Skip to main content
NCBI home page
ACS AuthorChoice logoLink to ACS AuthorChoice
. 2021 Oct 28;7(11):3025–3033. doi: 10.1021/acsinfecdis.1c00262

Ex Vivo Plasmodium malariae Culture Method for Antimalarial Drugs Screen in the Field

Laurent Dembele †,*, Nouhoum Diallo †, Fanta Sogore †, Bintou Diarra †, Fatoumata I Ballo †, Amadou Daou †, Ousmaila Diakite †, Yacouba Bare †, Cheick Papa Oumar Sangare †, Aboubecrin Sedhigh Haidara †, Seidina A S Diakite †, Amadou Niangaly †, Mahamadou Diakite †, Brice Campo ‡, Gordon A Awandare §, Yaw Aniweh §, Abdoulaye A Djimde †,*
PMCID: PMC9974065  PMID: 34711047

Abstract

graphic file with name id1c00262_0005.jpg

In vitro and ex vivo cultivation of Plasmodium (P) falciparum has facilitated active research into the malaria parasite toward the quest for basic knowledge and the discovery of effective drug treatments. Such a drug discovery program is currently difficult for P. malariae simply because of the absence of in vitro and ex vivo cultivation system for its asexual blood stages supporting antimalarial evaluation. Despite availability of artemisinin combination therapies effective on P. falciparum, P. malariae is being increasingly detected in malaria endemic countries. P. malariae is responsible for chronic infections and is associated with a high burden of anemia and morbidity. Here, we optimized and adapted ex vivo conditions under which P. malariae can be cultured and used for screening antimalarial drugs. Subsequently, this enabled us to test compounds such as artemether, chloroquine, lumefantrine, and quinine for ex vivo antimalarial activity against P. malariae.

Keywords: malaria, nonfalciparum, Plasmodium malariae, ex vivo culture, drug discovery

Routine in vitro cultivation system of P. falciparum developed in 19761 has led to a greater understanding of the parasite biology and subsequently to the development of effective interventions such as drug treatment against the parasite that is responsible for the highest malaria-specific mortality rates globally. Six species of malaria parasites, P. falciparum, P. knowlesi, P. vivax, P. ovale curtisi, P. ovale wallikeri, and P. malariae, have been shown to infect humans.2 Recently, the simian P. cynomolgi(3,4) was detected in humans. However, P. falciparum is the only species for which most life cycle stages have been successfully cultured5 to enable research into the different aspects of malaria elimination such as drug screening. Efforts at cultivating Plasmodium parasites in vitro are complicated as each Plasmodium species has its own life cycle and set of physiological, metabolic, and nutritional requirements.6,7

As an alternative to the in vitro continuous culture, ex vivo culture techniques have been established to support major research activities, such as drug sensitivity testing. Ex vivo cultures are usually developed using fresh or cryopreserved field isolates of Plasmodium species. During culture adaptation the parasite undergo changes that may impair growth of the ex vivo cultured parasites.6 Tireless attempts have however enabled development of an improved ex vivo cultivation methods for the second most prevalent and the most widespread species P. vivax.8 Such ex vivo culture is currently providing useful data on P. vivax, such as sensitivity to antimalarial drugs,8−10 parasite biology, and invasion mechanisms.11

While artemisinin-based combination therapy has helped to significantly decrease P. falciparum transmission, morbidity, and mortality, persistent transmission of P. malariae is widely reported.12−14P. malariae is highly prevalent in malaria endemic areas such as the Amazon13 area and sub-Saharan Africa.12,14,15P. malariae is the second dominant species in sub-Saharan African and has been shown to be able to cause life threatening chronic infections and severe anemia, similar to the deadliest P. falciparum.15,16 These have all been shown to have negative socio-economic impact in the affected countries.15,16 However, no cultivation method has been developed to contribute to the development of new antimalarial drugs against P. malariae or providing insight into the parasites’ biology, such as the mechanism of invasion and mechanism of drug resistance. In our current study, we defined conditions in which P. malariae has grown and displayed increased parasitemia at 72 h time point. Using this as a tool, we have screened known antimalarial compounds such as chloroquine, lumefantrine, artemether, and quinine for their activity against P. malariae fresh field clinical isolates. This, we believe, will facilitate the testing of new lead compounds as well as facilitate further development in the protocol to allow for the study of the parasite’s biology.

Results

Morphological and Molecular Detection of Plasmodium Malariae

The samples obtained from the patients were Giemsa stained for the identification of the different parasite species using light microscopy. The microscopic screen identified P. falciparum, P. malariae, and P. ovale (Figure 1a). Morphologically, only ring and early trophozoite stages of P. falciparum were observed in the thin smears (Figure 1a, top panel), while other late blood stages were detected for the other nonfalciparum species (Figure 1a). Morphologically, trophozoites of P. malariae and P. ovale were slightly bigger than those of P. falciparum (Figure 1a top and second panel). Multiple infected erythrocytes were absent for nonfalciparum species. Erythrocytes infected with P. ovale trophozoite or schizont stages were enlarged and exhibited Schüffner’s dots (Figure 1a, third and fourth panel). The trophozoites of P. malariae were more compact than those of P. ovale. The host erythrocytes infected with P. malariae trophozoite or schizont were not enlarged (Figure 1a, second panel). An equatorial band characteristic of P. malariae trophozoite dividing the red blood cell was visible (Figure 1a, second panel). The samples were also screened for any possible P. vivax infection, but none were seen as expected based on its geographical distribution (Figure 1a). P. knowlesi was not monitored in the current study as the geographical distribution of this parasite makes unlikely its presence in Mali.

Figure 1.

Figure 1

Open in a new tab

Microscopy and molecular detection of Human malaria species. (A) Giemsa-stained asexual blood stages of Human malaria parasites and (B) molecular detection of human malaria parasites species in test samples 1–10 along with control for Pf = Plasmodium falciparum, Pm = Plasmodium malariae, Poc = Plasmodium ovale curtisi, Pow = Plasmodium ovale wallikeri, Pv = Plasmodium vivax. W1 = Control 1, W2 = Control 2, bp = Base pairs, and MW = Molecular weight.

To further confirm the species observed in the samples, DNA was extracted from the samples. Species specific primers were used to amplify the different samples and genotype all different species (Figure 1b and Table 1). The primers for P. falciparum yielded a 206bp product as observed on the top panel relative to the positive control Pf. The additional bands observed in P. falciparum gel are result of primer dimerization appearing under 100bp of our reference molecular weight (MW) that first band appear at 100bp. P. malariae yielded a 145 band (Figure 1b, second panel) compared to the positive control band Pm, P. ovale curtisi yielded 787–789 bp relative to Poc, while P. ovale wallikeri gave a product of size 782 bp relative to Pow. The genotyping for P. vivax yielded no product relative to the positive control at 121 bp. The PCR assay revealed that samples 5 and 10 were monoinfections of P. falciparum while samples 3, 8, and 9 were P. malariae monoinfections (Figure 1b and Table 1). Samples 1 and 2 were respectively mixed infections of P. ovale wallikeri with P. falciparum and Plasmodium ovale curtisi together with both P. malariae and P. falciparum (Figure 1b). P. malariae mixed infection with P. falciparum was detected in samples 4, 6, and 7 (Figure 1b and Table 1).

Table 1. Summary of the List of Samples and the Parasitic Species Present in Each Sample.

samples/ species 1 2 3 4 5 6 7 8 9 10
P. falciparum (Pf) + + – + + + + – – +
P. malariae (Pm) – + + + – + + + + –
P. ovale curtisi (Poc) – + – – – – – – – –
P. ovale wallikeri (Pow) + – – – – – – – – –
P. vivax (Pv) – – – – – – – – – –
species per samples Pf + Pow Pf + Pm + Poc Pm Pf + Pm Pf Pf + Pm Pf + Pm Pm Pm Pf
Open in a new tab

P. malariae Has Successfully Matured and Grown in an Ex Vivo Culture System

We have used freshly collected PCR confirmed clean P. malariae field isolates cultured in P. falciparum’s routine media lacking extra glucose for 72 h. When culture media were supplemented with 10% glucose, P. malariae parasites died in the culture within 24–48 h. With the growth media lacking the extra 10% glucose supplement, P. malariae viability, maturation, and growth was monitored daily using flow cytometry for 3 days as shown in Figure 2 and Figure 3c. Time zero hour (0 h) corresponds to the freshly collected field isolates displaying small nucleic acid content in FL1, box 1 and less mitochondrial activity signal in FL4, box 2 (Figure 2a) resulting from the very low parasitemia of this parasite. The clustering was typical of early asexual blood stage that usually circulate in the bloodstream (box 1 and box 2 Figure 2a). The DNA staining showed 0.6% positivity of the acquired cells (Box 1 Figure 2a) while the mitochondria staining (Box 2 Figure 2a) indicated that 0.5% of the 0.6% parasites were viable. Thus, only 0.1% of the parasites were not viable at the time 0 h of the culture. After 24 hours (24 h) in culture, no parasite maturation has been observed and viability remained the same as observed in time 0 h (Figure 2a,b). Interestingly following 48 and 72 h cultures, a clear maturation of the parasites was observed (Figure 2c,d boxes 1 and 2). Thus, P. malariae has successfully matured in ex vivo culture. A slight increase of parasitemia was also observed during the 48 h culture period (Figure 2c) but was higher (7.8-fold) in the 72 h (Figure 2d) when compared to the time 0 h parasitemia 0.5% (Figure 2a) and the parasite free controls (Figure 2e,f). In addition to flow cytometry approach, we assessed parasites maturation and growth using standard microscopy (Figure 3a). Ring stage was detected for the different parasite isolates at initiation of the assay at time 0 h, while P. malariae typical trophozoite stages were detected at the 24 h time point culturing. At the 48 h time point, late trophozoites and early schizonts were detected (Figure 3a) indicating maturation of P. malariae ex vivo. By the 72 h time point of maintaining the culture, new ring stages (>90%) and rare bursting schizonts were observed (Figure 3a). Microscopic assessment of P. malariae cultures showed no increase of the parasitemia from 0 to 48 h while high parasitemia was observed in 72 h cultures for five different isolates (Figure 3b). To finally confirm that P. malariae was successfully grown in ex vivo culture, 19 field isolates were cultivated and parasitemia of viable parasites were monitored for the period using FACS for 3 days (Figure 3c). The starting parasitemia were estimated at 0.5% at time 0 h. The percentage parasitemia at 24 and 48 h following culture were similar to that of time 0 h, 0.5% (Figure 3b). Similarly, in Figure 2d and Figure 3b the 72 h cultures showed a significant increase of parasitemia for all 19 field isolates (Figure 3c). Thus, P. malariae has fully matured and grown in ex vivo culture.

Figure 2.

Figure 2

Open in a new tab

P. malariae maturation and growth monitoring in ex vivo culture using flow cytometry. (a) Time 0 h freshly collected P. malariae asexual stages, (b) time 24 h cultured P. malariae asexual blood stages, (c) time 48 h cultured P. malariae asexual blood stages, and (d) time 72 h cultured P. malariae asexual blood stages, (e) culture starting 0 h time point negative control of parasite free red blood cells, (f) culture time 72 h end point negative control of parasite free red blood cells. iRBC = infected red blood cells.

Figure 3.

Figure 3

Open in a new tab

Plasmodium malariae maturation and growth. (a) Giemsa-stained P. malariae parasites at defined time points of the culture. (b) Five P. malariae isolates parasitemia at defined time points of the culture measured using light microscopy. (c) Nineteen field isolates of P. malariae comparative growth measured using flow cytometry. At time 0 h, 0.5% parasitemia of P. malariae asexual blood stages are cultured for 24, 48, and 72 h, and times respective parasitemia of viable parasites were evaluated using flow cytometry. Parasites were detected with Sybr Green while viability was measured using deep red mito-tracker.

P. malariaeExVivo Culture System Supported Screening of Antimalarial Drug

When establishing the ex vivo culture conditions of P. malariae field isolates, we set to evaluate the potential for antimalarial screen. P. malariae fresh field isolates were cultured and incubated with serially diluted concentrations of Artemether, lumefantrine, chloroquine, and quinine for 72 h (Figure 4). Dose response curves of artemether, lumefantrine, chloroquine and quinine are displayed in Figure 4a–d, respectively. It was observed that the different isolates obtained from different patients showed differential susceptibility to artemether, lumefantrine, chloroquine, and quinine (Table 2). All antimalarials potently inhibited P. malariae within 72 h drug exposure Figure 4 and Table 2.

Figure 4.

Figure 4

Open in a new tab

P. malariae sensitivity to references antimalarial drugs. (A) Dose response curves of artemether against P. malariae asexual blood stages. (B) Dose response curves of lumefantrine against P. malariae asexual blood stages. (C) Dose response curves of chloroquine against P. malariae asexual blood stages. (D) Dose response curves of quinine against P. malariae asexual blood stages.

Table 2. IC50 Values of Selected Antimalarial Drug Compounds against P. malariaea.

  IC50 (nM) against P. malariae
compounds isolate 1 isolate 2 isolate 3 isolate 4 isolate 5 std deviation
artemether 3.51 9.971 5.31 10.46 6.71 2.98
lumefantrine 75.7 23.03 36.32 62.84 44.89 20.94
chloroquine 38.81 44.48 40.19 40.1 46.84 3.41
quinine 23.6 19.95 34.83 23.78 17.24 6.69
Open in a new tab
a

These data are from five independent experiments done with five different field isolates of P. malariae. std deviation = standard deviation.

Discussion

In this current study, we established suitable conditions for the ex vivo culture of P. malariae that have successfully supported screening of antimalarial drugs against this parasite (Figures 2, 3, and 4). We first combined previously reported PCR conditions17 and light microscopy to accurately detect all plasmodium species. Morphologically, Plasmodium ring stages are similar and difficult to distinguish for all species while trophozoites and mature forms can be used to discriminate Plasmodium species. Trophozoites of P. falciparum are slightly smaller than those of other species. The presence of a few number of mature stages together with more trophozoite forms, as well as the absence of multiple infected erythrocytes, are highly suggestive of nonfalciparum species.18

After accurate detection of all Plasmodium species from field isolated samples, we set to identify ex vivo culture conditions for P. malariae. We used several modified P. falciparum’s culture conditions and only when standard culture conditions of P. falciparum lacking extra glucose supplement were used P. malariae was able to grow successfully. Interestingly, previous attempts to cultivate P. malariae in vitro that managed to observe reinvasion all have used culture media lacking extra glucose supplements.19,20P. malariae maturation and growth ex vivo were monitored using flow cytometry combining DNA and mitochondrial21,22 staining to determine viable parasites from all parasites (dead + live), respectively, with deep red mito-tracker and Sybr Green. Giemsa-stained thin blood smears slides examination using microscope remains the gold standard approach used for the detection, quantification, speciation, and staging of Plasmodium blood stages.23 However, this technique relies on the microscopists skills that should be well-trained to correctly assess parasitemia and also accurately identify the different parasite species and stages.24 This is also a time-consuming and very tedious approach often marred with human errors. Several reports indicated high concordance between flow cytometry and microscopy in determining parasitemia and Plasmodium maturation.25−30 Flow cytometry has the ability to resolve microscopic bias and challenges in assessing malaria parasites maturation and growth accurately and therefore make this technique the preferred approach.28,30 Within 24 h cultivation of P. malariae, no evidence of maturation was observed (Figure 2a,b). After 48 h in culture, a clear maturation evidenced by the flow cytometry data was observed (Figure 2c) with a slight increase of parasitemia from 0.5% 24 h to 0.8% 48 h (Figure 2b,c). When blood is collected from P. malariae infected patients, some rare schizont stage can still be observed and this slight increase in parasitemia might be due to those rare schizont bursts. In agreement with the 72 h asexual life cycle of P. malariae,18 substantial increase of parasitemia was observed after time 72 h in culture (Figure 2d and Figure 3b,c). Reports have indicated that P. malariae may produce from 6 to 14 merozoites per schizont with an average number of 818ex vivo. Interestingly, 7.8-fold increase in P. malariae parasitemia in our study indicated that the merozoites average was 8 per schizont (Figure 2d and Figure 3b,c) ex vivo, which indicates that our observed growth rate was within the expected range. Siddiqui et al. observed that only at the end of 72 h the majority of P. malariae parasites (62 to 64%) matured to segments and a new generation of rings (8–10%) was formed.20 Like in our current study, P. malariae entire asexual cycle was shown to be 72 h.19,20 Siddiqui et al. cultured P. malariae in Aotus trivirgatu blood while Lingnau et al. cultured P. malariae in human blood group B Rh-positive. Both authors have used RPMI media containing low glucose and assessed parasite using microscopy only. None of these methods have been tested to support antimalarial evaluation and discovery. The current article is developed as a tool for drug discovery using human blood samples assessing parasite culture by combining microscopy as in a previous report31 with SYBR GREEN and Mitotracker readouts; both were not used in the previous reports. Thus, viable parasites can be assessed accurately in our current article using the unbiased flow cytometry approach and the mitotracker unlike the previous report. The current article has shown that drug IC50 can be predicted using the method presented herein.

New antimalarial drugs are mainly identified and developed after extensive testing against P. falciparum, which is the most important species that can be continuously grown in vitro. Recent studies provided some drug susceptibility profile for P. vivax(8,32) and P. knowlesi.33 The parasite drug susceptibility studies are very important to inform lead optimization toward discovery of drug that can inhibit all Plasmodium species. Drug sensitivity profiles against P. malariae have been unavailable as this species had not been adapted to ex vivo and/or in vitro culture supporting drug screening. Having established ex vivo culture conditions of P. malariae, we set to evaluate the culture method potential for antimalarial screening against P. malariae. We show that our method allowed blood stage drug screens of the currently used antimalarials artemether, lumefantrine, chloroquine and quinine (Figure 4). The drug IC50 values measured for tested antimalarial against P. malariae were comparable34 to that reported earlier against P. falciparum.35,36 However, there are reports of P. malariae treatment failures using current P. falciparum treatments.12,37−40 In our recent work,31 many P. malariae field isolates also displayed a decreased susceptibility to currently used antimalarial artemether and lumefantrine as well as to chloroquine that is no longer used in Mali because of P. falciparum resistance. These differences could be due to factors such as host related pharmacokinetic and pharmacodynamic effects which are absent ex vivo or the extended 72 h intraerythrocytic stage life cycle of P. malariae that may lead to a treatment designed to treat P. falciparum being nonoptimal for P. malariae.31 A further rational that could explain P. malariae decreased susceptibility to currently used antimalarial would be true drug resistance occurring in this parasite in which molecular markers remain to be well determined and characterized. Thus, this report would further enable one to conduct comparative drug susceptibility between P. malariae and P. falciparum in other malaria endemic countries as recently reported in Mali.31 Large data from such comparative drug susceptibility study across malaria species could help various malaria control programs to target eliminate any Plasmodium specie.

Conclusion

In this study, P. malariae was successfully grown in P. falciparum’s culture conditions lacking extra 10% glucose supplement. This culture method allowed screening of antimalarial drugs against P. malariae clinical field isolates. This ex vivo culturing method of P. malariae offers a wealth of opportunities to study the parasite biology as well as screening for active novel antimalarial against P. malariae. Finally, flow cytometry may be a better approach than light microscopy in assessing P. malariae maturation.

Methods

Ethical Considerations

The current study protocol was reviewed and approved by the ethical committee of the Faculties of Medicine-Odonto-Stomatology and Pharmacy, University of Science, Techniques and Technologies of Bamako, Mali with the reference No2O17/141/CE/FMPOS and No2O19/168/CE/FMPOS/FAPH. Only participants or their parent/guardian who provided written informed consent, plus children able to understand the study and who gave assent were enrolled in this study. All patients with malaria that consented to participate in the study were enrolled and treated using recommended AL therapy or quinine in case of AL failure to clear the parasite.

Study Design, Site, and Population Screen

We conducted a cross-sectional screening and detection of all Plasmodium malaria cases during a longitudinal prospective study aimed at assessing ex vivo efficacy of panel of antimalarials against P. malariae. Thus, only freshly collected field isolates of P. malariae monoinfection parasites were used in the current study drug assay while PCR assay was used to detect P. malariae monoinfection samples from other Plasmodium species infection samples.

For PCR assay, DNA was extracted from dried blood spots using the QIAamp DNA Mini Kit (QIAgen, Valencia, CA, U.S.A.) following the manufacturer’s instruction. Using the small subunit rRNA 18s gene41 and the most advanced and reliable PCR techniques for the diagnosis of human malaria,17 we performed two nested PCR assays. The first for the diagnosis of the genus Plasmodium using the following genus-specific set of primers.17 Set 1 was rPLU1 (TCAAAGATTAAGCCATGCAAGTGA) and rPLU5 (CCTGTTGTTGCCTTAAACTTC). Set 2 was rPLU3 (TTTTTATAAGGATAACTAC GGAAAAGCTGT) and rPLU4 (TACCCGTCATAGCCATGTTAGGCCAATACC). The second nested PCR was to determine specific Plasmodium species using the following set of primers: Set 1 as above and Set 3 was rFAL1 (TTAAACTG GTTTGGGAAAACCAAATATATT) and rFAL2 (ACACAATGAACTCAATCATGAC TACCCGTC) for P. falciparum (206 bp); rVIV1 (CGCTTCTAGCTTAATCCACATA ACTGATAC) and rVIV2 (ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA) for P. vivax (121 bp); rMAL1 (ATAACATAGTTGTACGTTAAGAATAACCGC) and rMAL2 (AAAATTCCCATGCATAAAAAATTATACAAA) for P. malariae (145 bp); rOVA1 (ATCTCTTTTGCTATTTTTTAGTATTGGAGA) and rOVA2 (ATCTAAGAATTTCACC TCTGACATCTG) for P. ovale curtisi (787–789bp); and rOVA1v (ATCTCCTTTACTTTTTGTACTGGAGA) and rOVA2v (GGAAAAGGACACTATAATGTATCCTAATA) for P. ovale wallikeri (782 bp).

Compounds tested included chloroquine, lumefantrine, artemether, and quinine all from Sigma (Sigma-Aldrich, France). This study was conducted from September 2018 to October 2019 in Faladje, a rural village located in Koulikoro region at 80 km from Bamako. Malaria is hyperendemic and highly seasonal in Faladje. Children older than 1 year and nonpregnant adults with uncomplicated or asymptomatic malaria were enrolled if written informed consent was obtained from patients, parents, or guardians of children. Thick and thin smears were Giemsa-stained and immediately read for initial parasitemia screening, quantification, and for parasite speciation to identify P. malariae carriage. Patients with severe malaria, chronic HIV, or tuberculosis infection or who had taken antimalarial drugs during the past 14 days were excluded.

Samples Blood Collection and Processes

For ex vivo drug assay and parasite culture, we were using 3–6 h freshly collected P. malariae samples in this study. Three to 10 mL venous blood were collected into acid-citrate-dextrose vacutainers (Becton-Dickinson, Franklin Lakes, NJ, U.S.A.) from P. malariae carriers before any antimalarial medication. Blood samples were transported on ice packs between 2 and 4 °C from the field site to the laboratory. Thick and thin smears were prepared and stained with 10% Giemsa for double parasite quantification and speciation. Dried blood spots were made for plasmodial DNA extraction and amplification using polymerase chain reaction (PCR) assay to confirm monoinfection of P. malariae as previously described17 while blood samples were centrifuged to save plasma for further assessment. Red blood cell pellets were washed three times with incomplete RPMI-1640 (10.43 g of RPMI-1640, 5.96 g of HEPES, 2.5 g of NaHCO3, 2.5 mL of gentamicin 50 mg/mL for 1 L in H2O). Erythrocyte pellets were split into two by using one half for cryopreservation in glycerolyte and immediately stored at −80 °C. The other half was transferred into complete RPMI medium for ex vivo culture and drug assay. Complete RPMI medium contained 10.43 g of RPMI-1640, 5.96 g of HEPES, 2.5 g of NaHCO3, 1 mL of hypoxanthine, 5 g of Albumax, 2.5 mL of gentamicin 50 mg/mL in 1L of H2O lacking extra glucose supplement. The hematocrit of the red blood cell pellets in complete RPMI-1640 was 2% and the parasitemia 0.5%. Monitoring of the ex vivo cultures of P. malariae parasites was done timely as shown in Figure 1 from time 0 h to time 72 h. The ex vivo sensitivity of P. malariae parasites to chloroquine, lumefantrine, artemether, and quinine was assessed using 72 h combined Sybr Green and Mitotracker assay as previously reported21,22,31 in plates of 96 wells. Nineteen P. malariae isolates with ring stage >80% were used for the ex vivo cultivation, while 5 isolates with ring stage >90% were used for the ex vivo drug assay. Only PCR confirmed monoinfection cases of P. malariae were used to validate isolates used in this study. All compounds were prepared in 100% DMSO and diluted in complete RPMI-1640 with drug concentration ranging from 10 to 0.004 μM (8 points of 3-fold serial dilutions). Drug assay plates of freshly collected P. malariae contained compounds tested; 0.02% dimethyl sulfoxide (0.02% DMSO) and uninfected erythrocytes were incubated in a final volume of 120 μL and cultured at 37 °C in a gas atmosphere of 5% CO2 for 72 h. After 72 h, drug assay plates were washed (HBSS 1X + FBS 2%) and double stained with Sybr Green and deep red mitotracker. Plates stained were read on Accuri flow cytometer with 200 000 events. Sybr Green and deep red mitotracker were respectively used to measure acid nuclei content in FL1, boxes 1–2, and mitochondrial activity in FL4 box 2 (Figure 1 and 2). Parasite maturation and growth are both determined by the acid nuclei content while viability is measured though mitochondrial activity.

Dose–response curves and inhibitory concentrations 50% (IC50) were calculated by nonlinear regression analysis using GraphPad Prism software version 8 with the data previously normalized to the untreated controls. Statistical test was done using GraphPad Prism software version 8 and t test. A p value <0.05 was considered as significant.

Acknowledgments

This work was supported by a clinical research grant from European and Developing Countries Clinical Trials Partnership (EDCTP) (TMA2017CDF-1892-HypnoBio) and Medicines for Malaria Venture (RD-18-0067). L.D., Y.A., N.D., F.S., B.D., F.I.B., A.D., O.D., Y.B., C.P.O.S., A.S.H., A.N., and S.D. codesigned and performed the experiments. B.C. critically supported the assay conduction with important input in data analysis and manuscript preparation. L.D. and Y.A. analyzed the data. L.D., A.D., Y.A., and G.A.A., codesigned the project and wrote the manuscript. M.D. provided access to some important lab facilities. All authors critically revised the manuscript.

This project is part of the European and Developing Countries Clinical Trials Partnership (EDCTP2) program supported by the European Union (Grant TMA2017CDF-1892-HypnoBio) and the Medicines for Malaria Venture (RD-18–0067).

The authors declare no competing financial interest.

References

  1. Trager W.; Jensen J. B. Human Malaria Parasites in Continuous Culture. Science (Washington, DC, U. S.) 1976, 193 (4254), 673–675. 10.1126/science.781840. [DOI] [PubMed] [Google Scholar]
  2. Calderaro A.; Piccolo G.; Gorrini C.; Rossi S.; Montecchini S.; Dell’Anna M. L.; De Conto F.; Medici M. C.; Chezzi C.; Arcangeletti M. C. Accurate Identification of the Six Human Plasmodium Spp. Causing Imported Malaria, Including Plasmodium Ovale Wallikeri and Plasmodium Knowlesi. Malar. J. 2013, 12, 321. 10.1186/1475-2875-12-321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Grignard L.; Shah S.; Chua T. H.; William T.; Drakeley C. J.; Fornace K. M. Natural Human Infections With Plasmodium Cynomolgi and Other Malaria Species in an Elimination Setting in Sabah, Malaysia. J. Infect. Dis. 2019, 220 (12), 1946–1949. 10.1093/infdis/jiz397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Imwong M.; Madmanee W.; Suwannasin K.; Kunasol C.; Peto T. J.; Tripura R.; Von Seidlein L.; Nguon C.; Davoeung C.; Day N. P. J.; Dondorp A. M.; White N. J. Asymptomatic Natural Human Infections with the Simian Malaria Parasites Plasmodium Cynomolgi and Plasmodium Knowlesi. J. Infect. Dis. 2019, 219 (5), 695–702. 10.1093/infdis/jiy519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Hollingdale M. R. Is Culture of the Entire Plasmodium Cycle, in Vitro, Now a Reality?. Parasitol. Today 1992, 8, 223. 10.1016/0169-4758(92)90114-H. [DOI] [PubMed] [Google Scholar]
  6. Schuster F. L. Cultivation of Plasmodium Spp. Clin. Microbiol. Rev. 2002, 15 (3), 355–364. 10.1128/CMR.15.3.355-364.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Grande R.; Antinori S.; Meroni L.; Menegon M.; Severini C. A Case of Plasmodium Malariae Recurrence: Recrudescence or Reinfection?. Malar. J. 2019, 18, 169. 10.1186/s12936-019-2806-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Russell B.; Suwanarusk R.; Malleret B.; Costa F. T. M.; Snounou G.; Kevin Baird J.; Nosten F.; Rénia L. Human Ex Vivo Studies on Asexual Plasmodium Vivax: The Best Way Forward. Int. J. Parasitol. 2012, 42, 1063–1070. 10.1016/j.ijpara.2012.08.010. [DOI] [PubMed] [Google Scholar]
  9. Aguiar A. C. C.; Pereira D. B.; Amaral N. S.; De Marco L.; Krettli A. U. Plasmodium Vivax and Plasmodium Falciparum Ex Vivo Susceptibility to Anti-Malarials and Gene Characterization in Rondônia, West Amazon, Brazil. Malar. J. 2014, 13, 73. 10.1186/1475-2875-13-73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chaorattanakawee S.; Lon C.; Chann S.; Thay K. H.; Kong N.; You Y.; Sundrakes S.; Thamnurak C.; Chattrakarn S.; Praditpol C.; Yingyuen K.; Wojnarski M.; Huy R.; Spring M. D.; Walsh D. S.; Patel J. C.; Lin J.; Juliano J. J.; Lanteri C. A.; Saunders D. L. Measuring Ex Vivo Drug Susceptibility in Plasmodium Vivax Isolates from Cambodia. Malar. J. 2017, 16 (1), 392. 10.1186/s12936-017-2034-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Rangel G. W.; Clark M. A.; Kanjee U.; Lim C.; Shaw-Saliba K.; Menezes M. J.; Mascarenhas A.; Chery L.; Gomes E.; Rathod P. K.; Ferreira M. U.; Duraisingh M. T. Enhanced Ex Vivo Plasmodium Vivax Intraerythrocytic Enrichment and Maturation for Rapid and Sensitive Parasite Growth Assays. Antimicrob. Agents Chemother. 2018, 62 (4), e02519–17. 10.1128/AAC.02519-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Betson M.; Clifford S.; Stanton M.; Kabatereine N. B.; Stothard J. R. Emergence of Nonfalciparum Plasmodium Infection Despite Regular Artemisinin Combination Therapy in an 18-Month Longitudinal Study of Ugandan Children and Their Mothers. J. Infect. Dis. 2018, 217 (7), 1099–1109. 10.1093/infdis/jix686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Camargo-Ayala P. A.; Cubides J. R.; Niño C. H.; Camargo M.; Rodríguez-Celis C. A.; Quiñones T.; Sánchez-Suárez L.; Patarroyo M. E.; Patarroyo M. A. High Plasmodium Malariae Prevalence in an Endemic Area of the Colombian Amazon Region. PLoS One 2016, 11 (7), e0159968. 10.1371/journal.pone.0159968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Yman V.; Wandell G.; Mutemi D. D.; Miglar A.; Asghar M.; Hammar U.; Karlsson M.; Lind I.; Nordfjell C.; Rooth I.; Ngasala B.; Homann M. V.; Färnert A. Persistent Transmission of Plasmodium Malariae and Plasmodium Ovale Species in an Area of Declining Plasmodium Falciparum Transmission in Eastern Tanzania. PLoS Neglected Trop. Dis. 2019, 13 (5), e0007414. 10.1371/journal.pntd.0007414. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Roucher C.; Rogier C.; Sokhna C.; Tall A.; Trape J. F. A 20-Year Longitudinal Study of Plasmodium Ovale and Plasmodium Malariae Prevalence and Morbidity in a West African Population. PLoS One 2014, 9 (2), e87169. 10.1371/journal.pone.0087169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Langford S.; Douglas N. M.; Lampah D. A.; Simpson J. A.; Kenangalem E.; Sugiarto P.; Anstey N. M.; Poespoprodjo J. R.; Price R. N. Plasmodium Malariae Infection Associated with a High Burden of Anemia: A Hospital-Based Surveillance Study. PLoS Neglected Trop. Dis. 2015, 9 (12), e0004195. 10.1371/journal.pntd.0004195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Fuehrer H.-P.; Noedl H.; Doern G. V. Recent Advances in Detection of Plasmodium Ovale : Implications of Separation into the Two Species Plasmodium Ovale Wallikeri and Plasmodium Ovale Curtisi. J. Clin. Microbiol. 2014, 52 (2), 387–391. 10.1128/JCM.02760-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Collins W. E.; Jeffery G. M. Plasmodium Malariae: Parasite and Disease. Clin. Microbiol. Rev. 2007, 20 (4), 579–92. 10.1128/CMR.00027-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Lingnau A.; Doehring-Schwerdtfeger E.; Maier W. A. Evidence for 6-Day Cultivation of Human Plasmodium Malariae. Z. Parasitenkd. 1994, 80 (3), 265–266. 10.1007/BF00932687. [DOI] [PubMed] [Google Scholar]
  20. Siddiqui W. A.; Schnell J. V.; Geiman Q. M. In Vitro Cultivation of Plasmodium Malariae. J. Parasitol. 1972, 58 (4), 804. 10.2307/3278322. [DOI] [PubMed] [Google Scholar]
  21. Dembele L.; Ang X.; Chavchich M.; Bonamy G. M. C.; Selva J. J.; Lim M. Y.-X.; Bodenreider C.; Yeung B. K. S.; Nosten F.; Russell B. M.; Edstein M. D.; Straimer J.; Fidock D. A.; Diagana T. T.; Bifani P. The Plasmodium PI(4)K Inhibitor KDU691 Selectively Inhibits Dihydroartemisinin-Pretreated Plasmodium Falciparum Ring-Stage Parasites. Sci. Rep. 2017, 7, 2325. 10.1038/s41598-017-02440-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Dembele L.; Gupta D. K.; Lim M. Y.-X.; Ang X.; Selva J. J.; Chotivanich K.; Nguon C.; Dondorp A. M.; Bonamy G. M. C.; Diagana T. T.; Bifani P. IImidazolopiperazines Kill Both Rings and Dormant Rings in Wild-Type and K13 Artemisinin-Resistant Plasmodium Falciparum In Vitro. Antimicrob. Agents Chemother. 2018, 62 (5), e02235–17. 10.1128/AAC.02235-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Giemsa G. Eine Vereinfachung Und Vervollkommung Meiner Methylenazur-Methylenblau-Eosin-Fa ¨rbemethode Zur Erzielung Der Romanowsky-Nacht’schen Chromatin-Fa ¨ Rbung. Cent. fur Bakteriol. I Abteilung 1904, 37, 307–313. [Google Scholar]
  24. Maguire J. D; Lederman E. R; Barcus M. J; O'Meara W. A P.; Jordon R. G; Duong S.; Muth S.; Sismadi P.; Bangs M. J; Prescott W R.; Baird J K.; Wongsrichanalai C. Production and Validation of Durable, High Quality Standardized Malaria Microscopy Slides for Teaching, Testing and Quality Assurance during an Era of Declining Diagnostic Proficiency. Malar. J. 2006, 5, 92. 10.1186/1475-2875-5-92. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Li Q.; Gerena L.; Xie L.; Zhang J.; Kyle D.; Milhous W. Development and Validation of Flow Cytometric Measurement for Parasitemia in Cultures of P. Falciparum Vitally Stained with YOYO-1. Cytometry, Part A 2007, 71A (5), 297–307. 10.1002/cyto.a.20380. [DOI] [PubMed] [Google Scholar]
  26. Grimberg B. T.; Erickson J. J.; Sramkoski R. M.; Jacobberger J. W.; Zimmerman P. A. Monitoring Plasmodium Falciparum Growth and Development by UV Flow Cytometry Using an Optimized Hoechst-Thiazole Orange Staining Strategy. Cytometry, Part A 2008, 73A (6), 546–554. 10.1002/cyto.a.20541. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Bei A. K.; DeSimone T. M.; Badiane A. S.; Ahouidi A. D.; Dieye T.; Ndiaye D.; Sarr O.; Ndir O.; Mboup S.; Duraisingh M. T. A Flow Cytometry-Based Assay for Measuring Invasion of Red Blood Cells by Plasmodium Falciparum. Am. J. Hematol. 2010, 85 (4), 234–7. 10.1002/ajh.21642. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Malleret B.; Claser C.; Ong A. S. M.; Suwanarusk R.; Sriprawat K.; Howland S. W.; Russell B.; Nosten F.; Rénia L. A Rapid and Robust Tri-Color Flow Cytometry Assay for Monitoring Malaria Parasite Development. Sci. Rep. 2011, 1, 118. 10.1038/srep00118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Lelliott P. M.; Lampkin S.; McMorran B. J.; Foote S. J.; Burgio G. A Flow Cytometric Assay to Quantify Invasion of Red Blood Cells by Rodent Plasmodium Parasites in Vivo. Malar. J. 2014, 13, 100. 10.1186/1475-2875-13-100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Tiendrebeogo R. W; Adu B.; Singh S. K; Dodoo D.; Dziegiel M. H; Mordmuller B.; Nebie I.; Sirima S. B; Christiansen M.; Theisen M. High-Throughput Tri-Colour Flow Cytometry Technique to Assess Plasmodium Falciparum Parasitaemia in Bioassays. Malar. J. 2014, 13, 412. 10.1186/1475-2875-13-412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Dembele L.; Aniweh Y.; Diallo N.; Sogore F.; Sangare C. P. O.; Haidara A. S.; Traore A.; Diakité S. A. S.; Diakite M.; Campo B.; Awandare G. A.; Djimde A. A. Plasmodium Malariae and Plasmodium Falciparum Comparative Susceptibility to Antimalarial Drugs in Mali. J. Antimicrob. Chemother. 2021, 76 (8), 2079–2087. 10.1093/jac/dkab133. [DOI] [PubMed] [Google Scholar]
  32. Lu F.; Gao Q.; Chotivanich K.; Xia H.; Cao J.; Udomsangpetch R.; Cui L.; Sattabongkot J. In Vitro Anti-Malarial Drug Susceptibility of Temperate Plasmodium Vivax from Central China. Am. J. Trop. Med. Hyg. 2011, 85 (2), 197–201. 10.4269/ajtmh.2011.10-0070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. van Schalkwyk D. A.; Blasco B.; Davina Nuñez R.; Liew J. W. K.; Amir A.; Lau Y. L.; Leroy D.; Moon R. W.; Sutherland C. J. Plasmodium Knowlesi Exhibits Distinct in Vitro Drug Susceptibility Profiles from Those of Plasmodium Falciparum. Int. J. Parasitol.: Drugs Drug Resist. 2019, 9, 93–99. 10.1016/j.ijpddr.2019.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Cheruiyot A. C.; Auschwitz J. M.; Lee P. J.; Yeda R. A.; Okello C. O.; Leed S. E.; Talwar M.; Murthy T.; Gaona H. W.; Hickman M. R.; Akala H. M.; Kamau E.; Johnson J. D. Assessment of the Worldwide Antimalarial Resistance Network Standardized Procedure for in Vitro Malaria Drug Sensitivity Testing Using SYBR Green Assay for Field Samples with Various Initial Parasitemia Levels. Antimicrob. Agents Chemother. 2016, 60 (4), 2417–2424. 10.1128/AAC.00527-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Wong R. P. M.; Lautu D.; Tavul L.; Hackett S. L.; Siba P.; Karunajeewa H. A.; Ilett K. F.; Mueller I.; Davis T. M. E. In Vitro Sensitivity of Plasmodium Falciparum to Conventional and Novel Antimalarial Drugs in Papua New Guinea. Trop. Med. Int. Health 2010, 15 (3), 342–349. 10.1111/j.1365-3156.2009.02463.x. [DOI] [PubMed] [Google Scholar]
  36. Tinto H.; Bonkian L. N.; Nana L. A.; Yerbanga I.; Lingani M.; Kazienga A.; Valéa I.; Sorgho H.; Kpoda H.; Guiguemdé T. R.; Ouédraogo J. B.; Mens P. F.; Schallig H.; D’Alessandro U. Ex Vivo Anti-Malarial Drugs Sensitivity Profile of Plasmodium Falciparum Field Isolates from Burkina Faso Five Years after the National Policy Change. Malar. J. 2014, 13, 1–7. 10.1186/1475-2875-13-207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Kugasia I. R.; Polara F. K.; Assallum H. Recrudescence of Plasmodium Malariae after Quinine. Case Rep. Med. 2014, 1. 10.1155/2014/590265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Visser B. J.; Wieten R. W.; Kroon D.; Nagel I. M.; Bélard S.; Van Vugt M.; Grobusch M. P. Efficacy and Safety of Artemisinin Combination Therapy (ACT) for Non-Falciparum Malaria: A Systematic Review. Malar. J. 2014, 13, 463. 10.1186/1475-2875-13-463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Rutledge G. G.; Marr I.; Huang G. K. L.; Auburn S.; Marfurt J.; Sanders M.; White N. J.; Berriman M.; Newbold C. I.; Anstey N. M.; Otto T. D.; Price R. N. Genomic Characterization of Recrudescent Plasmodium Malariae after Treatment with Artemether/Lumefantrine. Emerging Infect. Dis. 2017, 23 (8), 1300–1307. 10.3201/eid2308.161582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Sagara I.; Beavogui A. H.; Zongo I.; Soulama I.; Borghini-Fuhrer I.; Fofana B.; Traore A.; Diallo N.; Diakite H.; Togo A. H.; Koumare S.; Keita M.; Camara D.; Somé A. F.; Coulibaly A. S.; Traore O. B.; Dama S.; Goita S.; Djimde M.; Bamadio A.; Dara N.; Maiga H.; Sidibe B.; Dao F.; Coulibaly M.; Alhousseini M. L.; Niangaly H.; Sangare B.; Diarra M.; Coumare S.; Kabore M. J. T.; Ouattara S. M.; Barry A.; Kargougou D.; Diarra A.; Henry N.; Soré H.; Bougouma E. C.; Thera I.; Compaore Y. D.; Sutherland C. J.; Sylla M. M.; Nikiema F.; Diallo M. S.; Dicko A.; Picot S.; Borrmann S.; Duparc S.; Miller R. M.; Doumbo O. K.; Shin J.; Gil J. P.; Björkman A.; Ouedraogo J. B.; Sirima S. B.; Djimde A. A. Pyronaridine–Artesunate or Dihydroartemisinin–Piperaquine versus Current First-Line Therapies for Repeated Treatment of Uncomplicated Malaria: A Randomised, Multicentre, Open-Label, Longitudinal, Controlled, Phase 3b/4 Trial. Lancet 2018, 391 (10128), 1378–1390. 10.1016/S0140-6736(18)30291-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Snounou G.; Viriyakosol S.; Jarra W.; Thaithong S.; Brown K. N. Identification of the Four Human Malaria Parasite Species in Field Samples by the Polymerase Chain Reaction and Detection of a High Prevalence of Mixed Infections. Mol. Biochem. Parasitol. 1993, 58 (2), 283–292. 10.1016/0166-6851(93)90050-8. [DOI] [PubMed] [Google Scholar]

Articles from ACS Infectious Diseases are provided here courtesy of American Chemical Society

RESOURCES