscape of host-pathogen interactions with the bacterium Listeria monocytogenes. Proc Natl Acad Sci USA 108:19484–19491. doi: 10.1073/pnas.1112371108. [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Ray K, Marteyn B, Sansonetti PJ, Tang CM. 2009. Life on the inside: the intracellular lifestyle of cytosolic bacteria. Nat Rev Microbiol 7:333–340. doi: 10.1038/nrmicro2112. [DOI] [PubMed] [Google Scholar]
4.Beauregard KE, Lee KD, Collier RJ, Swanson JA. 1997. pH-dependent perforation of macrophage phagosomes by listeriolysin O from Listeria monocytogenes. J Exp Med 186:1159–1163. doi: 10.1084/jem.186.7.1159. [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Henry R, Shaughnessy L, Loessner MJ, Alberti-Segui C, Higgins DE, Swanson JA. 2006. Cytolysin-dependent delay of vacuole maturation in macrophages infected with Listeria monocytogenes. Cell Microbiol 8:107–119. doi: 10.1111/j.1462-5822.2005.00604.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Schnupf P, Portnoy DA. 2007. Listeriolysin O: a phagosome-specific lysin. Microbes Infect 9:1176–1187. doi: 10.1016/j.micinf.2007.05.005. [DOI] [PubMed] [Google Scholar]
7.Chico-Calero I, Suarez M, Gonzalez-Zorn B, Scortti M, Slaghuis J, Goebel W, Vazquez-Boland JA, European Listeria Genome Consortium . 2002. Hpt, a bacterial homolog of the microsomal glucose-6-phosphate translocase, mediates rapid intracellular proliferation in Listeria. Proc Natl Acad Sci USA 99:431–436. doi: 10.1073/pnas.012363899. [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Kocks C, Gouin E, Tabouret M, Berche P, Ohayon H, Cossart P. 1992. L. monocytogenes-induced actin assembly requires the actA gene product, a surface protein. Cell 68:521–531. doi: 10.1016/0092-8674(92)90188-i. [DOI] [PubMed] [Google Scholar]
9.Birmingham CL, Canadien V, Gouin E, Troy EB, Yoshimori T, Cossart P, Higgins DE, Brumell JH. 2007. Listeria monocytogenes evades killing by autophagy during colonization of host cells. Autophagy 3:442–451. doi: 10.4161/auto.4450. [DOI] [PubMed] [Google Scholar]
10.Portnoy DA, Auerbuch V, Glomski IJ. 2002. The cell biology of Listeria monocytogenes infection: the intersection of bacterial pathogenesis and cell-mediated immunity. J Cell Biol 158:409–414. doi: 10.1083/jcb.200205009. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Bierne H, Sabet C, Personnic N, Cossart P. 2007. Internalins: a complex family of leucine-rich repeat-containing proteins in Listeria monocytogenes. Microbes Infect 9:1156–1166. doi: 10.1016/j.micinf.2007.05.003. [DOI] [PubMed] [Google Scholar]
12.Rajabian T, Gavicherla B, Heisig M, Muller-Altrock S, Goebel W, Gray-Owen SD, Ireton K. 2009. The bacterial virulence factor InlC perturbs apical cell junctions and promotes cell-to-cell spread of Listeria. Nat Cell Biol 11:1212–1218. doi: 10.1038/ncb1964. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Gouin E, Adib-Conquy M, Balestrino D, Nahori MA, Villiers V, Colland F, Dramsi S, Dussurget O, Cossart P. 2010. The Listeria monocytogenes InlC protein interferes with innate immune responses by targeting the IκB kinase subunit IKKα. Proc Natl Acad Sci USA 107:17333–17338. doi: 10.1073/pnas.1007765107. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Gaillard JL, Berche P, Frehel C, Gouin E, Cossart P. 1991. Entry of L. monocytogenes into cells is mediated by internalin, a repeat protein reminiscent of surface antigens from Gram-positive cocci. Cell 65:1127–1141. doi: 10.1016/0092-8674(91)90009-n. [DOI] [PubMed] [Google Scholar]
15.Mengaud J, Ohayon H, Gounon P, Mege RM, Cossart P. 1996. E-cadherin is the receptor for internalin, a surface protein required for entry of L. monocytogenes into epithelial cells. Cell 84:923–932. doi: 10.1016/s0092-8674(00)81070-3. [DOI] [PubMed] [Google Scholar]
16.Schubert WD, Urbanke C, Ziehm T, Beier V, Machner MP, Domann E, Wehland J, Chakraborty T, Heinz DW. 2002. Structure of internalin, a major invasion protein of Listeria monocytogenes, in complex with its human receptor E-cadherin. Cell 111:825–836. doi: 10.1016/S0092-8674(02)01136-4. [DOI] [PubMed] [Google Scholar]
17.Shen Y, Naujokas M, Park M, Ireton K. 2000. InIB-dependent internalization of Listeria is mediated by the Met receptor tyrosine kinase. Cell 103:501–510. doi: 10.1016/s0092-8674(00)00141-0. [DOI] [PubMed] [Google Scholar]
18.Niemann HH, Jager V, Butler PJ, van den Heuvel J, Schmidt S, Ferraris D, Gherardi E, Heinz DW. 2007. Structure of the human receptor tyrosine kinase met in complex with the Listeria invasion protein InlB. Cell 130:235–246. doi: 10.1016/j.cell.2007.05.037. [DOI] [PubMed] [Google Scholar]
19.Disson O, Grayo S, Huillet E, Nikitas G, Langa-Vives F, Dussurget O, Ragon M, Le Monnier A, Babinet C, Cossart P, Lecuit M. 2008. Conjugated action of two species-specific invasion proteins for fetoplacental listeriosis. Nature 455:1114–1118. doi: 10.1038/nature07303. [DOI] [PubMed] [Google Scholar]
20.Pentecost M, Kumaran J, Ghosh P, Amieva MR. 2010. Listeria monocytogenes internalin B activates junctional endocytosis to accelerate intestinal invasion. PLoS Pathog 6:e1000900. doi: 10.1371/journal.ppat.1000900. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Veiga E, Cossart P. 2005. Listeria hijacks the clathrin-dependent endocytic machinery to invade mammalian cells. Nat Cell Biol 7:894–900. doi: 10.1038/ncb1292. [DOI] [PubMed] [Google Scholar]
22.Bonazzi M, Veiga E, Pizarro-Cerda J, Cossart P. 2008. Successive post-translational modifications of E-cadherin are required for InlA-mediated internalization of Listeria monocytogenes. Cell Microbiol 10:2208–2222. doi: 10.1111/j.1462-5822.2008.01200.x. [DOI] [PubMed] [Google Scholar]
23.Bonazzi M, Vasudevan L, Mallet A, Sachse M, Sartori A, Prevost MC, Roberts A, Taner SB, Wilbur JD, Brodsky FM, Cossart P. 2011. Clathrin phosphorylation is required for actin recruitment at sites of bacterial adhesion and internalization. J Cell Biol 195:525–536. doi: 10.1083/jcb.201105152. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Ireton K, Payrastre B, Cossart P. 1999. The Listeria monocytogenes protein InlB is an agonist of mammalian phosphoinositide 3-kinase. J Biol Chem 274:17025–17032. doi: 10.1074/jbc.274.24.17025. [DOI] [PubMed] [Google Scholar]
25.Pizarro-Cerda J, Cossart P. 2018. Listeria monocytogenes: cell biology of invasion and intracellular growth. Microbiol Spectr doi: 10.1128/microbiolspec.GPP3-0013-2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
26.de las Heras A, Cain RJ, Bielecka MK, Vazquez-Boland JA. 2011. Regulation of Listeria virulence: PrfA master and commander. Curr Opin Microbiol 14:118–127. doi: 10.1016/j.mib.2011.01.005. [DOI] [PubMed] [Google Scholar]
27.Deshayes C, Bielecka MK, Cain RJ, Scortti M, de las Heras A, Pietras Z, Luisi BF, Nunez Miguel R, Vazquez-Boland JA. 2012. Allosteric mutants show that PrfA activation is dispensable for vacuole escape but required for efficient spread and Listeria survival in vivo. Mol Microbiol 85:461–477. doi: 10.1111/j.1365-2958.2012.08121.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Milohanic E, Glaser P, Coppee JY, Frangeul L, Vega Y, Vazquez-Boland JA, Kunst F, Cossart P, Buchrieser C. 2003. Transcriptome analysis of Listeria monocytogenes identifies three groups of genes differently regulated by PrfA. Mol Microbiol 47:1613–1625. doi: 10.1046/j.1365-2958.2003.03413.x. [DOI] [PubMed] [Google Scholar]
29.Chatterjee SS, Hossain H, Otten S, Kuenne C, Kuchmina K, Machata S, Domann E, Chakraborty T, Hain T. 2006. Intracellular gene expression profile of Listeria monocytogenes. Infect Immun 74:1323–1338. doi: 10.1128/IAI.74.2.1323-1338.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Joseph B, Przybilla K, Stuhler C, Schauer K, Slaghuis J, Fuchs TM, Goebel W. 2006. Identification of Listeria monocytogenes genes contributing to intracellular replication by expression profiling and mutant screening. J Bacteriol 188:556–568. doi: 10.1128/JB.188.2.556-568.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Gregory SH, Sagnimeni AJ, Wing EJ. 1997. Internalin B promotes the replication of Listeria monocytogenes in mouse hepatocytes. Infect Immun 65:5137–5141. doi: 10.1128/iai.65.12.5137-5141.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Bauer S, Tapper H. 2004. Membrane retrieval in neutrophils during phagocytosis: inhibition by M protein-expressing S. pyogenes bacteria. J Leukoc Biol 76:1142–1150. doi: 10.1189/jlb.0404260. [DOI] [PubMed] [Google Scholar]
33.Bertrand CA, Laboisse C, Hopfer U, Bridges RJ, Frizzell RA. 2006. Methods for detecting internalized, FM 1-43 stained particles in epithelial cells and monolayers. Biophys J 91:3872–3883. doi: 10.1529/biophysj.106.086983. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Rink J, Ghigo E, Kalaidzidis Y, Zerial M. 2005. Rab conversion as a mechanism of progression from early to late endosomes. Cell 122:735–749. doi: 10.1016/j.cell.2005.06.043. [DOI] [PubMed] [Google Scholar]
35.Grosshans BL, Ortiz D, Novick P. 2006. Rabs and their effectors: achieving specificity in membrane traffic. Proc Natl Acad Sci USA 103:11821–11827. doi: 10.1073/pnas.0601617103. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Simonsen A, Lippe R, Christoforidis S, Gaullier JM, Brech A, Callaghan J, Toh BH, Murphy C, Zerial M, Stenmark H. 1998. EEA1 links PI(3)K function to Rab5 regulation of endosome fusion. Nature 394:494–498. doi: 10.1038/28879. [DOI] [PubMed] [Google Scholar]
37.Vieira OV, Bucci C, Harrison RE, Trimble WS, Lanzetti L, Gruenberg J, Schreiber AD, Stahl PD, Grinstein S. 2003. Modulation of Rab5 and Rab7 recruitment to phagosomes by phosphatidylinositol 3-kinase. Mol Cell Biol 23:2501–2514. doi: 10.1128/MCB.23.7.2501-2514.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Poteryaev D, Datta S, Ackema K, Zerial M, Spang A. 2010. Identification of the switch in early-to-late endosome transition. Cell 141:497–508. doi: 10.1016/j.cell.2010.03.011. [DOI] [PubMed] [Google Scholar]
39.Ellson C, Davidson K, Anderson K, Stephens LR, Hawkins PT. 2006. PtdIns3P binding to the PX domain of p40phox is a physiological signal in NADPH oxidase activation. EMBO J 25:4468–4478. doi: 10.1038/sj.emboj.7601346. [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Vieira OV, Botelho RJ, Rameh L, Brachmann SM, Matsuo T, Davidson HW, Schreiber A, Backer JM, Cantley LC, Grinstein S. 2001. Distinct roles of class I and class III phosphatidylinositol 3-kinases in phagosome formation and maturation. J Cell Biol 155:19–25. doi: 10.1083/jcb.200107069. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Backer JM. 2016. The intricate regulation and complex functions of the class III phosphoinositide 3-kinase Vps34. Biochem J 473:2251–2271. doi: 10.1042/BCJ20160170. [DOI] [PubMed] [Google Scholar]
42.Knight ZA, Gonzalez B, Feldman ME, Zunder ER, Goldenberg DD, Williams O, Loewith R, Stokoe D, Balla A, Toth B, Balla T, Weiss W, Williams RL, Shokat KM. 2006. A pharmacological map of the PI3-K family defines a role for p110α in insulin signaling. Cell 125:733–747. doi: 10.1016/j.cell.2006.03.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Camps M, Ruckle T, Ji H, Ardissone V, Rintelen F, Shaw J, Ferrandi C, Chabert C, Gillieron C, Francon B, Martin T, Gretener D, Perrin D, Leroy D, Vitte PA, Hirsch E, Wymann MP, Cirillo R, Schwarz MK, Rommel C. 2005. Blockade of PI3Kγ suppresses joint inflammation and damage in mouse models of rheumatoid arthritis. Nat Med 11:936–943. doi: 10.1038/nm1284. [DOI] [PubMed] [Google Scholar]
44.Jackson SP, Schoenwaelder SM, Goncalves I, Nesbitt WS, Yap CL, Wright CE, Kenche V, Anderson KE, Dopheide SM, Yuan Y, Sturgeon SA, Prabaharan H, Thompson PE, Smith GD, Shepherd PR, Daniele N, Kulkarni S, Abbott B, Saylik D, Jones C, Lu L, Giuliano S, Hughan SC, Angus JA, Robertson AD, Salem HH. 2005. PI 3-kinase p110β: a new target for antithrombotic therapy. Nat Med 11:507–514. doi: 10.1038/nm1232. [DOI] [PubMed] [Google Scholar]
45.Cain RJ, Vanhaesebroeck B, Ridley AJ. 2010. The PI3K p110alpha isoform regulates endothelial adherens junctions via Pyk2 and Rac1. J Cell Biol 188:863–876. doi: 10.1083/jcb.200907135. [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Marquis H, Doshi V, Portnoy D. 1995. The broad range phospholipase C and a metalloprotease mediated listeriolysin O-independent escape of Listeria monocytogenes from a primary vacuole in human epithelial cells. Infect Immun 63:4531–4534. doi: 10.1128/iai.63.11.4531-4534.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Li G, Stahl PD. 1993. Structure-function relationship of the small GTPase rab5. J Biol Chem 268:24475–24480. doi: 10.1016/S0021-9258(20)80550-X. [DOI] [PubMed] [Google Scholar]
48.Banerjee M, Copp J, Vuga D, Marino M, Chapman T, van der Geer P, Ghosh P. 2004. GW domains of the Listeria monocytogenes invasion protein InlB are required for potentiation of Met activation. Mol Microbiol 52:257–271. doi: 10.1111/j.1365-2958.2003.03968.x. [DOI] [PubMed] [Google Scholar]
49.Eskandarian HA, Impens F, Nahori M-A, Soubigou G, Coppée J-Y, Cossart P, Hamon MA. 2013. A role for SIRT2-dependent histone H3K18 deacetylation in bacterial infection. Science 341:1238858. doi: 10.1126/science.1238858. [DOI] [PubMed] [Google Scholar]
50.Maudet C, Kheloufi M, Levallois S, Gaillard J, Huang L, Gaultier C, Tsai Y-H, Disson O, Lecuit M. 2022. Bacterial inhibition of Fas-mediated killing promotes neuroinvasion and persistence. Nature 603:900–906. doi: 10.1038/s41586-022-04505-7. [DOI] [PubMed] [Google Scholar]
51.Bilanges B, Posor Y, Vanhaesebroeck B. 2019. PI3K isoforms in cell signalling and vesicle trafficking. Nat Rev Mol Cell Biol 20:515–534. doi: 10.1038/s41580-019-0129-z. [DOI] [PubMed] [Google Scholar]
52.Lefebvre J, Ancot F, Leroy C, Muharram G, Lemiere A, Tulasne D. 2012. Met degradation: more than one stone to shoot a receptor down. FASEB J 26:1387–1399. doi: 10.1096/fj.11-197723. [DOI] [PubMed] [Google Scholar]
53.Kinchen JM, Ravichandran KS. 2008. Phagosome maturation: going through the acid test. Nat Rev Mol Cell Biol 9:781–795. doi: 10.1038/nrm2515. [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Wandinger-Ness A, Zerial M. 2014. Rab proteins and the compartmentalization of the endosomal system. Cold Spring Harb Perspect Biol 6:a022616. doi: 10.1101/cshperspect.a022616. [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Mishra A, Eathiraj S, Corvera S, Lambright DG. 2010. Structural basis for Rab GTPase recognition and endosome tethering by the C₂H₂ zinc finger of Early Endosomal Autoantigen 1 (EEA1). Proc Natl Acad Sci USA 107:10866–10871. doi: 10.1073/pnas.1000843107. [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Alvarez-Dominguez C, Roberts R, Stahl PD. 1997. Internalized Listeria monocytogenes modulates intracellular trafficking and delays maturation of the phagosome. J Cell Sci 110:731–743. doi: 10.1242/jcs.110.6.731. [DOI] [PubMed] [Google Scholar]
57.Alvarez-Dominguez C, Madrazo-Toca F, Fernandez-Prieto L, Vandekerckhove J, Pareja E, Tobes R, Gomez-Lopez MT, Del Cerro-Vadillo E, Fresno M, Leyva-Cobián F, Carrasco-Marín E. 2008. Characterization of a Listeria monocytogenes protein interfering with Rab5a. Traffic 9:325–337. doi: 10.1111/j.1600-0854.2007.00683.x. [DOI] [PubMed] [Google Scholar]
58.Christoforidis S, McBride HM, Burgoyne RD, Zerial M. 1999. The Rab5 effector EEA1 is a core component of endosome docking. Nature 397:621–625. doi: 10.1038/17618. [DOI] [PubMed] [Google Scholar]
59.Langemeyer L, Fröhlich F, Ungermann C. 2018. Rab GTPase function in endosome and lysosome biogenesis. Trends Cell Biol 28:957–970. doi: 10.1016/j.tcb.2018.06.007. [DOI] [PubMed] [Google Scholar]
60.Borchers AC, Langemeyer L, Ungermann C. 2021. Who’s in control? Principles of Rab GTPase activation and endolysosomal membrane trafficking and beyond. J Cell Biol 220:e202105120. doi: 10.1083/jcb.202105120. [DOI] [PMC free article] [PubMed] [Google Scholar]
61.Nordmann M, Cabrera M, Perz A, Bröcker C, Ostrowicz C, Engelbrecht-Vandré S, Ungermann C. 2010. The Mon1-Ccz1 complex is the GEF of the late endosomal Rab7 homolog Ypt7. Curr Biol 20:1654–1659. doi: 10.1016/j.cub.2010.08.002. [DOI] [PubMed] [Google Scholar]
62.Langemeyer L, Borchers AC, Herrmann E, Füllbrunn N, Han Y, Perz A, Auffarth K, Kümmel D, Ungermann C. 2020. A conserved and regulated mechanism drives endosomal Rab transition. eLife 9:e56090. doi: 10.7554/eLife.56090. [DOI] [PMC free article] [PubMed] [Google Scholar]
63.Lawrence G, Brown CC, Flood BA, Karunakaran S, Cabrera M, Nordmann M, Ungermann C, Fratti RA. 2014. Dynamic association of the PI3P-interacting Mon1-Ccz1 GEF with vacuoles is controlled through its phosphorylation by the type 1 casein kinase Yck3. Mol Biol Cell 25:1608–1619. doi: 10.1091/mbc.E13-08-0460. [DOI] [PMC free article] [PubMed] [Google Scholar]
64.Cabrera M, Nordmann M, Perz A, Schmedt D, Gerondopoulos A, Barr F, Piehler J, Engelbrecht-Vandré S, Ungermann C. 2014. The Mon1-Ccz1 GEF activates the Rab7 GTPase Ypt7 via a longin-fold-Rab interface and association with PI3P-positive membranes. J Cell Sci 127:1043–1051. doi: 10.1242/jcs.140921. [DOI] [PMC free article] [PubMed] [Google Scholar]
65.Bohdanowicz M, Grinstein S. 2010. Vesicular traffic: a Rab SANDwich. Curr Biol 20:R311–R314. doi: 10.1016/j.cub.2010.02.030. [DOI] [PubMed] [Google Scholar]
66.Law F, Seo JH, Wang Z, DeLeon JL, Bolis Y, Brown A, Zong WX, Du G, Rocheleau CE. 2017. The VPS34 PI3K negatively regulates RAB-5 during endosome maturation. J Cell Sci 130:2007–2017. doi: 10.1242/jcs.194746. [DOI] [PMC free article] [PubMed] [Google Scholar]
67.Weber SS, Ragaz C, Hilbi H. 2009. Pathogen trafficking pathways and host phosphoinositide metabolism. Mol Microbiol 71:1341–1352. doi: 10.1111/j.1365-2958.2009.06608.x. [DOI] [PubMed] [Google Scholar]
68.Alix E, Mukherjee S, Roy CR. 2011. Subversion of membrane transport pathways by vacuolar pathogens. J Cell Biol 195:943–952. doi: 10.1083/jcb.201105019. [DOI] [PMC free article] [PubMed] [Google Scholar]
69.Fratti RA, Backer JM, Gruenberg J, Corvera S, Deretic V. 2001. Role of phosphatidylinositol 3-kinase and Rab5 effectors in phagosomal biogenesis and mycobacterial phagosome maturation arrest. J Cell Biol 154:631–644. doi: 10.1083/jcb.200106049. [DOI] [PMC free article] [PubMed] [Google Scholar]
70.Fratti RA, Chua J, Vergne I, Deretic V. 2003. Mycobacterium tuberculosis glycosylated phosphatidylinositol causes phagosome maturation arrest. Proc Natl Acad Sci USA 100:5437–5442. doi: 10.1073/pnas.0737613100. [DOI] [PMC free article] [PubMed] [Google Scholar]
71.Vergne I, Fratti RA, Hill PJ, Chua J, Belisle J, Deretic V. 2004. Mycobacterium tuberculosis phagosome maturation arrest: mycobacterial phosphatidylinositol analog phosphatidylinositol mannoside stimulates early endosomal fusion. Mol Biol Cell 15:751–760. doi: 10.1091/mbc.e03-05-0307. [DOI] [PMC free article] [PubMed] [Google Scholar]
72.Vergne I, Chua J, Lee HH, Lucas M, Belisle J, Deretic V. 2005. Mechanism of phagolysosome biogenesis block by viable Mycobacterium tuberculosis. Proc Natl Acad Sci USA 102:4033–4038. doi: 10.1073/pnas.0409716102. [DOI] [PMC free article] [PubMed] [Google Scholar]
73.Hernandez LD, Hueffer K, Wenk MR, Galan JE. 2004. Salmonella modulates vesicular traffic by altering phosphoinositide metabolism. Science 304:1805–1807. doi: 10.1126/science.1098188. [DOI] [PubMed] [Google Scholar]
74.Mallo GV, Espina M, Smith AC, Terebiznik MR, Aleman A, Finlay BB, Rameh LE, Grinstein S, Brumell JH. 2008. SopB promotes phosphatidylinositol 3-phosphate formation on Salmonella vacuoles by recruiting Rab5 and Vps34. J Cell Biol 182:741–752. doi: 10.1083/jcb.200804131. [DOI] [PMC free article] [PubMed] [Google Scholar]
75.Ripio MT, Dominguez-Bernal G, Lara M, Suarez M, Vazquez-Boland JA. 1997. A Gly145Ser substitution in the transcriptional activator PrfA causes constitutive overexpression of virulence factors in Listeria monocytogenes. J Bacteriol 179:1533–1540. doi: 10.1128/jb.179.5.1533-1540.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
76.Suarez M, Gonzalez-Zorn B, Vega Y, Chico-Calero I, Vazquez-Boland JA. 2001. A role for ActA in epithelial cell invasion by Listeria monocytogenes. Cell Microbiol 3:853–864. doi: 10.1046/j.1462-5822.2001.00160.x. [DOI] [PubMed] [Google Scholar]
77.Haima P, van Sinderen D, Schotting H, Bron S, Venema G. 1990. Development of a beta-galactosidase alpha-complementation system for molecular cloning in Bacillus subtilis. Gene 86:63–69. doi: 10.1016/0378-1119(90)90114-7. [DOI] [PubMed] [Google Scholar]
78.Arnaud M, Chastanet A, Debarbouille M. 2004. New vector for efficient allelic replacement in naturally nontransformable, low-GC-content, gram-positive bacteria. Appl Environ Microbiol 70:6887–6891. doi: 10.1128/AEM.70.11.6887-6891.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
79.Pogulis RJ, Vallejo AN, Pease LR. 1996. In vitro recombination and mutagenesis by overlap extension PCR. Methods Mol Biol 57:167–176. doi: 10.1385/0-89603-332-5:167. [DOI] [PubMed] [Google Scholar]
80.Schröder A, Schröder B, Roppenser B, Linder S, Sinha B, Fässler R, Aepfelbacher M. 2006. Staphylococcus aureus fibronectin binding protein-A induces motile attachment sites and complex actin remodeling in living endothelial cells. Mol Biol Cell 17:5198–5210. doi: 10.1091/mbc.e06-05-0463. [DOI] [PMC free article] [PubMed] [Google Scholar]
81.Fernandez-Mora E, Polidori M, Lührmann A, Schaible U, Haas A. 2005. Maturation of Rhodococcus equi-containing vacuole is arrested after completion of the early endosome stage. Traffic 6:635–653. doi: 10.1111/j.1600-0854.2005.00304.x. [DOI] [PubMed] [Google Scholar]
82.Lanahan SM, Wymann MP, Lucas CL. 2022. The role of PI3Kγ in the immune system: new insights and translational implications. Nat Rev Immunol 22:687–700. doi: 10.1038/s41577-022-00701-8. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

FIG S1

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S2

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S3

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S4

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S5

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S6

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S7

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S8

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S9

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S10

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

[B1] 1.Koopmans MM, Brouwer MC, Vázquez-Boland JA, van de Beek D. 2022. Human listeriosis. Clin Microbiol Rev doi: 10.1128/cmr.00060-19. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B2] 2.Cossart P. 2011. Illuminating the landscape of host-pathogen interactions with the bacterium Listeria monocytogenes. Proc Natl Acad Sci USA 108:19484–19491. doi: 10.1073/pnas.1112371108. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B3] 3.Ray K, Marteyn B, Sansonetti PJ, Tang CM. 2009. Life on the inside: the intracellular lifestyle of cytosolic bacteria. Nat Rev Microbiol 7:333–340. doi: 10.1038/nrmicro2112. [DOI] [PubMed] [Google Scholar]

[B4] 4.Beauregard KE, Lee KD, Collier RJ, Swanson JA. 1997. pH-dependent perforation of macrophage phagosomes by listeriolysin O from Listeria monocytogenes. J Exp Med 186:1159–1163. doi: 10.1084/jem.186.7.1159. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B5] 5.Henry R, Shaughnessy L, Loessner MJ, Alberti-Segui C, Higgins DE, Swanson JA. 2006. Cytolysin-dependent delay of vacuole maturation in macrophages infected with Listeria monocytogenes. Cell Microbiol 8:107–119. doi: 10.1111/j.1462-5822.2005.00604.x. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B6] 6.Schnupf P, Portnoy DA. 2007. Listeriolysin O: a phagosome-specific lysin. Microbes Infect 9:1176–1187. doi: 10.1016/j.micinf.2007.05.005. [DOI] [PubMed] [Google Scholar]

[B7] 7.Chico-Calero I, Suarez M, Gonzalez-Zorn B, Scortti M, Slaghuis J, Goebel W, Vazquez-Boland JA, European Listeria Genome Consortium . 2002. Hpt, a bacterial homolog of the microsomal glucose-6-phosphate translocase, mediates rapid intracellular proliferation in Listeria. Proc Natl Acad Sci USA 99:431–436. doi: 10.1073/pnas.012363899. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B8] 8.Kocks C, Gouin E, Tabouret M, Berche P, Ohayon H, Cossart P. 1992. L. monocytogenes-induced actin assembly requires the actA gene product, a surface protein. Cell 68:521–531. doi: 10.1016/0092-8674(92)90188-i. [DOI] [PubMed] [Google Scholar]

[B9] 9.Birmingham CL, Canadien V, Gouin E, Troy EB, Yoshimori T, Cossart P, Higgins DE, Brumell JH. 2007. Listeria monocytogenes evades killing by autophagy during colonization of host cells. Autophagy 3:442–451. doi: 10.4161/auto.4450. [DOI] [PubMed] [Google Scholar]

[B10] 10.Portnoy DA, Auerbuch V, Glomski IJ. 2002. The cell biology of Listeria monocytogenes infection: the intersection of bacterial pathogenesis and cell-mediated immunity. J Cell Biol 158:409–414. doi: 10.1083/jcb.200205009. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B11] 11.Bierne H, Sabet C, Personnic N, Cossart P. 2007. Internalins: a complex family of leucine-rich repeat-containing proteins in Listeria monocytogenes. Microbes Infect 9:1156–1166. doi: 10.1016/j.micinf.2007.05.003. [DOI] [PubMed] [Google Scholar]

[B12] 12.Rajabian T, Gavicherla B, Heisig M, Muller-Altrock S, Goebel W, Gray-Owen SD, Ireton K. 2009. The bacterial virulence factor InlC perturbs apical cell junctions and promotes cell-to-cell spread of Listeria. Nat Cell Biol 11:1212–1218. doi: 10.1038/ncb1964. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B13] 13.Gouin E, Adib-Conquy M, Balestrino D, Nahori MA, Villiers V, Colland F, Dramsi S, Dussurget O, Cossart P. 2010. The Listeria monocytogenes InlC protein interferes with innate immune responses by targeting the IκB kinase subunit IKKα. Proc Natl Acad Sci USA 107:17333–17338. doi: 10.1073/pnas.1007765107. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B14] 14.Gaillard JL, Berche P, Frehel C, Gouin E, Cossart P. 1991. Entry of L. monocytogenes into cells is mediated by internalin, a repeat protein reminiscent of surface antigens from Gram-positive cocci. Cell 65:1127–1141. doi: 10.1016/0092-8674(91)90009-n. [DOI] [PubMed] [Google Scholar]

[B15] 15.Mengaud J, Ohayon H, Gounon P, Mege RM, Cossart P. 1996. E-cadherin is the receptor for internalin, a surface protein required for entry of L. monocytogenes into epithelial cells. Cell 84:923–932. doi: 10.1016/s0092-8674(00)81070-3. [DOI] [PubMed] [Google Scholar]

[B16] 16.Schubert WD, Urbanke C, Ziehm T, Beier V, Machner MP, Domann E, Wehland J, Chakraborty T, Heinz DW. 2002. Structure of internalin, a major invasion protein of Listeria monocytogenes, in complex with its human receptor E-cadherin. Cell 111:825–836. doi: 10.1016/S0092-8674(02)01136-4. [DOI] [PubMed] [Google Scholar]

[B17] 17.Shen Y, Naujokas M, Park M, Ireton K. 2000. InIB-dependent internalization of Listeria is mediated by the Met receptor tyrosine kinase. Cell 103:501–510. doi: 10.1016/s0092-8674(00)00141-0. [DOI] [PubMed] [Google Scholar]

[B18] 18.Niemann HH, Jager V, Butler PJ, van den Heuvel J, Schmidt S, Ferraris D, Gherardi E, Heinz DW. 2007. Structure of the human receptor tyrosine kinase met in complex with the Listeria invasion protein InlB. Cell 130:235–246. doi: 10.1016/j.cell.2007.05.037. [DOI] [PubMed] [Google Scholar]

[B19] 19.Disson O, Grayo S, Huillet E, Nikitas G, Langa-Vives F, Dussurget O, Ragon M, Le Monnier A, Babinet C, Cossart P, Lecuit M. 2008. Conjugated action of two species-specific invasion proteins for fetoplacental listeriosis. Nature 455:1114–1118. doi: 10.1038/nature07303. [DOI] [PubMed] [Google Scholar]

[B20] 20.Pentecost M, Kumaran J, Ghosh P, Amieva MR. 2010. Listeria monocytogenes internalin B activates junctional endocytosis to accelerate intestinal invasion. PLoS Pathog 6:e1000900. doi: 10.1371/journal.ppat.1000900. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B21] 21.Veiga E, Cossart P. 2005. Listeria hijacks the clathrin-dependent endocytic machinery to invade mammalian cells. Nat Cell Biol 7:894–900. doi: 10.1038/ncb1292. [DOI] [PubMed] [Google Scholar]

[B22] 22.Bonazzi M, Veiga E, Pizarro-Cerda J, Cossart P. 2008. Successive post-translational modifications of E-cadherin are required for InlA-mediated internalization of Listeria monocytogenes. Cell Microbiol 10:2208–2222. doi: 10.1111/j.1462-5822.2008.01200.x. [DOI] [PubMed] [Google Scholar]

[B23] 23.Bonazzi M, Vasudevan L, Mallet A, Sachse M, Sartori A, Prevost MC, Roberts A, Taner SB, Wilbur JD, Brodsky FM, Cossart P. 2011. Clathrin phosphorylation is required for actin recruitment at sites of bacterial adhesion and internalization. J Cell Biol 195:525–536. doi: 10.1083/jcb.201105152. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B24] 24.Ireton K, Payrastre B, Cossart P. 1999. The Listeria monocytogenes protein InlB is an agonist of mammalian phosphoinositide 3-kinase. J Biol Chem 274:17025–17032. doi: 10.1074/jbc.274.24.17025. [DOI] [PubMed] [Google Scholar]

[B25] 25.Pizarro-Cerda J, Cossart P. 2018. Listeria monocytogenes: cell biology of invasion and intracellular growth. Microbiol Spectr doi: 10.1128/microbiolspec.GPP3-0013-2018. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B26] 26.de las Heras A, Cain RJ, Bielecka MK, Vazquez-Boland JA. 2011. Regulation of Listeria virulence: PrfA master and commander. Curr Opin Microbiol 14:118–127. doi: 10.1016/j.mib.2011.01.005. [DOI] [PubMed] [Google Scholar]

[B27] 27.Deshayes C, Bielecka MK, Cain RJ, Scortti M, de las Heras A, Pietras Z, Luisi BF, Nunez Miguel R, Vazquez-Boland JA. 2012. Allosteric mutants show that PrfA activation is dispensable for vacuole escape but required for efficient spread and Listeria survival in vivo. Mol Microbiol 85:461–477. doi: 10.1111/j.1365-2958.2012.08121.x. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B28] 28.Milohanic E, Glaser P, Coppee JY, Frangeul L, Vega Y, Vazquez-Boland JA, Kunst F, Cossart P, Buchrieser C. 2003. Transcriptome analysis of Listeria monocytogenes identifies three groups of genes differently regulated by PrfA. Mol Microbiol 47:1613–1625. doi: 10.1046/j.1365-2958.2003.03413.x. [DOI] [PubMed] [Google Scholar]

[B29] 29.Chatterjee SS, Hossain H, Otten S, Kuenne C, Kuchmina K, Machata S, Domann E, Chakraborty T, Hain T. 2006. Intracellular gene expression profile of Listeria monocytogenes. Infect Immun 74:1323–1338. doi: 10.1128/IAI.74.2.1323-1338.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B30] 30.Joseph B, Przybilla K, Stuhler C, Schauer K, Slaghuis J, Fuchs TM, Goebel W. 2006. Identification of Listeria monocytogenes genes contributing to intracellular replication by expression profiling and mutant screening. J Bacteriol 188:556–568. doi: 10.1128/JB.188.2.556-568.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B31] 31.Gregory SH, Sagnimeni AJ, Wing EJ. 1997. Internalin B promotes the replication of Listeria monocytogenes in mouse hepatocytes. Infect Immun 65:5137–5141. doi: 10.1128/iai.65.12.5137-5141.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B32] 32.Bauer S, Tapper H. 2004. Membrane retrieval in neutrophils during phagocytosis: inhibition by M protein-expressing S. pyogenes bacteria. J Leukoc Biol 76:1142–1150. doi: 10.1189/jlb.0404260. [DOI] [PubMed] [Google Scholar]

[B33] 33.Bertrand CA, Laboisse C, Hopfer U, Bridges RJ, Frizzell RA. 2006. Methods for detecting internalized, FM 1-43 stained particles in epithelial cells and monolayers. Biophys J 91:3872–3883. doi: 10.1529/biophysj.106.086983. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B34] 34.Rink J, Ghigo E, Kalaidzidis Y, Zerial M. 2005. Rab conversion as a mechanism of progression from early to late endosomes. Cell 122:735–749. doi: 10.1016/j.cell.2005.06.043. [DOI] [PubMed] [Google Scholar]

[B35] 35.Grosshans BL, Ortiz D, Novick P. 2006. Rabs and their effectors: achieving specificity in membrane traffic. Proc Natl Acad Sci USA 103:11821–11827. doi: 10.1073/pnas.0601617103. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B36] 36.Simonsen A, Lippe R, Christoforidis S, Gaullier JM, Brech A, Callaghan J, Toh BH, Murphy C, Zerial M, Stenmark H. 1998. EEA1 links PI(3)K function to Rab5 regulation of endosome fusion. Nature 394:494–498. doi: 10.1038/28879. [DOI] [PubMed] [Google Scholar]

[B37] 37.Vieira OV, Bucci C, Harrison RE, Trimble WS, Lanzetti L, Gruenberg J, Schreiber AD, Stahl PD, Grinstein S. 2003. Modulation of Rab5 and Rab7 recruitment to phagosomes by phosphatidylinositol 3-kinase. Mol Cell Biol 23:2501–2514. doi: 10.1128/MCB.23.7.2501-2514.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B38] 38.Poteryaev D, Datta S, Ackema K, Zerial M, Spang A. 2010. Identification of the switch in early-to-late endosome transition. Cell 141:497–508. doi: 10.1016/j.cell.2010.03.011. [DOI] [PubMed] [Google Scholar]

[B39] 39.Ellson C, Davidson K, Anderson K, Stephens LR, Hawkins PT. 2006. PtdIns3P binding to the PX domain of p40phox is a physiological signal in NADPH oxidase activation. EMBO J 25:4468–4478. doi: 10.1038/sj.emboj.7601346. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B40] 40.Vieira OV, Botelho RJ, Rameh L, Brachmann SM, Matsuo T, Davidson HW, Schreiber A, Backer JM, Cantley LC, Grinstein S. 2001. Distinct roles of class I and class III phosphatidylinositol 3-kinases in phagosome formation and maturation. J Cell Biol 155:19–25. doi: 10.1083/jcb.200107069. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B41] 41.Backer JM. 2016. The intricate regulation and complex functions of the class III phosphoinositide 3-kinase Vps34. Biochem J 473:2251–2271. doi: 10.1042/BCJ20160170. [DOI] [PubMed] [Google Scholar]

[B42] 42.Knight ZA, Gonzalez B, Feldman ME, Zunder ER, Goldenberg DD, Williams O, Loewith R, Stokoe D, Balla A, Toth B, Balla T, Weiss W, Williams RL, Shokat KM. 2006. A pharmacological map of the PI3-K family defines a role for p110α in insulin signaling. Cell 125:733–747. doi: 10.1016/j.cell.2006.03.035. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B43] 43.Camps M, Ruckle T, Ji H, Ardissone V, Rintelen F, Shaw J, Ferrandi C, Chabert C, Gillieron C, Francon B, Martin T, Gretener D, Perrin D, Leroy D, Vitte PA, Hirsch E, Wymann MP, Cirillo R, Schwarz MK, Rommel C. 2005. Blockade of PI3Kγ suppresses joint inflammation and damage in mouse models of rheumatoid arthritis. Nat Med 11:936–943. doi: 10.1038/nm1284. [DOI] [PubMed] [Google Scholar]

[B44] 44.Jackson SP, Schoenwaelder SM, Goncalves I, Nesbitt WS, Yap CL, Wright CE, Kenche V, Anderson KE, Dopheide SM, Yuan Y, Sturgeon SA, Prabaharan H, Thompson PE, Smith GD, Shepherd PR, Daniele N, Kulkarni S, Abbott B, Saylik D, Jones C, Lu L, Giuliano S, Hughan SC, Angus JA, Robertson AD, Salem HH. 2005. PI 3-kinase p110β: a new target for antithrombotic therapy. Nat Med 11:507–514. doi: 10.1038/nm1232. [DOI] [PubMed] [Google Scholar]

[B45] 45.Cain RJ, Vanhaesebroeck B, Ridley AJ. 2010. The PI3K p110alpha isoform regulates endothelial adherens junctions via Pyk2 and Rac1. J Cell Biol 188:863–876. doi: 10.1083/jcb.200907135. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B46] 46.Marquis H, Doshi V, Portnoy D. 1995. The broad range phospholipase C and a metalloprotease mediated listeriolysin O-independent escape of Listeria monocytogenes from a primary vacuole in human epithelial cells. Infect Immun 63:4531–4534. doi: 10.1128/iai.63.11.4531-4534.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B47] 47.Li G, Stahl PD. 1993. Structure-function relationship of the small GTPase rab5. J Biol Chem 268:24475–24480. doi: 10.1016/S0021-9258(20)80550-X. [DOI] [PubMed] [Google Scholar]

[B48] 48.Banerjee M, Copp J, Vuga D, Marino M, Chapman T, van der Geer P, Ghosh P. 2004. GW domains of the Listeria monocytogenes invasion protein InlB are required for potentiation of Met activation. Mol Microbiol 52:257–271. doi: 10.1111/j.1365-2958.2003.03968.x. [DOI] [PubMed] [Google Scholar]

[B49] 49.Eskandarian HA, Impens F, Nahori M-A, Soubigou G, Coppée J-Y, Cossart P, Hamon MA. 2013. A role for SIRT2-dependent histone H3K18 deacetylation in bacterial infection. Science 341:1238858. doi: 10.1126/science.1238858. [DOI] [PubMed] [Google Scholar]

[B50] 50.Maudet C, Kheloufi M, Levallois S, Gaillard J, Huang L, Gaultier C, Tsai Y-H, Disson O, Lecuit M. 2022. Bacterial inhibition of Fas-mediated killing promotes neuroinvasion and persistence. Nature 603:900–906. doi: 10.1038/s41586-022-04505-7. [DOI] [PubMed] [Google Scholar]

[B51] 51.Bilanges B, Posor Y, Vanhaesebroeck B. 2019. PI3K isoforms in cell signalling and vesicle trafficking. Nat Rev Mol Cell Biol 20:515–534. doi: 10.1038/s41580-019-0129-z. [DOI] [PubMed] [Google Scholar]

[B52] 52.Lefebvre J, Ancot F, Leroy C, Muharram G, Lemiere A, Tulasne D. 2012. Met degradation: more than one stone to shoot a receptor down. FASEB J 26:1387–1399. doi: 10.1096/fj.11-197723. [DOI] [PubMed] [Google Scholar]

[B53] 53.Kinchen JM, Ravichandran KS. 2008. Phagosome maturation: going through the acid test. Nat Rev Mol Cell Biol 9:781–795. doi: 10.1038/nrm2515. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B54] 54.Wandinger-Ness A, Zerial M. 2014. Rab proteins and the compartmentalization of the endosomal system. Cold Spring Harb Perspect Biol 6:a022616. doi: 10.1101/cshperspect.a022616. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B55] 55.Mishra A, Eathiraj S, Corvera S, Lambright DG. 2010. Structural basis for Rab GTPase recognition and endosome tethering by the C₂H₂ zinc finger of Early Endosomal Autoantigen 1 (EEA1). Proc Natl Acad Sci USA 107:10866–10871. doi: 10.1073/pnas.1000843107. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B56] 56.Alvarez-Dominguez C, Roberts R, Stahl PD. 1997. Internalized Listeria monocytogenes modulates intracellular trafficking and delays maturation of the phagosome. J Cell Sci 110:731–743. doi: 10.1242/jcs.110.6.731. [DOI] [PubMed] [Google Scholar]

[B57] 57.Alvarez-Dominguez C, Madrazo-Toca F, Fernandez-Prieto L, Vandekerckhove J, Pareja E, Tobes R, Gomez-Lopez MT, Del Cerro-Vadillo E, Fresno M, Leyva-Cobián F, Carrasco-Marín E. 2008. Characterization of a Listeria monocytogenes protein interfering with Rab5a. Traffic 9:325–337. doi: 10.1111/j.1600-0854.2007.00683.x. [DOI] [PubMed] [Google Scholar]

[B58] 58.Christoforidis S, McBride HM, Burgoyne RD, Zerial M. 1999. The Rab5 effector EEA1 is a core component of endosome docking. Nature 397:621–625. doi: 10.1038/17618. [DOI] [PubMed] [Google Scholar]

[B59] 59.Langemeyer L, Fröhlich F, Ungermann C. 2018. Rab GTPase function in endosome and lysosome biogenesis. Trends Cell Biol 28:957–970. doi: 10.1016/j.tcb.2018.06.007. [DOI] [PubMed] [Google Scholar]

[B60] 60.Borchers AC, Langemeyer L, Ungermann C. 2021. Who’s in control? Principles of Rab GTPase activation and endolysosomal membrane trafficking and beyond. J Cell Biol 220:e202105120. doi: 10.1083/jcb.202105120. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B61] 61.Nordmann M, Cabrera M, Perz A, Bröcker C, Ostrowicz C, Engelbrecht-Vandré S, Ungermann C. 2010. The Mon1-Ccz1 complex is the GEF of the late endosomal Rab7 homolog Ypt7. Curr Biol 20:1654–1659. doi: 10.1016/j.cub.2010.08.002. [DOI] [PubMed] [Google Scholar]

[B62] 62.Langemeyer L, Borchers AC, Herrmann E, Füllbrunn N, Han Y, Perz A, Auffarth K, Kümmel D, Ungermann C. 2020. A conserved and regulated mechanism drives endosomal Rab transition. eLife 9:e56090. doi: 10.7554/eLife.56090. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B63] 63.Lawrence G, Brown CC, Flood BA, Karunakaran S, Cabrera M, Nordmann M, Ungermann C, Fratti RA. 2014. Dynamic association of the PI3P-interacting Mon1-Ccz1 GEF with vacuoles is controlled through its phosphorylation by the type 1 casein kinase Yck3. Mol Biol Cell 25:1608–1619. doi: 10.1091/mbc.E13-08-0460. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B64] 64.Cabrera M, Nordmann M, Perz A, Schmedt D, Gerondopoulos A, Barr F, Piehler J, Engelbrecht-Vandré S, Ungermann C. 2014. The Mon1-Ccz1 GEF activates the Rab7 GTPase Ypt7 via a longin-fold-Rab interface and association with PI3P-positive membranes. J Cell Sci 127:1043–1051. doi: 10.1242/jcs.140921. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B65] 65.Bohdanowicz M, Grinstein S. 2010. Vesicular traffic: a Rab SANDwich. Curr Biol 20:R311–R314. doi: 10.1016/j.cub.2010.02.030. [DOI] [PubMed] [Google Scholar]

[B66] 66.Law F, Seo JH, Wang Z, DeLeon JL, Bolis Y, Brown A, Zong WX, Du G, Rocheleau CE. 2017. The VPS34 PI3K negatively regulates RAB-5 during endosome maturation. J Cell Sci 130:2007–2017. doi: 10.1242/jcs.194746. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B67] 67.Weber SS, Ragaz C, Hilbi H. 2009. Pathogen trafficking pathways and host phosphoinositide metabolism. Mol Microbiol 71:1341–1352. doi: 10.1111/j.1365-2958.2009.06608.x. [DOI] [PubMed] [Google Scholar]

[B68] 68.Alix E, Mukherjee S, Roy CR. 2011. Subversion of membrane transport pathways by vacuolar pathogens. J Cell Biol 195:943–952. doi: 10.1083/jcb.201105019. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B69] 69.Fratti RA, Backer JM, Gruenberg J, Corvera S, Deretic V. 2001. Role of phosphatidylinositol 3-kinase and Rab5 effectors in phagosomal biogenesis and mycobacterial phagosome maturation arrest. J Cell Biol 154:631–644. doi: 10.1083/jcb.200106049. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B70] 70.Fratti RA, Chua J, Vergne I, Deretic V. 2003. Mycobacterium tuberculosis glycosylated phosphatidylinositol causes phagosome maturation arrest. Proc Natl Acad Sci USA 100:5437–5442. doi: 10.1073/pnas.0737613100. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B71] 71.Vergne I, Fratti RA, Hill PJ, Chua J, Belisle J, Deretic V. 2004. Mycobacterium tuberculosis phagosome maturation arrest: mycobacterial phosphatidylinositol analog phosphatidylinositol mannoside stimulates early endosomal fusion. Mol Biol Cell 15:751–760. doi: 10.1091/mbc.e03-05-0307. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B72] 72.Vergne I, Chua J, Lee HH, Lucas M, Belisle J, Deretic V. 2005. Mechanism of phagolysosome biogenesis block by viable Mycobacterium tuberculosis. Proc Natl Acad Sci USA 102:4033–4038. doi: 10.1073/pnas.0409716102. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B73] 73.Hernandez LD, Hueffer K, Wenk MR, Galan JE. 2004. Salmonella modulates vesicular traffic by altering phosphoinositide metabolism. Science 304:1805–1807. doi: 10.1126/science.1098188. [DOI] [PubMed] [Google Scholar]

[B74] 74.Mallo GV, Espina M, Smith AC, Terebiznik MR, Aleman A, Finlay BB, Rameh LE, Grinstein S, Brumell JH. 2008. SopB promotes phosphatidylinositol 3-phosphate formation on Salmonella vacuoles by recruiting Rab5 and Vps34. J Cell Biol 182:741–752. doi: 10.1083/jcb.200804131. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B75] 75.Ripio MT, Dominguez-Bernal G, Lara M, Suarez M, Vazquez-Boland JA. 1997. A Gly145Ser substitution in the transcriptional activator PrfA causes constitutive overexpression of virulence factors in Listeria monocytogenes. J Bacteriol 179:1533–1540. doi: 10.1128/jb.179.5.1533-1540.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B76] 76.Suarez M, Gonzalez-Zorn B, Vega Y, Chico-Calero I, Vazquez-Boland JA. 2001. A role for ActA in epithelial cell invasion by Listeria monocytogenes. Cell Microbiol 3:853–864. doi: 10.1046/j.1462-5822.2001.00160.x. [DOI] [PubMed] [Google Scholar]

[B77] 77.Haima P, van Sinderen D, Schotting H, Bron S, Venema G. 1990. Development of a beta-galactosidase alpha-complementation system for molecular cloning in Bacillus subtilis. Gene 86:63–69. doi: 10.1016/0378-1119(90)90114-7. [DOI] [PubMed] [Google Scholar]

[B78] 78.Arnaud M, Chastanet A, Debarbouille M. 2004. New vector for efficient allelic replacement in naturally nontransformable, low-GC-content, gram-positive bacteria. Appl Environ Microbiol 70:6887–6891. doi: 10.1128/AEM.70.11.6887-6891.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B79] 79.Pogulis RJ, Vallejo AN, Pease LR. 1996. In vitro recombination and mutagenesis by overlap extension PCR. Methods Mol Biol 57:167–176. doi: 10.1385/0-89603-332-5:167. [DOI] [PubMed] [Google Scholar]

[B80] 80.Schröder A, Schröder B, Roppenser B, Linder S, Sinha B, Fässler R, Aepfelbacher M. 2006. Staphylococcus aureus fibronectin binding protein-A induces motile attachment sites and complex actin remodeling in living endothelial cells. Mol Biol Cell 17:5198–5210. doi: 10.1091/mbc.e06-05-0463. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B81] 81.Fernandez-Mora E, Polidori M, Lührmann A, Schaible U, Haas A. 2005. Maturation of Rhodococcus equi-containing vacuole is arrested after completion of the early endosome stage. Traffic 6:635–653. doi: 10.1111/j.1600-0854.2005.00304.x. [DOI] [PubMed] [Google Scholar]

[B82] 82.Lanahan SM, Wymann MP, Lucas CL. 2022. The role of PI3Kγ in the immune system: new insights and translational implications. Nat Rev Immunol 22:687–700. doi: 10.1038/s41577-022-00701-8. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Listeria InlB Expedites Vacuole Escape and Intracellular Proliferation by Promoting Rab7 Recruitment via Vps34

Robert J Cain

Mariela Scortti

Héctor J Monzó

José A Vázquez-Boland

Roles

ABSTRACT

INTRODUCTION

RESULTS

InlB is required for efficient intracellular proliferation.

FIG 1.

InlB promotes early vacuole escape.

FIG 2.

InlB promotes Rab7 recruitment to the Listeria-containing vacuole (LCV).

FIG 3.

InlB-dependent PI3P accumulation and class III PI3K (Vps34) recruitment.

FIG 4.

Vps34 supports InlB-dependent intracellular proliferation but not entry.

FIG 5.

Vps34 is required for Rab7 recruitment and efficient vacuole escape.

Rapid escape requires Rab7 and is not hindered by Rab5 inhibition.

FIG 6.

DISCUSSION

FIG 7.

MATERIALS AND METHODS

Bacteria, plasmids, antibodies, and reagents.

Reagents, antibodies, and oligonucleotides.

General DNA techniques.

Construction of L. monocytogenes inlA and inlB in-frame deletion mutants.

Mammalian cell cultures and transfections.

Cell infections.

Western blotting.

Fluorescence microscopy.

Statistics.

ACKNOWLEDGMENTS

Footnotes

Contributor Information

REFERENCES

Associated Data

Supplementary Materials

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases