Insights into the Roles of Lipoteichoic Acids and MprF in Bacillus subtilis

Aurélie Guyet; Amirah Alofi; Richard A Daniel

doi:10.1128/mbio.02667-22

. 2023 Feb 6;14(1):e02667-22. doi: 10.1128/mbio.02667-22

Insights into the Roles of Lipoteichoic Acids and MprF in Bacillus subtilis

Aurélie Guyet ^a,^✉, Amirah Alofi ^a, Richard A Daniel ^a,^✉

Editor: Tarek Msadek^b

PMCID: PMC9973362 PMID: 36744964

ABSTRACT

Gram-positive bacterial cells are protected from the environment by a cell envelope that is comprised of a thick layer of peptidoglycan that maintains cell shape and teichoic acid polymers whose biological function remains unclear. In Bacillus subtilis, the loss of all class A penicillin-binding proteins (aPBPs), which function in peptidoglycan synthesis, is conditionally lethal. Here, we show that this lethality is associated with an alteration of lipoteichoic acids (LTAs) and the accumulation of the major autolysin LytE in the cell wall. Our analysis provides further evidence that the length and abundance of LTAs act to regulate the cellular level and activity of autolytic enzymes, specifically LytE. Importantly, we identify a novel function for the aminoacyl-phosphatidylglycerol synthase MprF in the modulation of LTA biosynthesis in both B. subtilis and Staphylococcus aureus. This finding has implications for our understanding of antimicrobial resistance (particularly to daptomycin) in clinically relevant bacteria and the involvement of MprF in the virulence of pathogens such as methicillin-resistant S. aureus (MRSA).

KEYWORDS: LytE, MprF, PBP1, daptomycin, Bacillus subtilis, lipoteichoic acid

INTRODUCTION

Gram-positive bacteria have a common cell envelope architecture that contributes to maintaining cell shape and protects the cell from environmental changes. The best-characterized component of the cell envelope is the peptidoglycan (PG), which forms a mesh-like structure enclosing the cell membrane (Fig. 1A). On this structure, anionic polymers are either covalently attached to PG N-acetylmuramic acids, known as wall teichoic acids (WTAs), or tethered to the external face of the membrane, named lipoteichoic acids (LTAs) (1 –4). It is unclear whether LTAs are localized in a periplasm-like space between the membrane and PG or extend through the PG layers (5, 6).

FIG 1 — Representations of the cell envelope of the Gram-positive rod-shaped bacterium *Bacillus subtilis* and biosynthetic links between lipoteichoic acids and phospholipids. (A) Depiction of some of the cell envelope components and their functions in *B. subtilis*. This figure indicates the complexity of cell envelope synthesis due to the presence of enzymes that seemingly assume the same function. This redundancy of function has been identified in the reaction steps leading to the synthesis of the peptidoglycan (glycosyltransferases, 4 class A PBPs, and the essential RodA), the lipoteichoic acids (3 LTA synthases, where LtaS is the major enzyme), and the actin-like filaments that coordinate cell shape (3 Mre homologs, MreB/MreBH and Mbl, where the latter is essential in *B. subtilis* 168CA). The major autolysins CwlO and LytE (the absence of both is lethal to *B. subtilis*) cleave the peptidoglycan pentapeptides. The presence of aaPGols produced by MprF and the d-alanylation of teichoic acids by Dlt proteins are thought to create an electrostatic environment that protects the bacteria from CAMPs (cationic antimicrobial peptides). (Illustration created with BioRender.com.) (B) Schematic representation of the biosynthetic links among lipoteichoic acids, phospholipids, and glucolipids in *B. subtilis* (3, 83). LTAs consist of glycerolphosphate units anchored to the membrane by a glycolipid usually synthesized by UgtP. When grown in LB medium at 37°C, the majority of *B. subtilis* phospholipids are phosphatidylglycerol (37.5% ± 6.2%), phosphatidylethanolamine (30.5% ± 3.8%), Glc₂DAG (9.6% ± 4.7%), and lysyl-phosphatidylglycerol (LysPGol) (7.8% ± 3.7%) produced by MprF (83). Recently, l- and N-succinyl-LysPGol and l- and d-AlaPGol were identified in *B. subtilis* (25). The gray arrow indicates a reaction step that might be bidirectional.

Peptidoglycan is synthetized by glycosyltransferases (GTases) which catalyze the addition of a disaccharide pentapeptide precursor (lipid II) to the nascent PG chain (Fig. 1A), while transpeptidase (TPase) enzymes cross-link a proportion of the pentapeptides to adjacent PG strands (7, 8). In the absence of the bifunctional transmembrane GTase and TPase enzymes, known as class A penicillin-binding proteins (aPBPs) (Fig. 1A), Bacillus subtilis cells are viable but grow slowly, and the cells are longer and thinner (9, 10). The viability of B. subtilis lacking all aPBPs (referred to as Δ4) depends on the functionality of the essential protein RodA, which was recently identified to function as a PG glycosyltransferase (11, 12). The Δ4 strain is conditionally lethal on Penassay Broth (PAB) agar medium unless the medium is supplemented with magnesium (10). It is thought that this divalent cation alters the structure of the wall by binding to teichoic acids or PG and, by doing so, might alter the activity of cell wall hydrolases (Fig. 1A), the enzymes that modify and sculpt synthesized PG to allow the cell to elongate and divide (5, 13 –15).

In B. subtilis 168, both LTAs and WTAs are composed of polyglycerolphosphate (polyGroP) but are generated by independent biosynthetic pathways (Fig. 1B) (2 –5). Importantly, B. subtilis is not able to survive the loss of both LTA and WTA synthesis (16), and these teichoic acids seem to have roles in both cell growth (17) and division-separation (16, 18). It has also been determined that the anionic charge of these polymers can be modified by the addition of d-alanine or N-acetylglucosamine (19). d-Alanylation by Dlt proteins (Fig. 1A) has been proposed to regulate autolysin activity and cell wall ion homeostasis (3, 5) and also imparts some resistance to positively charged cationic antimicrobial peptides (CAMPs) (20). The net cell envelope charge has been proposed to be moderated by the teichoic acids and the phospholipid composition of the cell membrane (Fig. 1) (21, 22). In this respect, the transmembrane protein MprF is the only enzyme known to synthesize and translocate aminoacyl-phosphatidylglycerol (aaPGol), particularly lysyl-phosphatidylglycerol (LysPGol) (Fig. 1) (23 –26). MprF plays a role in the virulence of bacterial pathogens (26, 27), and in B. subtilis, it confers resistance to CAMPs (Fig. 1A) such as nisin and daptomycin (DAP) through mechanisms that are not yet characterized (28, 29). Phosphatidylglycerol (PGol) is also the substrate for LTA synthases, and in B. subtilis, three LTA synthases are present: LtaS (housekeeping), YfnI (stress), and YqgS (sporulation) (16, 18) (Fig. 1). These transmembrane LTA synthases have an extracellular catalytic domain that uses PGol to generate a polyGroP polymer on a lipid anchor (2, 3). The lipid anchor is usually a diglucosyldiacylglycerol (Glc₂DAG) produced by UgtP on the internal surface of the cell membrane (30) (Fig. 1A). As a ugtP mutant still produces LTA (31), this suggests that polyGroP polymers are probably anchored to a phosphatidylglycerol, as observed in Staphylococcus aureus (32, 33).

In S. aureus, LTA is essential and seems to modulate autolytic activity (34), while WTA is dispensable but appears to restrict autolytic activity (1, 4). Contrary to B. subtilis, S. aureus has only one LTA synthase (LtaS), whose absence is (conditionally) essential (35) and can be complemented by B. subtilis ltaS but not yfnI (18, 36). A recent in vitro study showed that S. aureus LtaS is processive and that LTA polymer elongation is regulated directly by the identity and concentration of the lipid starter units. Interestingly, the use of Glc₂DAG as a starter unit led to the formation of shorter polymers (33), while the use of PGol resulted in the synthesis of longer polymers. It is not clear if this newly identified mechanism is conserved in B. subtilis. However, in the absence of B. subtilis LtaS, YfnI activity results in LTA of increased length, and it is possible that the combination of LtaS and YfnI activities modulate the length of LTA (Fig. 1A) (18, 37).

By characterizing B. subtilis strains lacking peptidoglycan GTase activity (12), we aimed to understand the cell wall stresses that cause the inability of aPBP mutants to grow on glucose-rich media. Collectively, our data support the idea that in B. subtilis, the LTA length acts to moderate the activity of at least one important autolysin, LytE (Fig. 1A). The presence of glucose in a strain lacking aPBPs increases the expression of LtaS and YfnI and results in altered LTA production. Crucially, we identify a new role of MprF in altering LTA polymerization in both B. subtilis and S. aureus. Our results reveal that MprF acts to change the cell envelope in a more dramatic way than simply increasing the positive charge on the cell membrane and have important implications for understanding the association of MprF with both virulence and antibiotic resistance in Gram-positive bacteria.

RESULTS

MprF alters cell viability in the absence of ponA or mbl.

In Bacillus subtilis, the absence of all aPBPs (ΔponA ΔpbpD ΔpbpF ΔpbpG mutant, referred to as Δ4 here) is conditionally lethal on glucose-rich PAB medium unless supplemented with magnesium (10, 12, 38). The suppressive effect of divalent magnesium has been observed in other cell wall-deficient mutants (10, 16, 38, 39), and it is not well understood. To identify the cell wall factors that are able to suppress the lethality of aPBP mutants, we applied random transposition mutagenesis to a strain deleted for the vegetative aPBPs (Tables 1 to 3). Mapping of the transposon in strain SWA11a revealed an insertion in the mprF gene, encoding a lysyl-phosphatidylglycerol (LysPGol) synthase known to participate in phospholipid metabolism (Fig. 1) (23, 28). The introduction of an mprF deletion into Δ4 confirmed that the Δ4 ΔmprF strain was viable on nutrient agar (NA) with glucose (NA-glucose) and PAB agar (Fig. 2A; see also Fig. S1A in the supplemental material). A strain lacking ponA, encoding the major aPBP (PBP1), is viable but exhibits a growth phenotype that is suppressed by magnesium (Fig. 2A and Fig. S1B). Here, the deletion of mprF in the ΔponA strain improved its growth and colony morphology.

TABLE 1.

Plasmids used in this study^a

Plasmid	Relevant feature(s)	Reference or source
pAM-21	kan P_T7 LytE^(26–334)-His₆ lacI	This study
pCotC-GFP	Used as a matrix to amplify cat	75
pDR111	bla amyE::(lacI P_hyspank spc)	D. Rudner, unpublished data
pDR111-P_hyspank-ltaS	bla amyE::(lacI P_hyspank-ltaS spc)	This study
pDR111-P_hyspank-mprF	bla amyE::(lacI P_hyspank-mprF spc)*	This study
pDR111-P_hyspank-yfnI	bla amyE::(lacI P_hyspank-yfnI spc)	This study
pDR111-P_hyspank-yqgS	bla amyE::(lacI P_hyspank-yqgS spc)	This study
pET28a(+)	kan P_T7 his lacI	Novagen
pG⁺host9::ΔponA	erm, carrying flanking DNA regions of ponA	12
pG⁺host10::ΔpbpD	bla, carrying flanking DNA regions of pbpD	12
pG⁺host10::ΔpbpF	bla, carrying flanking DNA regions of pbpF	12
pIC22	Used as a matrix to amplify phleo	76
pLOSS*	bla spc P_spac mcs P_divIVA-lacZ lacI rep_pLS20(GA→CC)	39
pLOSS-P_spac-lytE	bla spc P_spac-lytE P_divIVA-lacZ lacI rep_pLS20(GA→CC)	This study
pLOSS-P_spac-ponA	bla spc P_spac-ponA P_divIVA-lacZ lacI rep_pLS20(GA→CC)	12
pMarB	bla erm TnYLB-1::kan Himar1 transposase	77
pMUTinHis	bla erm P_spac mcs His₁₂ lacZ lacI	73
pMUTin-′lytE-his	bla erm P_spac mcs ′LytE-6 aa-His₁₂ lacZ lacI	This study
pMUTin-′ltaS-his	bla erm P_spac mcs ′LtaS-6 aa-His₁₂ lacZ lacI	This study
pMUTin-′yfnI-his	bla erm P_spac mcs ′YfnI-6 aa-His₁₂ lacZ lacI	This study

Open in a new tab

Plasmids are in alphabetical order. cat, chloramphenicol resistance; bla, ampicillin resistance; spc, spectinomycin resistance; erm, erythromycin resistance; phleo, phleomycin resistance; kan, kanamycin resistance; lacI, gene encoding a lactose repressor; mcs, multiple-cloning site; lacZ, gene encoding β-galactosidase; aa, amino acids [LEMRGS]; rep_pLS20(GA→CC), unstable replication in Bacillus. P_hyspank and P_spac are IPTG-inducible promoters, with P_hyspank being known to be stronger. *, For pDR111-P_hyspank-mprF the native start codon was changed to ATG.

TABLE 2.

Strains used in this study

Strain	Relevant genotype or description^a	Source(s) and/or reference^b
E. coli
DH5α	F⁻ endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG ϕ80dlacZΔM15 Δ(lacZYA-argF)U169 hsdR17(r_K⁻ m_K⁺) λ⁻	Lab stock
BL21(DE3)	B F⁻ ompT gal dcm lon hsdS_B(r_B⁻ m_B⁻) λ(DE3[lacI lacUV5-T7p07 ind1 sam7 nin5]) [malB⁺]K-12(λ^s)	Novagen
B. subtilis
168CA	trpC2	R. Daniel, lab stock
168 1A1	trpC2 (BGSC strain 1A1)	54
3725CA	trpC2 Ωneo ΔmreB	3725 (78)→168CA cells
4261CA	trpC2 Δmbl::cat	4261 (79)→168CA cells
4285CA	trpC2 ΔltaS::cat	4285 (79)→168CA cells
4287CA	trpC2 ΔyfnI::spc	4287 (79)→168CA cells
4289CA	trpC2 ΔyfnI::erm	4289 (79)→168CA cells
4292CA	trpC2 ΔyqgS::spc	4292 (79)→168CA cells
4293CA	trpC2 ΔyqgS::cat	4293 (79)→168CA cells
4294CA	trpC2 ΔyqgS::erm	4294 (79)→168CA cells
4620	trpC2 ΔltaS::neo ΔyfnI::cat ΔyqgS::spc ΔyvgJ::erm	79
AG105	trpC2 ΔpbpD ΔpbpF	pG⁺host10::ΔpbpF (12)→RE103 cells
AG108	trpC2 ΔponA ΔpbpD ΔpbpF	pG⁺host10::ΔpbpF→RE104 cells
AG123	trpC2 ΔponA ΔpbpD ΔpbpF pLOSS-P_spac-ponA	pLOSS-P_spac-ponA→AG108 cells
AG141	trpC2 ΔponA ΔpbpD ΔpbpF pLOSS-P_spac-ponA lacA::cat	K532→AG123 cells
AG157	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan)	12
AG181	trpC2 ΔmprF::phleo	This study
AG185	trpC2 ΔmprF::phleo Ωneo ΔmreB	3725CA→AG181 cells
AG189	trpC2 ΔmprF::phleo Δmbl::cat	4261CA→AG181 cells
AG193	trpC2 ΔponA ΔmprF::phleo	AG181→RE101 cells
AG200	trpC2 ΔponA ΔpbpD ΔpbpF pLOSS-P_spac-ponA ΔmprF::phleo lacA::cat	AG181→AG141 cells
AG200BK#42	trpC2 ΔponA ΔpbpD ΔpbpF pLOSS-P_spac-ponA ΔmprF::phleo lacA::cat gtaB::TnYLB-1(kan)	This study
AG210	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) ΔmprF::phleo lacA::cat pLOSS-P_spac-ponA	DPVB45CA→AG200 cells
AG211	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) pLOSS-P_spac-ponA	DPVB45CA→AG123 cells
AG223	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) ΔmprF::phleo	AG181→AG157 cells
AG229	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan)	AG211 plasmid lost on 20 mM MgSO₄ with kan
AG290	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) pLOSS-P_spac-ponA ΔgtaB::erm	SM08→AG211 cells
AG290NopLoss	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) ΔgtaB::erm	AG290 plasmid lost on 20 mM MgSO₄ with kan
AG292	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) pLOSS-P_spac-ponA Ωerm ΔtagE	SM50→AG211 cells
AG293	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) ggaAB::spc	SM31→AG229 cells
AG296	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) pLOSS-P_spac-ponA pgcA::tet	SSB122→AG211 cells
AG304	trpC2 amyE::(P_hyspank-mprF spc)	pDR111-P_hyspank-mprF→168CA cells
AG311	trpC2 ΔponA amyE::(P_hyspank-mprF spc)	AG304→RE101 cells
AG317	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) amyE::(P_hyspank-mprF spc)	AG304→AG157 cells
AG322	trpC2 amyE::(P_hyspank-mprF spc) Δmbl::cat	4261CA→AG304 cells
AG327	trpC2 amyE::(P_hyspank-mprF spc) Ωneo ΔmreB	3725CA→AG304 cells
AG341	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) dltAB::cat	DLT71 (40)→AG157 cells
AG342	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) ΔltaS::cat	4285CA→AG157 cells
AG343	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) ΔyfnI::erm	4289CA→AG157 cells
AG344	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) ΔyqgS::erm	4294CA→AG157 cells
AG347	trpC2 ΔmprF::phleo ΔltaS::cat	4285CA→AG181 cells
AG349	trpC2 amyE::(P_hyspank-mprF spc) ΔltaS::cat	4285CA→AG304 cells
AG353	trpC2 amyE::(P_hyspank-mprF spc) ΔyfnI::erm	4289CA→AG304 cells
AG370	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) ΔltaS::cat ΔyfnI::erm	4289CA→AG342 cells
AG372	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) ΔltaS::cat ΔyqgS::erm	4294CA→AG342 cells
AG377	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) ΔyqgS::erm ΔyfnI::spc	4287CA→AG344 cells
AG380	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) ΔltaS::cat ΔyqgS::erm ΔyfnI::spc	4287CA→AG372 cells
AG383	trpC2 ΔponA ΔltaS::cat	4285CA→RE101 cells
AG384	trpC2 ΔponA ΔyfnI::erm	4289CA → RE101 cells
AG385	trpC2 ΔponA ΔyqgS::spc	4292CA→RE101 cells
AG389	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) ΔmprF::phleo ΔltaS::cat ΔyqgS::erm	AG223→AG372 cells
AG390	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) ΔmprF::phleo ΔygqS::erm ΔyfnI::spc	AG223→AG377 cells
AG393	trpC2 ΔponA ΔltaS::cat ΔyfnI::erm	4289CA→AG383 cells
AG394	trpC2 ΔponA ΔltaS::cat ΔyqgS::spc	4292CA→AG383 cells
AG395	trpC2 ΔponA ΔyfnI::spc ΔyqgS::spc	4292CA→AG384 cells
AG399	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) ΔmprF::phleo ΔltaS::cat ΔyfnI::erm	AG223→AG370 cells
AG400	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) ΔmprF::phleo ΔltaS::cat ΔyqgS::erm ΔyfnI::spc	AG223→AG380 cells
AG403	trpC2 ΔponA ΔltaS::cat ΔyfnI::erm ΔyqgS::spc	4292CA→AG393 cells
AG417	trpC2 Δ3 (ΔpbpD ΔpbpF ΔpbpG::kan)	DPVB45CA→AG105 cells
AG421	trpC2 Δ3 (ΔpbpD ΔpbpF ΔpbpG::kan) amyE::(P_hyspank-mprF spc)	AG304→AG417 cells
AG443	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) ΔugtP::spc	PG253→AG157 cells
AG444	trpC2 ΔponA ΔugtP::spc	PG253→RE101 cells
AG474	trpC2 ΔcwlO::spc	PDC463 (43)→168CA cells
AG475	trpC2 amyE::(P_hyspank-lytE spc)	(P. Dominguez-Cuevas, unpublished strain)→168CA cells
AG484	trpC2 ΔponA amyE::(P_hyspank-lytE spc)	AG475→RE101 cells
AG501	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) amyE::(P_hyspank-lytE spc)	AG475→AG157 cells
AG502	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) ΔmprF::phleo amyE::(P_hyspank-lytE spc)	AG475→AG223 cells
AG506	trpC2 ΔponA ΔgtaB::erm	SM08→RE101 cells
AG547	trpC2 ΔlytE::cat	This study
AG549	trpC2 ΔlytE::cat pLOSS-P_spac-lytE	pLOSS-P_spac-lytE→AG547 cells
AG551	trpC2 pLOSS-P_spac-lytE	pLOSS-P_spac-lytE→168CA cells
AG557	trpC2 ΔponA pLOSS-P_spac-lytE	pLOSS-P_spac-lytE→RE101 cells
AG565	trpC2 ΩlytE-His₁₂::(pMUTin-′lytE erm)	pMUTinHis-'lytE→168CA cells
AG569	trpC2 ΩltaS-His₁₂::(pMUTin-′ltaS erm)	pMUTinHis-'ltaS→168CA cells
AG570	trpC2 ΩyfnI-His₁₂::(pMUTin-′yfnI erm)	pMUTinHis-'yfnI→168CA cells
AG586	trpC2 ΔcwlO::spc ΩlytE-His₁₂::(pMUTin-′lytE erm)	pMUTinHis-'lytE→AG474 cells
AG587	trpC2 ΔponA ΩlytE-His₁₂::(pMUTin-′lytE erm)	AG565→RE101 cells
AG588	trpC2 ΔponA ΩltaS-His₁₂::(pMUTin-′ltaS erm)	AG569→RE101 cells
AG589	trpC2 ΔponA ΩyfnI-His₁₂::(pMUTin-′yfnI erm)	AG570→RE101 cells
AG593	trpC2 ΔyqgS::spc ΔltaS::cat	4292CA→4285CA cells
AG594	trpC2 ΔyfnI::erm ΔltaS::cat	4289CA→4285CA cells
AG595	trpC2 ΔyfnI::erm ΔyqgS::spc	4292CA→4289CA cells
AG600	trpC2 ΔltaS::cat ΔyfnI::erm ΔyqgS::spc	4285CA→AG595 cells
AG614	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) lacA::cat ΔmprF::phleo pLOSS-P_spac-ponA ΔgtaB::erm	SM08→AG210 cells
AG632	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) ΔmprF::phleo ΔugtP::spc	PG253→AG223 cells
AG636	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) lacA::cat ΔmprF::phleo ΔgtaB::erm	AG614 plasmid lost on NA–20 mM MgSO₄ with erm
AG1460	trpC2 Δ3 (ΔpbpD ΔpbpF ΔpbpG::kan) amyE::(P_hyspank-lytE spc)	AG475→AG417 cells
AG1461	trpC2 ΔlytE::cat amyE::(P_hyspank-lytE spc)	AG475→AG547 cells
AG1462	trpC2 ΔltaS::cat amyE::(P_hyspank-lytE spc)	AG475→4285CA cells
AG1463	trpC2 ΔyfnI::erm amyE::(P_hyspank-lytE spc)	AG475→4289CA cells
AG1465	trpC2 Δ4 (ΔponA ΔpbpD ΔpbpF ΔpbpG::kan) ΔltaS::cat amyE::(P_hyspank-lytE spc)	AG475→AG342 cells
AG1466	trpC2 ΔltaS::cat pLOSS-P_spac-lytE	pLOSS-P_spac-lytE→4285CA cells
AG1467	trpC2 ΔyfnI::erm pLOSS-P_spac-lytE	pLOSS-P_spac-lytE→4289CA cells
AG1469	trpC2 ΔltaS::cat ΔyfnI::erm pLOSS-P_spac-lytE	pLOSS-P_spac-lytE→AG594 cells
AG1478	trpC2 ΔmprF::phleo amyE::(P_hyspank-lytE spc)	AG475→AG181 cells
AG1479	trpC2 ΔponA ΔmprF::phleo amyE::(P_hyspank-lytE spc)	AG475→AG193 cells
AG1480	trpC2 ΔponA ΔltaS::cat amyE::(P_hyspank-lytE spc)	AG475→AG383 cells
AG1481	trpC2 ΔmprF::phleo pLOSS-P_spac-lytE	pLOSS-P_spac-lytE→AG181 cells
AG1482	trpC2 ΔponA ΔmprF::phleo pLOSS-P_spac-lytE	pLOSS-P_spac-lytE→AG193 cells
AG1483	trpC2 ΔponA ΔltaS::cat pLOSS-P_spac-lytE	pLOSS-P_spac-lytE→AG383 cells
AG1486	trpC2 ΔmprF::phleo ΩlytE-His₁₂::(pMUTin-′lytE erm)	AG565→AG181 cells
AG1487	trpC2 ΔponA ΔmprF::phleo ΩlytE-His₁₂::(pMUTin-′lytE erm)	AG565→AG193 cells
AG1488	trpC2 ΔponA ΔltaS::cat ΩlytE-His₁₂::(pMUTin-′lytE erm)	AG565→AG383 cells
AG1489	trpC2 ΔltaS::cat ΩlytE-His₁₂::(pMUTin-′lytE erm)	AG565→4285CA cells
AG1490	trpC2 ΔltaS::cat ΔyqgS::erm	4294CA→4285CA cells
AG1491	trpC2 ΔyqgS::cat ΔyfnI::erm	4293CA→4289CA cells
AG1492	trpC2 ΔyqgS::cat amyE::(P_hyspank-lytE spc)	AG475→4293CA cells
AG1493	trpC2 ΔyqgS::cat pLOSS-P_spac-lytE	pLOSS-P_spac-lytE→4293CA cells
AG1497	trpC2 ΔltaS::cat ΔyfnI::erm amyE::(P_hyspank-lytE spc)	AG475→AG594 cells
AG1498	trpC2 ΔltaS::cat ΔyqgS::erm amyE::(P_hyspank-lytE spc)	AG475→AG1490 cells
AG1499	trpC2 ΔyqgS::cat ΔyfnI::erm amyE::(P_hyspank-lytE spc)	AG475→AG1491 cells
AG1500	trpC2 ΔltaS::cat ΔyqgS::erm pLOSS-P_spac-lytE	pLOSS-P_spac-lytE→AG1490 cells
AG1502	trpC2 ΔyqgS::cat ΔyfnI::erm pLOSS-P_spac-lytE	pLOSS-P_spac-lytE→AG1491 cells
AG1535	trpC2 ΔugtP::spc ΩlytE-His₁₂::(pMUTin-′lytE erm)	AG565→PG253 cells
AG1541	trpC2 ΔcwlO::spc ΩlytE-His₁₂::(pMUTin-′lytE erm)	AG565→AG474 cells
AG1581	trpC2 Δmbl::zeo amyE::(P_hyspank-mprF spc)	AK045B→AG304 cells
AG1593	trpC2 ΔmreBH::kan	BGSC strain^c→168CA cells
AG1594	trpC2 ΔugtP::kan	BGSC strain^c→168CA cells
AG1604	trpC2 ΔponA Ωneo ΔmreB	KS36 → RE101 cells
AG1605	trpC2 ΔponA Δmbl::zeo	AK045B→RE101 cells
AG1643	trpC2 ΔugtP::kan amyE::(P_hyspank-lytE spc)	AG1594→AG475 cells
AG1663	trpC2 ΔmprF::kan	BGSC strain^c→168CA cells
AG1667	trpC2 ΔltaS::cat ΔyfnI::erm amyE::(P_hyspank-lytE spc) ΔmprF::kan	AG1663→AG1497 cells
AG1668	trpC2 ΔltaS::cat ΔyqgS::erm amyE::(P_hyspank-lytE spc) ΔmprF::kan	AG1663→AG1498 cells
AG1669	trpC2 ΔyqgS::cat ΔyfnI::erm amyE::(P_hyspank-lytE spc) ΔmprF::kan	AG1663→AG1499 cells
AG1670	trpC2 ΔltaS::cat ΔyfnI::erm amyE::(P_hyspank-lytE spc) ΔugtP::kan	AG1594→AG1497 cells
AG1671	trpC2 ΔltaS::cat ΔyqgS::erm amyE::(P_hyspank-lytE spc) ΔugtP::kan	AG1594→AG1498 cells
AG1672	trpC2 ΔyqgS::cat ΔyfnI::erm amyE::(P_hyspank-lytE spc) ΔugtP::kan	AG1594→AG1499 cells
AG1673	trpC2 ΔltaS::cat ΔyqgS::spc ΔmprF::kan	AG1663→AG593 cells
AG1675	trpC2 ΔyfnI::erm ΔyqgS::spc ΔmprF::kan	AG1663→AG595 cells
AG1684	trpC2 ΔponA ΩlytE-his₁₂::(pMUTin-′lytE erm) amyE::(P_hyspank-mprF spc)	AG304→AG587 cells
AG1685	trpC2 ΔponA ΩlytE-His₁₂::(pMUTin-′lytE erm) ΔugtP::kan	AG1594→AG587 cells
AK045B	trpC2 Δmbl::zeo (168CA background)	H. Strahl’s lab, A. Koh
Dap^R1	DAP-resistant isolate derived from 168 1A1	54
Dap^R20	DAP-resistant isolate derived from 168 1A1	54
DLT71CA	trpC2 dltAB::cat	DLT71 (40)→168CA cells
DPVB45CA	trpC2 ΔpbpG::kan	DPVB45 (80)→168CA
HB15507	Dap^R20 pgsA^WT	54
HB15516	Dap^R1 pgsA^WT	54
K532	trpC2 lacA::cat	D. Claessen, unpublished data
KS36	trpC2 Ωneo ΔmreB	H. Strahl’s lab, K. Seistrup
PG253	trpC2 ΔugtP::spc	P. Gamba, unpublished data
RE101	trpC2 ΔponA	12
RE102	trpC2 ΔpbpF	pG⁺host10::ΔpbpF (12)→168CA cells
RE103	trpC2 ΔpbpD	pG⁺host10::ΔpbpD (12)→168CA cells
RE104	trpC2 ΔponA ΔpbpD	pG⁺host9::ΔponA (12)→RE103 cells
SM08	trpC2 ΔgtaB::erm	S. Moore, unpublished data
SM31	trpC2 ggaAB::spc	S. Moore, unpublished
SM50	trpC2 Ωerm ΔtagE	S. Moore, unpublished
SSB122	trpC2 pgcA (yhxB)::tet	81
SWA11a	trpC2 ΔponA ΔpbpD ΔpbpF lacA::cat mprF::TnYLB-1(kan)	This study
S. aureus
SA113	SA113 (wild type, methicillin sensitive)	T. Palmer, lab collection
SA113 ΔmprF	SA113 ΔmprF::erm	21

Open in a new tab

spc, antibiotic resistance to spectinomycin; kan, antibiotic resistance to kanamycin; erm, antibiotic resistance to erythromycin; neo, antibiotic resistance to neomycin; cat, antibiotic resistance to chloramphenicol; tet, antibiotic resistance to tetracycline; zeo, antibiotic resistance to zeocin; phleo, antibiotic resistance to phleomycin. TnYLB-1(kan) is a transposon that originates from pMarB (Table 1). His₁₂ indicates a coding sequence that corresponds to a His₁₂ tag at the C terminus. P_hyspank and P_spac are IPTG-inducible promoters, with P_hyspank being known to be stronger. Δ indicates a deletion, and Ω indicates an insertion. In this study, the mutations ΔponA ΔpbpD ΔpbpF ΔpbpG::kan and ΔpbpD ΔpbpF ΔpbpG::kan have the simplified annotations Δ4 and Δ3, respectively. Strains KS36, PG253, SM08, SM31 and SM50 were made in the 168CA background.

Arrows indicate how the strain was constructed by transformation using either plasmid DNA or chromosomal DNA (the strain name is then indicated).

BGSC refers to the deletion mutant collection of the Bacillus Genetic Stock Center (82).

TABLE 3.

Primers used in this study

Primer name	Sequence^a	Use(s)^b
oAA01	TTTTTCACCTTAATGCTTTGCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGG	Amplification of pET28a(+)
oAA02	ACCTCGGTGCGAAAAGATTCCACCACCACCACCACCACT	Amplification of pET28a(+)
oAA03	TAAGAAGGAGATATACCATGCAAAGCATTAAGGTGAAAAAAGGCGAC	Amplification of lytE from bases 76–1002
oAA04	CAGTGGTGGTGGTGGTGGTGGAATCTTTTCGCACCGAGGTAACG	Amplification of lytE from bases 76–1002
oAA05	ACGCCGAAACAAGCGCTC	Check the pET28a-lytE-his plasmid
oAA06	GCTAGTTATTGCTCAGCG	Check the pET28a-lytE-his plasmid
oAG18	GTTGACTTTATCTACAAGGT	Check the insert cloned into pLOSS-P_spac-lytE
oAG19	GGTACCAGTAGTTCACCAC	Check the insert cloned into pLOSS-P_spac-lytE
oAG81	GAATCGCCTGGCTCACATCATC	Check B. subtilis mprF::TnYLB-1
oAG82	CGGCAAAGAACAGTCCCAAG	Check B. subtilis mprF::TnYLB-1
oAG103	CCTGTATGTCTGGCACTCAC	Amplification upstream of mprF
oAG104	GCTCTAGATGGTCTCTCCAATCATATTC	Amplification upstream of mprF (EcoRI)
oAG105	CGGAATTCTAAGACGGAGTCTTTTTTTATTTCG	Amplification downstream of mprF (XbaI)
oAG106	CGGAGATGCGAGAGGGTTTC	Amplification downstream of mprF
oAG107	TGCGGCATGCTCATATCCAG	Check B. subtilis ΔmprF
oAG108	TGGGCCAATCAGTGGACAAG	Check B. subtilis ΔmprF
oAG122	GCGTCTGCCTGAAATTAACC	Check B. subtilis Δmbl
oAG123	GCAATCATTGCGGATGTTGC	Check B. subtilis Δmbl
oAG124	CCATCATCTGGTGCGAAAGG	Check B. subtilis ΔponA^c
oAG125	CCGCAAAGCCGATTAATTGG	Check B. subtilis ΔponA^c
oAG126	TCTATTGGCGAGTGCTTC	Check B. subtilis ΔpbpF^c
oAG127	AGCATCGACTCCGTATTG	Check B. subtilis ΔpbpF^c
oAG128	TTATTCGGAATGGCGATGGG	Check B. subtilis ΔpbpD^c
oAG129	CCTTAATGGCTGCAGTTGAC	Check B. subtilis ΔpbpD^c
oAG165	CTAACCTGGCTGACATTCAC	Check B. subtilis gtaB::TnYLB-1
oAG166	TGATCAGGTCTTCGCAGTTG	Check B. subtilis gtaB::TnYLB-1
oAG197	GCTCTAGAGCACCCATTAGTTCAACAAACG	Amplification of cat (XbaI)
oAG198	GCGGATCCAGTACAGTCGGCATTATCTC	Amplification of cat (BamHI)
oAG261	GCCAGTGAATCGCTGGAAAG	Check B. subtilis ΔugtP
oAG262	ATCTGGGAGCACCCGTCAAG	Check B. subtilis ΔugtP
oAG271	GGGGTCGACAAAGGAGATTCCTAGGATGCTGATTAAAAAGAATGCT	Construction of pDR111-P_hyspank-mprF
oAG272	GGGGCATGCTTGATGATATTGAAACCT	Construction of pDR111-P_hyspank-mprF
oAG300	CAATCACGAAACAATAATTGG	Check the insert cloned into pDR111
oAG301	GTTGACTTTATCTACAAGGTG	Check the insert cloned into pDR111
oAG308	GGGGCTAGCAAAGGAGATTCCTAGGATGAAAACATTTATAAAAGAAAGAGG	Construction of pDR111-P_hyspank-ltaS (NheI)
oAG309	CCGGCATGCCCGAATGTGGAATTTGC	Construction of pDR111-P_hyspank-ltaS (SphI)
oAG310	GGGGCTAGCAAAGGAGATTCCTAGGATGAAGAAACTTTTTTCTTACAAAC	Construction of pDR111-P_hyspank-yfnI (NheI)
oAG311	CCGGCATGCTGTAATGATATGAGAGAAAGC	Construction of pDR111-P_hyspank-yfnI (SphI)
oAG312	GGGGCTAGCAAAGGAGATTCCTAGGATGCGAAAAACGTTTTTTTCGAAG	Construction of pDR111-P_hyspank-yqgS (NheI)
oAG313	CCGGCATGCGAAAGCCTCCCGCTCACTTC	Construction of pDR111-P_hyspank-yqgS (SphI)
oAG314	TCGTCCAGTGATTGGTTTCC	Check B. subtilis ΔyfnI
oAG315	GACCGCTTTCATCTCTACCC	Check B. subtilis ΔyfnI
oAG316	CGCCACTTTCTCCCTCATAC	Check B. subtilis ΔltaS
oAG317	GTCAAATCGGGCGGGCAATC	Check B. subtilis ΔltaS
oAG318	CGTATCGAGAGCCGGAGAAC	Check B. subtilis ΔyqgS
oAG319	GAAGCTCTTTGCCGCTATGC	Check B. subtilis ΔyqgS
oAG340	GTCACATGAAGTCAAGACTATT	Check B. subtilis ΔlytE
oAG341	ACGGTTTATCAAGGAAGGACTC	Check B. subtilis ΔlytE
oAG348	GTGGCGGCCGCATGAAAAAGCAAATCATTACAG	Construction of pLOSS-P_spac-lytE (NotI)
oAG349	CCGGGATCCGATTGCCCTTTATGAAAATAAG	Construction of pLOSS-P_spac-lytE (BamHI)
oAG350	GTCTGTGCTTGAGGATAAGG	Amplification upstream of lytE for construction of ΔlytE
oAG351	GGGTCTAGACTGCTGTCGTAGCTGTAATG	Amplification upstream of lytE (XbaI) for construction of ΔlytE
oAG352	CCGGGATCCGCGAAAAGATTCTAATTTTTAG	Amplification downstream of lytE (BamHI) for construction of ΔlytE
oAG353	GATCCGTTTGCGTGTTTC	Amplification downstream of lytE for construction of ΔlytE
oAG354	GGGGAATTCGGCGGAACGACAACTTCAG	Construction of pMUTin-′lytE-his, amplification of the 3′ terminus of ′lytE (no stop codon)
oAG355	GGGCTCGAGGAATCTTTTCGCACCGAGG	Construction of pMUTin-′lytE-his, amplification of the 3′ terminus of ′lytE (no stop codon)
oAG360	GGCGAATTCGATTTATTCTCTAAAGACCACG	Construction of pMUTin-′yfnI-his, amplification of the 3′ terminus of ′yfnI (no stop codon)
oAG361	GGGCTCGAGTTTGATTTCTTTCTCCTTGCCG	Construction of pMUTin-′yfnI-his, amplification of the 3′ terminus of ′yfnI (no stop codon)
oAG366	GGCGAATTCCGAAACGGAGACTTTATTTCAC	Construction of pMUTin-′ltaS-his, amplification of the 3′ terminus of ′ltaS (no stop codon)
oAG367	GGGCTCGAGTTTATCTTCGTTATCCTTTGAC	Construction of pMUTin-′ltaS-his, amplification of the 3′ terminus of ′ltaS (no stop codon)
oAG368	CAAGGTGTGGCATAATGT	Check integration into pMUTinHis
oAG369	GACATCCAGAGGCACTTC	Check integration in pMUTinHis
oAG412	CACCTGGTTTTCTGCTATAGT	Check B. subtilis ΔgtaB
oAG413	GTTTAACTCTACAATCAGTG	Check B. subtilis ΔgtaB
PhleoXbaI-fw	GCTCTAGATCTTCCTTCAGGTTATGAC	Amplification of phleo from pIC22 (XbaI)
PhleoEcoRI-rev	CGAATTCCGCGCCCGATTGCTGAAC	Amplification of phleo from pIC22 (EcoRI)

Open in a new tab

Restriction enzyme sites are in boldface type.

cat, chloramphenicol resistance; phleo, phleomycin resistance cassette. P_spac and P_hyspank are promoters inducible with IPTG, the latter of which is known to be stronger. TnYLB-1 is a transposon associated with kanamycin resistance.

See reference 12.

FIG 2 — MprF alters the cell viability of *B. subtilis* class A PBP and *mbl* mutants. (A) Tenfold spot growth assays of *B. subtilis* strains 168CA (wild type), AG157 (Δ*ponA* Δ*pbpD* Δ*pbpF* Δ*pbpG* [termed Δ4]), AG223 (Δ4 Δ*mprF*), SWA11a (Δ*ponA* Δ*pbpD* Δ*pbpF mprF*::TnYLB-1 lacA), AG417 (Δ*pbpD* Δ*pbpF* Δ*pbpG* [termed Δ3]), RE101 (Δ*ponA*), AG193 (Δ*ponA* Δ*mprF*), and AG181 (Δ*mprF*). NA plates (with 1% glucose) were incubated at 37°C for 24 h, and images were taken. (B) The effect of *mprF* overexpression (MprF↑) was assayed in different strain backgrounds using an IPTG-inducible *mprF* construct. NA plates (with 1% glucose) were incubated at 37°C for 24 h and scanned. The strains tested were AG304 (168CA MprF↑), AG317 (Δ4 MprF↑), AG311 (Δ*ponA* MprF↑), AG421 (Δ3 MprF↑), and AG322 (Δ*mbl* MprF↑). (C) Phase-contrast and membrane dye (FM5-95) microscopy images of *B. subtilis* strains 168CA and AG322 (Δ*mbl* MprF↑) grown in NB with or without IPTG (0.1 mM) to mid-exponential phase at 37°C. Bar, 5 μm (D to G) Transmission electron microscopy (TEM) images showing cross sections of strains 168CA (wild type) (D), AG181 (Δ*mprF*) (E), and AG304 (MprF↑) (F and G) grown in nutrient broth (and IPTG for AG304). Arrows indicate abnormal cell wall structures that seem specific to the MprF↑ strain. All images were taken at a ×15,000 magnification and processed in Fiji with scale bars attached. Strain phenotypes were tested at least three times, and the TEM experiment was carried out one time. Supporting information for this figure is presented in Fig. S1 and Fig. S2A and B in the supplemental material.

FIG S1

Conditional growth of mutants of cell envelope components. (A) Tenfold spot dilution growth assays of B. subtilis strains 168CA (wild type), AG157 (ΔponA ΔpbpD ΔpbpF ΔpbpG [named Δ4]), AG223 (Δ4 ΔmprF), SWA11a (ΔponA ΔpbpD ΔpbpF mprF::TnYLB-1 lacA), AG417 (ΔpbpD ΔpbpF ΔpbpG [named Δ3]), RE101 (ΔponA), AG193 (ΔponA ΔmprF), and AG181 (ΔmprF). Serial dilutions were spotted onto nutrient agar (NA) with or without glucose (1%) (Fig. 2A) as well as onto PAB agar (this figure). Plates were incubated at 37°C for 24 h and imaged. (B) Comparison of the Δ4 and ΔponA mutants in the absence of MprF or LtaS. Strains were streaked from glycerol stocks onto NA plates (supplemented with antibiotics and/or magnesium where required). After incubation at 37°C overnight, a single colony of each strain was then streaked across the set of plates shown at the top (with 0.5% glucose and 10 mM MgSO₄) and scanned after 16 h of incubation at 37°C. The following strains were inoculated: RE101 (ΔponA), AG193 (ΔponA ΔmprF), AG383 (ΔponA ΔltaS), AG157 (Δ4), AG223 (Δ4 ΔmprF), AG342 (Δ4 ΔltaS), AG181 (ΔmprF), 4285CA (ΔltaS), and AG347 (ΔmprF ΔltaS). (C) Cultures of strains grown overnight were diluted back into NB and grown at 37°C in the presence or absence of IPTG (dashed or solid lines, respectively). Growth curves of strains carrying P_hyspank-mprF are displayed as follows: black diamonds, wild-type-like MprF↑ (AG304 strain); red circles, ΔponA MprF↑ (AG311 strain); blue triangles, Δ4 MprF↑ (AG317 strain); green squares, Δmbl MprF↑ (AG322 strain). Download FIG S1, TIF file, 1.9 MB^{(2MB, tif)}.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S2

Conditional growth of strains with magnesium dependence. (A and B) Growth of actin-like mutants in the 168CA background and in the absence of ponA. Strains were streaked from a glycerol stock onto NA plates supplemented with antibiotics and/or magnesium where required. After incubation at 37°C overnight, a single colony of each strain was then streaked across the set of plates (0.5% glucose) shown at the top and scanned after 24 h or 48 h of incubation at 37°C. The following strains obtained in the 168CA background were inoculated: ΔmreB (KS36), Δmbl (AK045B), and ΔmreBH (AG1593) (A) and ΔponA (RE101), ΔponA Δmbl (AG1605), and ΔponA ΔmreB (AG1604) (B). (C) The absence of gtaB or ugtP causes severe growth defects in the absence of ponA. The ΔponA (RE101), ΔugtP (PG253), ΔponA ΔugtP (AG444), and ΔponA ΔgtaB (AG506) strains were prepared as described above for panels A and B and then streaked across a set of plates as shown at the top. Pictures were taken after 24 h and 72 h of incubation at 37°C. Download FIG S2, TIF file, 2.7 MB^{(2.7MB, tif)}.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

In light of these results, we reasoned that if MprF activity is detrimental to the Δ4 mutant, its overexpression should be deleterious to the ΔponA mutant. Consistent with this idea, the overexpression of MprF (MprF↑) was found to be lethal in ponA-deleted strains on NA-glucose (Fig. 2B). In contrast, on NA, both the ΔponA and Δ4 strains grew slowly when mprF overexpression was induced (Fig. 2B), but no obvious effect was observed for the 168CA or Δ3 (ΔpbpD ΔpbpF ΔpbpG) strain. We also observed that the overexpression of mprF caused ΔponA and Δ4 cells to lyse in nutrient broth (NB) (Fig. S1C).

The identification of ΔmprF as a suppressor mutation suggested that an increased negative charge on the membrane could contribute to the rescue of Δ4 growth. However, this seemed to contradict the long-standing hypothetical role of magnesium in altering the cell envelope by neutralizing anionic polymers and/or autolysis activity (1, 5). As it is known that the function of the dlt operon is to add positive charges to LTA, it would be predicted that the loss of Dlt’s function should have a suppression effect on Δ4 strain viability similar to that of the ΔmprF mutation (40, 41). However, the Δ4 ΔdltAB strain was unable to grow on glucose-rich media (data not shown). We also deleted the genes encoding the cardiolipin synthases in the Δ4 mutant to alter the membrane charge and the cellular pool of PGol (Fig. 1B), but the loss of cardiolipin also had no suppressive effect on the Δ4 phenotype (data not shown).

To understand if the effect of MprF was specific to the Δ4 and ΔponA mutants, we altered MprF expression in other known magnesium-dependent mutants, ΔmreB and Δmbl. It should, however, be noted that only the Δmbl strain requires magnesium to be able to grow on an NA plate compared to the ΔmreB strain (Fig. S2A). MreB, Mbl, and MreBH are actin-like isologues that help maintain cell shape by controlling both cell wall synthesis (42) and the major autolytic enzymes CwlO and LytE (Mbl for CwlO and MreB/MreBH for LytE) (43). Interestingly, we identified that MprF overexpression rescued the growth of the Δmbl strain on NA-glucose and NA (Fig. 2B). In addition, the morphological defects associated with this mutation (16) were less pronounced, resulting in wide rod-shaped cells and cell chains that were less often twisted (Fig. 2C).

The suppression of Δmbl lethality by MprF overexpression raised the possibility that MprF plays a role in cell wall metabolism. Interestingly, transmission electron microscopy (TEM) imaging of a strain overexpressing MprF (Fig. 2F and G) showed an increase in cell wall thickness (and cell poles appeared “dented”) and misplaced division septa, consistent with roles in cell wall metabolism and, perhaps, cell division. However, the ΔmprF mutant did not show significant changes in cell morphology (Fig. 2E).

Previous reports showed that the lethality of B. subtilis Δmbl is suppressed by the deletion of the major LTA synthase LtaS (16) and that in an ltaS mutant, the activity of the LTA synthase YfnI results in longer LTA polymers (18). This suggested that the overexpression of MprF in the Δmbl mutant might diminish the cellular level of PGol (through a different pathway [Fig. 1B]) (24) or that MprF functions in LTA synthesis.

Conditional essentiality of UgtP in the absence of MprF and the class A PBPs.

To comprehend the effect of the loss of MprF on a strain lacking aPBPs and identify the MprF suppression pathway, we carried out a transposon screen in a strain lacking the vegetative class A PBPs, mprF, and lacA and carrying pLOSS-P_spac-ponA (strain AG200) (Tables 1 and 2) (12), with the objective of identifying alleles that rendered the maintenance of the plasmid copy of ponA essential. From this screen, strain AG200BK#42 was isolated with the expected phenotype and was found to carry a transposon inserted into the gtaB gene. GtaB catalyzes the cytoplasmic conversion of glucose-1-phosphate (Glc-1-P) to UDP-Glc (Fig. 1), where the latter ultimately contributes to LTA synthesis and WTA modification. The introduction of a gtaB deletion into the Δ4 and Δ4 ΔmprF backgrounds resulted in lethal (NA-glucose) and sick (NA) phenotypes (Fig. 3A), confirming the conditional essentiality of GtaB.

FIG 3 — LtaS causes cell morphogenesis defects in an all-class A PBP mutant. (A) The absence of *gtaB* or *ugtP* causes a severe growth defect in the absence of class A PBPs and MprF. Strains were grown exponentially in NB with 20 mM MgSO₄, washed, and diluted in NB prior to the preparation of a tenfold 1 serial dilution in NB with spotting onto the same NA and NA-glucose (0.5%) plates, which were incubated at 37°C and imaged after 24 h and 45 h. Strains were also spotted onto the same media supplemented with 10 mM MgSO₄ to confirm that all of the strains’ dilution spots could grow; at 17 h of incubation, only the Δ4 Δ*gtaB* and Δ4 Δ*ugtP* strains displayed colonies of smaller sizes at that time point (data not shown). The strains tested were *B. subtilis* 168CA (wild type), PG253 (Δ*ugtP*), SM08 (Δ*gtaB*), AG157 (Δ4), AG290NopLoss (Δ4 Δ*gtaB*), AG443 (Δ4 Δ*ugtP*), AG223 (Δ4 Δ*mprF*), AG636 (Δ*4 lacA* Δ*mprF* Δ*gtaB*), and AG632 (Δ4 Δ*mprF* Δ*ugtP*). (B) Spot dilution growth assays for *B. subtilis* strains 168CA (wild type), AG157 (Δ4), AG342 (Δ4 Δ*ltaS*), AG343 (Δ4 Δ*yfnI*), AG344 (Δ4 Δ*yqgS*), AG370 (Δ4 Δ*ltaS* Δ*yfnI*), AG372 (Δ4 Δ*ltaS* Δ*yqgS*), AG377 (Δ4 Δ*yfnI* Δ*yqgS*), and AG380 (Δ4 Δ*ltaS* Δ*yfnI* Δ*yqgS*). Samples were inoculated onto the same NA plates with or without 1% glucose and incubated at 37°C for 24 h. * indicates that the Δ4 Δ*yfnI* strain was found to pick up suppressor mutations more rapidly than AG342. (C) Tenfold serial dilutions were prepared for *B. subtilis* strains 168CA (wild type), AG223 (Δ4 Δ*mprF*), AG389 (AG223 Δ*ltaS* Δ*yqgS*), AG390 (AG223 Δ*yfnI* Δ*yqgS*), AG399 (AG223 Δ*ltaS* Δ*yfnI*), and AG400 (AG223 Δ*yqgS* Δ*ltaS* Δ*yfnI*) and spotted on the same plates. Plates (with 1% glucose here) were incubated at 37°C and imaged after 24 h. (D) Representative microscopy images of cells of strains from panel B grown in NB at 37°C for 120 min and stained with FM5-95 dye. Bar, 5 μm. The average cell diameters from Table 4 are indicated. * indicates that the cell measurement was done on the straight regions of the cell chain. Strain phenotypes were tested at least three times. Supporting information is presented in Fig. S2C and Fig. S3 in the supplemental material, which also display results obtained in the Δ*ponA* background.

FIG S3

Cell morphology changes associated with deletions of LTA synthase genes combined with class A PBP-null mutants of B. subtilis. (A and B) All of the strains grew exponentially in NB with 10 mM MgSO₄ and were washed and diluted in NB. Strains 168CA, AG157 (Δ4), AG342 (Δ4 ΔltaS), AG377 (Δ4 ΔyfnI ΔyqgS), AG370 (Δ4 ΔltaS ΔyfnI), AG372 (Δ4 ΔltaS ΔyqgS), AG380 (Δ4 ΔltaS ΔyfnI ΔyqgS), and AG223 (Δ4 ΔmprF) (Table 2) were grown for 120 min until mid-exponential phase at 37°C. Cells were stained with FM5-95 dye, and microscopy images were acquired. Cells were measured using the ObjectJ plug-in in ImageJ. About 400 cells were counted for each strain. The results shown here are from data acquired from one experiment only. Due to the formation of twisted cell chains, the cell measurement of the Δ4 ΔltaS ΔyfnI ΔyqgS strain was done on the straight regions of the chain. Distributions of the cell width (A) and cell length (B) are shown. Table 4 indicates the average cell widths and cell lengths of the cell populations analyzed. (C and D) Effects of LTA synthase deletions in the ΔponA background. (C) Tenfold serial dilutions were prepared in NB as described above for strains 168CA, RE101 (ΔponA), AG383 (ΔponA ΔltaS), AG384 (ΔponA ΔyfnI), AG385 (ΔponA ΔyqgS), AG393 (ΔponA ΔltaS ΔyfnI), AG394 (ΔponA ΔltaS ΔyqgS), AG395 (ΔponA ΔyfnI ΔyqgS), and AG403 (ΔponA ΔltaS ΔyfnI ΔyqgS) (Table 2). Plates were incubated at 37°C and imaged at 22 h. (D) The strains described above for panel C were diluted in NB and grown at 37°C for 120 min. When cells reached mid-exponential phase, cell membranes were stained with FM5-95 dye and observed under a microscope. Representative images were assembled using Photoshop. Bar, 5 μm. Download FIG S3, TIF file, 1.6 MB^{(1.7MB, tif)}.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

To determine if this was related to LTA synthesis or WTA modification, we deleted sequentially, in the Δ4 or Δ4/pLOSS-P_spac-ponA background, each enzyme whose function is immediately upstream or downstream of GtaB (Fig. 1B). Characterization of the resulting strains (Table 2) showed that only the deletion of ugtP, encoding the enzyme that produces the Glc₂DAG lipid anchor for LTA, had an effect similar to that of gtaB. The Δ4 ΔmprF ΔugtP mutant was unable to grow on NA-glucose (Fig. 3A), a phenotype common to ΔponA ΔgtaB and ΔponA ΔugtP mutants (Fig. S2C). On NA, the Δ4 ΔgtaB and Δ4 ΔugtP mutants grew very slowly (Fig. 3A, right).

The level of LysPGol is known to increase in ΔugtP cells (24), which could explain the similarity of the phenotypes of the Δ4 ΔugtP and Δ4 MprF↑ mutants (i.e., slow growth on NA) but not the dominant effect of the ΔugtP mutation on the Δ4 ΔmprF mutant. In S. aureus, it has been observed that ΔugtP (ypfP) and ΔgtaB mutants produce long LTAs (32). Those and our results together reinforced the idea that MprF may have a role in LTA synthesis.

The deletion of ltaS improves the conditional lethality of a strain lacking aPBPs.

To verify that LTA synthesis alters Δ4 growth, we analyzed the phenotypes of strains lacking aPBPs and the LTA synthase genes individually or in combination (Fig. 1). Surprisingly, the Δ4 ΔltaS mutant was viable on NA-glucose, even when yfnI or yqgS was also deleted (Fig. 3B). Conversely, strains expressing LtaS showed limited growth and were found to pick up suppressor mutations rapidly on NA-glucose (e.g., Δ4 ΔyfnI and Δ4 ΔyfnI ΔyqgS) (Fig. 3B). Thus, LtaS activity also contributes to the glucose-associated lethality of the Δ4 mutant. Interestingly, the absence of MprF is more advantageous to the Δ4 mutant than the absence of LtaS, as it results in faster growth and larger colonies on NA-glucose (Fig. S1B). This phenotypic difference indicated that slightly different mechanisms helped restore the growth of the Δ4 mutant.

To test this, the LTA synthase genes were systematically deleted in the Δ4 ΔmprF (AG223) background, and the viability of the mutants generated was determined on NA with or without glucose. All of the strains remained viable on NA-glucose (Fig. 3C), suggesting that the effect of the loss of MprF could be related to LTA. In addition, in the Δ4 ΔmprF background, the combined absence of ltaS and yfnI delayed growth on NA-glucose, resulting in a phenotype similar to that observed on NA (Fig. 3C). Thus, in these specific genetic backgrounds, LTA synthesis is not essential but permits higher growth efficiencies.

The absence of neither LtaS nor MprF had any effect on the filamentous thin-cell morphology of the Δ4 mutant (Table 4 and Fig. S3A and B). In the absence of all three LTA synthases, B. subtilis is viable, but the cells are filamentous and clumpy (16). We also observed that the combined absence of LtaS, YfnI, and/or YqgS in the Δ4, ΔponA, or Δ4 ΔmprF genetic background led to an increase in the cell diameter, although cells remained linked at the site of division (Fig. 3D, Table 4, and Fig. S3A and B). However, when LtaS was the only functional LTA synthase (e.g., Δ4 ΔyqgS ΔyfnI) (Fig. 3D), cells were thin and comparable to those of the Δ4 and ΔponA mutants (Fig. S3C and D). Collectively, our results indicate that the activity of the LTA synthases, particularly LtaS, could account for the Δ4 phenotype.

TABLE 4.

Cell morphogenesis changes associated with deletions of LTA synthase genes combined with class A PBP-null mutants of B. subtilis^a

Strain	Cell width (μm)		Cell length (μm)		No. of cells counted
Strain	Avg	SD	Avg	SD	No. of cells counted
168CA	0.8399	0.0469	3.258	0.787	437
Δ4	0.6595	0.0492	4.557	2.075	419
Δ4 ΔmprF	0.6793	0.0546	4.659	2.18	399
Δ4 ΔltaS	0.6679	0.055	4.828	2.325	414
Δ4 ΔltaS ΔyfnI	0.7269	0.0528	4.873	2.24	426
Δ4 ΔltaS ΔyqgS	0.756	0.0499	4.926	2.301	420
Δ4 ΔyfnI ΔyqgS	0.6538	0.0513	4.813	1.926	423
Δ4 ΔltaS ΔyfnI ΔyqgS^b	0.7666	0.0529	5.312	2.651	416

Open in a new tab

The average cell widths and cell lengths of strains 168CA, AG157 (Δ4), AG342 (Δ4 ΔltaS), AG377 (Δ4 ΔyfnI ΔyqgS), AG370 (Δ4 ΔltaS ΔyfnI), AG372 (Δ4 ΔltaS ΔyqgS), AG380 (Δ4 ΔltaS ΔyfnI ΔyqgS), and AG223 (Δ4 ΔmprF) are analyzed in Fig. S3A and B in the supplemental material. Standard deviations are indicated.

Due to the formation of twisted cell chains, the cell measurement of the Δ4 ΔltaS ΔyfnI ΔyqgS strain was done on the straight regions of the chain.

Impact of glucose, PBP1, and MprF on LTA synthesis.

To comprehend the effects of LtaS, MprF, and UgtP in the absence of aPBPs, we decided to analyze LTA production. We developed a Western blot protocol relying on a monoclonal antibody for Gram-positive LTA (Thermo Fisher) and a polyclonal PBP2B antibody (as a control). First, we determined the LTA profiles for B. subtilis wild-type (WT) strain 168CA and the LTA synthase mutants (Fig. 4A and Fig. S4) grown in NB and NB-glucose (0.2%). The wild-type LTA signal corresponded to a range of mobilities between 7 and 17 kDa, as previously identified (18). Interestingly, the LTA signal in ΔltaS cells grown in NB-glucose (>15 kDa) (Fig. 4A, left, 2nd lane) was distinct from that seen for growth in NB (7 to 32 kDa) (Fig. 4A, right, 2nd lane). However, the LTA pattern was different when YfnI was the only functional LTA synthase (Fig. 4A). This analysis also revealed that short LTAs (<10 kDa) were more abundantly produced in NB-glucose. This seemed to be related to LtaS activity, as we observed an increase in short LTAs in the ΔyfnI and ΔyfnI ΔyqgS mutants compared to 168CA (Fig. 4A, left, 3rd and 5th lanes). Collectively, our results show that the regulation of LTA synthesis is more complex than previously thought (18) as it is influenced by the metabolic/nutritional status of the cells.

FIG S4

Results of three independent LTA Western blot assays supporting the data in Fig. 4A. The lower part of the membrane was probed using a monoclonal LTA antibody and an HRP-linked anti-mouse antibody. The other membrane part was probed using polyclonal anti-PBP2B and HRP-linked anti-rabbit antibodies to provide a sample loading control. Samples were prepared from B. subtilis strains 168CA (wild type), 4285CA (ΔltaS), 4289CA (ΔyfnI), 4292CA (ΔyqgS), AG595 (ΔyfnI ΔyqgS), AG593 (ΔltaS ΔyqgS), AG594 (ΔltaS ΔyfnI), AG600 (ΔltaS ΔyfnI ΔyqgS), and 4620 (ΔltaS ΔyfnI ΔyqgS ΔyvgJ [denoted ΔLTA here]). Download FIG S4, TIF file, 1.3 MB^{(1.3MB, tif)}.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S5

Results of three independent LTA Western blot assays supporting the data in Fig. 4B. (A to C) The lower part of the membrane was probed using a monoclonal LTA antibody and an HRP-linked anti-mouse antibody. The other membrane part was probed using polyclonal anti-PBP2B and HRP-linked anti-rabbit antibodies to provide a sample loading control. Samples were prepared from B. subtilis strains 168CA (wild type), AG417 (ΔpbpD ΔpbpF ΔpbpG), RE101 (ΔponA), AG181 (ΔmprF), AG193 (ΔponA ΔmprF), AG304 (MprF↑), AG311 (ΔponA MprF↑), 4261CA (Δmbl), and AG322 (Δmbl MprF↑). (D) The LTA signals of some of the strains grown with glucose are represented as densitometry graphs below their corresponding LTA blots. Analysis was done for each biological replicate presented in either Fig. 4B (panel B) or panels A and C in this figure. Raw blot images were analyzed using ImageJ software and the “analysis gels” function after a same-sized area was defined for each lane. The dashed lines provide guidelines to help compare the shifts of LTA lengths between samples relative to the wild type. Download FIG S5, TIF file, 13.1 MB^{(13.5MB, tif)}.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S6

Results of three independent LTA Western blot assays supporting the data in Fig. 4C. The lower part of the membrane was probed using a monoclonal LTA antibody and an HRP-linked anti-mouse antibody. The other membrane part was probed using polyclonal anti-PBP2B and HRP-linked anti-rabbit antibodies to provide a sample loading control. Samples were extracted from B. subtilis strains 168CA, 4285CA (ΔltaS), AG383 (ΔltaS ΔponA), PG253 (ΔugtP), and AG444 (ΔugtP ΔponA). Download FIG S6, TIF file, 0.9 MB^{(977.9KB, tif)}.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

If the mprF mutation suppressed the ΔponA phenotype by altering LTA synthesis (Fig. 2A and Fig. S1B), a change in the LTA profile might be detectable. To test this, we used the ΔponA mutant, where only the major aPBP was deleted, as the multiple-aPBP-deletion strain was very lytic and did not grow under certain conditions (Fig. S1). Western blot analysis of ΔponA cells grown in the presence of glucose at 0.2% (Fig. 4B, left, 3rd lane) revealed a shift toward shorter LTAs than those of the wild type (Fig. S5D). This increase in short LTAs was not evident in the absence of glucose. Interestingly, the LTA signal of the ΔponA ΔmprF mutant decreased compared to that of the ΔponA mutant (Fig. 4B, left, 5th lane), and the ΔmprF mutant (Fig. 4B, left, 4th lane) showed a decrease in the LTA signal compared to that of 168CA in NB-glucose (Fig. S5D). In the absence of mprF, both strains had a reduction in the LTA length (Fig. S5D). We next examined the effects of mprF overexpression (MprF↑) (Fig. 4B, 6th lane), and we were surprised to see increases in the LTA polymer length and range (Fig. S5D). This effect was dependent on LtaS but not YfnI, as a similar LTA profile was observed for the ΔyfnI MprF↑ strain, while the profile of the ΔltaS MprF↑ strain was similar to that of the ΔltaS strain (strains AG353 and AG349 in Table 2) (data not shown). The latter was expected as LtaS activity seems dominant over YfnI activity (18). The overexpression of mprF in ΔponA cells resulted in a broader size range of LTAs than that seen for the wild type and the ΔponA mutant, as we observed an increase in the LTA signals below 10 kDa but also above 15 kDa (Fig. 4B, and Fig. S5D 7th lanes). To some extent, this resembled what was observed in the ΔponA and MprF↑ single mutants except that the LTA polymers of the ΔponA MprF↑ mutant were not as long as those of the MprF↑ single mutant (Fig. S5D). Thus, the cumulative effect of the mutations led to an increase in the LTA length range and could explain the lethality of the ΔponA MprF↑ double mutant on NA-glucose-IPTG (isopropyl-β-d-thiogalactopyranoside) (Fig. 2B).

In contrast to the ΔponA mutant, the overexpression of mprF in the Δmbl mutant rescued its growth (Fig. 2B). To see whether this viability was associated with a change in the LTA profile, we analyzed the two strains by Western blotting. The LTA size range of the Δmbl mutant was shifted toward shorter LTAs, and the overall LTA signal was weaker than that of the wild type (Fig. 4B, and Fig. S5D second to last lanes). The overexpression of mprF in the Δmbl mutant resulted in increases in both the LTA length and abundance (Fig. 4B, last lane). Longer LTA polymers, similar to those of the ΔltaS mutant (Fig. 4A), were also observed in the Δmbl ΔltaS mutant (data not shown). Thus, an increase in the LTA length seems to characterize the effects of both Δmbl suppressor mutations, suggesting that the presence of short and/or less abundant LTAs could be a factor contributing to the growth defect of the Δmbl mutant.

Analysis of the ΔltaS ΔponA mutant revealed the dominance of the ltaS deletion in that the LTAs exhibited retarded migration (Fig. 4C and Fig. S6, 3rd lanes) similar to that observed for the ΔltaS mutant (Fig. 4C). In the absence of UgtP, which produces a lipid anchor, Glc₂DAG (Fig. 1), we observed an increase in the LTA length in both media, but the shift was more distinct with glucose (>12 kDa) (Fig. 4C, left, 4th lane). The latter is comparable to the LTA signal detected previously by Gründling and Schneewind (32) for the S. aureus ΔugtP mutant, which showed an LTA size range higher than that of the wild type when grown in tryptic soy broth (TSB), a glucose-rich medium. Analysis of the ΔponA ΔugtP mutant, which was conditionally lethal on NA-glucose (Fig. S2C), revealed increases in both the LTA signal and length (7 to 25 kDa) (Fig. 4C, left, 5th lane), a pattern reminiscent of that determined for the ΔponA MprF↑ strain (Fig. 4B, left, 7th lane), which was also lethal on NA-glucose (Fig. 2B).

To conclude, we show for the first time that MprF has a role in altering the length of LTAs through an LtaS-dependent mechanism and has an impact on cell wall metabolism. Our results also provide strong evidence that the conditions leading to the lethality of ponA are associated with increases in the abundance and length of LTAs.

Overexpression of the major autolysin LytE is lethal in the absence of PBP1 or LtaS.

Our results implied that the conditional lethality of the aPBP mutants might be linked to an interplay between the LTA length and autolysin activity. Autolysins or cell wall hydrolases help shape and recycle the peptidoglycan during cell elongation and division. B. subtilis expresses a large number of them, but only the loss of both of the PG d,l-endopeptidases CwlO and LytE is lethal (13, 14, 44 –46) (Fig. 1A). We focused on LytE because it is considered to be one of the key autolysins, and it is secreted and thought to be anchored to the lateral cell wall and septum in a way that is influenced by teichoic acids (43). The abundance of LytE is also increased in a ΔltaS mutant (47), and both LtaS and LytE affect colony development (48) and cell diameter (16, 43).

We reasoned that if an imbalance of LytE activity existed in the aPBP mutants (Δ4 and ΔponA) grown in glucose-rich medium, then a deliberate increase in LytE expression should exacerbate the strain phenotype, leading to cell death. Interestingly, lytE overexpression (by IPTG induction of a P_hyspank-lytE allele) was lethal in both the Δ4 and ΔponA backgrounds when cells were grown on NA-glucose (Fig. 5A and Fig. S7A), and it significantly delayed their growth on NA but not that of the Δ3 ponA⁺ strain. This result confirmed that an imbalance in autolytic activity was detrimental to the cells that had lost PBP1. Importantly, the overexpression of lytE in the Δ4 ΔltaS, ΔponA ΔltaS, and ΔltaS strains was also lethal (Fig. 5A), while the growth of the ΔponA ΔmprF strain was only slightly delayed. The ΔmprF single mutant was also unaffected by lytE overexpression. In contrast, the Δ4 ΔmprF mutant was viable when lytE was overexpressed, although its growth was severely perturbed on glucose.

FIG 5 — LytE overexpression is conditionally lethal in the absence of PBP1 or LtaS. (A) *lytE* overexpression was analyzed in strains that integrated IPTG-inducible *P_hyspank-lytE* at the *amyE* locus (in the presence of 0.1 mM IPTG), represented as LytE↑ here. The following tested strains with relevant features are shown: AG484 (Δ*ponA* LytE↑), AG1460 (Δ*3 ponA*⁺ LytE↑), AG501 (Δ4 LytE↑), AG502 (Δ4 Δ*mprF* LytE↑), AG1465 (Δ4 Δ*ltaS* LytE↑), AG1478 (Δ*mprF* LytE↑), AG1479 (Δ*ponA* Δ*mprF* LytE↑), AG1462 (Δ*ltaS* LytE↑), AG1480 (Δ*ponA* Δ*ltaS* LytE↑), AG1497 (Δ*ltaS* Δ*yfnI* LytE↑), AG1498 (Δ*ltaS* Δ*yqgS* LytE↑), and AG1499 (Δ*yqgS* Δ*yfnI* LytE↑). The following strains that did not display any obvious phenotype are not represented here: AG475 (168CA LytE↑), AG1461 (Δ*lytE* LytE↑), AG1463 (Δ*yfnI* LytE↑), and AG1492 (Δ*yqgS* LytE↑). Plates (with 0.5% glucose here) were incubated at 37°C and scanned after 24 h (this figure) and 48 h (see Fig. S7A in the supplemental material). (B) Strains AG1481 (Δ*mprF* pLOSS-*P_spac-lytE*) and AG551 (168CA carrying pLOSS-*P_spac-lytE*) were streaked onto NA and NA-glucose (0.5%) supplemented with IPTG (1 mM) and X-Gal from a fresh colony on NA-spectinomycin. Plates were incubated at 37°C and scanned after 24 h. Blue colonies indicate the stabilization of plasmid pLOSS-*P_spac-lytE* in the Δ*mprF* strain. Grayscale images are shown here to help visualize white colonies. (C) Detection of LytE-His₁₂ and PBP2B by Western blotting. For simplification, only the relevant background features are displayed for the following strains (expressing LytE-His₁₂ under the control of its native promoter): wild-type-like AG565 (WT*), AG587 (Δ*ponA*), AG1486 (Δ*mprF*), AG1487 (Δ*ponA* Δ*mprF*), AG1489 (Δ*ltaS*), AG1488 (Δ*ponA* Δ*ltaS*), AG1535 (Δ*ugtP*), and AG1541 (Δ*cwlO*). In addition, *B. subtilis* 168CA was grown in parallel (without antibiotics) and used here as a negative control for the LytE blot. The membrane was split and incubated with either monoclonal penta-His and HRP-linked anti-mouse antibodies or polyclonal anti-PBP2B and HRP-linked anti-rabbit antibodies. Note that a “ladder” sample loaded after the NB-glucose (0.2%) sample set is not displayed, and the image editing is symbolized by the vertical black line (see the original in Fig. S7B, middle). (D) Detection of the LTA synthases LtaS/YfnI and PBP2B by Western blotting. The samples used in the experiment in panel C were loaded onto a new SDS gel, and Western blotting was carried out with polyclonal anti-LtaS (able to detect YfnI [J. Errington, unpublished data]), polyclonal anti-PBP2B, and HRP-linked anti-rabbit antibodies. The results from one representative set of three independent Western blot experiments are shown here and in Fig. S7B and Fig. S8A. Additional supporting information is presented in Fig. S8 and Fig. S9. In each section, samples were derived from the same experiment.

FIG S7

Abundance of LytE in the cell envelope and growth characteristics of the strains. (A) LytE overexpression is conditionally lethal in the absence of PBP1 or LtaS. lytE overexpression was analyzed in strains that integrated IPTG-inducible P_hyspank-lytE at the amyE locus, represented here as LytE↑. The following strains with relevant features were tested: AG484 (ΔponA LytE↑), AG1460 (Δ3 ponA⁺ LytE↑), AG501 (Δ4 LytE↑), AG502 (Δ4 ΔmprF LytE↑), AG1465 (Δ4 ΔltaS LytE↑), AG1478 (ΔmprF LytE↑), AG1479 (ΔponA ΔmprF LytE↑), AG1462 (ΔltaS LytE↑), AG1480 (ΔponA ΔltaS LytE↑), AG1497 (ΔltaS ΔyfnI LytE↑), AG1498 (ΔltaS ΔyqgS LytE↑), and AG1499 (ΔyqgS ΔyfnI LytE↑). The following strains that did not display any obvious phenotype are not represented here: AG475 (168CA LytE↑), AG1461 (ΔlytE LytE↑), AG1463 (ΔyfnI LytE↑), and AG1492 (ΔyqgS LytE↑). NA plates were supplemented with IPTG (0.1 mM), glucose (Glc) (0.5%), and MgSO₄ (10 mM). Plates were incubated at 37°C and scanned after 24 h (Fig. 5A) and 48 h. (B) Results of three independent experiments supporting the data in Fig. 5C. The relative abundances of the LytE and PBP2B proteins in mutant strains were detected by Western blotting. Strains expressing LytE-His₁₂ under the control of its native promoter were grown in NB and NB supplemented with 0.2% glucose until the late exponential growth phase at 37°C. For simplification, only the following strains with relevant background features are displayed: wild-type-like AG565 (WT*), AG587 (ΔponA), AG1486 (ΔmprF), AG1487 (ΔponA ΔmprF), AG1489 (ΔltaS), AG1488 (ΔponA ΔltaS), AG1535 (ΔugtP), and AG1541 (ΔcwlO). In addition, wild-type strain 168CA (i.e., not expressing LytE-His₁₂) was grown in parallel and used here as a negative control for the LytE blot. The bottom part of the membrane (split at the ~53-kDa position) was incubated with monoclonal penta-His and HRP-linked anti-mouse antibodies. The top membrane part was detected with polyclonal anti-PBP2B and HRP-linked anti-rabbit antibodies. #For each section, the middle panel corresponds to the raw image of the LytE-His₁₂ blot at a detection time where one of the sample signals had reached saturation. Download FIG S7, TIF file, 2.1 MB^{(2.1MB, tif)}.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S8

Data supporting the results in Fig. 5. (A) Results of three independent experiments supporting the data in Fig. 5D. The relative abundances of the LTA synthases LtaS, YfnI, and PBP2B in mutant strains were determined by Western blotting. The samples used in Fig. S7B were loaded onto a new SDS gel, and the Western blot was developed with polyclonal anti-LtaS (which cross-reacts with YfnI [Errington, unpublished]), polyclonal anti-PBP2B, and HRP-linked anti-rabbit antibodies. A weak nonspecific protein band was observed between PBP2B and LtaS and was detected by the anti-PBP2B antibody. Strains expressing LytE-His₁₂ under the control of its native promoter were grown in NB and NB supplemented with glucose (0.2%) until late exponential phase at 37°C. For simplification, only the following strains with relevant background features are displayed: 168CA, wild-type-like AG565 (WT*), AG587 (ΔponA), AG1486 (ΔmprF), AG1487 (ΔponA ΔmprF), AG1489 (ΔltaS), AG1488 (ΔponA ΔltaS), AG1535 (ΔugtP), and AG1541 (ΔcwlO). (B) Accumulation of LtaS-His and YfnI-His in ΔponA cells. Strains were grown in NB and NB supplemented with 0.2% glucose until the late exponential growth phase at 37°C. The strains were tested once under conditions similar to those for the protein Western blots presented in this study, following a preliminary test. *The strains used here express the following His-tagged proteins under the control of their native promoters: LtaS-His₁₂ in a wild-type-like (AG569) or a ΔponA (AG588) background and YfnI-His₁₂ in a wild-type-like (WT) (AG570 strain) or a ΔponA (AG589) background. His-tagged proteins were detected with monoclonal penta-His and HRP-linked anti-mouse antibodies. The membrane was reused to detect PBP2B (sample loading control) with polyclonal anti-PBP2B and HRP-linked anti-rabbit antibodies (second panel). The experiment was performed on one biological set of samples. (C) Accumulation of LtaS/YfnI and LytE in LTA synthase mutants. The following strains were grown (NB with or without 0.2% glucose) under conditions similar to those of our previous assays: B. subtilis 168CA, 4285CA (ΔltaS), 4289CA (ΔyfnI), 4292CA (ΔyqgS), AG595 (ΔyqgS ΔyfnI), AG593 (ΔltaS ΔyqgS), AG594 (ΔltaS ΔyfnI), and AG600 (ΔltaS ΔyfnI ΔyqgS). Here, the Western blot experiments were carried out under the same conditions as those of the other assays (polyclonal anti-LtaS antibody cross-reacts with YfnI [Errington, unpublished]) (A), except for the use of our newly produced polyclonal anti-LytE antibody (C). The experiment was performed on one biological set of samples. Download FIG S8, TIF file, 1.0 MB^{(1MB, tif)}.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S9

Effect of magnesium in culture medium on the production of LytE and LtaS and the accumulation of LtaS/YfnI and LytE in the synthetically sick ΔponA MprF↑ and ΔponA ΔugtP strains. Detection of LytE-His₁₂ and PBP2B was performed by Western blotting. Strains expressing LytE-His₁₂ under the control of its native promoter were grown in NB supplemented with 0.2% glucose with or without MgSO₄ (10 mM) at 37°C. For simplification, here, only the following strains with the relevant background features are displayed: wild-type-like AG565 (WT*), AG587 (ΔponA), AG1487 (ΔponA ΔmprF), AG1488 (ΔponA ΔltaS), AG1541 (ΔcwlO), AG1684 (ΔponA MprF↑), and AG1685 (ΔponA ΔugtP). The last two strains were also grown in parallel in NB. The top membrane part was incubated with polyclonal anti-LtaS (which cross-reacts with YfnI [Errington, unpublished]), polyclonal anti-PBP2B, and HRP-linked anti-rabbit antibodies. The bottom part of the membrane was incubated with monoclonal penta-His and HRP-linked anti-mouse antibodies. Images were processed using ImageJ software. The results of three independent experiments are presented here. Download FIG S9, TIF file, 0.6 MB^{(623.2KB, tif)}.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

These observations suggested that the ΔponA ΔltaS and ΔponA ΔmprF double mutants, which have different LTA length ranges, were differently sensitive to LytE activity. Therefore, we examined the LTA synthase double mutants to see how they reacted to an increase in lytE expression. We found that when lytE was overexpressed, the LTA synthase double mutants were viable only if ltaS was still present (Fig. 5A, bottom strain), and the deletion of mprF or ugtP from these mutants had no effect on strain viability (Table 2 and data not shown). Interestingly, the ΔltaS LytE↑ mutant was viable on NA (Fig. 5A, 8th strain) but not on NA-glucose, which is probably related to the above-described observation that the ΔltaS mutant produced LTAs of different lengths on these two media (Fig. 4A). Thus, it is clear that the activity of LtaS is required for the cell to balance the effect of lytE overexpression, presumably by producing LTAs of a specific length.

To comprehend the apparent tolerance of LtaS⁺ and ΔmprF cells to LytE overexpression, we constructed an unstable replicon plasmid, pLOSS-P_spac-lytE, which expresses lytE at a lower level than P_hyspank-lytE (Table 1). This plasmid will be retained by the cell only if lytE expression benefits the cells. In the ΔmprF mutant (AG1481 strain), the pLOSS-P_spac-lytE plasmid was retained under all medium conditions tested, including elevated magnesium levels, as indicated by the blue color of the colonies on plates supplemented with IPTG–X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside) (Fig. 5B). However, in the other strains tested (e.g., 168CA, ΔponA, ΔponA ΔmprF, and LTA synthase mutants) (Table 2), the plasmid was frequently lost, an indication that there was no selective advantage for the cells to maintain the plasmid. At this stage, it is unclear if the ΔmprF strain’s tolerance of lytE overexpression is due to the loss of aaPGols, the production of shorter LTAs, or both.

LTA influences LytE activity.

The conditional lethality observed when lytE was overexpressed prompted us to investigate the cellular levels of this autolytic enzyme in our strains. First, we constructed strains that could express a recombinant protein, LytE-LEMGRSH₁₂ (using pMUTin-′lytE-his) (Table 1), and then analyzed the total lysates by Western blotting using an antihistidine antibody (for LytE) (Fig. 5C and Fig. S7B) and an anti-LtaS antibody raised against LtaS (74 kDa) that cross-reacts with YfnI (73 kDa) (Fig. 5D and Fig. S8A). These analyses showed that LytE and LtaS/YfnI accumulated in ΔponA cells, particularly when grown in the presence of glucose (Fig. 5C and D). Next, using a set of strains that carried either pMUTin-′ltaS-his or pMUTin-′yfnI-his integrated into the genome, we could confirm that both LtaS and YfnI were more abundant in ΔponA cells (Tables 1 to 3 and Fig. S8B).

Importantly, in the ΔponA ΔmprF strain, the LytE and LtaS/YfnI protein levels were lower than those in the ΔponA strain (Fig. 5C and D), but no obvious change was observed in the ΔmprF mutant compared to the wild-type background expressing the LytE-LEMGRSH12 protein (denoted as WT*). On the contrary, analysis of the lytic ΔponA MprF↑ and ΔponA ΔugtP strains cultured in either NB or NB-glucose showed that there were increased levels of LtaS/YfnI compared to those in the ΔponA strain (Fig. S9B and C, 6 and 7th lanes). LytE was also more abundant in the ΔponA ΔugtP and ΔponA MprF↑ mutants than in the wild type.

Finally, both the ΔltaS and ΔponA ΔltaS mutants exhibited increases in the levels of both LytE and YfnI when grown in NB-glucose, an effect that was more pronounced for the ΔponA ΔltaS mutant (Fig. 5C and D, left). Therefore, in the absence of LtaS, the abundance of LytE increased. In addition, analysis of the set of LTA synthase mutants (Fig. S8C) revealed that the levels of LtaS/YfnI were increased in the presence of glucose; the level of LtaS was also increased significantly in the absence of YfnI. Therefore, our observations are consistent with the idea that the altered abundances of LytE and LtaS/YfnI proteins in ΔponA cells were associated with the sick phenotype.

Taken together, our results show a correlation between the LTA length and the LytE abundance in the cell, which suggests that LTA acts to moderate cell wall metabolism through LytE. In ponA mutants, this function is unbalanced such that the activity of LytE, and, therefore, cell wall degradation, is predominant (summarized in Fig. 7).

FIG 7 — Summary of the alterations in LTA and LytE levels associated with the conditional lethality of the Δ*ltaS* and Δ*ponA* mutants. (A) The overexpression of *lytE* (inducible) in the LTA synthase double mutants is lethal except when the major LTA synthase LtaS is functional. The presence of a distinct LTA length is presented by the mutant strains (Fig. 4A and Fig. 5A). (B) In glucose, the viability and lethality of mutants in the Δ*ponA* background were associated with distinct LTA, LytE, and LtaS/YfnI levels (Fig. 2A and B, Fig. 3A, Fig. 4B and C, and Fig. 5A, C, and D). * indicates that the overexpression of *lytE* (inducible) is lethal to the Δ*ponA* mutant but not the Δ*ponA* Δ*mprF* mutant (Fig. 5A). Strains with the ability to grow without significant delays are referred to as viable (green text in the cell). Lethal refers to the absence of the growth of the mutant on NA or under the specified conditions (dashed cell with red text). In these cases, analysis of the strains was done by shifting cultures to nonpermissive conditions (e.g., low magnesium and the addition of glucose or an inducer). Arrows indicate an increase (↑) or a decrease (↓) in the specified factor. Here, it is assumed that the strength of the LTA signal observed by Western blotting is proportional to the abundance.

LTA production is altered in S. aureus ΔmprF and is an important factor in the sensitivity of B. subtilis to daptomycin.

MprF is conserved in the Firmicutes and has been shown to contribute to S. aureus pathogenicity (21, 22). Importantly, studies of clinical isolates have found that methicillin-resistant S. aureus (MRSA) strains that have acquired resistance to daptomycin, a lipopeptide antibiotic that acts to interfere with membranes containing phosphatidylglycerol (26, 49 –51), frequently carry single nucleotide polymorphisms (SNPs) in the mprF gene (52, 53). Although some mprF SNPs were associated with an MprF gain of activity (increasing LysPGol and reducing PGol), others had no clear correlation between the phospholipid composition and the relative surface charge of the cell (26). In light of our results, we asked whether the newly discovered role of MprF in LTA production is conserved in S. aureus and whether this might contribute to DAP resistance (Dap^R). Analysis of LTA production in a methicillin-sensitive S. aureus mprF mutant showed that the LTAs migrated faster than those of wild-type strain SA113 (Fig. 6A and Fig. S10A). However, when exposed to daptomycin, the length and production of LTAs increased in both S. aureus ΔmprF and wild-type strains (samples treated with 0.25 and 0.5 μg/mL DAP, respectively) (Fig. S10B and C). It is also noteworthy that even when exposed to DAP, the LTAs produced by the wild type remained longer than those of the ΔmprF mutant, which perhaps indicates that the LTA length plays a role in DAP sensitivity. This effect was observed at DAP concentrations that did not significantly impact wild-type growth (Fig. S10E) but significantly impaired the growth of the mprF mutant (Fig. S10D and E), as previously reported (52, 53). These results are consistent with the idea that the role of MprF in modulating LTA production is conserved in both Bacillus and Staphylococcus species, with a change in the nature and/or production of LTAs (rather than an alteration in membrane properties) being associated with DAP resistance.

FIG 6 — Daptomycin resistance and LTA synthesis in *B. subtilis* and *S. aureus*. (A) Samples of methicillin-sensitive *Staphylococcus aureus* strains SA113 and SA113 Δ*mprF* (21) were probed for LTA by Western blotting. (B) Researchers identified that a modified allele of *pgsA*, *pgsA^A64V*, was the major determinant of the daptomycin resistance of the *B. subtilis* Dap^R1 and Dap^R20 strains selected by serial daptomycin antibiotic passages (54). (Top and middle) Strains 168 1A1 (wild type [WT]), Dap^R1, Dap^R20, HB15516 (Dap^R1 *pgsA*^WT), and HB15507 (Dap^R20 *pgsA*^WT) were grown in NB overnight at 30°C, and LTA was detected (top) along with PBP2B (middle) by Western blotting. Analysis of the samples grown exponentially at 37°C using these cultures grown overnight is presented in Fig. S10F in the supplemental material. (Bottom) Cellular abundance of the LTA synthase detected with an anti-LtaS antibody (which also cross-reacts with YfnI [Errington, unpublished]). Here, the samples were normalized based on the previous PBP2B blot (middle) (blotted as described in the legend of Fig. 5D). The results from one representative set of three experiments are shown here and in Fig. S10F. (C) The absence of the LTA synthase LtaS increases the susceptibility of *B. subtilis* to daptomycin. DAP strip assays (Liofilchem) on NA-CaCl₂ plates were carried out on *B. subtilis* strains 168CA (wild type), AG600 (Δ*ltaS* Δ*yfnI* Δ*yqgS* [denoted No LTA]), AG593 (Δ*ltaS* Δ*yqgS*), AG594 (Δ*ltaS* Δ*yfnI*), AG595 (Δ*yfnI* Δ*yqgS* [denoted LtaS-only]), AG1673 (Δ*ltaS* Δ*yqgS* Δ*mprF*), AG1675 (Δ*yfnI* Δ*yqgS* Δ*mprF*), and AG1663 (Δ*mprF*). Plates were incubated at 37°C and scanned after 24 h (illustrations at the top). The table represents the averages from at least two independent experiments except for the Δ*mprF* strain (*). Additional supporting information is presented in Fig. S10.

FIG S10

Effects of Ca²⁺-daptomycin on growth and LTA production in B. subtilis and S. aureus. (A) Samples of methicillin-sensitive Staphylococcus aureus strains SA113 and SA113 ΔmprF (Table 2) were probed for LTA by Western blotting. Three independent sets of cultures grown in LB medium at 37°C were tested simultaneously. (B) S. aureus strains SA113 and SA113 ΔmprF were initially grown exponentially for 3 h, after which calcium-daptomycin (DAP) or calcium only (1.25 mM final concentration) was added to the culture for an hour. The collected samples were analyzed by LTA Western blotting as described above for panel A. (C) Analysis of the blot image obtained in panel B processed in Fiji (ImageJ) using the gel analysis function to extract the LTA signal for each sample. (D) The growth of strains SA113 and SA113 ΔmprF in the presence of calcium-daptomycin was monitored using a plate reader. Here, cells were diluted at an OD₆₀₀ of 0.05 in LB medium using a preculture of cells in the exponential growth phase. Graphs represent averages of triplicate values. (E) Growth of strains exposed to a range of calcium-daptomycin concentrations similar to those used in panel B when LTA changes were observed. Growth was monitored using a plate reader. Graphs represent the averages of triplicate values. (F) Detection of LTA in daptomycin-resistant strains of B. subtilis. The B. subtilis Dap^R1 and Dap^R20 mutants, carrying the pgsA^A64V allele conferring daptomycin resistance (Table 2), and strains 168 1A1 (wild type [WT]), HB15516 (Dap^R1 pgsA^WT), and HB15507 (Dap^R20 pgsA^WT) were grown in NB overnight at 30°C and to the late exponential growth phase (37°C, using these cultures grown overnight). For each set of samples, LTA was detected along with PBP2B production by Western blotting. The bottom panel shows the cellular abundances of PBP2B and the LTA synthase detected with anti-LtaS antibody (which cross-reacts with YfnI [Errington, unpublished]). Samples used in the bottom panel were those from the LTA/PBP2B experiment loaded onto a new SDS gel after sample normalization based on the PBP2B signal shown in the top panel. (G) Growth curves for the B. subtilis 168CA, ΔmprF (AG1663), Δdlt (DLT71CA), ΔltaS ΔyfnI ΔyqgS (AG600), ΔyqgS ΔyfnI (AG595), ΔltaS ΔyqgS (AG593), and ΔltaS ΔyfnI (AG594) strains in NB at 37°C in the presence of calcium-daptomycin, monitored using a plate reader. Graphs are representative of the results from 1 set out of 3 independent experiments. Download FIG S10, TIF file, 0.7 MB^{(723.7KB, tif)}.

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

As we could not test this idea directly using Dap^R MRSA strains due to laboratory regulations, we turned our interest to the strongest known Dap^R allele in B. subtilis, pgsA^A64V (54). This mutation of the essential gene pgsA, encoding the PGol synthase (Fig. 1B), has been shown to reduce cellular PGol contents and was suggested to modify LTA production (54). Thus, we compared the LTAs of B. subtilis 168 1A1 (WT), isogenic strains carrying pgsA^A64V (strains Dap^R1 and Dap^R20), and the pgsA^A64V strain complemented with pgsA^WT grown overnight in NB. As shown in Fig. 6B and Fig. S10F, the LTA signal below the 30-kDa marker was essentially absent in the Dap^R strains, whereas the pgsA-complemented strains (Dap^R pgsA^WT) had LTA profiles similar to that of the wild-type strain. Thus, PgsA^A64V accounts for the severe reduction in LTA production. Finally, we verified that the two major LTA synthases were still produced in the Dap^R strains by Western blotting (Fig. 6B and Fig. S10F). A strong LtaS/YfnI signal was detected in the Dap^R strains, which proved that one or both LTA synthases were still expressed but upregulated.

The above-described findings in S. aureus and B. subtilis suggested that alterations in LTAs could be associated with DAP sensitivity. As S. aureus ltaS is essential, we analyzed the DAP sensitivity of B. subtilis expressing only one LTA synthase. Our assays on NA (Fig. 6C) and NB (Fig. S10G) showed that strains lacking the major LTA synthase LtaS were sensitive to DAP, and this sensitivity was higher than that observed for the ΔmprF or Δdlt mutant (Fig. S10G). Thus, LtaS activity is required for DAP tolerance in B. subtilis, more so than MprF.

DISCUSSION

In the absence of the class A PBPs (Δ4), B. subtilis is viable due to the presence of RodA, the essential PG glycosyltransferase (controlled at least in part by the cell envelope stress regulator σ^M [11, 12]), and yet lethal on glucose-rich medium (Fig. 2A; see also Fig. S1B in the supplemental material). By studying either Δ4 or the ΔponA single mutant, we now understand that the presence of glucose leads to increases in the abundances of the LTA synthases LtaS and YfnI. The increases in these enzymes result in altered LTA production, which in turn causes the accumulation of the major autolysin LytE (Fig. 4 and 5), resulting in an inability to regulate the activity of autolysins (Fig. 7). This lytic phenotype could be suppressed by the absence of MprF (Fig. 2A and Fig. S1B), and we present evidence that MprF is involved in regulating LTA production (Fig. 8). In the ΔponA mutant, the loss of MprF resulted in reduced LTA production and decreased levels of LytE (Fig. 4B, Fig. 5C, and Fig. S5D). This was consistent with our finding that increases in the length and abundance of LTAs (overexpression of mprF and ΔugtP mutants) and/or an increase in LytE correlated with glucose-mediated lethality in the ΔponA mutant (Fig. 2B, Fig. 3A, Fig. 4B and C, Fig. 5A, Fig. S5D, and Fig. S9B and C). However, the loss of the major LTA synthase LtaS improved the growth of the Δ4 mutant only slightly (Fig. 3B and Fig. S1B) but did not significantly improve that of the ΔponA mutant (Fig. S1B). We assume that this was because the loss of LtaS led to the production of very long LTA polymers and a persistently high level of LytE (Fig. 4C and Fig. 5C). In support of this, the analysis of strains defective only in LTA synthesis (last three rows in Fig. 5A) indicated that LtaS is required to regulate lytE when artificially overexpressed (Fig. 5A and Fig. 7), presumably because a distinct LTA length range (7 to 17 kDa) and/or an abundance similar that of the wild type (Fig. 4A) is required to counteract excess LytE activity (Fig. 7).

FIG 8 — MprF positively regulates the synthesis of LTA in *B. subtilis* and *S. aureus*. (A) MprF or its substrates positively regulate LTA production in *B. subtilis* and *S. aureus*. (B) Proposed role of MprF in LTA production via its substrate aaPGol (not limiting). (1) LtaS could use the aminoacyl-glycerolphosphate (aaGroP) of aaPGol as the last LTA capping unit. Potentially, the addition of this positively charged capping unit (e.g., lysyl- and alanyl-GroP) could contribute to protection against CAMPs. (2 and 3) MprF indirectly alters LtaS processivity. The release of the aminoacyl could permit LtaS to use the PGol as a lipid anchor (2), and the presence of aaPGol in the vicinity of LtaS could create an electrostatic environment that helps maintain the growing LTA chain in a conformation that favors LtaS processing (3). (Illustration created with BioRender.com.)

The suggestion that LTAs could inhibit the activities of autolysins was proposed many years ago (1, 5), but the key factors involved have not been identified. Recent work in S. aureus showed that a ΔugtP mutant producing long LTAs is susceptible to PG hydrolases (55), and it has been suggested that the major autolysin LytA is sequestered by LTAs during exponential growth (56). Our results indicate that LytE in B. subtilis exhibits similar characteristics and that the length of LTAs has a role in modulating the abundance of LytE or, presumably, its activity (Fig. 7). We still do not know how this mechanism may work in relation to the location of the LTAs in the wall relative to the active autolysins, particularly LytE, and this remains an important question to be answered in future work.

In B. subtilis 168, the expression of lytE is quite complex and coordinated by regulators such as σ^I and WalR (46, 57). In contrast, the transcriptional regulation of mprF is not well defined, although analyses of another B. subtilis wild-type strain, BSB1, have shown that the expression of mprF and pgsA is positively correlated with those of walKR, the essential two-component response system that controls cell wall metabolism, and, notably, lytE (cluster A418 in the SubtiWiki expression data browser [58, 59]). However, the expression of walKR and sigI is not significantly altered in Luria-Bertani medium containing glucose (LB-glucose) (58) or in the absence of all aPBPs (12). Possibly, these regulators play a posttranscriptional role in the Δ4 mutant where the σ^M cell wall stress response is known to be active (12, 57). Some of the cell wall-associated genes mentioned previously (sigM, ponA, ltaS, yfnI, mprF, and pgsA) are differently expressed in cells of B. subtilis BSB1 in LB-glucose medium (58, 59), suggesting that B. subtilis needs to adapt its cell wall metabolism in response to glucose. This might account for the partial redundancy of the functions of the B. subtilis LTA synthases. Evidence also suggests that the presence of magnesium in culture medium leads Bacillus cells to adjust their cell wall metabolism. When investigating the effect of magnesium on aPBP mutants in the presence of glucose, we have observed that magnesium decreased the abundance of LytE significantly in both the ΔponA and ΔponA ΔmprF mutants (Fig. S9) and less significantly in the ΔponA ΔltaS mutant. In addition, high levels of magnesium have an impact on LTA production (our work in progress) and other processes (60, 61). Thus, the mechanism by which exogenous magnesium improves the growth of some cell wall mutants might require LtaS activity to tune the abundance of LytE in the cell wall (14). Altogether, the results of our study bring a new perspective on the importance of LTAs for cell envelope stability and how extracellular biosynthesis is regulated.

MprF is known to synthesize aminoacyl-phosphatidylglycerol (aaPGol) phospholipids and translocate them across the membrane (Fig. 1). In this work, we show that MprF activity impacts the biosynthesis of LTAs (Fig. 8). The LTA profiles observed in B. subtilis and S. aureus lacking MprF (seen as being shorter and/or having decreased abundances) and the overexpression of B. subtilis MprF (causing smeared and retarded mobility of the LTAs) (Fig. 4B and Fig. 6A) suggest that MprF positively regulates LTA production (Fig. 8A). Other studies have indicated that MprFs may have relaxed substrate specificities across species (22, 62) and even synthesize lysyl-glucosyl-DAG glycolipid in Streptococcus agalactiae (63). Recently, it has been shown that when S. aureus LtaS uses PGol as an alternative anchor for the glycolipid produced by UgtP, the concentrations of these free lipid starter units regulate the length of the LTA polymerized in vitro (33). We do not yet know how LTA synthesis is regulated by MprF, but it seems to be LtaS dependent. It is possible that MprF provides the last capping unit (Lys- and Ala-GroP) for LtaS to terminate the LTA being polymerized; this would also contribute to protection against CAMPs (Fig. 8B1). Alternatively, aaPGols might be a source of GroP units (Fig. 8B2) for the formation of LTAs in addition to the known PGol source altering processivity (33). Another possibility would be that aaPGols change the electrostatic environment and that this impacts the activity of the LTA synthase(s) by keeping the LTA polymers adjacent to the membrane (Fig. 8B3).

Gain-of-function mutations in MprF have been identified in methicillin-resistant S. aureus (MRSA) clinical isolates that have acquired resistance to daptomycin (DAP), an antibiotic used as a last resort to treat MRSA infections (26, 53). Over the years, MprF-mediated resistance to DAP (Dap^R) has been investigated, but a consensus model has yet to link Dap^R to a particular domain of MprF and/or to a particular LysPGol content in one or both membrane leaflets (26, 64). We showed that the B. subtilis Dap^R pgsA^A64V mutant, known to have a reduced PGol content (54), has a significant decrease in LTAs (Fig. 6B) and that the LTA synthase LtaS is required for the DAP tolerance of B. subtilis (Fig. 6C). Together, the results of this study lead to a new model where modifications of LTA synthesis and/or polymer composition through the modulation of LTA synthesis via MprF combined with changes in the d-alanylation of teichoic acid (65, 66) and phospholipid composition (50) result in a less permeable cell envelope. Thus, DAP resistance would not necessarily be associated with an increase in cell wall thickness (67). Analyses of LTA synthesis and the cell wall composition of MRSA clinical isolates will help verify our MprF-mediated Dap^R mechanism and help appreciate the role of MprF in the net cell surface charge and protection against cationic antimicrobial peptides. Our results also give support to the practical application of compounds targeting LTA synthesis (68, 69) and MprF-targeting monoclonal antibodies (70) as approaches to treat clinically relevant bacteria.

MATERIALS AND METHODS

Plasmids, bacterial strains, and primers.

The plasmids and strains used in this study are listed in Tables 1 and 2. Strain construction is described below and in Table 2 (last column). The primers used are listed in Table 3.

Growth conditions and general methods.

B. subtilis strains were grown routinely on nutrient agar (NA; Oxoid) or in nutrient broth (NB; Oxoid). For some assays, strains were grown in liquid Difco antibiotic medium 3 (Penassay broth [PAB]; Oxoid) and on PAB agar (15 g/L agar; Oxoid). B. subtilis transformations were carried out as previously described using SMM defined minimal medium (71, 72). B. subtilis cultures were usually incubated at 30°C (overnight), and the next morning, they were diluted and grown at 37°C (unless otherwise specified). Escherichia coli and Staphylococcus aureus strains were incubated at 37°C on NA plates or in Luria-Bertani (LB) medium. PCR, plasmid manipulations, and E. coli transformation were carried out using standard methods. Strains were selected on NA supplemented with ampicillin (100 μg/mL for E. coli), spectinomycin (60 μg/mL), kanamycin (5 μg/mL), phleomycin (1 μg/mL), erythromycin (0.5 μg/mL), chloramphenicol (5 μg/mL), or daptomycin (see below). Various supplements were also used: IPTG (isopropyl-β-d-thiogalactopyranoside) (0.1 or 1 mM), X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside) (100 μg/mL), MgSO₄ (between 5 mM and 25 mM as required), and glucose (final concentrations of up to 1%). For NA plates supplemented with 20 mM MgSO₄, the concentrations of spectinomycin, kanamycin, and erythromycin were doubled to avoid the growth of false-positive strains. Strains with the pMUTin-his integration were always grown in the presence of erythromycin.

Plasmid construction.

To obtain the pDR111-P_hyspank-mprF plasmid, the mprF (BSU_08425) coding sequence was amplified using primers oAG271 and oAG272, which changed the start codon from TTG to ATG. The PCR product and the pDR111 plasmid (Table 1) were digested with the SalI and SphI restriction enzymes, ligated, and transformed into E. coli DH5α. Digestion and PCR sequencing using primers oAG300 and oAG301 verified the presence of the insert.

To construct pDR111-P_hyspank-ltaS, pDR111-P_hyspank-yfnI, and pDR111-P_hyspank-yqgS, each LTA synthase gene was amplified by PCR with primer pairs oAG308-oAG309 (2,064 bp), oAG310-oAG311 (2,078 bp), and oAG312-oAG313 (1,990 bp), respectively. PCR products were digested with NheI and SphI, each ligated to pDR111 digested with the same restriction enzymes. The next steps were carried out as described above for pDR111-P_hyspank-mprF.

For pLOSS-P_spac-lytE, lytE was amplified by PCR with primers oAG348 and oAG349 (1,143 bp), and the PCR product was inserted into pLOSS* (Table 1) as NotI and BamHI fragments. After transformation, the resulting plasmid was checked by PCRs with primers oAG18 and oAG19 and finally checked by sequencing.

To construct the plasmids pMUTin-′lytE-his, pMUTin-′ltaS-his, and pMUTin-′yfnI-his, the 3′-terminal part of the gene of interest (except for the stop codon) was amplified with primer pairs oAG354-oAG355, oAG366-oAG367, and oAG360-oAG361, respectively, to obtain PCR products ranging from 288 to 309 bp. The PCR products and plasmid pMUTinHis (Table 1) (73) were digested with EcoRI and XhoI, ligated, and transformed into E. coli DH5α. Each ′lytE, ′ltaS, and ′yfnI insertion was verified by PCR and plasmid sequencing using primers oAG368 and oAG369.

To construct pAM-21, plasmid pET28a(+) (Novagen) and lytE (from bp 76, removing the coding sequence for the signal peptide) were amplified by PCRs using primer pairs oAA01-oAA02 and oAA03-oAA04, respectively. The DNA fragments generated were assembled using the NEBuilder HiFi DNA assembly kit (New England BioLabs [NEB]). The resulting plasmid was verified by sequencing using primers oAA05 and oAA06.

B. subtilis directed mutagenesis.

The steps leading to the construction of new mutants are indicated in the last column of Table 2, with additional details here. New mutants were often obtained by the transformation of competent cells with clean genomic DNA (gDNA) extracted from another existing B. subtilis mutant. The presence of the mutations was verified by PCR using the “check” primers listed in Table 3.

The construction of some of the markerless class A PBP mutants was previously described (12). Additional mutants described in this study were obtained using plasmids pG⁺host9::ΔponA, pG⁺host10::ΔpbpD, and pG⁺host10::ΔpbpF (Table 1) (12). PCRs with primers oAG124 to oAG129 were consistently performed to check that the markerless deletions were still present (12).

All transformants of the background strains with, and/or leading to, deletions of ponA, mreB, mbl, gtaB, ugtP, and ltaS were selected on NA medium supplemented with MgSO₄ (20 to 25 mM) with the appropriate antibiotic.

To construct strain AG181 (ΔmprF), DNA fragments upstream and downstream of the mprF coding sequence were amplified by PCR using primer pairs oAG103-oAG104 (2,390 bp) and oAG105-oAG106 (2,414 bp), respectively, and digested with EcoRI and XbaI, respectively. The phleomycin resistance antibiotic cassette was amplified by PCR with primers PhleoXbaI-fw and PhleoEcoRI-rev from plasmid pIC22 and digested with both EcoRI and XbaI. The 3 digested PCR fragments were ligated to generate a linear DNA and then transformed into 168CA with selection for phleomycin resistance. The deletion of mprF was confirmed by PCR using primers oAG107 and oAG108.

Strain AG304 (amyE::P_hyspank-mprF spc) was obtained by the transformation of 168CA with the pDR111-P_hyspank-mprF plasmid (Table 1). The correct recombination (double crossover) at amyE was confirmed by the absence of amylase activity when grown on NA with 0.2% starch and by PCR (primers oAG300 and oAG301). The same methods were used to confirm the mutation obtained after the transformation of other pDR111 derivatives.

We constructed our own lytE deletion mutant (ΔlytE::cat). For this, regions of genomic DNA upstream and downstream of lytE were amplified by PCRs with primer pairs oAG350-oAG351 (2,048 bp) and oAG352-oAG353 (2,500 bp) and then digested with XbaI and BamHI (Table 3), respectively. The chloramphenicol resistance cassette from the pCotC-GFP plasmid (Table 1) was amplified with primers oAG197 and oAG198. The resulting PCR product (850 bp) was then digested with XbaI and BamHI, and the three DNA fragments were ligated and transformed into B. subtilis 168CA. Strain AG547 was obtained from this transformation, and the deletion of lytE was confirmed by PCR using primers oAG340 and oAG341 (Table 3).

Strains AG565 and AG586 were obtained by the integration of pMUTin-′lytE-his (erythromycin selection) into the chromosomes of 168CA and the ΔcwlO mutant (strain AG474), respectively. The plasmid integration (single crossover) in B. subtilis resulted in the expression of the recombinant protein with a C-terminal LEMRGSH₁₂ tag under the control of its native promoter. Since the integration of this plasmid into the ΔcwlO background did not result in any phenotypic change, this indicated that LytE-His₁₂ was functional, as a lytE cwlO double mutant is lethal (44). Thereafter, the genomic DNA of strain AG565 was used to transform all of the strains needed for Western blot analysis (Table 2). Of note, strain AG1541 (ΔcwlO) obtained by genomic DNA recombination has the same genotype as that of the AG586 strain obtained by plasmid integration.

Random transposition mutagenesis.

Random transposition mutagenesis was performed as previously described (39, 74) using the pMarB plasmid that carries the transposon TnYLB-1 encoding kanamycin resistance. pMarB was introduced into B. subtilis strains carrying pLOSS-P_spac-ponA (12) (Table 1), a plasmid with an unstable origin of replication, and lacZ, which helps to monitor plasmid stability by observing the formation of blue or white colonies. After screening the random library of mutants, genomic DNAs extracted from positive clones were backcrossed into the parental strain used for the transposon screen. Transposon insertion sites were identified by inverse PCR using gDNA extracted from the backcrossed positive clones (74) and sequencing the resulting PCR products. Further verification of the transposon’s site of insertion was obtained using specific primers.

For the suppressor screen in the ponA pbpD pbpF mutant background, we constructed strain AG141 (Table 2), which carries deletions of the three vegetative class A PBPs, the lacA gene (74), and pLOSS-P_spac-ponA (12). The transposon mutant library was screened on PAB agar supplemented with MgSO₄ (10 mM), X-Gal, and IPTG (1 mM), and white colonies were selected. Strain SWA11a (Table 2) had a transposon in the mprF coding sequence, which was verified using specific primers oAG81 and oAG82 (Table 3).

A conditional lethal screen was also carried out in a ponA pbpD pbpF mprF lacA pLOSS-P_spac-ponA strain (AG200) (Table 2). Here, the transposon mutant library was screened on NA and PAB supplemented with X-Gal and IPTG (1 mM). Blue colonies, indicating plasmid stability, were selected. One mutant was isolated, and its genomic DNA was backcrossed into the AG200 background. The resulting blue-forming strain, AG200BK#42 (Table 2), was found to carry a transposon in the gtaB coding sequence using primers oAG165 and oAG166 (Table 3).

Spot growth assays.

Strains were grown in NB with 20 mM MgSO₄ at 30°C overnight. The cultures were then diluted 1:100 into fresh NB with 10 mM MgSO₄ (or, when applicable, 20 mM MgSO₄) and grown to mid-exponential phase at 37°C. Cells were harvested, washed in NB, and diluted to an optical density at 600 nm (OD₆₀₀) of ~0.3 in NB. Each culture was then serially diluted 1:10 using a 96-multiwell plate and NB. Using a multichannel pipette, 5 μL of each dilution was transferred to various agar plates. As a control, all of the serial dilutions presented in the figures were also spotted onto media supplemented with 10 mM or 20 mM MgSO₄ to ensure that growth occurred for all spots (data not shown). Plates were incubated at 37°C overnight and scanned at different time points. Images were edited using Photoshop CS software.

Microscopy imaging.

Cells were grown to the exponential growth phase at 37°C in NB medium. Before the cells were mounted onto microscope slides, the slides were covered with a thin layer of NA medium supplemented with the FM5-95 membrane dye at 140 μg/mL (Invitrogen). Fluorescence microscopy was carried out with a Zeiss Axiovert 200M microscope attached to a Sony Cool-Snap HQ cooled charge-coupled-device (CCD) camera with a Nikon APO 100×/1.40 oil Ph3 lens objective. Images were acquired using Metamorph 6 imaging software (Molecular Devices, Inc.). Images were analyzed with ImageJ (http://rsb.info.nih.gov/ij/) and assembled with Photoshop CS software.

Images stained with the FM5-95 membrane dye were processed using the ObjectJ plug-in in ImageJ to measure the diameter and length of about 400 cells per strain. Measurements were performed only once as the cell diameter change was obvious under a microscope and in the images in Fig. 3D (Table 4; for details, see Fig. S3A and B in the supplemental material).

Transmission electron microscopy.

Strains were grown in NB medium (with IPTG when applicable) until they reached an OD₆₀₀ of about 0.4. The cell pellets were fixed in 2% glutaraldehyde in sodium cacodylate buffer (0.1 M) at 4°C for at least 24 h. Samples were spun, molten 4% agarose was added to the samples, and the samples were respun. Samples were allowed to cool in a fridge for 30 min. The agarose block was removed from each tube and cut into 1-mm³ pieces. The samples were then dehydrated by microwave processing using the Pelco Biowave Pro+ system incorporating Pelco Coldspot Pro. In a vacuum chamber, samples were rinsed 3 times in 0.1 M sodium cacodylate buffer (150 W for 40 s), treated with 1% osmium, pulsed (100 W for 8 min), and rinsed 3 times in distilled water (150 W for 40 s). They were then taken out of the vacuum chamber, and a graded series of dried acetone was applied to the samples (25%, 50%, 75%, and 3 times with 100% at 150 W for 40 s for each step). This was followed by impregnation with a series of increasing concentrations of epoxy resin (Taab medium resin) in acetone (25%, 50%, 75%, and 3 times with 100% at 300 W for 3 min for each step). Samples were embedded in fresh 100% resin and polymerized at 60°C for 24 h in a conventional oven. Once polymerized, the resin block was cut into semithin survey sections (0.5 μm) and stained with 1% toluidine blue in 1% sodium tetraborate (Borax). Ultrathin sections (approximately 70 nm) were then cut using a diamond knife on a Leica EM UC7 ultramicrotome. The sections were stretched with chloroform to eliminate compression and mounted onto Pioloform-filmed copper grids. The grids were stained with uranyl acetate (2%) and lead citrate and viewed on a Hitachi HT7800 transmission electron microscope using an Emsis Xarosa camera.

Sample preparation for LTA polymer detection.

B. subtilis strains were grown overnight at 30°C with shaking in NB supplemented with 5 mM MgSO₄ (or 10 mM MgSO₄ for mbl mutants). The cells were then diluted (1:60 to 1:80 depending on the strain) to an OD₆₀₀ of ~0.02 in prewarmed NB and NB supplemented with 0.2% glucose. The strains were then incubated at 37°C with shaking and grown for about 4.5 h (late exponential phase). At the sampling time, the OD₆₀₀ of the cultures was measured before harvesting 15 to 25 mL of each culture by spinning at 3,273 × g for 10 min using a swingout centrifuge at room temperature (RT). Pellets were washed with 200 μL of solution A (with 10 mL of Tris-HCl at 100 mM [pH 7.4] and one cOmplete Mini EDTA-free protease inhibitor cocktail tablet from Roche) and pelleted with a benchtop centrifuge. Cell pellets were then frozen in liquid nitrogen and stored at −20°C until processing. Samples were resuspended in a volume of solution B (an equal volume of solution A and lithium dodecyl sulfate [LDS] sample buffer [Life Technologies]) ranging from 70 to 200 μL in proportion to their OD₆₀₀ values. Samples were boiled for 30 min at 100°C, cooled on ice for 3 min, and incubated with 100 U of Benzonase (catalogue number E1014; Sigma) for 30 min at 37°C. Samples were pelleted at 4°C, and the supernatants containing the extracted LTAs were collected. The supernatants were frozen in liquid nitrogen and kept at −25°C. For LTA Western blotting, the quantity of the sample loaded was normalized using Bio-Rad protein assays such that the final OD₅₉₅ was approximately 0.35. Sample sets to be compared were grown, extracted, measured, and normalized together for each experiment.

S. aureus strains were grown overnight at 37°C with shaking in LB medium. The cells were then diluted (about 300-fold) to an OD₆₀₀ of about 0.02 and grown in LB medium at 37°C until reaching the late exponential growth phase at an OD₆₀₀ of about 1. Ten milliliters of the cultures was harvested, and samples were prepared as described above for B. subtilis, with the following changes: 60 μL of solution B was used, and ~18- to 20-μL samples were loaded onto an SDS-PAGE gel, with samples normalized to their OD₆₀₀ values.

Total protein sample preparation.

For LytE or LtaS Western blotting, cells were grown, harvested, and processed in the same way as described above for the LTA samples, with the exception that to detect the His-tagged proteins (LytE, LtaS, or YfnI), the strains were grown in the presence of erythromycin. An 8-mL culture sample was resuspended in 180 to 200 μL of solution A and sonicated until a clear lysate was obtained. Samples were centrifuged at 16,000 × g for 10 min at 4°C, and a volume of the sample supernatant was loaded onto an SDS gel and normalized based on the OD₆₀₀ of the culture collected.

SDS-PAGE, LTA and protein Western blotting, and detection blots.

For SDS-PAGE, samples were diluted in solution B with the addition of a reducing agent (1.5 μL per sample) to a final volume of 20 μL, heated at 70°C for 10 min, loaded onto a gel (NuPAGE 4 to 12% Bis-Tris gradient midi gel; Life Technologies), and separated by electrophoresis. For the LTA-PBP2B experiment, morpholineethanesulfonic acid (MES) buffer, a Novex Sharp prestained protein ladder (Life Technologies), and a 0.2-μm Amersham Hybond sequencing polyvinylidene difluoride (PVDF) membrane (GE Healthcare) were used, whereas for LytE (37 kDa) or LtaS (74 kDa) Western blotting, morpholinepropanesulfonic acid (MOPS) buffer, an Abcam prestained midrange protein ladder (catalogue number Ab116027), and a 0.45-μm Amersham Hybond PVDF membrane (GE Healthcare) were used. The SDS-PAGE gels were transferred to membranes using the Trans-Blot Turbo transfer system (Bio-Rad), using an in-house transfer buffer (600 mM Tris, 600 mM glycine, 280 mM Tricine, 2.5 mM EDTA, and 0.05% SDS). After transfer, the membranes were washed three times for 5 min each in phosphate-buffered saline (PBS) using a rocking shaker; afterward, the membranes were cut where required to allow different detection methods.

For LTA Western blotting, the membrane was cut at the 60-kDa ladder position. The bottom part of the membrane was used for LTA blotting, whereas the top part was used to detect the membrane protein PBP2B (79 kDa) as a loading/extraction control. All LTA Western blot steps were performed at room temperature in a rolling shaker using 50-mL Falcon tubes. The LTA membranes were incubated for 1 h 15 min in PBS buffer with 3% bovine serum albumin (BSA) (catalogue number A7030; Sigma) and then for 1 h 30 min in fresh PBS–3% BSA with Gram-positive LTA monoclonal antibody (catalogue number MA1-7402; Thermo Fisher) at a dilution of 1:1,000. The membrane was then washed briefly twice, followed by four 8-min washes in PBS, and then incubated in PBS–5% dried semiskimmed milk with a 1:10,000 dilution of anti-mouse horseradish peroxidase (HRP)-linked secondary antibody (catalogue number A9044; Sigma) for 1 h. This was then followed by two brief washes and six 8-min washes prior to detection.

For Western blot detection of LytE-His₁₂ or LtaS and PBP2B, all of the following steps were performed at room temperature using a rocking shaker. The membranes were washed after transfer in PBS–0.1% Tween 20 (PBS-T) and blocked in PBS-T with 5% milk (PBS-T-milk) for 1 h 15 min at room temperature. Thereafter, the LytE-His₁₂/PBP2B membrane blot was cut at the ~53-kDa ladder position. Membranes were placed into fresh buffer containing PBS-T-milk for 1 h (or 1 h 30 min when performing the LTA Western blotting in parallel) with polyclonal rabbit anti-PBP2B antibody (at 1:5,000) (laboratory stock or available at Merck [catalogue number ABS2199]), mouse monoclonal penta-His antibody (catalogue number 34660; Qiagen) (stock at 200 μg/mL) (used at a dilution of 1:2,000), or polyclonal rabbit anti-LtaS antibody (at 1:1,000) (laboratory stock). Two brief washing steps were performed in PBS-T, followed by 3 washes for 10 min. Membranes were incubated in PBS-T-milk for 1 h using 1:10,000 dilutions of anti-rabbit or anti-mouse HRP-linked secondary antibody (catalogue number A0545 or A9044, respectively; Sigma) as required. Membranes were then washed as described above for the previous step.

The Pierce ECL Plus Western blotting substrate (catalogue number 32132; Thermo Scientific) was used for detection as recommended by the manufacturer. Chemiluminescence was detected using an ImageQuant LAS 4000 mini digital imaging system (GE Healthcare), and membranes were exposed in 1-min increments for 20 min. Membranes were also imaged by epi-illumination to detect the prestained protein ladder on the membrane. Under our conditions, the quantities of LTA samples loaded were scaled down to avoid burnouts of the signals observed for some of the tested strains. Occasionally, for the LTA blots, strains (in NB only) displayed a very weak signal above the 30-kDa ladder position. This phenomenon was observed by others performing Bacillus LTA Western blotting and was assumed to be related not to LTAs but possibly to the cross-reactivity of the antibody to WTAs that also contain glycerolphosphate (18).

Images were edited in ImageJ (Fiji), and the same contrast enhancement was applied to the membranes in the same set of experiments. Three independent sets of experimental samples were generated by Western blotting. Contrast was sometimes added to the images, particularly to observe LytE signals in low-expressing strains.

LytE purification and raising antiserum.

Plasmid pAM-21 was transferred to the E. coli BL21(DE3) strain, and the culture was grown at 37°C in LB-kanamycin medium. When the culture reached an OD₆₀₀ of ~0.5, lytE expression was induced with 1 mM IPTG for 3 h. Fifty milliliters of the culture was collected by centrifugation at 9,000 × g for 5 min and resuspended in 15 mL of a solution of PBS with 4 μg/mL of lysozyme. After incubation for 20 min at RT, cells were sonicated, and once a clear lysate was obtained, the cells were harvested at 3,000 × g for 4 min. The cell pellet was resuspended in PBS buffer with 8 M urea and incubated for 30 min at RT on a rolling shaker. The cells were then centrifuged at 9,000 × g for 10 min, and the supernatant was collected, mixed gently with 200 μL of high-performance Ni-Sepharose (GE Healthcare), and incubated for 1 h under the same conditions as the ones described above. Next, the sample was washed 3 to 4 times in buffer A (50 mM Tris [pH 8] and 300 mM NaCl), and the last wash was done in buffer B (50 mM Tris, 300 mM NaCl, and 5 mM imidazole). The protein was eluted five times in buffer C (PBS with 8 M urea and 100 mM imidazole), and the eluents were analyzed by SDS-PAGE. Ice-cold acetone was added to the desired eluted sample at a 4:1 volume ratio, and the sample was incubated overnight at −20°C. The sample was centrifuged at 4°C for 10 min at 15,000 × g, and the pellet was left to dry at RT. The pellet was suspended in 200 μL of PBS, and a 100-μg aliquot was sent for raising antiserum (Eurogentec). The LytE antiserum was used for Western blotting at a 1:5,000 dilution with the anti-rabbit secondary antibody (1:10,000).

Growth assays in the presence of daptomycin.

For the S. aureus samples for LTA Western blotting, cultures were grown as described above, but after growth in LB medium for 3 h, CaCl₂ (1.25 mM final concentration) was added to the cultures, which were then divided and grown for an extra hour with or without daptomycin (DAP) (stock at 1 mg/mL) (catalogue number ab141204; Abcam).

For the NA-CaCl₂-DAP assays, strains were grown in NB for about 3 h at 37°C (exponential phase) and then normalized to an OD₆₀₀ of 0.5. Cells (300 μL) were spread onto 25-mL NA plates supplemented with CaCl₂ (1.25 mM final concentration). A 0.016- to 256-mg/L daptomycin antimicrobial susceptibility testing strip (Liofilchem) was applied to the surface of the plate. Plates were incubated at 37°C overnight and scanned after 24 h. Images were edited in Fiji (ImageJ). The manufacturer’s guidance was used for the interpretation of growth inhibition.

To monitor strain growth in a plate reader, we used precultures that had been grown in NB (or in LB medium for S. aureus) at 37°C for about 3 h. For each assay, a daptomycin stock at 17.4 mg/mL was used to prepare a fresh DAP stock at 0.1 mg/mL, and this was used to make dilutions of the antibiotic as required in 96-well plates in 100 μL of medium supplemented with CaCl₂ (1.25 mM final concentration). Plates were then loaded with 100 μL of cells (diluted in medium-CaCl₂ and normalized to the desired OD₆₀₀). Plates were shaken at 37°C in a Tecan Sunrise plate reader, and the OD₆₀₀ was measured every 6 min. Conditions were tested in duplicates or triplicates whenever possible. Data were collected using Magellan software (version 7.2). Microsoft Excel was used for analysis and the generation of graphs.

ACKNOWLEDGMENTS

We thank P. Aldridge and L. J. Wu for critical reading of the manuscript. We thank the following colleagues for their help in providing strains, genomic DNAs, or daptomycin stocks: S. Moore, P. Dominguez-Cuevas, P. Gamba, A. Koh, K. Seistrup, L. Bowman, J. Buttress, and H. Strahl. We thank J. D. Helmann, B. M. Wendel, and A. Peschel for strains related to daptomycin resistance. Technical support was provided by I. Selmes, F. Davison, and T. Fletcher, and TEM sample processing was performed by Tracey Davey at Electron Microscopy Research Services, Newcastle University. We thank J. Errington for the anti-LtaS antibody, H. Strahl and W. Vollmer for helpful discussion, C. Winterhalter and S. Fenyk for advice on Western blotting, and P. Tiago for sharing SubtiWiki data.

This work was funded by grants from the BBSRC (BB/G015902/1), the EPSRC (EP/N031962/1) (R.A.D. and A.G.), and the SACB (studentship for A.A.). Electron Microscopy Research Services, Newcastle University, is funded by the BBSRC (BB/R013942/1).

Conceptualization, A.G. Funding Acquisition, R.A.D. Methodology, A.G. Investigation, mostly A.G.; A.A. cloned pAM-21, purified LytE, and optimized the use of the anti-LytE serum. Project Administration, R.A.D. Supervision, R.A.D. Validation, A.G. Visualization, A.G. Writing, Original Draft, A.G. Writing, Review & Editing, A.G. and R.A.D.

We declare that we have no conflict of interest.

Contributor Information

Aurélie Guyet, Email: aurelie.guyet@newcastle.ac.uk.

Richard A. Daniel, Email: richard.daniel@newcastle.ac.uk.

Tarek Msadek, Institut Pasteur.

REFERENCES

1.Hanson BR, Neely MN. 2012. Coordinate regulation of Gram-positive cell surface components. Curr Opin Microbiol 15:204–210. doi: 10.1016/j.mib.2011.12.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Percy MG, Grundling A. 2014. Lipoteichoic acid synthesis and function in Gram-positive bacteria. Annu Rev Microbiol 68:81–100. doi: 10.1146/annurev-micro-091213-112949. [DOI] [PubMed] [Google Scholar]
3.Schneewind O, Missiakas D. 2019. Lipoteichoic acid synthesis and function in gram-positive bacteria, p 163–180. In Geiger O (ed), Biogenesis of fatty acids, lipids and membranes. Handbook of hydrocarbon and lipid microbiology. Springer, Cham, Switzerland. [Google Scholar]
4.Rajagopal M, Walker S. 2017. Envelope structures of Gram-positive bacteria. Curr Top Microbiol Immunol 404:1–44. doi: 10.1007/82_2015_5021. [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Neuhaus FC, Baddiley J. 2003. A continuum of anionic charge: structures and functions of d-alanyl-teichoic acids in Gram-positive bacteria. Microbiol Mol Biol Rev 67:686–723. doi: 10.1128/MMBR.67.4.686-723.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Erickson HP. 2021. How teichoic acids could support a periplasm in Gram-positive bacteria, and let cell division cheat turgor pressure. Front Microbiol 12:664704. doi: 10.3389/fmicb.2021.664704. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Pazos M, Vollmer W. 2021. Regulation and function of class A penicillin-binding proteins. Curr Opin Microbiol 60:80–87. doi: 10.1016/j.mib.2021.01.008. [DOI] [PubMed] [Google Scholar]
8.Straume D, Piechowiak KW, Kjos M, Havarstein LS. 2021. Class A PBPs: it is time to rethink traditional paradigms. Mol Microbiol 116:41–52. doi: 10.1111/mmi.14714. [DOI] [PubMed] [Google Scholar]
9.McPherson DC, Popham DL. 2003. Peptidoglycan synthesis in the absence of class A penicillin-binding proteins in Bacillus subtilis. J Bacteriol 185:1423–1431. doi: 10.1128/JB.185.4.1423-1431.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Kawai Y, Daniel RA, Errington J. 2009. Regulation of cell wall morphogenesis in Bacillus subtilis by recruitment of PBP1 to the MreB helix. Mol Microbiol 71:1131–1144. doi: 10.1111/j.1365-2958.2009.06601.x. [DOI] [PubMed] [Google Scholar]
11.Meeske AJ, Riley EP, Robins WP, Uehara T, Mekalanos JJ, Kahne D, Walker S, Kruse AC, Bernhardt TG, Rudner DZ. 2016. SEDS proteins are a widespread family of bacterial cell wall polymerases. Nature 537:634–638. doi: 10.1038/nature19331. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Emami K, Guyet A, Kawai Y, Devi J, Wu LJ, Allenby N, Daniel RA, Errington J. 2017. RodA as the missing glycosyltransferase in Bacillus subtilis and antibiotic discovery for the peptidoglycan polymerase pathway. Nat Microbiol 2:16253. doi: 10.1038/nmicrobiol.2016.253. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Do T, Page JE, Walker S. 2020. Uncovering the activities, biological roles, and regulation of bacterial cell wall hydrolases and tailoring enzymes. J Biol Chem 295:3347–3361. doi: 10.1074/jbc.REV119.010155. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Wilson S, Garner E. 2021. An exhaustive multiple knockout approach to understanding cell wall hydrolase function in Bacillus subtilis. bioRxiv. doi: 10.1101/2021.02.18.431929. [DOI] [PMC free article] [PubMed]
15.Brunet YR, Wang X, Rudner DZ. 2019. SweC and SweD are essential co-factors of the FtsEX-CwlO cell wall hydrolase complex in Bacillus subtilis. PLoS Genet 15:e1008296. doi: 10.1371/journal.pgen.1008296. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Schirner K, Marles-Wright J, Lewis RJ, Errington J. 2009. Distinct and essential morphogenic functions for wall- and lipo-teichoic acids in Bacillus subtilis. EMBO J 28:830–842. doi: 10.1038/emboj.2009.25. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Soldo B, Lazarevic V, Karamata D. 2002. tagO is involved in the synthesis of all anionic cell-wall polymers in Bacillus subtilis 168. Microbiology (Reading) 148:2079–2087. doi: 10.1099/00221287-148-7-2079. [DOI] [PubMed] [Google Scholar]
18.Wormann ME, Corrigan RM, Simpson PJ, Matthews SJ, Grundling A. 2011. Enzymatic activities and functional interdependencies of Bacillus subtilis lipoteichoic acid synthesis enzymes. Mol Microbiol 79:566–583. doi: 10.1111/j.1365-2958.2010.07472.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Schneewind O, Missiakas D. 2014. Lipoteichoic acids, phosphate-containing polymers in the envelope of Gram-positive bacteria. J Bacteriol 196:1133–1142. doi: 10.1128/JB.01155-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Kingston AW, Liao X, Helmann JD. 2013. Contributions of the σ^W, σ^M and σ^X regulons to the lantibiotic resistome of Bacillus subtilis. Mol Microbiol 90:502–518. doi: 10.1111/mmi.12380. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Peschel A, Jack RW, Otto M, Collins LV, Staubitz P, Nicholson G, Kalbacher H, Nieuwenhuizen WF, Jung G, Tarkowski A, van Kessel KP, van Strijp JA. 2001. Staphylococcus aureus resistance to human defensins and evasion of neutrophil killing via the novel virulence factor MprF is based on modification of membrane lipids with l-lysine. J Exp Med 193:1067–1076. doi: 10.1084/jem.193.9.1067. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Slavetinsky C, Kuhn S, Peschel A. 2017. Bacterial aminoacyl phospholipids—biosynthesis and role in basic cellular processes and pathogenicity. Biochim Biophys Acta 1862:1310–1318. doi: 10.1016/j.bbalip.2016.11.013. [DOI] [PubMed] [Google Scholar]
23.Staubitz P, Peschel A. 2002. MprF-mediated lysinylation of phospholipids in Bacillus subtilis—protection against bacteriocins in terrestrial habitats? Microbiology (Reading) 148:3331–3332. doi: 10.1099/00221287-148-11-3331. [DOI] [PubMed] [Google Scholar]
24.Johnson CM, Grossman AD. 2016. The composition of the cell envelope affects conjugation in Bacillus subtilis. J Bacteriol 198:1241–1249. doi: 10.1128/JB.01044-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Atila M, Katselis G, Chumala P, Luo Y. 2016. Characterization of N-succinylation of L-lysylphosphatidylglycerol in Bacillus subtilis using tandem mass spectrometry. J Am Soc Mass Spectrom 27:1606–1613. doi: 10.1007/s13361-016-1455-4. [DOI] [PubMed] [Google Scholar]
26.Ernst CM, Peschel A. 2019. MprF-mediated daptomycin resistance. Int J Med Microbiol 309:359–363. doi: 10.1016/j.ijmm.2019.05.010. [DOI] [PubMed] [Google Scholar]
27.Nowak J, Visnovsky SB, Cruz CD, Fletcher GC, van Vliet AHM, Hedderley D, Butler R, Flint S, Palmer J, Pitman AR. 2021. Inactivation of the gene encoding the cationic antimicrobial peptide resistance factor MprF increases biofilm formation but reduces invasiveness of Listeria monocytogenes. J Appl Microbiol 130:464–477. doi: 10.1111/jam.14790. [DOI] [PubMed] [Google Scholar]
28.Salzberg LI, Helmann JD. 2008. Phenotypic and transcriptomic characterization of Bacillus subtilis mutants with grossly altered membrane composition. J Bacteriol 190:7797–7807. doi: 10.1128/JB.00720-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Hachmann AB, Angert ER, Helmann JD. 2009. Genetic analysis of factors affecting susceptibility of Bacillus subtilis to daptomycin. Antimicrob Agents Chemother 53:1598–1609. doi: 10.1128/AAC.01329-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Jorasch P, Wolter FP, Zahringer U, Heinz E. 1998. A UDP glucosyltransferase from Bacillus subtilis successively transfers up to four glucose residues to 1,2-diacylglycerol: expression of ypfP in Escherichia coli and structural analysis of its reaction products. Mol Microbiol 29:419–430. doi: 10.1046/j.1365-2958.1998.00930.x. [DOI] [PubMed] [Google Scholar]
31.Lazarevic V, Soldo B, Medico N, Pooley H, Bron S, Karamata D. 2005. Bacillus subtilis α-phosphoglucomutase is required for normal cell morphology and biofilm formation. Appl Environ Microbiol 71:39–45. doi: 10.1128/AEM.71.1.39-45.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Gründling A, Schneewind O. 2007. Genes required for glycolipid synthesis and lipoteichoic acid anchoring in Staphylococcus aureus. J Bacteriol 189:2521–2530. doi: 10.1128/JB.01683-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Hesser AR, Schaefer K, Lee W, Walker S. 2020. Lipoteichoic acid polymer length is determined by competition between free starter units. Proc Natl Acad Sci USA 117:29669–29676. doi: 10.1073/pnas.2008929117. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Oku Y, Kurokawa K, Matsuo M, Yamada S, Lee BL, Sekimizu K. 2009. Pleiotropic roles of polyglycerolphosphate synthase of lipoteichoic acid in growth of Staphylococcus aureus cells. J Bacteriol 191:141–151. doi: 10.1128/JB.01221-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Coe KA, Lee W, Stone MC, Komazin-Meredith G, Meredith TC, Grad YH, Walker S. 2019. Multi-strain Tn-Seq reveals common daptomycin resistance determinants in Staphylococcus aureus. PLoS Pathog 15:e1007862. doi: 10.1371/journal.ppat.1007862. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Grundling A, Schneewind O. 2007. Synthesis of glycerol phosphate lipoteichoic acid in Staphylococcus aureus. Proc Natl Acad Sci USA 104:8478–8483. doi: 10.1073/pnas.0701821104. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Hashimoto M, Seki T, Matsuoka S, Hara H, Asai K, Sadaie Y, Matsumoto K. 2013. Induction of extracytoplasmic function sigma factors in Bacillus subtilis cells with defects in lipoteichoic acid synthesis. Microbiology (Reading) 159:23–35. doi: 10.1099/mic.0.063420-0. [DOI] [PubMed] [Google Scholar]
38.Murray T, Popham DL, Setlow P. 1998. Bacillus subtilis cells lacking penicillin-binding protein 1 require increased levels of divalent cations for growth. J Bacteriol 180:4555–4563. doi: 10.1128/JB.180.17.4555-4563.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Claessen D, Emmins R, Hamoen LW, Daniel RA, Errington J, Edwards DH. 2008. Control of the cell elongation-division cycle by shuttling of PBP1 protein in Bacillus subtilis. Mol Microbiol 68:1029–1046. doi: 10.1111/j.1365-2958.2008.06210.x. [DOI] [PubMed] [Google Scholar]
40.Perego M, Glaser P, Minutello A, Strauch MA, Leopold K, Fischer W. 1995. Incorporation of D-alanine into lipoteichoic acid and wall teichoic acid in Bacillus subtilis. Identification of genes and regulation. J Biol Chem 270:15598–15606. doi: 10.1074/jbc.270.26.15598. [DOI] [PubMed] [Google Scholar]
41.Wood BM, Santa Maria JP, Jr, Matano LM, Vickery CR, Walker S. 2018. A partial reconstitution implicates DltD in catalyzing lipoteichoic acid d-alanylation. J Biol Chem 293:17985–17996. doi: 10.1074/jbc.RA118.004561. [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Kawai Y, Asai K, Errington J. 2009. Partial functional redundancy of MreB isoforms, MreB, Mbl and MreBH, in cell morphogenesis of Bacillus subtilis. Mol Microbiol 73:719–731. doi: 10.1111/j.1365-2958.2009.06805.x. [DOI] [PubMed] [Google Scholar]
43.Dominguez-Cuevas P, Porcelli I, Daniel RA, Errington J. 2013. Differentiated roles for MreB-actin isologues and autolytic enzymes in Bacillus subtilis morphogenesis. Mol Microbiol 89:1084–1098. doi: 10.1111/mmi.12335. [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Hashimoto M, Ooiwa S, Sekiguchi J. 2012. Synthetic lethality of the lytE cwlO genotype in Bacillus subtilis is caused by lack of d,l-endopeptidase activity at the lateral cell wall. J Bacteriol 194:796–803. doi: 10.1128/JB.05569-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Salzberg LI, Powell L, Hokamp K, Botella E, Noone D, Devine KM. 2013. The WalRK (YycFG) and σ^I RsgI regulators cooperate to control CwlO and LytE expression in exponentially growing and stressed Bacillus subtilis cells. Mol Microbiol 87:180–195. doi: 10.1111/mmi.12092. [DOI] [PubMed] [Google Scholar]
46.Dobihal GS, Brunet YR, Flores-Kim J, Rudner DZ. 2019. Homeostatic control of cell wall hydrolysis by the WalRK two-component signaling pathway in Bacillus subtilis. Elife 8:e52088. doi: 10.7554/eLife.52088. [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Kasahara J, Kiriyama Y, Miyashita M, Kondo T, Yamada T, Yazawa K, Yoshikawa R, Yamamoto H. 2016. Teichoic acid polymers affect expression and localization of dl-endopeptidase LytE required for lateral cell wall hydrolysis in Bacillus subtilis. J Bacteriol 198:1585–1594. doi: 10.1128/JB.00003-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Mamou G, Fiyaksel O, Sinai L, Ben-Yehuda S. 2017. Deficiency in lipoteichoic acid synthesis causes a failure in executing the colony developmental program in Bacillus subtilis. Front Microbiol 8:1991. doi: 10.3389/fmicb.2017.01991. [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Muller A, Wenzel M, Strahl H, Grein F, Saaki TNV, Kohl B, Siersma T, Bandow JE, Sahl HG, Schneider T, Hamoen LW. 2016. Daptomycin inhibits cell envelope synthesis by interfering with fluid membrane microdomains. Proc Natl Acad Sci USA 113:E7077–E7086. doi: 10.1073/pnas.1611173113. [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Gray DA, Wenzel M. 2020. More than a pore: a current perspective on the in vivo mode of action of the lipopeptide antibiotic daptomycin. Antibiotics (Basel) 9:17. doi: 10.3390/antibiotics9010017. [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Grein F, Muller A, Scherer KM, Liu X, Ludwig KC, Klockner A, Strach M, Sahl HG, Kubitscheck U, Schneider T. 2020. Ca²⁺-daptomycin targets cell wall biosynthesis by forming a tripartite complex with undecaprenyl-coupled intermediates and membrane lipids. Nat Commun 11:1455. doi: 10.1038/s41467-020-15257-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Friedman L, Alder JD, Silverman JA. 2006. Genetic changes that correlate with reduced susceptibility to daptomycin in Staphylococcus aureus. Antimicrob Agents Chemother 50:2137–2145. doi: 10.1128/AAC.00039-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
53.Ernst CM, Slavetinsky CJ, Kuhn S, Hauser JN, Nega M, Mishra NN, Gekeler C, Bayer AS, Peschel A. 2018. Gain-of-function mutations in the phospholipid flippase MprF confer specific daptomycin resistance. mBio 9:e01659-18. doi: 10.1128/mBio.01659-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Hachmann AB, Sevim E, Gaballa A, Popham DL, Antelmann H, Helmann JD. 2011. Reduction in membrane phosphatidylglycerol content leads to daptomycin resistance in Bacillus subtilis. Antimicrob Agents Chemother 55:4326–4337. doi: 10.1128/AAC.01819-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Hesser AR, Matano LM, Vickery CR, Wood BM, Santiago AG, Morris HG, Do T, Losick R, Walker S. 2020. The length of lipoteichoic acid polymers controls Staphylococcus aureus cell size and envelope integrity. J Bacteriol 202:e00149-20. doi: 10.1128/JB.00149-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Flores-Kim J, Dobihal GS, Fenton A, Rudner DZ, Bernhardt TG. 2019. A switch in surface polymer biogenesis triggers growth-phase-dependent and antibiotic-induced bacteriolysis. Elife 8:e44912. doi: 10.7554/eLife.44912. [DOI] [PMC free article] [PubMed] [Google Scholar]
57.Patel Y, Zhao H, Helmann JD. 2020. A regulatory pathway that selectively up-regulates elongasome function in the absence of class A PBPs. Elife 9:e57902. doi: 10.7554/eLife.57902. [DOI] [PMC free article] [PubMed] [Google Scholar]
58.Nicolas P, Mader U, Dervyn E, Rochat T, Leduc A, Pigeonneau N, Bidnenko E, Marchadier E, Hoebeke M, Aymerich S, Becher D, Bisicchia P, Botella E, Delumeau O, Doherty G, Denham EL, Fogg MJ, Fromion V, Goelzer A, Hansen A, Hartig E, Harwood CR, Homuth G, Jarmer H, Jules M, Klipp E, Le Chat L, Lecointe F, Lewis P, Liebermeister W, March A, Mars RAT, Nannapaneni P, Noone D, Pohl S, Rinn B, Rugheimer F, Sappa PK, Samson F, Schaffer M, Schwikowski B, Steil L, Stulke J, Wiegert T, Devine KM, Wilkinson AJ, van Dijl JM, Hecker M, Volker U, Bessieres P, Noirot P. 2012. Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science 335:1103–1106. doi: 10.1126/science.1206848. [DOI] [PubMed] [Google Scholar]
59.Pedreira T, Elfmann C, Stulke J. 2022. The current state of SubtiWiki, the database for the model organism Bacillus subtilis. Nucleic Acids Res 50:D875–D882. doi: 10.1093/nar/gkab943. [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Wendel BM, Pi H, Kruger L, Herzberg C, Stulke J, Helmann JD. 2022. A central role for magnesium homeostasis during adaptation to osmotic stress. mBio 13:e00092-22. doi: 10.1128/mbio.00092-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
61.Tesson B, Dajkovic A, Keary R, Marliere C, Dupont-Gillain CC, Carballido-Lopez R. 2022. Magnesium rescues the morphology of Bacillus subtilis mreB mutants through its inhibitory effect on peptidoglycan hydrolases. Sci Rep 12:1137. doi: 10.1038/s41598-021-04294-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
62.Song D, Jiao H, Liu Z. 2021. Phospholipid translocation captured in a bifunctional membrane protein MprF. Nat Commun 12:2927. doi: 10.1038/s41467-021-23248-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
63.Joyce LR, Manzer HS, da C Mendonça J, Villarreal R, Nagao PE, Doran KS, Palmer KL, Guan Z. 2022. Identification of a novel cationic glycolipid in Streptococcus agalactiae that contributes to brain entry and meningitis. PLoS Biol 20:e3001555. doi: 10.1371/journal.pbio.3001555. [DOI] [PMC free article] [PubMed] [Google Scholar]
64.Thitiananpakorn K, Aiba Y, Tan X-E, Watanabe S, Kiga K, Sato’o Y, Boonsiri T, Li F-Y, Sasahara T, Taki Y, Azam AH, Zhang Y, Cui L. 2020. Association of mprF mutations with cross-resistance to daptomycin and vancomycin in methicillin-resistant Staphylococcus aureus (MRSA). Sci Rep 10:16107. doi: 10.1038/s41598-020-73108-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
65.Bertsche U, Yang SJ, Kuehner D, Wanner S, Mishra NN, Roth T, Nega M, Schneider A, Mayer C, Grau T, Bayer AS, Weidenmaier C. 2013. Increased cell wall teichoic acid production and D-alanylation are common phenotypes among daptomycin-resistant methicillin-resistant Staphylococcus aureus (MRSA) clinical isolates. PLoS One 8:e67398. doi: 10.1371/journal.pone.0067398. [DOI] [PMC free article] [PubMed] [Google Scholar]
66.Mishra NN, Bayer AS, Weidenmaier C, Grau T, Wanner S, Stefani S, Cafiso V, Bertuccio T, Yeaman MR, Nast CC, Yang SJ. 2014. Phenotypic and genotypic characterization of daptomycin-resistant methicillin-resistant Staphylococcus aureus strains: relative roles of mprF and dlt operons. PLoS One 9:e107426. doi: 10.1371/journal.pone.0107426. [DOI] [PMC free article] [PubMed] [Google Scholar]
67.Yang S-J, Nast CC, Mishra NN, Yeaman MR, Fey PD, Bayer AS. 2010. Cell wall thickening is not a universal accompaniment of the daptomycin nonsusceptibility phenotype in Staphylococcus aureus: evidence for multiple resistance mechanisms. Antimicrob Agents Chemother 54:3079–3085. doi: 10.1128/AAC.00122-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
68.Muscato JD, Morris HG, Mychack A, Rajagopal M, Baidin V, Hesser AR, Lee W, Inecik K, Wilson LJ, Kraml CM, Meredith TC, Walker S. 2022. Rapid inhibitor discovery by exploiting synthetic lethality. J Am Chem Soc 144:3696–3705. doi: 10.1021/jacs.1c12697. [DOI] [PMC free article] [PubMed] [Google Scholar]
69.Chee Wezen X, Chandran A, Eapen RS, Waters E, Bricio-Moreno L, Tosi T, Dolan S, Millership C, Kadioglu A, Grundling A, Itzhaki LS, Welch M, Rahman T. 2022. Structure-based discovery of lipoteichoic acid synthase inhibitors. J Chem Inf Model 62:2586–2599. doi: 10.1021/acs.jcim.2c00300. [DOI] [PMC free article] [PubMed] [Google Scholar]
70.Slavetinsky CJ, Hauser JN, Gekeler C, Slavetinsky J, Geyer A, Kraus A, Heilingbrunner D, Wagner S, Tesar M, Krismer B, Kuhn S, Ernst CM, Peschel A. 2022. Sensitizing Staphylococcus aureus to antibacterial agents by decoding and blocking the lipid flippase MprF. Elife 11:e66376. doi: 10.7554/eLife.66376. [DOI] [PMC free article] [PubMed] [Google Scholar]
71.Anagnostopoulos C, Spizizen J. 1961. Requirements for transformation in Bacillus subtilis. J Bacteriol 81:741–746. doi: 10.1128/jb.81.5.741-746.1961. [DOI] [PMC free article] [PubMed] [Google Scholar]
72.Hamoen LW, Smits WK, de Jong A, Holsappel S, Kuipers OP. 2002. Improving the predictive value of the competence transcription factor (ComK) binding site in Bacillus subtilis using a genomic approach. Nucleic Acids Res 30:5517–5528. doi: 10.1093/nar/gkf698. [DOI] [PMC free article] [PubMed] [Google Scholar]
73.Ishikawa S, Kawai Y, Hiramatsu K, Kuwano M, Ogasawara N. 2006. A new FtsZ-interacting protein, YlmF, complements the activity of FtsA during progression of cell division in Bacillus subtilis. Mol Microbiol 60:1364–1380. doi: 10.1111/j.1365-2958.2006.05184.x. [DOI] [PubMed] [Google Scholar]
74.Surdova K, Gamba P, Claessen D, Siersma T, Jonker MJ, Errington J, Hamoen LW. 2013. The conserved DNA-binding protein WhiA is involved in cell division in Bacillus subtilis. J Bacteriol 195:5450–5460. doi: 10.1128/JB.00507-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
75.Veening JW, Kuipers OP, Brul S, Hellingwerf KJ, Kort R. 2006. Effects of phosphorelay perturbations on architecture, sporulation, and spore resistance in biofilms of Bacillus subtilis. J Bacteriol 188:3099–3109. doi: 10.1128/JB.188.8.3099-3109.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
76.Steinmetz M, Richter R. 1994. Plasmids designed to alter the antibiotic resistance expressed by insertion mutations in Bacillus subtilis, through in vivo recombination. Gene 142:79–83. doi: 10.1016/0378-1119(94)90358-1. [DOI] [PubMed] [Google Scholar]
77.Le Breton Y, Mohapatra NP, Haldenwang WG. 2006. In vivo random mutagenesis of Bacillus subtilis by use of TnYLB-1, a mariner-based transposon. Appl Environ Microbiol 72:327–333. doi: 10.1128/AEM.72.1.327-333.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
78.Formstone A, Errington J. 2005. A magnesium-dependent mreB null mutant: implications for the role of mreB in Bacillus subtilis. Mol Microbiol 55:1646–1657. doi: 10.1111/j.1365-2958.2005.04506.x. [DOI] [PubMed] [Google Scholar]
79.Schirner K, Errington J. 2009. The cell wall regulator σ^I specifically suppresses the lethal phenotype of mbl mutants in Bacillus subtilis. J Bacteriol 191:1404–1413. doi: 10.1128/JB.01497-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
80.McPherson DC, Driks A, Popham DL. 2001. Two class A high-molecular-weight penicillin-binding proteins of Bacillus subtilis play redundant roles in sporulation. J Bacteriol 183:6046–6053. doi: 10.1128/JB.183.20.6046-6053.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
81.Branda SS, Gonzalez-Pastor JE, Dervyn E, Ehrlich SD, Losick R, Kolter R. 2004. Genes involved in formation of structured multicellular communities by Bacillus subtilis. J Bacteriol 186:3970–3979. doi: 10.1128/JB.186.12.3970-3979.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
82.Koo B-M, Kritikos G, Farelli JD, Todor H, Tong K, Kimsey H, Wapinski I, Galardini M, Cabal A, Peters JM, Hachmann A-B, Rudner DZ, Allen KN, Typas A, Gross CA. 2017. Construction and analysis of two genome-scale deletion libraries for Bacillus subtilis. Cell Syst 4:291–305.e7. doi: 10.1016/j.cels.2016.12.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
83.Matsuoka S, Hashimoto M, Kamiya Y, Miyazawa T, Ishikawa K, Hara H, Matsumoto K. 2011. The Bacillus subtilis essential gene dgkB is dispensable in mutants with defective lipoteichoic acid synthesis. Genes Genet Syst 86:365–376. doi: 10.1266/ggs.86.365. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

FIG S1

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S2

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S3

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S4

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S5

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S6

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S7

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S8

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S9

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

FIG S10

This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

[B1] 1.Hanson BR, Neely MN. 2012. Coordinate regulation of Gram-positive cell surface components. Curr Opin Microbiol 15:204–210. doi: 10.1016/j.mib.2011.12.011. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B2] 2.Percy MG, Grundling A. 2014. Lipoteichoic acid synthesis and function in Gram-positive bacteria. Annu Rev Microbiol 68:81–100. doi: 10.1146/annurev-micro-091213-112949. [DOI] [PubMed] [Google Scholar]

[B3] 3.Schneewind O, Missiakas D. 2019. Lipoteichoic acid synthesis and function in gram-positive bacteria, p 163–180. In Geiger O (ed), Biogenesis of fatty acids, lipids and membranes. Handbook of hydrocarbon and lipid microbiology. Springer, Cham, Switzerland. [Google Scholar]

[B4] 4.Rajagopal M, Walker S. 2017. Envelope structures of Gram-positive bacteria. Curr Top Microbiol Immunol 404:1–44. doi: 10.1007/82_2015_5021. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B5] 5.Neuhaus FC, Baddiley J. 2003. A continuum of anionic charge: structures and functions of d-alanyl-teichoic acids in Gram-positive bacteria. Microbiol Mol Biol Rev 67:686–723. doi: 10.1128/MMBR.67.4.686-723.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B6] 6.Erickson HP. 2021. How teichoic acids could support a periplasm in Gram-positive bacteria, and let cell division cheat turgor pressure. Front Microbiol 12:664704. doi: 10.3389/fmicb.2021.664704. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B7] 7.Pazos M, Vollmer W. 2021. Regulation and function of class A penicillin-binding proteins. Curr Opin Microbiol 60:80–87. doi: 10.1016/j.mib.2021.01.008. [DOI] [PubMed] [Google Scholar]

[B8] 8.Straume D, Piechowiak KW, Kjos M, Havarstein LS. 2021. Class A PBPs: it is time to rethink traditional paradigms. Mol Microbiol 116:41–52. doi: 10.1111/mmi.14714. [DOI] [PubMed] [Google Scholar]

[B9] 9.McPherson DC, Popham DL. 2003. Peptidoglycan synthesis in the absence of class A penicillin-binding proteins in Bacillus subtilis. J Bacteriol 185:1423–1431. doi: 10.1128/JB.185.4.1423-1431.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B10] 10.Kawai Y, Daniel RA, Errington J. 2009. Regulation of cell wall morphogenesis in Bacillus subtilis by recruitment of PBP1 to the MreB helix. Mol Microbiol 71:1131–1144. doi: 10.1111/j.1365-2958.2009.06601.x. [DOI] [PubMed] [Google Scholar]

[B11] 11.Meeske AJ, Riley EP, Robins WP, Uehara T, Mekalanos JJ, Kahne D, Walker S, Kruse AC, Bernhardt TG, Rudner DZ. 2016. SEDS proteins are a widespread family of bacterial cell wall polymerases. Nature 537:634–638. doi: 10.1038/nature19331. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B12] 12.Emami K, Guyet A, Kawai Y, Devi J, Wu LJ, Allenby N, Daniel RA, Errington J. 2017. RodA as the missing glycosyltransferase in Bacillus subtilis and antibiotic discovery for the peptidoglycan polymerase pathway. Nat Microbiol 2:16253. doi: 10.1038/nmicrobiol.2016.253. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B13] 13.Do T, Page JE, Walker S. 2020. Uncovering the activities, biological roles, and regulation of bacterial cell wall hydrolases and tailoring enzymes. J Biol Chem 295:3347–3361. doi: 10.1074/jbc.REV119.010155. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B14] 14.Wilson S, Garner E. 2021. An exhaustive multiple knockout approach to understanding cell wall hydrolase function in Bacillus subtilis. bioRxiv. doi: 10.1101/2021.02.18.431929. [DOI] [PMC free article] [PubMed]

[B15] 15.Brunet YR, Wang X, Rudner DZ. 2019. SweC and SweD are essential co-factors of the FtsEX-CwlO cell wall hydrolase complex in Bacillus subtilis. PLoS Genet 15:e1008296. doi: 10.1371/journal.pgen.1008296. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B16] 16.Schirner K, Marles-Wright J, Lewis RJ, Errington J. 2009. Distinct and essential morphogenic functions for wall- and lipo-teichoic acids in Bacillus subtilis. EMBO J 28:830–842. doi: 10.1038/emboj.2009.25. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B17] 17.Soldo B, Lazarevic V, Karamata D. 2002. tagO is involved in the synthesis of all anionic cell-wall polymers in Bacillus subtilis 168. Microbiology (Reading) 148:2079–2087. doi: 10.1099/00221287-148-7-2079. [DOI] [PubMed] [Google Scholar]

[B18] 18.Wormann ME, Corrigan RM, Simpson PJ, Matthews SJ, Grundling A. 2011. Enzymatic activities and functional interdependencies of Bacillus subtilis lipoteichoic acid synthesis enzymes. Mol Microbiol 79:566–583. doi: 10.1111/j.1365-2958.2010.07472.x. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B19] 19.Schneewind O, Missiakas D. 2014. Lipoteichoic acids, phosphate-containing polymers in the envelope of Gram-positive bacteria. J Bacteriol 196:1133–1142. doi: 10.1128/JB.01155-13. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B20] 20.Kingston AW, Liao X, Helmann JD. 2013. Contributions of the σ^W, σ^M and σ^X regulons to the lantibiotic resistome of Bacillus subtilis. Mol Microbiol 90:502–518. doi: 10.1111/mmi.12380. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B21] 21.Peschel A, Jack RW, Otto M, Collins LV, Staubitz P, Nicholson G, Kalbacher H, Nieuwenhuizen WF, Jung G, Tarkowski A, van Kessel KP, van Strijp JA. 2001. Staphylococcus aureus resistance to human defensins and evasion of neutrophil killing via the novel virulence factor MprF is based on modification of membrane lipids with l-lysine. J Exp Med 193:1067–1076. doi: 10.1084/jem.193.9.1067. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B22] 22.Slavetinsky C, Kuhn S, Peschel A. 2017. Bacterial aminoacyl phospholipids—biosynthesis and role in basic cellular processes and pathogenicity. Biochim Biophys Acta 1862:1310–1318. doi: 10.1016/j.bbalip.2016.11.013. [DOI] [PubMed] [Google Scholar]

[B23] 23.Staubitz P, Peschel A. 2002. MprF-mediated lysinylation of phospholipids in Bacillus subtilis—protection against bacteriocins in terrestrial habitats? Microbiology (Reading) 148:3331–3332. doi: 10.1099/00221287-148-11-3331. [DOI] [PubMed] [Google Scholar]

[B24] 24.Johnson CM, Grossman AD. 2016. The composition of the cell envelope affects conjugation in Bacillus subtilis. J Bacteriol 198:1241–1249. doi: 10.1128/JB.01044-15. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B25] 25.Atila M, Katselis G, Chumala P, Luo Y. 2016. Characterization of N-succinylation of L-lysylphosphatidylglycerol in Bacillus subtilis using tandem mass spectrometry. J Am Soc Mass Spectrom 27:1606–1613. doi: 10.1007/s13361-016-1455-4. [DOI] [PubMed] [Google Scholar]

[B26] 26.Ernst CM, Peschel A. 2019. MprF-mediated daptomycin resistance. Int J Med Microbiol 309:359–363. doi: 10.1016/j.ijmm.2019.05.010. [DOI] [PubMed] [Google Scholar]

[B27] 27.Nowak J, Visnovsky SB, Cruz CD, Fletcher GC, van Vliet AHM, Hedderley D, Butler R, Flint S, Palmer J, Pitman AR. 2021. Inactivation of the gene encoding the cationic antimicrobial peptide resistance factor MprF increases biofilm formation but reduces invasiveness of Listeria monocytogenes. J Appl Microbiol 130:464–477. doi: 10.1111/jam.14790. [DOI] [PubMed] [Google Scholar]

[B28] 28.Salzberg LI, Helmann JD. 2008. Phenotypic and transcriptomic characterization of Bacillus subtilis mutants with grossly altered membrane composition. J Bacteriol 190:7797–7807. doi: 10.1128/JB.00720-08. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B29] 29.Hachmann AB, Angert ER, Helmann JD. 2009. Genetic analysis of factors affecting susceptibility of Bacillus subtilis to daptomycin. Antimicrob Agents Chemother 53:1598–1609. doi: 10.1128/AAC.01329-08. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B30] 30.Jorasch P, Wolter FP, Zahringer U, Heinz E. 1998. A UDP glucosyltransferase from Bacillus subtilis successively transfers up to four glucose residues to 1,2-diacylglycerol: expression of ypfP in Escherichia coli and structural analysis of its reaction products. Mol Microbiol 29:419–430. doi: 10.1046/j.1365-2958.1998.00930.x. [DOI] [PubMed] [Google Scholar]

[B31] 31.Lazarevic V, Soldo B, Medico N, Pooley H, Bron S, Karamata D. 2005. Bacillus subtilis α-phosphoglucomutase is required for normal cell morphology and biofilm formation. Appl Environ Microbiol 71:39–45. doi: 10.1128/AEM.71.1.39-45.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B32] 32.Gründling A, Schneewind O. 2007. Genes required for glycolipid synthesis and lipoteichoic acid anchoring in Staphylococcus aureus. J Bacteriol 189:2521–2530. doi: 10.1128/JB.01683-06. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B33] 33.Hesser AR, Schaefer K, Lee W, Walker S. 2020. Lipoteichoic acid polymer length is determined by competition between free starter units. Proc Natl Acad Sci USA 117:29669–29676. doi: 10.1073/pnas.2008929117. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B34] 34.Oku Y, Kurokawa K, Matsuo M, Yamada S, Lee BL, Sekimizu K. 2009. Pleiotropic roles of polyglycerolphosphate synthase of lipoteichoic acid in growth of Staphylococcus aureus cells. J Bacteriol 191:141–151. doi: 10.1128/JB.01221-08. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B35] 35.Coe KA, Lee W, Stone MC, Komazin-Meredith G, Meredith TC, Grad YH, Walker S. 2019. Multi-strain Tn-Seq reveals common daptomycin resistance determinants in Staphylococcus aureus. PLoS Pathog 15:e1007862. doi: 10.1371/journal.ppat.1007862. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B36] 36.Grundling A, Schneewind O. 2007. Synthesis of glycerol phosphate lipoteichoic acid in Staphylococcus aureus. Proc Natl Acad Sci USA 104:8478–8483. doi: 10.1073/pnas.0701821104. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B37] 37.Hashimoto M, Seki T, Matsuoka S, Hara H, Asai K, Sadaie Y, Matsumoto K. 2013. Induction of extracytoplasmic function sigma factors in Bacillus subtilis cells with defects in lipoteichoic acid synthesis. Microbiology (Reading) 159:23–35. doi: 10.1099/mic.0.063420-0. [DOI] [PubMed] [Google Scholar]

[B38] 38.Murray T, Popham DL, Setlow P. 1998. Bacillus subtilis cells lacking penicillin-binding protein 1 require increased levels of divalent cations for growth. J Bacteriol 180:4555–4563. doi: 10.1128/JB.180.17.4555-4563.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B39] 39.Claessen D, Emmins R, Hamoen LW, Daniel RA, Errington J, Edwards DH. 2008. Control of the cell elongation-division cycle by shuttling of PBP1 protein in Bacillus subtilis. Mol Microbiol 68:1029–1046. doi: 10.1111/j.1365-2958.2008.06210.x. [DOI] [PubMed] [Google Scholar]

[B40] 40.Perego M, Glaser P, Minutello A, Strauch MA, Leopold K, Fischer W. 1995. Incorporation of D-alanine into lipoteichoic acid and wall teichoic acid in Bacillus subtilis. Identification of genes and regulation. J Biol Chem 270:15598–15606. doi: 10.1074/jbc.270.26.15598. [DOI] [PubMed] [Google Scholar]

[B41] 41.Wood BM, Santa Maria JP, Jr, Matano LM, Vickery CR, Walker S. 2018. A partial reconstitution implicates DltD in catalyzing lipoteichoic acid d-alanylation. J Biol Chem 293:17985–17996. doi: 10.1074/jbc.RA118.004561. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B42] 42.Kawai Y, Asai K, Errington J. 2009. Partial functional redundancy of MreB isoforms, MreB, Mbl and MreBH, in cell morphogenesis of Bacillus subtilis. Mol Microbiol 73:719–731. doi: 10.1111/j.1365-2958.2009.06805.x. [DOI] [PubMed] [Google Scholar]

[B43] 43.Dominguez-Cuevas P, Porcelli I, Daniel RA, Errington J. 2013. Differentiated roles for MreB-actin isologues and autolytic enzymes in Bacillus subtilis morphogenesis. Mol Microbiol 89:1084–1098. doi: 10.1111/mmi.12335. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B44] 44.Hashimoto M, Ooiwa S, Sekiguchi J. 2012. Synthetic lethality of the lytE cwlO genotype in Bacillus subtilis is caused by lack of d,l-endopeptidase activity at the lateral cell wall. J Bacteriol 194:796–803. doi: 10.1128/JB.05569-11. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B45] 45.Salzberg LI, Powell L, Hokamp K, Botella E, Noone D, Devine KM. 2013. The WalRK (YycFG) and σ^I RsgI regulators cooperate to control CwlO and LytE expression in exponentially growing and stressed Bacillus subtilis cells. Mol Microbiol 87:180–195. doi: 10.1111/mmi.12092. [DOI] [PubMed] [Google Scholar]

[B46] 46.Dobihal GS, Brunet YR, Flores-Kim J, Rudner DZ. 2019. Homeostatic control of cell wall hydrolysis by the WalRK two-component signaling pathway in Bacillus subtilis. Elife 8:e52088. doi: 10.7554/eLife.52088. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B47] 47.Kasahara J, Kiriyama Y, Miyashita M, Kondo T, Yamada T, Yazawa K, Yoshikawa R, Yamamoto H. 2016. Teichoic acid polymers affect expression and localization of dl-endopeptidase LytE required for lateral cell wall hydrolysis in Bacillus subtilis. J Bacteriol 198:1585–1594. doi: 10.1128/JB.00003-16. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B48] 48.Mamou G, Fiyaksel O, Sinai L, Ben-Yehuda S. 2017. Deficiency in lipoteichoic acid synthesis causes a failure in executing the colony developmental program in Bacillus subtilis. Front Microbiol 8:1991. doi: 10.3389/fmicb.2017.01991. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B49] 49.Muller A, Wenzel M, Strahl H, Grein F, Saaki TNV, Kohl B, Siersma T, Bandow JE, Sahl HG, Schneider T, Hamoen LW. 2016. Daptomycin inhibits cell envelope synthesis by interfering with fluid membrane microdomains. Proc Natl Acad Sci USA 113:E7077–E7086. doi: 10.1073/pnas.1611173113. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B50] 50.Gray DA, Wenzel M. 2020. More than a pore: a current perspective on the in vivo mode of action of the lipopeptide antibiotic daptomycin. Antibiotics (Basel) 9:17. doi: 10.3390/antibiotics9010017. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B51] 51.Grein F, Muller A, Scherer KM, Liu X, Ludwig KC, Klockner A, Strach M, Sahl HG, Kubitscheck U, Schneider T. 2020. Ca²⁺-daptomycin targets cell wall biosynthesis by forming a tripartite complex with undecaprenyl-coupled intermediates and membrane lipids. Nat Commun 11:1455. doi: 10.1038/s41467-020-15257-1. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B52] 52.Friedman L, Alder JD, Silverman JA. 2006. Genetic changes that correlate with reduced susceptibility to daptomycin in Staphylococcus aureus. Antimicrob Agents Chemother 50:2137–2145. doi: 10.1128/AAC.00039-06. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B53] 53.Ernst CM, Slavetinsky CJ, Kuhn S, Hauser JN, Nega M, Mishra NN, Gekeler C, Bayer AS, Peschel A. 2018. Gain-of-function mutations in the phospholipid flippase MprF confer specific daptomycin resistance. mBio 9:e01659-18. doi: 10.1128/mBio.01659-18. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B54] 54.Hachmann AB, Sevim E, Gaballa A, Popham DL, Antelmann H, Helmann JD. 2011. Reduction in membrane phosphatidylglycerol content leads to daptomycin resistance in Bacillus subtilis. Antimicrob Agents Chemother 55:4326–4337. doi: 10.1128/AAC.01819-10. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B55] 55.Hesser AR, Matano LM, Vickery CR, Wood BM, Santiago AG, Morris HG, Do T, Losick R, Walker S. 2020. The length of lipoteichoic acid polymers controls Staphylococcus aureus cell size and envelope integrity. J Bacteriol 202:e00149-20. doi: 10.1128/JB.00149-20. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B56] 56.Flores-Kim J, Dobihal GS, Fenton A, Rudner DZ, Bernhardt TG. 2019. A switch in surface polymer biogenesis triggers growth-phase-dependent and antibiotic-induced bacteriolysis. Elife 8:e44912. doi: 10.7554/eLife.44912. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B57] 57.Patel Y, Zhao H, Helmann JD. 2020. A regulatory pathway that selectively up-regulates elongasome function in the absence of class A PBPs. Elife 9:e57902. doi: 10.7554/eLife.57902. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B58] 58.Nicolas P, Mader U, Dervyn E, Rochat T, Leduc A, Pigeonneau N, Bidnenko E, Marchadier E, Hoebeke M, Aymerich S, Becher D, Bisicchia P, Botella E, Delumeau O, Doherty G, Denham EL, Fogg MJ, Fromion V, Goelzer A, Hansen A, Hartig E, Harwood CR, Homuth G, Jarmer H, Jules M, Klipp E, Le Chat L, Lecointe F, Lewis P, Liebermeister W, March A, Mars RAT, Nannapaneni P, Noone D, Pohl S, Rinn B, Rugheimer F, Sappa PK, Samson F, Schaffer M, Schwikowski B, Steil L, Stulke J, Wiegert T, Devine KM, Wilkinson AJ, van Dijl JM, Hecker M, Volker U, Bessieres P, Noirot P. 2012. Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science 335:1103–1106. doi: 10.1126/science.1206848. [DOI] [PubMed] [Google Scholar]

[B59] 59.Pedreira T, Elfmann C, Stulke J. 2022. The current state of SubtiWiki, the database for the model organism Bacillus subtilis. Nucleic Acids Res 50:D875–D882. doi: 10.1093/nar/gkab943. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B60] 60.Wendel BM, Pi H, Kruger L, Herzberg C, Stulke J, Helmann JD. 2022. A central role for magnesium homeostasis during adaptation to osmotic stress. mBio 13:e00092-22. doi: 10.1128/mbio.00092-22. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B61] 61.Tesson B, Dajkovic A, Keary R, Marliere C, Dupont-Gillain CC, Carballido-Lopez R. 2022. Magnesium rescues the morphology of Bacillus subtilis mreB mutants through its inhibitory effect on peptidoglycan hydrolases. Sci Rep 12:1137. doi: 10.1038/s41598-021-04294-5. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B62] 62.Song D, Jiao H, Liu Z. 2021. Phospholipid translocation captured in a bifunctional membrane protein MprF. Nat Commun 12:2927. doi: 10.1038/s41467-021-23248-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B63] 63.Joyce LR, Manzer HS, da C Mendonça J, Villarreal R, Nagao PE, Doran KS, Palmer KL, Guan Z. 2022. Identification of a novel cationic glycolipid in Streptococcus agalactiae that contributes to brain entry and meningitis. PLoS Biol 20:e3001555. doi: 10.1371/journal.pbio.3001555. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B64] 64.Thitiananpakorn K, Aiba Y, Tan X-E, Watanabe S, Kiga K, Sato’o Y, Boonsiri T, Li F-Y, Sasahara T, Taki Y, Azam AH, Zhang Y, Cui L. 2020. Association of mprF mutations with cross-resistance to daptomycin and vancomycin in methicillin-resistant Staphylococcus aureus (MRSA). Sci Rep 10:16107. doi: 10.1038/s41598-020-73108-x. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B65] 65.Bertsche U, Yang SJ, Kuehner D, Wanner S, Mishra NN, Roth T, Nega M, Schneider A, Mayer C, Grau T, Bayer AS, Weidenmaier C. 2013. Increased cell wall teichoic acid production and D-alanylation are common phenotypes among daptomycin-resistant methicillin-resistant Staphylococcus aureus (MRSA) clinical isolates. PLoS One 8:e67398. doi: 10.1371/journal.pone.0067398. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B66] 66.Mishra NN, Bayer AS, Weidenmaier C, Grau T, Wanner S, Stefani S, Cafiso V, Bertuccio T, Yeaman MR, Nast CC, Yang SJ. 2014. Phenotypic and genotypic characterization of daptomycin-resistant methicillin-resistant Staphylococcus aureus strains: relative roles of mprF and dlt operons. PLoS One 9:e107426. doi: 10.1371/journal.pone.0107426. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B67] 67.Yang S-J, Nast CC, Mishra NN, Yeaman MR, Fey PD, Bayer AS. 2010. Cell wall thickening is not a universal accompaniment of the daptomycin nonsusceptibility phenotype in Staphylococcus aureus: evidence for multiple resistance mechanisms. Antimicrob Agents Chemother 54:3079–3085. doi: 10.1128/AAC.00122-10. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B68] 68.Muscato JD, Morris HG, Mychack A, Rajagopal M, Baidin V, Hesser AR, Lee W, Inecik K, Wilson LJ, Kraml CM, Meredith TC, Walker S. 2022. Rapid inhibitor discovery by exploiting synthetic lethality. J Am Chem Soc 144:3696–3705. doi: 10.1021/jacs.1c12697. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B69] 69.Chee Wezen X, Chandran A, Eapen RS, Waters E, Bricio-Moreno L, Tosi T, Dolan S, Millership C, Kadioglu A, Grundling A, Itzhaki LS, Welch M, Rahman T. 2022. Structure-based discovery of lipoteichoic acid synthase inhibitors. J Chem Inf Model 62:2586–2599. doi: 10.1021/acs.jcim.2c00300. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B70] 70.Slavetinsky CJ, Hauser JN, Gekeler C, Slavetinsky J, Geyer A, Kraus A, Heilingbrunner D, Wagner S, Tesar M, Krismer B, Kuhn S, Ernst CM, Peschel A. 2022. Sensitizing Staphylococcus aureus to antibacterial agents by decoding and blocking the lipid flippase MprF. Elife 11:e66376. doi: 10.7554/eLife.66376. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B71] 71.Anagnostopoulos C, Spizizen J. 1961. Requirements for transformation in Bacillus subtilis. J Bacteriol 81:741–746. doi: 10.1128/jb.81.5.741-746.1961. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B72] 72.Hamoen LW, Smits WK, de Jong A, Holsappel S, Kuipers OP. 2002. Improving the predictive value of the competence transcription factor (ComK) binding site in Bacillus subtilis using a genomic approach. Nucleic Acids Res 30:5517–5528. doi: 10.1093/nar/gkf698. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B73] 73.Ishikawa S, Kawai Y, Hiramatsu K, Kuwano M, Ogasawara N. 2006. A new FtsZ-interacting protein, YlmF, complements the activity of FtsA during progression of cell division in Bacillus subtilis. Mol Microbiol 60:1364–1380. doi: 10.1111/j.1365-2958.2006.05184.x. [DOI] [PubMed] [Google Scholar]

[B74] 74.Surdova K, Gamba P, Claessen D, Siersma T, Jonker MJ, Errington J, Hamoen LW. 2013. The conserved DNA-binding protein WhiA is involved in cell division in Bacillus subtilis. J Bacteriol 195:5450–5460. doi: 10.1128/JB.00507-13. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B75] 75.Veening JW, Kuipers OP, Brul S, Hellingwerf KJ, Kort R. 2006. Effects of phosphorelay perturbations on architecture, sporulation, and spore resistance in biofilms of Bacillus subtilis. J Bacteriol 188:3099–3109. doi: 10.1128/JB.188.8.3099-3109.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B76] 76.Steinmetz M, Richter R. 1994. Plasmids designed to alter the antibiotic resistance expressed by insertion mutations in Bacillus subtilis, through in vivo recombination. Gene 142:79–83. doi: 10.1016/0378-1119(94)90358-1. [DOI] [PubMed] [Google Scholar]

[B77] 77.Le Breton Y, Mohapatra NP, Haldenwang WG. 2006. In vivo random mutagenesis of Bacillus subtilis by use of TnYLB-1, a mariner-based transposon. Appl Environ Microbiol 72:327–333. doi: 10.1128/AEM.72.1.327-333.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B78] 78.Formstone A, Errington J. 2005. A magnesium-dependent mreB null mutant: implications for the role of mreB in Bacillus subtilis. Mol Microbiol 55:1646–1657. doi: 10.1111/j.1365-2958.2005.04506.x. [DOI] [PubMed] [Google Scholar]

[B79] 79.Schirner K, Errington J. 2009. The cell wall regulator σ^I specifically suppresses the lethal phenotype of mbl mutants in Bacillus subtilis. J Bacteriol 191:1404–1413. doi: 10.1128/JB.01497-08. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B80] 80.McPherson DC, Driks A, Popham DL. 2001. Two class A high-molecular-weight penicillin-binding proteins of Bacillus subtilis play redundant roles in sporulation. J Bacteriol 183:6046–6053. doi: 10.1128/JB.183.20.6046-6053.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B81] 81.Branda SS, Gonzalez-Pastor JE, Dervyn E, Ehrlich SD, Losick R, Kolter R. 2004. Genes involved in formation of structured multicellular communities by Bacillus subtilis. J Bacteriol 186:3970–3979. doi: 10.1128/JB.186.12.3970-3979.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B82] 82.Koo B-M, Kritikos G, Farelli JD, Todor H, Tong K, Kimsey H, Wapinski I, Galardini M, Cabal A, Peters JM, Hachmann A-B, Rudner DZ, Allen KN, Typas A, Gross CA. 2017. Construction and analysis of two genome-scale deletion libraries for Bacillus subtilis. Cell Syst 4:291–305.e7. doi: 10.1016/j.cels.2016.12.013. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B83] 83.Matsuoka S, Hashimoto M, Kamiya Y, Miyazawa T, Ishikawa K, Hara H, Matsumoto K. 2011. The Bacillus subtilis essential gene dgkB is dispensable in mutants with defective lipoteichoic acid synthesis. Genes Genet Syst 86:365–376. doi: 10.1266/ggs.86.365. [DOI] [PubMed] [Google Scholar]

PERMALINK

Insights into the Roles of Lipoteichoic Acids and MprF in Bacillus subtilis

Aurélie Guyet

Amirah Alofi

Richard A Daniel

Roles

ABSTRACT

INTRODUCTION

FIG 1.

RESULTS

MprF alters cell viability in the absence of ponA or mbl.

TABLE 1.

TABLE 2.

TABLE 3.

FIG 2.

Conditional essentiality of UgtP in the absence of MprF and the class A PBPs.

FIG 3.

The deletion of ltaS improves the conditional lethality of a strain lacking aPBPs.

TABLE 4.

Impact of glucose, PBP1, and MprF on LTA synthesis.

FIG 4.

Overexpression of the major autolysin LytE is lethal in the absence of PBP1 or LtaS.

FIG 5.

LTA influences LytE activity.

FIG 7.

LTA production is altered in S. aureus ΔmprF and is an important factor in the sensitivity of B. subtilis to daptomycin.

FIG 6.

DISCUSSION

FIG 8.

MATERIALS AND METHODS

Plasmids, bacterial strains, and primers.

Growth conditions and general methods.

Plasmid construction.

B. subtilis directed mutagenesis.

Random transposition mutagenesis.

Spot growth assays.

Microscopy imaging.

Transmission electron microscopy.

Sample preparation for LTA polymer detection.

Total protein sample preparation.

SDS-PAGE, LTA and protein Western blotting, and detection blots.

LytE purification and raising antiserum.

Growth assays in the presence of daptomycin.

ACKNOWLEDGMENTS

Contributor Information

REFERENCES

Associated Data

Supplementary Materials

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases