Skip to main content
mBio logoLink to mBio
. 2023 Jan 4;14(1):e03223-22. doi: 10.1128/mbio.03223-22

A Manganese-independent Aldolase Enables Staphylococcus aureus To Resist Host-imposed Metal Starvation

Paola K Párraga Solórzano a,#, Talina S Bastille a,#, Jana N Radin a, Thomas E Kehl-Fie a,b,✉
Editor: Justin A Thorntonc
PMCID: PMC9973326  PMID: 36598285

ABSTRACT

The preferred carbon source of Staphylococcus aureus and many other pathogens is glucose, and its consumption is critical during infection. However, glucose utilization increases the cellular demand for manganese, a nutrient sequestered by the host as a defense against invading pathogens. Therefore, bacteria must balance glucose metabolism with the increasing demand that metal-dependent processes, such as glycolysis, impose upon the cell. A critical regulator that enables S. aureus to resist nutritional immunity is the ArlRS two-component system. This work revealed that ArlRS regulates the expression of FdaB, a metal-independent fructose 1,6-bisphosphate aldolase. Further investigation revealed that when S. aureus is metal-starved by the host, FdaB functionally replaces the metal-dependent isozyme FbaA, thereby allowing S. aureus to resist host-imposed metal starvation in culture. Although metal-dependent aldolases are canonically zinc-dependent, this work uncovered that FbaA requires manganese for activity and that FdaB protects S. aureus from manganese starvation. Both FbaA and FdaB contribute to the ability of S. aureus to cause invasive disease in wild-type mice. However, the virulence defect of a strain lacking FdaB was reversed in calprotectin-deficient mice, which have defects in manganese sequestration, indicating that this isozyme contributes to the ability of this pathogen to overcome manganese limitation during infection. Cumulatively, these observations suggest that the expression of the metal-independent aldolase FdaB allows S. aureus to alleviate the increased demand for manganese that glucose consumption imposes, and highlights the cofactor flexibility of even established metalloenzyme families.

KEYWORDS: Staphylococcus aureus, aldolase, nutritional immunity, calprotectin, manganese

INTRODUCTION

For many bacterial pathogens, including Staphylococcus aureus, glucose is the preferred carbon source for growth, with reductions in the ability to consume glucose ablating virulence (1–9). The value of glucose consumption to invaders is highlighted by the increased risk of infection with S. aureus, Escherichia coli, Streptococcus pneumoniae, Mycobacterium tuberculosis, Klebsiella pneumoniae, and Candida albicans that is faced by diabetic and hyperglycemic individuals (10–12). While glucose consumption is necessary for and enhances infections, many glycolytic enzymes require metals, such as manganese (Mn) and zinc (Zn), to function, and this increases the cellular demand for these essential nutrients (2, 3, 13–19). This creates a conflict that pathogens must resolve as the host restricts the availability of metals during infection (20, 21). Thus, bacteria must balance their need to consume glucose with the increased demand for metals that glycolysis places upon the cell. How S. aureus and other pathogens balance these competing demands remains largely unknown.

Glycolysis increases the staphylococcal demand for Mn (13, 22, 23). In a nutrient-replete environment, the increased cellular demand for metals that glycolysis places on the cell does not pose a challenge. However, during infection, essential metals, including Mn, iron (Fe), and Zn, are withheld from invaders by the host (24–28). The impact of this defense, known as nutritional immunity, is far-reaching, with 50% of enzymes and 30% of proteins being predicted to require a metal cofactor for proper function (29, 30). Differing from organic molecules that can frequently be synthesized as needed, inorganic nutrients, such as transition metals, must be obtained from the environment. As a result, nutritional immunity disrupts a wide range of cellular processes in pathogens, including those involved in metabolism and virulence (13, 14, 27, 31–34). A critical component of the host’s nutrient withholding response is the immune effector calprotectin (CP) (21, 26, 35). The loss of CP ablates the ability of the host to restrict metals during infection and renders mice more susceptible to disease by multiple bacterial and fungal pathogens, including S. aureus, A. baumannii, and K. pneumoniae (23, 26, 28, 36–38). CP is the most abundant protein in the cytosol of neutrophils, and its concentration can exceed 1 mg/mL in areas of infection (39, 40). CP is a heterodimer of S100A8 and S100A9 and possesses two metal-binding sites that can tightly bind Mn, Zn, and other transition metals (41–45). In addition to inhibiting processes that are necessary for optimal growth, such as glycolysis, CP-imposed metal starvation also inhibits the activity of enzymes that are essential for bacteria to survive the onslaught of the immune response, such as Mn-dependent superoxide dismutases (SODs) (13, 27).

To successfully overcome nutritional immunity, pathogens rely on the expression of high-affinity metal uptake systems and adaptation (46). S. aureus, for instance, expresses two Mn transporters: MntH, a natural resistance-associated macrophage protein (NRAMP) family member, and MntABC, an ATP-binding cassette (ABC) permease (22, 23, 47). The adaptations that facilitate success in the face of nutritional immunity include the reduced utilization of metal-dependent processes and the activation of alternative pathways and enzymes that do not rely on the restricted metal (13, 48–55). In addition to glucose, S. aureus can use amino acids as an energy source and can thus reduce its cellular demand for Mn (13). However, S. aureus must retain the ability to consume glucose to cause infection (2, 56). S. aureus and other bacteria frequently coordinate their responses to metal limitation by using the metal-sensing regulators Fur (Fe), Zur (Zn), and MntR (Mn) (46, 47, 57, 58). However, other regulatory systems that do not directly sense metal availability, such as the staphylococcal two-component system (TCS) ArlRS, also contribute to overcoming Mn starvation and nutritional immunity (14). ArlRS directly and indirectly controls the expression of numerous virulence determinants, including toxins, exoenzymes, immune modulators, and cell surface proteins involved in clumping and adherence (59–65). This TCS appears to sense the alterations in metabolic flux that occur in the latter half of glycolysis, which can be caused by Mn limitation and elevated pyruvate concentration (14, 62). Upon activation, ArlRS facilitates a metabolic shift toward amino acid utilization, thereby reducing the cellular demand for Mn (13). Consistent with its expansive regulatory network, the loss of ArlRS reduces the ability of S. aureus to cause disease in several animal models of infection (13, 61, 65–67). Notably, when the host cannot sequester Mn, the need for ArlRS during infection is ablated (13). Cumulatively, this indicates that ArlRS significantly contributes to coordinating the staphylococcal metabolic response to Mn limitation during infection.

The current studies seek to better understand how ArlRS contributes to coordinating the metabolic response of S. aureus to nutritional immunity. This work reveals that this TCS controls the expression of a metal-independent variant of aldolase (FdaB) that functionally replaces a metal-dependent isozyme (FbaA) when S. aureus is metal-starved by the host. While metal-dependent aldolases classically rely on Zn for activity, further investigation revealed that FbaA utilizes Mn and that FdaB enables S. aureus to survive host-imposed Mn limitation.

RESULTS

Gene regulation upon ArlRS activation.

Two prior studies have elucidated the ArlRS regulon (60, 64). However, these studies were conducted prior to the identification of the signals that activate ArlRS (14, 62). Thus, these studies only compared gene expression differences between wild-type bacteria and strains lacking the ArlRS system in standard culture conditions. Both prior studies compared gene expression between the wild-type and a strain lacking a functional ArlRS system, following growth in TBS to mid-exponential phase, with Liang et al. harvesting RNA from WCUH29 (OD600 of 0.4) and Crosby et al. harvesting RNA from USA300 LAC (OD600 of 1.5). The absence of glucose was recently observed to activate ArlRS (14, 68). This finding was leveraged to better understand the ArlRS regulon by comparing gene expression between wild-type bacteria and ΔarlRS, following growth in the presence and absence of glucose. The use of glucose limitation as an activating signal allows for the activation of ArlRS while minimizing of the impact of the activating stimulus on the growth of the wild-type bacteria and ΔarlRS. This analysis, which harvested RNA from exponentially growing S. aureus Newman at an OD600 of 0.1, revealed that, in the presence of glucose, 183 genes are downregulated and 217 are upregulated in the ΔarlRS mutant, compared to the wild-type S. aureus Newman (Table S1). The apparent activity in the absence of an activating signal is consistent with the prior observation that even in the absence of ArlS, ArlR can drive the expression of the mgrA P2 promoter (68). In the absence of glucose, when ArlS is active, 202 genes are downregulated and 452 are upregulated in ΔarlRS, compared to the wild-type strain (Table S2). In total, using a 2-fold change in transcript abundance, 614 genes whose expression is modulated by ArlRS were unique to the current analysis (Fig. 1). Notably, despite this increased number of ArlRS-regulated genes in the current data set, it did not fully encompass all of the genes identified by prior analyses (60, 64). 39 genes were shared between all three studies, whereas 137 genes were shared when only data sets generated using RNA-seq were considered (Table S3) (60, 64). Prior work observed that the genes whose expression is influenced by ArlRS are dependent on the specific activating stimulus (69). Thus, it seems likely that the difference between the current work and previous work can be attributed to a combination of assaying gene expression in the presence and absence of an activating signal, differences in culture medium, and the growth phase, with the shared genes perhaps representing a core regulon. Regardless, the current analysis further establishes ArlRS as a significant modulator of staphylococcal gene expression.

FIG 1.

FIG 1

Gene regulation upon ArlRS activation. Venn diagram depicting the genes regulated by ArlRS in the absence and presence of glucose and overlap with ArlRS regulons obtained in previous studies (60, 64).

TABLE S1

List of genes whose expression changes between the wild-type and ΔarlRS, following growth in glucose-containing medium. Download Table S1, XLSX file, 0.04 MB (47.4KB, xlsx) .

Copyright © 2023 Párraga Solórzano et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

TABLE S2

List of genes whose expression changes between the wild-type and ΔarlRS, following growth in medium without glucose. Download Table S2, XLSX file, 0.1 MB (68.6KB, xlsx) .

Copyright © 2023 Párraga Solórzano et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

TABLE S3

List of common changes between wild-type S. aureus and strains lacking ArlRS from this study and from Crosby et al. Download Table S3, XLSX file, 0.01 MB (10.2KB, xlsx) .

Copyright © 2023 Párraga Solórzano et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FdaB promotes resistance to calprotectin.

Among the genes regulated by ArlRS is fdaB, whose expression decreases 4-fold in ΔarlRS when glucose is present. This result is similar to previous observations by Crosby et al. (64) and was confirmed using qRT-PCR (Fig. 2A). FdaB is a fructose 1,6-bisphosphate aldolase that does not require a metal ion for activity and has previously been implicated in the facilitation of gluconeogenesis (70). S. aureus also possesses a putatively Zn-dependent aldolase, FbaA (71), which is associated with glycolytic flux. During glycolysis, aldolase converts fructose 1,6-bisphosphate into glyceraldehyde 3-phosphate and dihydroxyacetone 3-phosphate, and it performs the reverse reaction during gluconeogenesis. Given this prior connection to glycolytic flux, the individual contributions of the aldolases to S. aureus growth were evaluated in a TSB-based, metal-replete, glucose-containing medium. While the loss of FdaB did not affect the ability of S. aureus to grow under these conditions, a ΔfbaA mutation resulted in a pronounced growth defect in both strain Newman and the USA300 strain JE2 (Fig. 2B and C). The ectopic expression of FbaA from a plasmid reversed the growth defect in both strains (Fig. 2D). These findings are consistent with potential unique roles in glycolysis and/or gluconeogenesis, and they suggest that FbaA is necessary in metal-replete environments. However, the presence of metal-dependent and independent variants of aldolase is reminiscent of the Mn-dependent and Mn-independent phosphoglycerate mutase (PGM) isozymes that are possessed by S. aureus and Salmonella enterica Typhimurium. Whereas the PGM isozymes were previously thought to contribute to glycolysis and gluconeogenesis, respectively, the Mn-independent variants of PGM enable both of these pathogens to maintain glycolytic flux when Mn-starved by the host (72). Therefore, the contribution of FdaB to resistaning host-imposed metal starvation was evaluated. For these and subsequent assays with CP, an NRPMI-based medium was used. This medium contains glucose and was supplemented with Mn, Zn, and Fe such that it would be metal-replete in the absence of CP. The loss of FdaB reduced the ability of S. aureus Newman and USA300 JE2 to grow in the presence of CP (Fig. 2E and F). The constitutive expression of FdaB from a plasmid reversed the phenotype (Fig. 2G and H). Overall, these observations indicate that FdaB is necessary for S. aureus to resist CP-imposed metal starvation.

FIG 2.

FIG 2

FdaB promotes resistance to calprotectin. (A) Wild-type S. aureus Newman was grown in TSB with glucose in the presence and absence of 240 μg/mL of CP, and the transcript levels of fbaA and fdaB were assessed via qRT-PCR. *, P ≤ 0.05 relative to the wild-type by a two-way ANOVA with Tukey’s multiple-comparison test. #, P ≤ 0.05 relative to the same strain in the absence of CP by a two-way ANOVA with Tukey’s multiple-comparison test. (B and C) S. aureus Newman, USA300 JE2 wild-type, ΔfbaA, and ΔfdaB were grown overnight in TSB, subcultured 1:100 in medium containing 38% TSB and 62% CP buffer, and grown in the absence of calprotectin. Growth was assessed via the measurement of the optical density, with panel C showing the OD600 values at t = 6 h. *, P ≤ 0.05 relative to the wild-type by a one-way ANOVA with Tukey’s multiple-comparison test. (D) Wild-type bacteria and ΔfbaA containing either an empty pOS1 plgt (pVC) or pOS1 plgt:fbaA (pFbaA) were grown as described in panels B and C. Growth was assessed at 6 h via the measurement of the optical densitiy. *, P ≤ 0.05 for the indicated comparison by a one-way ANOVA with Sidak’s multiple-comparison test. (E and F) S. aureus Newman, USA300 wild-type, ΔfdaB, and (G and H) S. aureus wild-type and ΔfdaB pOS1 plgt (pVC) or pOS1 plgt:fdaB (pFdaB) were assessed for CP sensitivity following growth in NRPMI containing 1 μM Zn, 1 μM Mn, and 1 μM Fe. Growth was assessed via the measurement of the absorbance at OD600 (F, G, and H) at t = 6 h. *, P ≤ 0.05 relative to the wild-type by a two-way ANOVA with Tukey’s multiple-comparison test. n ≥ 3. Error bars indicate the SEM.

ArlRS is not needed to induce FdaB in response to host-imposed metal starvation.

Having established that FdaB contributes to the resistance against metal starvation, the necessity of ArlRS for FdaB expression in the presence of CP was also assessed. In the presence of CP, a similar level of transcript was observed in ΔarlRS, compared to wild-type bacteria (Fig. 2A). This suggests the existence of another regulator that can induce the expression of fdaB in a metal-deplete medium. The expression of fbaA was also assessed and was observed to decrease in response to CP in both the wild-type bacteria and in a ΔarlRS mutant (Fig. 2A). This observation raised the possibility that the need for FdaB is due to the reduced expression of FbaA in the presence of CP. However, the constitutive expression of FbaA from a plasmid does not rescue the growth of ΔfdaB in metal-deplete medium (Fig. 3A). This suggests that the need for FdaB is not simply due to the reduced expression of FbaA. The sensitivity of ΔfdaB, ΔarlRS, and ΔarlRSΔfdaB to CP was also assessed. While both ΔfdaB and ΔarlRS were more sensitive to CP than were the wild-type bacteria, the growth defect upon the loss of ArlRS was more pronounced than the loss of FdaB (Fig. 3B and C). However, the growth of ΔarlRSΔfdaB was not further impaired, compared to the ΔarlRS mutant (Fig. 3B and C). Cumulatively, these results suggest that ArlRS induces the expression of fdaB. However, this TCS is not necessary to express the metal-independent aldolase isozyme in response to CP.

FIG 3.

FIG 3

ArlRS is not needed to induce FdaB in response to host-imposed metal starvation. (A) S. aureus Newman wild-type, ΔfdaB containing pOS1 plgt (pVC), pOS1 plgt:fdaB (pFdaB), or pOS1 plgt:fbaA (pFbaA), and (B and C) Newman wild-type and ΔfdaB, ΔarlRS, or ΔfdaBΔarlRS were assessed for CP sensitivity in NRPMI containing 1 μM Zn, 1 μM Mn, and 1 μM Fe. Growth was assessed via the measurement of the absorbance at OD600 at (A and C) t = 6 h. (A) *, P ≤ 0.05 relative to the wild-type containing an empty vector control at the same CP concentration by a two-way ANOVA with Tukey’s multiple-comparison test. (C) *, P ≤ 0.05 relative to the wild-type at the same CP concentration by a two-way ANOVA with Tukey's multiple-comparison test. n ≥ 3. Error bars indicate the SEM.

FdaB facilitates growth in manganese-limited environments.

While FbaA is a putatively Zn-dependent enzyme, CP can bind multiple first-row transition metals using two binding sites (26, 73–75). The first site (S1) can bind Mn, Zn, and Fe via six histidines, whereas the second site (S2) binds Zn, but not Mn or Fe, using three histidines and one aspartic acid (43, 44, 76, 77). To elucidate whether CP-imposed Zn limitation renders FdaB necessary for growth, wild-type CP and its ΔS1 and ΔS2 mutants, which have altered metal-binding properties, were leveraged. The ΔS1 mutant cannot bind Mn or Fe but retains the ability to bind Zn, whereas the ΔS2 variant binds all three metals. Surprisingly the Newman and USA300 JE2 ΔfdaB mutants have growth defects in the presence of ΔS2 but not in the presence of ΔS1 (Fig. 4A). This suggests that Zn limitation is not driving the necessity of FdaB for growth in the presence of CP. Given the unexpected nature of this finding, the ability of wild-type S. aureus and ΔfdaB to grow in a metal-defined medium, namely, NRPMI, which was lacking Mn, Zn, and Fe, was evaluated. Consistent with FdaB enabling S. aureus to survive metal starvation, the loss of FdaB ablated the growth of S. aureus Newman and USA300 JE2 in media to which Mn, Zn, and Fe were not added (Fig. 4B–F). The addition of Mn, but not Fe or Zn, reversed the growth defect (Fig. 4B, C, E, and F). Notably, differing from the results obtained using the TSB-based medium (Fig. 2B), ΔfbaA grew equivalent to the wild-type in NRPMI to which Mn, Zn, or Fe had been individually added back. This suggests that either all three metals must be present for the loss of FbaA to impact growth or that another component of the growth medium dictates the importance of FbaA. The ectopic expression of FdaB reversed the growth defect of the ΔfdaB mutant in Newman (Fig. 4D). Cumulatively, these results suggest that FdaB promotes resistance to Mn starvation. The loss of both S. aureus Mn transporters, MntABC and MntH, reduces intracellular Mn levels, compared to the wild-type (22). To further test the idea that FdaB is important for responding to Mn starvation, the impact that the loss of the staphylococcal Mn transporters has on ΔfdaB growth was investigated. Compared to ΔfdaB and ΔmntCΔmntH, ΔfdaBΔmntCΔmntH is more sensitive to CP (Fig. 4G and H), with the double mutant having a growth defect, even in the absence of CP. This finding indicates that losing the ability to import Mn intensifies the impact of losing the metal-independent aldolase. While unexpected, cumulatively, these results suggest that FdaB is necessary for S. aureus to resist Mn limitation.

FIG 4.

FIG 4

FdaB facilitates growth in manganese-limited environments. (A) S. aureus Newman and USA300 (JE2) wild-type and ΔfdaB mutants were assessed for sensitivity to 240 μg/mL of wild-type CP or the ΔS1 and ΔS2 variants following growth in NRPMI containing 1 μM Zn, 1 μM Mn, and 1 μM Fe. Growth was assessed via the measurement of the absorbance at OD600 at t = 6 h. *, P ≤ 0.05 relative to the wild-type with the same CP variant by a two-way ANOVA with Tukey’s multiple-comparison test. (B and C) S. aureus Newman wild-type, ΔfbaA, ΔfdaB, as well as (D) Newman wild-type and ΔfdaB containing pOS1 plgt (pVC) or pOS1 plgt:fdaB (pFdaB) and (E and F) USA300 JE2 wild-type, ΔfbaA and ΔfdaB were grown in NRPMI containing 1 μM of the indicated metal. Growth was assessed via the measurement of the absorbance at OD600 (C, D, and F) at t = 8 h. (C and F) *, P ≤ 0.05 relative to the wild-type at the same growth condition by a two-way ANOVA with Tukey’s multiple-comparison test. (D) *, P ≤ 0.05 relative to the wild-type containing an empty vector by a one-way ANOVA with Tukey’s multiple-comparison test. (G & H) S. aureus Newman wild-type, ΔfdaB, ΔmntHΔmntC, and ΔfdaBΔmntHΔmntC were assessed for CP sensitivity in NRPMI containing 1 μM Zn, 1 μM Mn, and 1 μM Fe. Growth was assessed via the measurement of the absorbance at OD600 (H) at t = 6 h. *, P ≤ 0.05 relative to the wild-type strain at the CP concentration by a two-way ANOVA with Tukey’s multiple-comparison test. #, P ≤ 0.05 relative to the parental strain at the same CP concentration by a two-way ANOVA with Tukey’s multiple-comparison test. n ≥ 3. Error bars indicate the SEM.

FbaA activity is dependent on manganese.

The unexpected finding that FdaB is necessary for the ability of S. aureus to resist Mn starvation called into question the Zn dependency of FbaA. To evaluate the metal dependency of FbaA, ΔfdaB was used to eliminate the activity of the metal-independent aldolase. As the ΔfdaB mutant grows poorly in NRPMI lacking Mn, aldolase activity was initially assessed following growth in medium supplemented with Mn or with Mn and Zn. Regardless of whether the medium contained Zn, similar levels of aldolase activity were observed in the ΔfdaB mutant (Fig. 5). To more directly test the metal dependency of FbaA, the cell lysates were treated with EDTA and then supplemented with either Mn or Zn. Treatment with EDTA eliminated the aldolase activity of the ΔfdaB mutant. The addition of excess Mn restored aldolase activity to comparable levels to those of untreated cell lysates (Fig. 5). In contrast, the addition of Zn resulted in a minimal increase in aldolase activity. Taken together, these observations suggest that FbaA requires Mn for activity.

FIG 5.

FIG 5

The activity of FbaA is Mn-dependent. S. aureus Newman ΔfdaB was grown in NRPMI containing 1 μM of the indicated metal. The aldolase activity was assessed. When indicated, the cell lysates were treated with EDTA, and Mn or Zn was added to the reaction. *, P ≤ 0.05 relative to the untreated by a two-way ANOVA with Tukey’s multiple-comparison test. n ≥ 3. Error bars indicate the SEM.

Both staphylococcal aldolases contribute to infection.

The current results suggest that FdaB enables S. aureus to resist Mn starvation in culture but that FbaA may be critical in metal-replete, glucose-containing environments. To determine the importance of the aldolase isozymes in vivo, a retro-orbital systemic model of staphylococcal infection was used. Initially, wild-type C57BL/6 mice were infected with wild-type S. aureus, ΔfdaB, and ΔfbaA. The bacterial burdens of mice infected with ΔfdaB and ΔfbaA were significantly decreased in the heart and liver, compared to those infected with wild-type S. aureus (Fig. 6A and B). These results suggest that both the metal-dependent and metal-independent aldolases are necessary for S. aureus to cause infection. Differing from the heart and liver, the loss of neither aldolase reduced the bacterial burdens in the kidney (Fig. 6B), suggesting that either aldolase is sufficient in this tissue. The expression of either FbaA or FdaB from a plasmid largely reversed the virulence defect of ΔfbaA or ΔfdaB, respectively (Fig. 6C). Next, CP-deficient mice, which fail to remove Mn from the liver during infection (9), were infected to determine whether the virulence defect of ΔfdaB is associated with an inability to cope with host-imposed Mn starvation. CP-deficient mice infected with wild-type S. aureus, ΔfbaA, or ΔfdaB had comparable bacterial burdens in the liver (Fig. 6A), indicating that FdaB is necessary to resist Mn starvation during infection. Cumulatively, these findings highlight the importance of both aldolases during infection and indicate that FdaB contributes to the ability of S. aureus to overcome Mn starvation.

FIG 6.

FIG 6

FdaB is necessary for the ability of S. aureus to cause infection. 9-week-old mice or C57BL/6J or CP-deficient mice (C57BL/6J S100A9−/−), were retro-orbitally infected with 1 × 107 of S. aureus Newman wild-type, ΔfbaA, or ΔfdaB. After 4 days, the bacterial burdens in the (A) liver, (B) heart, and kidney were enumerated. (C) Newman wild-type, ΔfbaA, or ΔfdaB carrying either empty pKK30 (pEmpty), pKK30:fbaA (pFbaA), or pKK30:fdaB (pFdaB) were used to infect the mice, and after 4 days, the bacterial burdens were assessed. Statistical significance was evaluated via a Mann-Whitney U test. Specific P values for relevant comparisons are indicated. Bars indicate the median.

DISCUSSION

Nutrients, such as glycolic substrates and metals, are critical for pathogens during infection (2–5, 21, 25, 78–80). Glucose is the preferred carbon source for many invading pathogens, but it can also increase the cellular demand for Mn (13). This creates a challenge for S. aureus and for other pathogens, as glycolysis contributes to their ability to survive the assault by the immune system, but metal availability is also restricted at the sites of infections (46, 81). Therefore, to successfully cause infection, pathogens must balance rerouting metabolism to consume alternative energy sources, such as amino acids, with strategies that maximize their ability to retain glycolytic flux. The present work reveals that the metabolic regulator ArlRS, which has been implicated in the promotion of amino acid consumption (13), also regulates the expression of FdaB, a metal-independent aldolase that promotes resistance to host-imposed Mn starvation. This finding is unexpected, as the metal-dependent staphylococcal aldolase was predicted to depend on Zn, as do most metal-dependent versions of this enzyme (71, 82–87). Further investigation revealed that, differing from most previously characterized metal-dependent aldolases, which are Zn-dependent, FbaA utilizes Mn as a cofactor. Thus, the current work reveals aldolase as a target of nutritional immunity, a mechanism used by pathogens to preserve aldolase activity, and emphasizes the plasticity of enzyme metal specificity across organisms.

The surprising observation that FdaB is necessary to resist Mn starvation is not simply explained by the reduced expression of FbaA in Mn-deplete conditions, as the constitutive expression of FbaA does not reverse the growth defect of ΔfdaB in the presence of CP (Fig. 3A). Further investigation revealed that FbaA requires Mn for full activity (Fig. 5). Taken together, these observations suggest that S. aureus FbaA uses Mn, not Zn, as a cofactor. Whereas, to the best of our knowledge, S. aureus is the first pathogen to be identified to possess a Mn-dependent aldolase, Deinococcus radiodurans and Bacillus methanolicus also possess Mn-dependent class II fructose-1,6-bisphosphate aldolases (88, 89). Notably, all of these bacteria have intrinsically high intracellular Mn concentrations. Despite these prior findings and the similarity of class II aldolases to FbaA in S. aureus, class II aldolases are, by default, presumed to be Zn-dependent. This current work highlights the need to carefully evaluate metal dependency including consideration of the natural metal content of the host species, even for enzyme classes that have been extensively studied.

Aldolase is not the only staphylococcal glycolytic enzyme with two isoforms. PGM also has metal-dependent and metal-independent variants (72). Similar to the current observations, the metal-independent PGM isozyme, GpmA, contributes to resisting nutritional immunity (72). Notably, metal-independent glycolytic isozymes of PGM also promote resistance to Mn starvation in Salmonella (72). Differing from the staphylococcal PGMs, for which the metal-dependent isozyme appears to be dispensable in a systemic model of infection (72), both FdaB and FbaA are necessary for invasive disease in the heart and liver. This is despite the fact that, similar to PGM, both aldolases carry out the same chemical reaction. The classical explanation for the possession of two glycolytic enzymes is that one preferentially functions in glycolysis and the other preferentially functions in gluconeogenesis. This is one potential explanation for the nonredundancy of the staphylococcal aldolases, and this idea is supported by the observation that the loss of FbaA results in a growth defect in metal-replete media containing glucose. However, FdaB is capable of promoting S. aureus growth in glucose-containing media if Mn is limited. This suggests that environmental conditions, such as metal availability and regulatory cues, may drive the nonredundancy of the two staphylococcal aldolases, rather than specific roles in glycolysis and gluconeogenesis. Alternatively, metal-dependent aldolases from Neisseria meningitidis, Mycoplasma hyopneumoniae, and Francisella novicida have been associated with moonlighting functions, such as acting as transcriptional regulators and adhesins (90–92). While both aldolases are necessary for the infection of the liver and heart, either is sufficient in the kidneys. This suggests that in some tissues, they serve the same purpose or that despite the kidney being a Mn-restricted environment, the need for aldolase activity is reduced to a point that residual activity from FbaA is sufficient. Alternatively, it is possible that aldolase activity is dispensable in the kidney. Regardless of the rationale for why FbaA contributes to S. aureus infection, the current results establish an important role for the metal-independent isozyme FdaB in resisting Mn starvation during infection.

There are two different classes of aldolases: class-I and class-II, where class-I are metal-independent and class-II are metal-dependent, and bacteria can possess one or more of these enzymes (90). When bacteria express a single aldolase, it is most commonly metal-dependent, belonging to class II (90). However, certain bacteria, including S. aureus, Escherichia coli, and Mycobacterium tuberculosis express two aldolases, with one belonging to class I and the other to class II (93–96). Similar to that of S. aureus, the metal-independent aldolase of E. coli has been suggested to favor gluconeogenesis (70). However, the current work raises the possibility that possessing a second metal-independent aldolase may also facilitate the ability of bacteria to survive metal starvation or potentially other stresses. Although, in the case of E. coli, it seems more likely that the metal-independent aldolase would promote resistance to Zn limitation, as the metal-dependent isozyme relies on that metal for function (97). Interestingly, Bacillus methanolicus possesses two apparently metal-dependent aldolases (98), with the molecular rationale remaining unknown. The observation that not all aldolases are Zn-dependent raises the possibility that the second aldolase in this species may also promote resistance to metal limitation if the two isozymes have differing metal specificities.

The current observations suggest that ArlRS also aids in the preservation of glycolytic flux by modulating the expression of one of the staphylococcal aldolases. While ArlRS is not necessary to induce the expression of fdaB in response to CP, the loss of this TCS does ablate FdaB expression (Fig. 2A). This observation suggests the existence of additional regulators that modulate FdaB expression in response to metal limitation. It is tempting to speculate that the upregulation of FdaB by ArlRS might enhance gluconeogenesis and thereby allow for the production of essential biosynthetic precursors that lay upstream of aldolase. This role for ArlRS would also be consistent with its apparent ability to sense the accumulation of metabolites from the latter half of the glycolytic pathway and with the reported role of FdaB in gluconeogenesis (14, 99). In addition to withholding essential metals, the host has other defenses that can disrupt glycolytic flux, including the production of itaconate, which can inhibit FbaA, among other enzymes (100). Given the importance of aldolase activity to glycolysis and the multiple ways by which the host can target this pathway, it is perhaps unsurprising that multiple regulators can control the expression of fdaB. While multiple host defenses can target FbaA, the observation that the loss of CP reverses the virulence defect of ΔfdaB suggests that this alternative isozyme is important for resting nutritional immunity.

Adaptation to host-imposed environmental challenges is critical for bacterial survival. The expression of two different aldolases with different biochemical properties supports the importance of the redundancy of certain enzymes that are critical in coping with the different stresses that pathogens encounter during infection. It also highlights this pathogen’s remarkable metabolic plasticity and ability to adapt to hostile host milieu.

MATERIALS AND METHODS

Ethics statement.

All experiments involving animals were approved by the Institutional Animal Care and Use Committee of the University of Illinois at Urbana-Champaign (IACUC license number 15059) and were performed according to NIH guidelines, the Animal Welfare Act, and U.S. federal law.

Strains and growth conditions.

S. aureus strains were grown at 37°C in tryptic soy broth with glucose (TSB) on a roller drum or on tryptic soy agar (TSA) plates for the performance of routine culturing or for genetic manipulation. E. coli strains were routinely cultivated at 37°C in Luria broth (LB) with shaking or on Luria agar plates. As needed for plasmid maintenance in E. coli and S. aureus, 100 μg/mL of ampicillin and 10 μg/mL of chloramphenicol were added to the growth media, respectively. Both bacterial species were stored at −80°C in a growth medium that contained 30% glycerol.

S. aureus Newman or USA300 (JE2) and derivatives were used for all of the experiments. For the overnight cultures, the bacteria were grown in 5 mL of either tryptic soy broth with glucose (TSB) or Chelex-treated RPMI plus 1% Casamino Acids (NRPMI) supplemented with 1 mM MgCl2, 100 μM CaCl2, and 1 μM FeCl2 in 15 mL conical tubes at 37°C on a roller drum (13, 23). 10 μg/mL of chloramphenicol was added as need for plasmid maintenance. The hemolytic activity of all staphylococcal strains was confirmed via plating on blood agar plates. The strains used in this study are listed in Table 1. The fbaA::erm and fdaB::erm alleles were obtained from the Nebraska Transposon Mutant Library (NTML) and were introduced into S. aureus Newman and USA300 JE2 via phage transduction. Plasmids in the pOS1plgt background were constructed with the indicated primers (Table 2) via restriction cloning, whereas those in the pKK30 background were constructed via Gibson assembly.

TABLE 1.

Staphylococcus aureus strains and plasmids used in this study

Bacterial strains Genotype Source
Newman WT Wild-type methicillin sensitive strain 105
Newman ΔfbaA fbaA::erm This study
Newman ΔfdaB fdaB::erm This study
USA300 JE2 Wild-type methicillin resistant strain NTML (ID: NR-46543)
USA300 JE2 ΔfbaA fbaA::erm NTML (ID: NR-47019)
USA300 JE2 ΔfdaB fdaB::erm NTML (ID: NR-46831)
Newman ΔarlRS ΔarlRS 13
Newman ΔfdaB ΔarlRS fdaB::erm ΔarlRS This study
Newman ΔmntCΔmntH ΔmntCΔmntH 13
Newman ΔfdaBΔmntCΔmntH fdaB::erm ΔmntCΔmntH This study
pOS1 plgt empty pOS1 plgt without an insert 48
pOS1 plgt:fbaA pOS1 plgt with fbaA under the control of the lgt promoter This study
pOS1 plgt:fdaB pOS1 plgt with fdaB under the control of the lgt promoter This study
pKK30 empty pKK30 vector without an insert 106
pKK30:fbaA pKK30 with fbaA under the control of the native promoter This study
pKK30:fdaB pKK30 with fdaB under the control of the native promoter This study

TABLE 2.

Primers used in this study

Name Sequence
2503 F NdeI (for fbaA complementation) AGTCCATATGAATAAAGAGCAATTAGAAAAAATG
2503 R BamHI (for fbaA complementation) AGTCGGATCCTTAGTTTTTGTTTACAGAT
2029 F NdeI (for fdaB complementation) AGTCCATATGCCTTTAGTTTCAATGAAAGAAATG
2029 R BamHI (for fdaB complementation) AGTCGGATCCTTATTTAGCGCGGTTAGAAGTAC
2503 F (for fbaA expression analysis) GGATCGCGAAGTAGAAAGCA
2503 R (for fbaA expression analysis) AATGTGACGTTCGTTTGCAC
2029 F (for fdaB expression analysis) TTCAGCAAAAGCAGTTCGTG
2029 R (for fdaB expression analysis) TAGCGCGGTTAGAAGTACCG
fbaA pKK30 F (for fbaA complementation) TGCTTGTAATTCATGATTCGTCTACTTATAAAATATTGTAATTAATGACTACATATTATG
fbaA pKK30 R (for fbaA complementation) TCATATATCAAGCAAAGTGACAGGCGATGCTTATTTAGCGCGGTTAGAAG
fdaB pKK30 F (for fdaB complementation) TTTTGCTTGTAATTCATGATTCGTTTAATTAAACTGACAATTATTTTTCACATTTTATAC
fdaB pKK30 R (for fdaB complementation) TCATATATCAAGCAAAGTGACAGGCGATGCTTAGTTTTTGTTTACAGATGCGTC

Transcriptome profiling.

S. aureus Newman wild-type and ΔarlRS were grown in TSB with glucose overnight. Then, the cultures were diluted 1:100 into 96-well round-bottom plates containing 100 μL of growth medium (38% TSB [with or without glucose] and 62% calprotectin buffer [20 mM Tris pH 7.5, 100 mM NaCl, 3 mM CaCl2, 10 mM β-mercaptoethanol]). The growth medium was supplemented with 1 μM MnCl2 and 1 μM ZnSO4. Bacteria were harvested during log-phase growth (OD600 of approximately 0.1), and an equal volume of ice-cold 1:1 acetone-ethanol was then added to the cultures before freezing at −80°C until RNA extraction. RNA was extracted, and cDNA was generated as previously described (101–103). Purified RNA was submitted for RNA-seq preparation and sequencing at the Roy J. Carver Biotechnology Center (CBC) at the University of Illinois Urbana-Champaign.

Expression analysis.

To assess the expression of fbaA and fdaB, S. aureus Newman was grown in TSB with glucose overnight. Then, the cultures were diluted 1:100 into 96-well round-bottom plates containing 100 μL of growth medium (38% TSB with glucose and 62% calprotectin buffer [20 mM Tris pH 7.5, 100 mM NaCl, 3 mM CaCl2, 10 mM β-mercaptoethanol]) in the presence and absence of 240 μg/mL of CP. The growth medium was supplemented with 1 μM MnCl2 and 1 μM ZnSO4. Bacteria were harvested, RNA was extracted, and cDNA was prepared as indicated above for transcriptome profiling. Gene expression was assessed via quantitative reverse transcription-PCR (qRT-PCR), using the indicated primers (Table 2), with 16S being used as a normalizing control.

Calprotectin growth assays.

CP assays were largely performed as described previously (13, 27, 43). Overnight cultures grown in TSB with glucose were diluted 1:50 into 5 mL of fresh medium and were then incubated for 1 h or, if the strain contained a plasmid, 2 h at 37°C on a roller drum. The cultures were then back-diluted 1:100 in 96-well round-bottom plates containing 100 μL of growth medium (38% 3 × NRPMI and 62% calprotectin buffer [20 mM Tris pH 7.5, 100 mM NaCl, 3 mM CaCl2]) in the presence of various concentrations of CP. The growth medium was supplemented with 1 μM MnCl2, 1 μM FeCl2, and 1 μM ZnSO4. For all assays, the bacteria were incubated with orbital shaking (180 rpm) at 37°C, and growth was measured by assessing the optical density (OD600) every 1 to 2 h. Prior to the measurement of the optical density, the 96-well plates were vortexed.

Metal starvation growth assays.

For the growth assays using Chelex-treated medium to impose metal limitation, overnight cultures grown in NRPMI that contained 1 mM MgCl2 and 100 μM CaCl2, were diluted 1:10 in fresh medium that lacked metals before being further diluted 1:100 in 96-well round-bottom plates containing NRPMI supplemented with 1 mM MgCl2 and 100 μM CaCl2. As specified, 1 μM MnCl2, 1 μM ZnSO4, and 1 μM FeCl2 were also added. The bacteria were incubated with orbital shaking (180 rpm) at 37°C, and growth was measured by assessing the optical density (OD600) every 1 to 2 h. Prior to the measurement of the optical density, the 96-well plates were vortexed.

Aldolase activity assays.

Overnight cultures grown in NRPMI containing 1 mM MgCl2, 100 μM CaCl2, and 1 μM FeCl2 were diluted 1:10 in fresh medium before being further diluted 1:100 in 96-well round-bottom plates containing NRPMI supplemented with 1 mM MgCl2, 100 μM CaCl2, and 1 μM FeCl2. Additionally, 1 μM MnCl2 and/or 1 μM ZnSO4 were added as specified. Bacteria were harvested during logarithmic-phase growth (t = 6 h), with approximately 8 mL of cell culture per sample being harvested via centrifugation. The bacterial pellets were washed with 10 mL of 50 mM Tris-HCl (pH 7.5), before resuspension in 1 mL of this buffer. Prior to assaying aldolase activity, the cells were homogenized twice in a FastPrep-24 Beadbeater at 6 m/s for 45 s cycles with 5 min of incubation on ice in between. The cell lysates were centrifuged at 4°C in a microcentrifuge at 14,000 × g for 10 min. The supernatants were collected and used for the aldolase activity assay, which was performed as described by Zhang, et al., with a few modifications (88). Briefly, aldolase activity was determined by mixing untreated or EDTA-treated supernatants, 2 mM hydrazine, and 2.4 mM fructose-1,6-bisphosphate in 50 mM Tris-HCl (pH 7.5). Glyceraldehyde-3-phosphate produced from fructose-1,6-bisphosphate reacts with hydrazine to form an aldehyde-hydrazone, the production of which was measured via the tracking of the absorbance at 240 nm after 1 h of incubation at 25°C. Supernatants treated with 0.67 nM EDTA were incubated for 10 min at 25°C prior to their use for the aldolase activity assay. When indicated, 1 mM MnCl2 or 1 mM ZnSO4 was added to the reaction. For normalization, the total protein was determined using a BCA assay. Activity was defined as the change of the absorbance at 240 nm per minute per mg of total protein.

Animal experiments.

All animal infections were performed as previously described (13, 48, 104). 9-week-old female C57BL/6 or S100A9−/− mice were retro-orbitally infected with approximately 1 × 107 CFU suspended in 100 μL of sterile PBS. The infection was allowed to proceed for 4 days, after which the mice were sacrificed. The liver, heart, and kidneys were collected. These organs were homogenized, and the bacterial burdens were determined via the plating of serial dilutions.

Data availability.

Transcriptional profiling data were deposited in the NCBI Gene Expression Omnibus (GEO) repository (accession number: GSE202268).

ACKNOWLEDGMENTS

We sincerely thank the Roy J. Carver Biotechnology Center (CBC) at the University of Illinois Urbana-Champaign for the RNA-seq library preparation and sequencing. We also thank the members of the Kehl-Fie lab for their critical reading of the manuscript and thoughtful discussions.

This work was supported by grants from the National Institutes of Health (R01AI 118880, R01AI155611, and R21 AI149115), a Vallee Scholar Award to T.E.K.-F., and an Alice Helm Graduate Student Excellence Award to P.K.P.S.

Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the NIH or of the Vallee Foundation.

Contributor Information

Thomas E. Kehl-Fie, Email: kehlfie@illinois.edu.

Justin A. Thornton, Mississippi State University

REFERENCES

  • 1.Gotz A, Goebel W. 2010. Glucose and glucose 6-phosphate as carbon sources in extra- and intracellular growth of enteroinvasive Escherichia coli and Salmonella enterica. Microbiology (Reading) 156:1176–1187. doi: 10.1099/mic.0.034744-0. [DOI] [PubMed] [Google Scholar]
  • 2.Vitko NP, Grosser MR, Khatri D, Lance TR, Richardson AR. 2016. Expanded glucose import capability affords Staphylococcus aureus optimized glycolytic flux during infection. mBio 7. doi: 10.1128/mBio.00296-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Vitko NP, Spahich NA, Richardson AR. 2015. Glycolytic dependency of high-level nitric oxide resistance and virulence in Staphylococcus aureus. mBio 6. doi: 10.1128/mBio.00045-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bowden SD, Rowley G, Hinton JC, Thompson A. 2009. Glucose and glycolysis are required for the successful infection of macrophages and mice by Salmonella enterica serovar typhimurium. Infect Immun 77:3117–3126. doi: 10.1128/IAI.00093-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Tchawa Yimga M, Leatham MP, Allen JH, Laux DC, Conway T, Cohen PS. 2006. Role of gluconeogenesis and the tricarboxylic acid cycle in the virulence of Salmonella enterica serovar Typhimurium in BALB/c mice. Infect Immun 74:1130–1140. doi: 10.1128/IAI.74.2.1130-1140.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Inada T, Kimata K, Aiba H. 1996. Mechanism responsible for glucose-lactose diauxie in Escherichia coli: challenge to the cAMP model. Genes Cells 1:293–301. doi: 10.1046/j.1365-2443.1996.24025.x. [DOI] [PubMed] [Google Scholar]
  • 7.Deutscher J, Francke C, Postma PW. 2006. How phosphotransferase system-related protein phosphorylation regulates carbohydrate metabolism in bacteria. Microbiol Mol Biol Rev 70:939–1031. doi: 10.1128/MMBR.00024-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Deutscher J, Kuster E, Bergstedt U, Charrier V, Hillen W. 1995. Protein kinase-dependent HPr/CcpA interaction links glycolytic activity to carbon catabolite repression in gram-positive bacteria. Mol Microbiol 15:1049–1053. doi: 10.1111/j.1365-2958.1995.tb02280.x. [DOI] [PubMed] [Google Scholar]
  • 9.Liebeke M, Dorries K, Zuhlke D, Bernhardt J, Fuchs S, Pane-Farre J, Engelmann S, Volker U, Bode R, Dandekar T, Lindequist U, Hecker M, Lalk M. 2011. A metabolomics and proteomics study of the adaptation of Staphylococcus aureus to glucose starvation. Mol Biosyst 7:1241–1253. doi: 10.1039/c0mb00315h. [DOI] [PubMed] [Google Scholar]
  • 10.Kourany WM, Miro JM, Moreno A, Corey GR, Pappas PA, Abrutyn E, Hoen B, Habib G, Fowler VG, Jr, Sexton DJ, Olaison L, Cabell CH, Investigators IM. ICE MD Investigators. 2006. Influence of diabetes mellitus on the clinical manifestations and prognosis of infective endocarditis: a report from the International Collaboration on Endocarditis-Merged Database. Scand J Infect Dis 38:613–619. doi: 10.1080/00365540600617017. [DOI] [PubMed] [Google Scholar]
  • 11.Lipsky BA, Tabak YP, Johannes RS, Vo L, Hyde L, Weigelt JA. 2010. Skin and soft tissue infections in hospitalised patients with diabetes: culture isolates and risk factors associated with mortality, length of stay and cost. Diabetologia 53:914–923. doi: 10.1007/s00125-010-1672-5. [DOI] [PubMed] [Google Scholar]
  • 12.Casqueiro J, Casqueiro J, Alves C. 2012. Infections in patients with diabetes mellitus: a review of pathogenesis. Indian J Endocrinol Metab 16 Suppl 1:S27–36. doi: 10.4103/2230-8210.94253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Radin JN, Kelliher JL, Parraga Solorzano PK, Kehl-Fie TE. 2016. The two-component system ArlRS and alterations in metabolism enable Staphylococcus aureus to resist calprotectin-induced manganese starvation. PLoS Pathog 12:e1006040. doi: 10.1371/journal.ppat.1006040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Parraga Solorzano PK, Yao J, Rock CO, Kehl-Fie TE. 2019. Disruption of glycolysis by nutritional immunity activates a two-component system that coordinates a metabolic and antihost response by Staphylococcus aureus. mBio 10. doi: 10.1128/mBio.01321-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kehres DG, Maguire ME. 2003. Emerging themes in manganese transport, biochemistry and pathogenesis in bacteria. FEMS Microbiol Rev 27:263–290. doi: 10.1016/S0168-6445(03)00052-4. [DOI] [PubMed] [Google Scholar]
  • 16.Bond CS, White MF, Hunter WN. 2001. High resolution structure of the phosphohistidine-activated form of Escherichia coli cofactor-dependent phosphoglycerate mutase. J Biol Chem 276:3247–3253. doi: 10.1074/jbc.M007318200. [DOI] [PubMed] [Google Scholar]
  • 17.Chander M, Setlow B, Setlow P. 1998. The enzymatic activity of phosphoglycerate mutase from gram-positive endospore-forming bacteria requires Mn2+ and is pH sensitive. Can J Microbiol 44:759–767. doi: 10.1139/cjm-44-8-759. [DOI] [PubMed] [Google Scholar]
  • 18.Crow VL, Pritchard GG. 1977. The effect of monovalent and divalent cations on the activity of Streptococcus lactis C10 pyruvate kinase. Biochim Biophys Acta 481:105–114. doi: 10.1016/0005-2744(77)90142-5. [DOI] [PubMed] [Google Scholar]
  • 19.Yamada T, Carlsson J. 1975. Glucose-6-phosphate-dependent pyruvate kinase in Streptococcus mutans. J Bacteriol 124:562–563. doi: 10.1128/jb.124.1.562-563.1975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Juttukonda LJ, Skaar EP. 2015. Manganese homeostasis and utilization in pathogenic bacteria. Mol Microbiol 97:216–228. doi: 10.1111/mmi.13034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kehl-Fie TE, Skaar EP. 2010. Nutritional immunity beyond iron: a role for manganese and zinc. Curr Opin Chem Biol 14:218–224. doi: 10.1016/j.cbpa.2009.11.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Radin JN, Zhu J, Brazel EB, McDevitt CA, Kehl-Fie TE. 2019. Synergy between nutritional immunity and independent host defenses contributes to the importance of the MntABC manganese transporter during Staphylococcus aureus infection. Infect Immun 87. doi: 10.1128/IAI.00642-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kehl-Fie TE, Zhang Y, Moore JL, Farrand AJ, Hood MI, Rathi S, Chazin WJ, Caprioli RM, Skaar EP. 2013. MntABC and MntH contribute to systemic Staphylococcus aureus infection by competing with calprotectin for nutrient manganese. Infect Immun 81:3395–3405. doi: 10.1128/IAI.00420-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Bullen JJ. 1981. The significance of iron in infection. Rev Infect Dis 3:1127–1138. doi: 10.1093/clinids/3.6.1127. [DOI] [PubMed] [Google Scholar]
  • 25.Cassat JE, Skaar EP. 2013. Iron in infection and immunity. Cell Host Microbe 13:509–519. doi: 10.1016/j.chom.2013.04.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Corbin BD, Seeley EH, Raab A, Feldmann J, Miller MR, Torres VJ, Anderson KL, Dattilo BM, Dunman PM, Gerads R, Caprioli RM, Nacken W, Chazin WJ, Skaar EP. 2008. Metal chelation and inhibition of bacterial growth in tissue abscesses. Science 319:962–965. doi: 10.1126/science.1152449. [DOI] [PubMed] [Google Scholar]
  • 27.Kehl-Fie TE, Chitayat S, Hood MI, Damo S, Restrepo N, Garcia C, Munro KA, Chazin WJ, Skaar EP. 2011. Nutrient metal sequestration by calprotectin inhibits bacterial superoxide defense, enhancing neutrophil killing of Staphylococcus aureus. Cell Host Microbe 10:158–164. doi: 10.1016/j.chom.2011.07.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Weinberg ED. 2009. Iron availability and infection. Biochim Biophys Acta 1790:600–605. doi: 10.1016/j.bbagen.2008.07.002. [DOI] [PubMed] [Google Scholar]
  • 29.Waldron KJ, Rutherford JC, Ford D, Robinson NJ. 2009. Metalloproteins and metal sensing. Nature 460:823–830. doi: 10.1038/nature08300. [DOI] [PubMed] [Google Scholar]
  • 30.Andreini C, Bertini I, Cavallaro G, Holliday GL, Thornton JM. 2008. Metal ions in biological catalysis: from enzyme databases to general principles. J Biol Inorg Chem 13:1205–1218. doi: 10.1007/s00775-008-0404-5. [DOI] [PubMed] [Google Scholar]
  • 31.Papp-Wallace KM, Maguire ME. 2006. Manganese transport and the role of manganese in virulence. Annu Rev Microbiol 60:187–209. doi: 10.1146/annurev.micro.60.080805.142149. [DOI] [PubMed] [Google Scholar]
  • 32.Bolick DT, Kolling GL, Moore JH, 2nd, de Oliveira LA, Tung K, Philipson C, Viladomiu M, Hontecillas R, Bassaganya-Riera J, Guerrant RL. 2014. Zinc deficiency alters host response and pathogen virulence in a mouse model of enteroaggregative Escherichia coli-induced diarrhea. Gut Microbes 5:618–627. doi: 10.4161/19490976.2014.969642. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Ogunniyi AD, Mahdi LK, Jennings MP, McEwan AG, McDevitt CA, Van der Hoek MB, Bagley CJ, Hoffmann P, Gould KA, Paton JC. 2010. Central role of manganese in regulation of stress responses, physiology, and metabolism in Streptococcus pneumoniae. J Bacteriol 192:4489–4497. doi: 10.1128/JB.00064-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Price SL, Vadyvaloo V, DeMarco JK, Brady A, Gray PA, Kehl-Fie TE, Garneau-Tsodikova S, Perry RD, Lawrenz MB. 2021. Yersiniabactin contributes to overcoming zinc restriction during Yersinia pestis infection of mammalian and insect hosts. Proc Natl Acad Sci USA 118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zackular JP, Chazin WJ, Skaar EP. 2015. Nutritional immunity: S100 proteins at the host-pathogen interface. J Biol Chem 290:18991–18998. doi: 10.1074/jbc.R115.645085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Hood MI, Mortensen BL, Moore JL, Zhang Y, Kehl-Fie TE, Sugitani N, Chazin WJ, Caprioli RM, Skaar EP. 2012. Identification of an Acinetobacter baumannii zinc acquisition system that facilitates resistance to calprotectin-mediated zinc sequestration. PLoS Pathog 8:e1003068. doi: 10.1371/journal.ppat.1003068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Achouiti A, Vogl T, Urban CF, Rohm M, Hommes TJ, van Zoelen MA, Florquin S, Roth J, van 't Veer C, de Vos AF, van der Poll T. 2012. Myeloid-related protein-14 contributes to protective immunity in gram-negative pneumonia derived sepsis. PLoS Pathog 8:e1002987. doi: 10.1371/journal.ppat.1002987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Bianchi M, Niemiec MJ, Siler U, Urban CF, Reichenbach J. 2011. Restoration of anti-Aspergillus defense by neutrophil extracellular traps in human chronic granulomatous disease after gene therapy is calprotectin-dependent. J Allergy Clin Immunol 127:1243–1252. doi: 10.1016/j.jaci.2011.01.021. [DOI] [PubMed] [Google Scholar]
  • 39.Clohessy PA, Golden BE. 1995. Calprotectin-mediated zinc chelation as a biostatic mechanism in host defence. Scand J Immunol 42:551–556. doi: 10.1111/j.1365-3083.1995.tb03695.x. [DOI] [PubMed] [Google Scholar]
  • 40.Gebhardt C, Nemeth J, Angel P, Hess J. 2006. S100A8 and S100A9 in inflammation and cancer. Biochem Pharmacol 72:1622–1631. doi: 10.1016/j.bcp.2006.05.017. [DOI] [PubMed] [Google Scholar]
  • 41.Brophy MB, Hayden JA, Nolan EM. 2012. Calcium ion gradients modulate the zinc affinity and antibacterial activity of human calprotectin. J Am Chem Soc 134:18089–18100. doi: 10.1021/ja307974e. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Brophy MB, Nakashige TG, Gaillard A, Nolan EM. 2013. Contributions of the S100A9 C-terminal tail to high-affinity Mn(II) chelation by the host-defense protein human calprotectin. J Am Chem Soc 135:17804–17817. doi: 10.1021/ja407147d. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Damo SM, Kehl-Fie TE, Sugitani N, Holt ME, Rathi S, Murphy WJ, Zhang Y, Betz C, Hench L, Fritz G, Skaar EP, Chazin WJ. 2013. Molecular basis for manganese sequestration by calprotectin and roles in the innate immune response to invading bacterial pathogens. Proc Natl Acad Sci USA 110:3841–3846. doi: 10.1073/pnas.1220341110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Hayden JA, Brophy MB, Cunden LS, Nolan EM. 2013. High-affinity manganese coordination by human calprotectin is calcium-dependent and requires the histidine-rich site formed at the dimer interface. J Am Chem Soc 135:775–787. doi: 10.1021/ja3096416. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Korndorfer IP, Brueckner F, Skerra A. 2007. The crystal structure of the human (S100A8/S100A9)2 heterotetramer, calprotectin, illustrates how conformational changes of interacting alpha-helices can determine specific association of two EF-hand proteins. J Mol Biol 370:887–898. doi: 10.1016/j.jmb.2007.04.065. [DOI] [PubMed] [Google Scholar]
  • 46.Chandrangsu P, Rensing C, Helmann JD. 2017. Metal homeostasis and resistance in bacteria. Nat Rev Microbiol 15:338–350. doi: 10.1038/nrmicro.2017.15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Horsburgh MJ, Wharton SJ, Cox AG, Ingham E, Peacock S, Foster SJ. 2002. MntR modulates expression of the PerR regulon and superoxide resistance in Staphylococcus aureus through control of manganese uptake. Mol Microbiol 44:1269–1286. doi: 10.1046/j.1365-2958.2002.02944.x. [DOI] [PubMed] [Google Scholar]
  • 48.Garcia YM, Barwinska-Sendra A, Tarrant E, Skaar EP, Waldron KJ, Kehl-Fie TE. 2017. A superoxide dismutase capable of functioning with iron or manganese promotes the resistance of Staphylococcus aureus to calprotectin and nutritional immunity. PLoS Pathog 13:e1006125. doi: 10.1371/journal.ppat.1006125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Smaldone GT, Revelles O, Gaballa A, Sauer U, Antelmann H, Helmann JD. 2012. A global investigation of the Bacillus subtilis iron-sparing response identifies major changes in metabolism. J Bacteriol 194:2594–2605. doi: 10.1128/JB.05990-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Masse E, Gottesman S. 2002. A small RNA regulates the expression of genes involved in iron metabolism in Escherichia coli. Proc Natl Acad Sci USA 99:4620–4625. doi: 10.1073/pnas.032066599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Gaballa A, Antelmann H, Aguilar C, Khakh SK, Song KB, Smaldone GT, Helmann JD. 2008. The Bacillus subtilis iron-sparing response is mediated by a Fur-regulated small RNA and three small, basic proteins. Proc Natl Acad Sci USA 105:11927–11932. doi: 10.1073/pnas.0711752105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Merchant SS, Helmann JD. 2012. Elemental economy: microbial strategies for optimizing growth in the face of nutrient limitation. Adv Microb Physiol 60:91–210. doi: 10.1016/B978-0-12-398264-3.00002-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Yost FJ, Jr, Fridovich I. 1973. An iron-containing superoxide dismutase from Escherichia coli. J Biol Chem 248:4905–4908. doi: 10.1016/S0021-9258(19)43649-1. [DOI] [PubMed] [Google Scholar]
  • 54.Sankaran B, Bonnett SA, Shah K, Gabriel S, Reddy R, Schimmel P, Rodionov DA, de Crecy-Lagard V, Helmann JD, Iwata-Reuyl D, Swairjo MA. 2009. Zinc-independent folate biosynthesis: genetic, biochemical, and structural investigations reveal new metal dependence for GTP cyclohydrolase IB. J Bacteriol 191:6936–6949. doi: 10.1128/JB.00287-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Natori Y, Nanamiya H, Akanuma G, Kosono S, Kudo T, Ochi K, Kawamura F. 2007. A fail-safe system for the ribosome under zinc-limiting conditions in Bacillus subtilis. Mol Microbiol 63:294–307. doi: 10.1111/j.1365-2958.2006.05513.x. [DOI] [PubMed] [Google Scholar]
  • 56.Richardson AR. 2019. Virulence and metabolism. Microbiol Spectr 7. doi: 10.1128/microbiolspec.GPP3-0011-2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Lindsay JA, Foster SJ. 2001. zur: a Zn(2+)-responsive regulatory element of Staphylococcus aureus. Microbiology (Reading) 147:1259–1266. doi: 10.1099/00221287-147-5-1259. [DOI] [PubMed] [Google Scholar]
  • 58.Horsburgh MJ, Ingham E, Foster SJ. 2001. In Staphylococcus aureus, fur is an interactive regulator with PerR, contributes to virulence, and is necessary for oxidative stress resistance through positive regulation of catalase and iron homeostasis. J Bacteriol 183:468–475. doi: 10.1128/JB.183.2.468-475.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Fournier B, Hooper DC. 2000. A new two-component regulatory system involved in adhesion, autolysis, and extracellular proteolytic activity of Staphylococcus aureus. J Bacteriol 182:3955–3964. doi: 10.1128/JB.182.14.3955-3964.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Liang X, Zheng L, Landwehr C, Lunsford D, Holmes D, Ji Y. 2005. Global regulation of gene expression by ArlRS, a two-component signal transduction regulatory system of Staphylococcus aureus. J Bacteriol 187:5486–5492. doi: 10.1128/JB.187.15.5486-5492.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Walker JN, Crosby HA, Spaulding AR, Salgado-Pabon W, Malone CL, Rosenthal CB, Schlievert PM, Boyd JM, Horswill AR. 2013. The Staphylococcus aureus ArlRS two-component system is a novel regulator of agglutination and pathogenesis. PLoS Pathog 9:e1003819. doi: 10.1371/journal.ppat.1003819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Harper L, Balasubramanian D, Ohneck EA, Sause WE, Chapman J, Mejia-Sosa B, Lhakhang T, Heguy A, Tsirigos A, Ueberheide B, Boyd JM, Lun DS, Torres VJ. 2018. Staphylococcus aureus responds to the central metabolite pyruvate to regulate virulence. mBio 9. doi: 10.1128/mBio.02272-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Crosby HA, Kwiecinski J, Horswill AR. 2016. Staphylococcus aureus aggregation and coagulation mechanisms, and their function in host-pathogen interactions. Adv Appl Microbiol 96:1–41. doi: 10.1016/bs.aambs.2016.07.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Crosby HA, Tiwari N, Kwiecinski JM, Xu Z, Dykstra A, Jenul C, Fuentes EJ, Horswill AR. 2020. The Staphylococcus aureus ArlRS two-component system regulates virulence factor expression through MgrA. Mol Microbiol 113:103–122. doi: 10.1111/mmi.14404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Kwiecinski JM, Crosby HA, Valotteau C, Hippensteel JA, Nayak MK, Chauhan AK, Schmidt EP, Dufrene YF, Horswill AR. 2019. Staphylococcus aureus adhesion in endovascular infections is controlled by the ArlRS-MgrA signaling cascade. PLoS Pathog 15:e1007800. doi: 10.1371/journal.ppat.1007800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Benton BM, Zhang JP, Bond S, Pope C, Christian T, Lee L, Winterberg KM, Schmid MB, Buysse JM. 2004. Large-scale identification of genes required for full virulence of Staphylococcus aureus. J Bacteriol 186:8478–8489. doi: 10.1128/JB.186.24.8478-8489.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Burgui S, Gil C, Solano C, Lasa I, Valle J. 2018. A systematic evaluation of the two-component systems network reveals that ArlRS is a key regulator of catheter colonization by Staphylococcus aureus. Front Microbiol 9:342. doi: 10.3389/fmicb.2018.00342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Parraga Solorzano PK, Shupe AC, Kehl-Fie TE. 2021. The sensor histidine kinase ArlS is necessary for Staphylococcus aureus to activate ArlR in response to nutrient availability. J Bacteriol 203:e0042221. doi: 10.1128/JB.00422-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Crosby HA, Schlievert PM, Merriman JA, King JM, Salgado-Pabon W, Horswill AR. 2016. The Staphylococcus aureus global regulator MgrA modulates clumping and virulence by controlling surface protein expression. PLoS Pathog 12:e1005604. doi: 10.1371/journal.ppat.1005604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Stribling D, Perham RN. 1973. Purification and characterization of two fructose diphosphate aldolases from Escherichia coli (Crookes' strain). Biochem J 131:833–841. doi: 10.1042/bj1310833. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Capodagli GC, Lee SA, Boehm KJ, Brady KM, Pegan SD. 2014. Structural and functional characterization of methicillin-resistant Staphylococcus aureus's class IIb fructose 1,6-bisphosphate aldolase. Biochemistry 53:7604–7614. doi: 10.1021/bi501141t. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Radin JN, Kelliher JL, Solorzano PKP, Grim KP, Ramezanifard R, Slauch JM, Kehl-Fie TE. 2019. Metal-independent variants of phosphoglycerate mutase promote resistance to nutritional immunity and retention of glycolysis during infection. PLoS Pathog 15:e1007971. doi: 10.1371/journal.ppat.1007971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Nakashige TG, Zhang B, Krebs C, Nolan EM. 2015. Human calprotectin is an iron-sequestering host-defense protein. Nat Chem Biol 11:765–771. doi: 10.1038/nchembio.1891. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Nakashige TG, Zygiel EM, Drennan CL, Nolan EM. 2017. Nickel sequestration by the host-defense protein human calprotectin. J Am Chem Soc 139:8828–8836. doi: 10.1021/jacs.7b01212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Besold AN, Gilston BA, Radin JN, Ramsoomair C, Culbertson EM, Li CX, Cormack BP, Chazin WJ, Kehl-Fie TE, Culotta VC. 2018. Role of calprotectin in withholding zinc and copper from Candida albicans. Infect Immun 86. doi: 10.1128/IAI.00779-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Clark HL, Jhingran A, Sun Y, Vareechon C, de Jesus Carrion S, Skaar EP, Chazin WJ, Calera JA, Hohl TM, Pearlman E. 2016. Zinc and manganese chelation by neutrophil S100A8/A9 (calprotectin) limits extracellular Aspergillus fumigatus hyphal growth and corneal infection. J Immunol 196:336–344. doi: 10.4049/jimmunol.1502037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Gagnon DM, Brophy MB, Bowman SE, Stich TA, Drennan CL, Britt RD, Nolan EM. 2015. Manganese binding properties of human calprotectin under conditions of high and low calcium: X-ray crystallographic and advanced electron paramagnetic resonance spectroscopic analysis. J Am Chem Soc 137:3004–3016. doi: 10.1021/ja512204s. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Porcheron G, Garenaux A, Proulx J, Sabri M, Dozois CM. 2013. Iron, copper, zinc, and manganese transport and regulation in pathogenic Enterobacteria: correlations between strains, site of infection and the relative importance of the different metal transport systems for virulence. Front Cell Infect Microbiol 3:90. doi: 10.3389/fcimb.2013.00090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Palmer LD, Skaar EP. 2016. Transition metals and virulence in bacteria. Annu Rev Genet 50:67–91. doi: 10.1146/annurev-genet-120215-035146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Neumann W, Hadley RC, Nolan EM. 2017. Transition metals at the host-pathogen interface: how Neisseria exploit human metalloproteins for acquiring iron and zinc. Essays Biochem 61:211–223. doi: 10.1042/EBC20160084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Becker KW, Skaar EP. 2014. Metal limitation and toxicity at the interface between host and pathogen. FEMS Microbiol Rev 38:1235–1249. doi: 10.1111/1574-6976.12087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Berry A, Marshall KE. 1993. Identification of zinc-binding ligands in the class II fructose-1,6-bisphosphate aldolase of Escherichia coli. FEBS Lett 318:11–16. doi: 10.1016/0014-5793(93)81317-s. [DOI] [PubMed] [Google Scholar]
  • 83.Blom NS, Tetreault S, Coulombe R, Sygusch J. 1996. Novel active site in Escherichia coli fructose 1,6-bisphosphate aldolase. Nat Struct Biol 3:856–862. doi: 10.1038/nsb1096-856. [DOI] [PubMed] [Google Scholar]
  • 84.Hall DR, Leonard GA, Reed CD, Watt CI, Berry A, Hunter WN. 1999. The crystal structure of Escherichia coli class II fructose-1, 6-bisphosphate aldolase in complex with phosphoglycolohydroxamate reveals details of mechanism and specificity. J Mol Biol 287:383–394. doi: 10.1006/jmbi.1999.2609. [DOI] [PubMed] [Google Scholar]
  • 85.Cooper SJ, Leonard GA, McSweeney SM, Thompson AW, Naismith JH, Qamar S, Plater A, Berry A, Hunter WN. 1996. The crystal structure of a class II fructose-1,6-bisphosphate aldolase shows a novel binuclear metal-binding active site embedded in a familiar fold. Structure 4:1303–1315. doi: 10.1016/S0969-2126(96)00138-4. [DOI] [PubMed] [Google Scholar]
  • 86.Kobes RD, Simpson RT, Vallee RL, Rutter WJ. 1969. A functional role of metal ions in a class II aldolase. Biochemistry 8:585–588. doi: 10.1021/bi00830a018. [DOI] [PubMed] [Google Scholar]
  • 87.Harris CE, Kobes RD, Teller DC, Rutter WJ. 1969. The molecular characteristics of yeast aldolase. Biochemistry 8:2442–2454. doi: 10.1021/bi00834a029. [DOI] [PubMed] [Google Scholar]
  • 88.Zhang YM, Liu JK, Shouri MR, Wong TY. 2006. Characterization of a Mn-dependent fructose-1,6-bisphosphate aldolase in Deinococcus radiodurans. Biometals 19:31–37. doi: 10.1007/s10534-005-4320-7. [DOI] [PubMed] [Google Scholar]
  • 89.Stolzenberger J, Lindner SN, Wendisch VF. 2013. The methylotrophic Bacillus methanolicus MGA3 possesses two distinct fructose 1,6-bisphosphate aldolases. Microbiology (Reading) 159:1770–1781. doi: 10.1099/mic.0.067314-0. [DOI] [PubMed] [Google Scholar]
  • 90.Pirovich DB, Da'dara AA, Skelly PJ. 2021. Multifunctional fructose 1,6-bisphosphate aldolase as a therapeutic target. Front Mol Biosci 8:719678. doi: 10.3389/fmolb.2021.719678. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Ziveri J, Tros F, Guerrera IC, Chhuon C, Audry M, Dupuis M, Barel M, Korniotis S, Fillatreau S, Gales L, Cahoreau E, Charbit A. 2017. The metabolic enzyme fructose-1,6-bisphosphate aldolase acts as a transcriptional regulator in pathogenic Francisella. Nat Commun 8:853. doi: 10.1038/s41467-017-00889-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92.Yu Y, Liu M, Hua L, Qiu M, Zhang W, Wei Y, Gan Y, Feng Z, Shao G, Xiong Q. 2018. Fructose-1,6-bisphosphate aldolase encoded by a core gene of Mycoplasma hyopneumoniae contributes to host cell adhesion. Vet Res 49:114. doi: 10.1186/s13567-018-0610-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93.Tunio SA, Oldfield NJ, Berry A, Ala'Aldeen DA, Wooldridge KG, Turner DP. 2010. The moonlighting protein fructose-1, 6-bisphosphate aldolase of Neisseria meningitidis: surface localization and role in host cell adhesion. Mol Microbiol 76:605–615. doi: 10.1111/j.1365-2958.2010.07098.x. [DOI] [PubMed] [Google Scholar]
  • 94.Allen AE, Moustafa A, Montsant A, Eckert A, Kroth PG, Bowler C. 2012. Evolution and functional diversification of fructose bisphosphate aldolase genes in photosynthetic marine diatoms. Mol Biol Evol 29:367–379. doi: 10.1093/molbev/msr223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95.Shams F, Oldfield NJ, Wooldridge KG, Turner DP. 2014. Fructose-1,6-bisphosphate aldolase (FBA)-a conserved glycolytic enzyme with virulence functions in bacteria: 'ill met by moonlight'. Biochem Soc Trans 42:1792–1795. doi: 10.1042/BST20140203. [DOI] [PubMed] [Google Scholar]
  • 96.Bai NJ, Pai MR, Murthy PS, Venkitasubramanian TA. 1974. Effect of oxygen tension on the aldolases of Mycobacterium tuberculosis H37Rv. FEBS Lett 45:68–70. doi: 10.1016/0014-5793(74)80812-4. [DOI] [PubMed] [Google Scholar]
  • 97.Szwergold BS, Ugurbil K, Brown TR. 1995. Properties of fructose-1,6-bisphosphate aldolase from Escherichia coli: an NMR analysis. Arch Biochem Biophys 317:244–252. doi: 10.1006/abbi.1995.1159. [DOI] [PubMed] [Google Scholar]
  • 98.Schultenkamper K, Gutle DD, Lopez MG, Keller LB, Zhang L, Einsle O, Jacquot JP, Wendisch VF. 2021. Interrogating the role of the two distinct fructose-bisphosphate aldolases of Bacillus methanolicus by site-directed mutagenesis of key amino acids and gene repression by CRISPR interference. Front Microbiol 12:669220. doi: 10.3389/fmicb.2021.669220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 99.Hecker M, Mader U, Volker U. 2018. From the genome sequence via the proteome to cell physiology - pathoproteomics and pathophysiology of Staphylococcus aureus. Int J Med Microbiol 308:545–557. doi: 10.1016/j.ijmm.2018.01.002. [DOI] [PubMed] [Google Scholar]
  • 100.Tomlinson KL, Lung TWF, Dach F, Annavajhala MK, Gabryszewski SJ, Groves RA, Drikic M, Francoeur NJ, Sridhar SH, Smith ML, Khanal S, Britto CJ, Sebra R, Lewis I, Uhlemann AC, Kahl BC, Prince AS, Riquelme SA. 2021. Staphylococcus aureus induces an itaconate-dominated immunometabolic response that drives biofilm formation. Nat Commun 12:1399. doi: 10.1038/s41467-021-21718-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101.Collins JA, Irnov I, Baker S, Winkler WC. 2007. Mechanism of mRNA destabilization by the glmS ribozyme. Genes Dev 21:3356–3368. doi: 10.1101/gad.1605307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 102.Grossoehme N, Kehl-Fie TE, Ma Z, Adams KW, Cowart DM, Scott RA, Skaar EP, Giedroc DP. 2011. Control of copper resistance and inorganic sulfur metabolism by paralogous regulators in Staphylococcus aureus. J Biol Chem 286:13522–13531. doi: 10.1074/jbc.M111.220012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 103.Kehl-Fie TE, Porsch EA, Miller SE, St Geme JW, 3rd. 2009. Expression of Kingella kingae type IV pili is regulated by sigma54, PilS, and PilR. J Bacteriol 191:4976–4986. doi: 10.1128/JB.00123-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 104.Grim KP, San Francisco B, Radin JN, Brazel EB, Kelliher JL, Parraga Solorzano PK, Kim PC, McDevitt CA, Kehl-Fie TE. 2017. The metallophore staphylopine enables Staphylococcus aureus to compete with the host for zinc and overcome nutritional immunity. mBio 8. doi: 10.1128/mBio.01281-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 105.Duthie ES, Lorenz LL. 1952. Staphylococcal coagulase; mode of action and antigenicity. J Gen Microbiol 6:95–107. doi: 10.1099/00221287-6-1-2-95. [DOI] [PubMed] [Google Scholar]
  • 106.Krute CN, Kraus KL, Markiewicz MA, Joyner JA, Pokhrel S, Hall PR, Bose JL. 2016. Generation of a stable plasmid for in vitro and in vivo studies of Staphylococcus species. Appl Environ Microbiol 82:6859–6869. doi: 10.1128/AEM.02370-16. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

TABLE S1

List of genes whose expression changes between the wild-type and ΔarlRS, following growth in glucose-containing medium. Download Table S1, XLSX file, 0.04 MB (47.4KB, xlsx) .

Copyright © 2023 Párraga Solórzano et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

TABLE S2

List of genes whose expression changes between the wild-type and ΔarlRS, following growth in medium without glucose. Download Table S2, XLSX file, 0.1 MB (68.6KB, xlsx) .

Copyright © 2023 Párraga Solórzano et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

TABLE S3

List of common changes between wild-type S. aureus and strains lacking ArlRS from this study and from Crosby et al. Download Table S3, XLSX file, 0.01 MB (10.2KB, xlsx) .

Copyright © 2023 Párraga Solórzano et al.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

Data Availability Statement

Transcriptional profiling data were deposited in the NCBI Gene Expression Omnibus (GEO) repository (accession number: GSE202268).


Articles from mBio are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES