Abstract
Introduction
Chronic kidney disease (CKD) is a major public health issue worldwide, which is characterized by irreversible loss of nephron and renal function. However, the molecular mechanism of CKD remains underexplored.
Methods
This study integrated three transcriptional profile datasets to investigate the molecular mechanism of CKD. The differentially expressed genes (DEGs) between Sham control (Con) and unilateral ureteral obstruction (UUO)-operated mice were analyzed by utilizing the limma package in R. The shared DEGs were analyzed by Gene Ontology and functional enrichment. Protein-protein interactions (PPIs) were constructed by utilizing the STRING database. Hub genes were analyzed by MCODE and Cytohubba. We further validated the gene expression by using the other dataset and mouse UUO model.
Results
A total of 315 shared DEGs between Con and UUO samples were identified. Gene function and KEGG pathway enrichment revealed that DEGs were mainly enriched in inflammatory response, immune system process, and chemokine signaling pathway. Two modules were clustered based on PPI network analysis. Module 1 contained 13 genes related to macrophage activation, migration, and chemotaxis. Ten hub genes were identified by PPI network analysis. Subsequently, the expression levels of hub genes were validated with the other dataset. Finally, these four validated hub genes were further confirmed by our UUO mice. Three validated hub genes, Gng2, Pf4, and Ccl9, showed significant response to UUO.
Conclusion
Our study reveals the coordination of genes during UUO and provides a promising gene panel for CKD treatment. GNG2 and PF4 were identified as potential targets for developing CKD drugs.
Keywords: Chronic kidney disease, Unilateral ureteral obstruction, Differentially expressed genes, Protein-protein interaction, Hub genes, Bioinformatic analysis
Introduction
Chronic kidney disease (CKD) is a global public health issue with rising incidence and prevalence rates, that inevitably progresses to end-stage renal disease when faced with excessive loss of nephrons and gradual decline of renal function [1, 2]. The characters of the initiation and progression of CKD are inflammation, oxidative stress and fibrosis [3, 4]. Although prominent events triggered the initiation and progression of CKD have been studied widely, it is still urgent to identify the effective biomarkers or gene targets for suppressing the development of CKD.
Renal inflammation, including pro-inflammatory milieu and immune dysfunction, has been considered an important determinant factor throughout initiation and progression of CKD, regardless of initiating causes [5]. Once stimulated by various pathogenic components, renal parenchymal cells and immune cells secrete various inflammatory mediators, such as chemokines and cytokines, which in turn recruit more immune cells and lead to vicious cycle and fibrosis development [6–8]. Although numerous studies have demonstrated that chemokines and immune response are tightly associated with CKD, the roles of chemokines and immune cells still need to be further explored.
Chemokines, belonging to chemotactic cytokines, are classified into 4 subfamilies, including CCL, CXCL, CX3CL, and XCL. Chemokines and their receptors are tightly associated with the development of CKD via recruiting multiple inflammatory cells [9, 10]. CCL2 is upregulated in the glomerulus and tubulointerstitium of CKD. The CCL2/CCR2 axis involves in activation and infiltration of macrophages to damage sites and finally induce interstitial renal fibrosis [11]. Deficiency of CCL2 ameliorates renal artery stenosis-induced interstitial inflammation and fibrosis [12]. The enhanced CX3CL1/CX3CR1 axis is observed in the kidney of human and animal CKD models and contributes to infiltration of immune cells and the progression of fibrosis. However, inhibition of CX3CL1/CX3CR1 axis by deficiency or antagonists suppresses the progression of renal fibrosis and impairment in CKD [13]. Increased CCL17 was observed in CKD patients along with decrease of renal function [10]. Although the role of chemokines and their receptors in inciting the development of CKD has been demonstrated, the research on the up- and downstream of chemokines also needs to be further deepened.
This led us to explore the mechanism that regulates renal inflammation in the development of CKD. In the current study, by using multiple bioinformatic analyses of three GEO datasets, hub gene validation of other datasets, and unilateral ureteral obstruction (UUO) operated mice experiment, we found that the expressions of two key genes, Gng2 and Pf4, increased significantly with the development of CKD. These findings indicate that GNG2 and PF4 may be potential molecular biomarkers or targets for the initiation and development of CKD.
Materials and Methods
Affymetrix Microarray Data Information
The profile datasets GSE38117, GSE87212, GSE125015, and GSE121190 were obtained from the NCBI Gene Expression Omnibus (GEO, https://www.ncbi.nlm.nih.gov/geo/) database. The detailed information for these datasets is presented in Table 1. The datasets GSE38117, GSE87212, and GSE125015 were used for analyzing differentially expressed genes (DEGs), function enrichment, protein-protein interactions (PPIs), and hub genes. The dataset GSE121190 was utilized for validating the gene expression levels of hub genes.
Table 1.
The information of datasets downloaded from NCBI Gene Expression Omnibus (GEO)
| Dataset | Study | Platform | Organism | Sacrificed day after ligation | Sample | |
|---|---|---|---|---|---|---|
| Sham | UUO | |||||
| GSE38117 | Lecru L, 2015 | GPL4134 | Mus musculus | 8 | 3 | 3 |
| GSE87212 | Vaidya V, 2017 | GPL19057 | Mus musculus | 10 | 4 | 4 |
| GSE125015 | Wu H, 2020 | GPL21493 | Mus musculus | 10 | 4 | 4 |
| GSE121190 | Higashi AY, 2019 | GPL11180 | Mus musculus | 14 | 3 | 3 |
UUO, unilateral ureteral obstruction.
Identification of DEGs
The mean value of multiple probes was calculated for a single gene. The DEG identification between Sham control (Con) and UUO groups was performed using the limma (linear models for microarray data) package in R [14]. The |log2 fold change|> 2 and p values <0.05 were considered the threshold for the DEG selection. The shared DEGs were identified by the venn diagram of DEGs.
Functional and KEGG Pathway Enrichment Analysis of DEGs
DAVID (https://david.ncifcrf.gov/) is an online gene functional annotation database for analyzing the comprehensive sets of the biological meaning of candidate genes [15]. The DEGs were analyzed by DAVID for enriched Gene Ontology (GO) terms (including biological processes (BP), cellular components, and molecular functions) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway related to UUO.
PPI Network Construction and Module Analysis
To predict the PPI network of the DEGs, we used the Search Tool for the Retrieval of Interacting Genes (STRING, https://string-db.org/) database, a global online database [16]. The cut-off values were set at combined scores >0.9. Cytoscape (version 3.7.1) was used for PPI network construction [17], and the plug-in APP Molecular Complex Detection (MCODE) was employed to select notable modules within this PPI network [18]. The criteria were set at MCODE scores >7, node cut-off = 0.2, k-core = 2, and maximum depth = 100. Function enrichment of genes in module 1 was analyzed by STRING for enriched GO terms and KEGG pathway. Cytohubba, an APP in Cytoscape, was used to identify hub genes within the PPI network. According to the maximal clique centrality (MCC) method, top ten hub genes were identified and ranked. Additionally, ten hub genes were analyzed by GeneMANIA (http://genemania.org/), which is a gene function prediction web platform to investigate gene-gene interactions and predict the function of genes and gene sets [19].
Animal Model
Age- and weight-matched male C57BL/6 N mice (8- to 12-week-old, 20–29 g) were used in the present experiments. All mice were housed at the Center for Animal Experiments of Wuhan University in specific pathogen-free environments. The experiments were approved by the Ethics Committee of Tongren Hospital, and carried out in keeping with the guidelines of the National Health and Medical Research Council of China. For establishing the UUO model, the left ureter of mice was exposed and tied off with silk suture after anesthetizing with 30% isoflurane; Con mice were suffering the same operation without ligation. Mice were sacrificed for further experiments at 7 and 14 days after operation.
Quantitative Real-Time PCR
Total RNA was obtained from dissected kidneys by utilizing TRIzol reagents (Sigma-Aldrich, St. Louis, MO, USA). cDNA was obtained by mRNA transcription. Quantitative real-time PCR was carried out using the ABI7900 real-time PCR system (Illumina Eco, USA) with SYBR Premix Ex Taq II (Takara Bio, Otsu, Japan). The sequences of primers used are presented in Table 2.
Table 2.
Sequences of quantitative real-time PCR primers
| Probe | Sense | Antisense |
|---|---|---|
| α-sma | AGCCATCTTTCATTGGGATGG | CCCCTGACAGGACGTTGTTA |
| Fn | GGCCACCATTACTGGTCTGG | GGAAGGGTAACCAGTTGGGG |
| Gng2 | GACCTCACCACCCATCTGC | CCTGGCAGATCTGACTTGCT |
| Pf4 | GTTCCCCAGCTCATAGCCACC | TTATATAGGGGTGCTTGCCGGT |
| Ccl9 | GCCCAGATCACACATGCAAC | AGGACAGGCAGCAATCTGAA |
| Lpar3 | CCAACCTCCTGGCCTTCTTC | CCACGAAGGCGCCTAAGAC |
| Gapdh | GGTTGTCTCCTGCGACTTCA | TGGTCCAGGGTTTCTTACTCC |
Western Blotting
The Western blotting on tissue lysates was performed as described [20]. In brief, total protein lysates were loaded into SDS-PAGE and transferred onto PVDF membrane (Merch Millipore, Darmstadt, Germany). After incubating with TBS containing 5% skim milk for 1 h at room temperature, the membrane incubated with rabbit polyclonal antibody against α-SMA (14395-1-AP, 1:1,000), mouse monoclonal antibody against fibronectin (FN) (66042-1-Ig, 1:1,000), and mouse monoclonal antibody against GAPDH (sc-365062, 1:2,500) primary antibodies overnight at 4°C and incubated with secondary antibodies for 1 h at room temperature. Band density was detected with the Odyssey CLX Infrared Image System (LI-COR Biosciences, Lincoln, NE, USA), and quantified using NIH ImageJ software.
Morphometric Analysis
Paraffin-embedded sections with 4 μm thickness from each isolated kidney were stained with hematoxylin and eosin or Sirius red following the standard procedure, respectively. The tubular damage and tubulointerstitial fibrosis were measured as described [21].
Immunofluorescence Staining
Paraffin-embedded slides with 4 μm thickness were deparaffinized and blocked with 10% normal donkey serum (Vector laboratories, Burlington, Canada) dissolved in PBS. Subsequently, the slides were incubated with α-SMA and FN primary antibodies, then incubated with Alexa Flour 488-conjugate secondary antibody. Finally, slides were stained with DAPI (Life Technologies, Carlsbad, CA, USA). Ten fields (×200 magnification) were randomly selected from 5 individual mice in each group, and the percentage of positive area was semiquantitated utilizing NIH ImageJ software (http://resbweb.nih.gov/ij/).
Statistics
Statistical analyses were performed with SPSS version 23 (IBM-SPSS Inc., Chicago, IL, USA) using unpaired 2-tailed t test and one-way ANOVA multiple comparisons. All results are expressed as the mean ± standard error. The p value <0.05 was considered significant.
Results
Identification of DEGs in UUO
A total of 686, 2,084, and 1,644 DEGs were identified from GSE38117, GSE87212, and GSE125015 datasets, respectively. Volcano plots indicated the upregulated and downregulated DEGs between Con and UUO samples (Fig. 1a). These heatmaps demonstrated the distinct expression levels of DEGs in three datasets (Fig. 1b).
Fig. 1.
Identification of differentially expressio genes (DEGs) in three datasets (GSE38117, GSE87212, and GSE125015). a The volcano plot of the DEGs. b The heatmap of DEGs. Red indicates the upregulated genes, and green represents the downregulated genes. The threshold of DEG selection is p value <0.05 and log2FC >2. FC, fold change.
GO Enrichment and KEGG Pathway Analyses
315 shared DEGs were identified in all three datasets (Fig. 2a), including 272 upregulated and 43 downregulated DEGs in UUO compared with Con. To identify further insights into the functional enrichment of shared DEGs and key candidate pathways in the development of UUO-induced obstructive nephropathy, GO terms and KEGG pathway for the DEGs were performed by DAVID. The result showed that the shared DEGs were significantly enriched in processes such as inflammatory response, innate immune response, and immune system process, in BP (Fig. 2b). For the cellular component (CC), the shared DEGs were mainly enriched in the membrane, extracellular region, extracellular exosome, etc. (Fig. 2c). The shared DEGs of molecular function (MF) were most related to protein binding, peptidase activity, etc. (Fig. 2d). Meanwhile, for the enriched KEGG pathways, the shared DEGs were most related to tuberculosis, osteoclast differentiation, chemokine signaling pathway, etc. (Fig. 2e). For the Reactome pathways, the shared DEGs were mainly enriched in platelet degranulation, GPVI-mediated activation cascade generation of second messenger, cell surface interactions at the vascular wall, degradation of the extracellular matrix, etc. (Fig. 2f).
Fig. 2.
Functional enrichment analyses of DEGs. a Venn diagram of 315 shared DEGs. b–d The top ten significantly enriched GO terms in biological process (BP) (b), cellular component (CC) (c), and molecular function (MF) (d) are ranked for the shared DEGs. e–f The top 10 KEGG (e) and Reactome (f) pathways. FDR <0.05 is set as the threshold.
PPI Network Construction and Module Analysis
The PPI network of the shared DEGs was built, containing 314 nodes and 438 edges, using the STRING database (Fig. 3a). The top two significant modules were further identified using the Cytoscape APP MCODE (Fig. 3b–c; Table 3). Module 1 contained thirteen genes, Gng2, Gpr18, Gpsm3, Sucnr1, Ccl5, Lpar3, Pf4, Cx3cr1, Anxa1, P2ry12, Ccl9, C3ar1, and Ccl6. Module 1 ranked the highest score, indicating the core function of these genes. The GO functions of the module 1 were related to macrophage activation, migration, and chemotaxis (BPs), chemokine receptor binding and chemokine activity (molecular functions), and extracellular organelles and space (cellular components) (Table 4). KEGG and Reactome pathways implied that these thirteen genes were significantly enriched in chemokine signaling pathway, cytokine-cytokine receptor interaction, hemostasis, and signaling transduction. Chemokine, chemokine interleukin-8-like domain, and G protein-coupled receptor were the features revealed by INTERPRO protein domain analysis (Table 4).
Fig. 3.
PPI network construction and modules identification. a PPI network construction using online database STRING. The nodes in cluster represented different proteins, and the edges between the nodes indicated interactions between two proteins. b–c Top two significant modules were identified from the PPI network. The scores in module 1 and 2 are 13 and 8, respectively. Red nodes indicated the upregulated genes, and green nodes presented the downregulated genes.
Table 3.
The top two modules identified by MCODE based on the 315 shared DEGs
| Module | Score | Node | Edge | Gene symbol |
|---|---|---|---|---|
| 1 | 13 | 13 | 78 | Gng2, Gpr18, Gpsm3, Sucnr1, Ccl5, Lpar3, Pf4, Cx3cr1, Anxa1, P2ry12, Ccl9, C3ar1, Ccl6 |
| 2 | 8 | 8 | 28 | Srgn, Tgfb1, Fermt3, Serpina3g, Sparc, F13a1, Fn1, Serping1 |
Table 4.
Functional and pathway enrichment analyses of module 1
| Term | Description | Count | Strength | FDR |
|---|---|---|---|---|
| BP | ||||
| GO:0002281 | Macrophage activation involved in immune response | 2 of 12 | 2.45 | 2.90E−04 |
| GO:1905523 | Positive regulation of macrophage migration | 3 of 22 | 2.36 | 8.17E−06 |
| GO:0033630 | Positive regulation of cell adhesion mediated by integrin | 2 of 20 | 2.23 | 6.60E−04 |
| GO:0010759 | Positive regulation of macrophage chemotaxis | 2 of 20 | 2.23 | 6.60E−04 |
| GO:0002548 | Monocyte chemotaxis | 3 of 31 | 2.22 | 1.77E−05 |
| Molecular function | ||||
| GO:0008009 | Chemokine activity | 4 of 41 | 2.22 | 1.19E−06 |
| GO:0048020 | CCR chemokine receptor binding | 3 of 35 | 2.16 | 3.73E−05 |
| GO:0008201 | Heparin binding | 2 of 139 | 1.39 | 2.42E−02 |
| GO:0004930 | G protein-coupled receptor activity | 6 of 533 | 1.28 | 1.15E−05 |
| GO:0098772 | Molecular function regulator | 6 of 1,573 | 0.81 | 1.30E−03 |
| Cellular component | ||||
| GO:0043230 | Extracellular organelle | 2 of 96 | 1.55 | 4.32E−02 |
| GO:0005615 | Extracellular space | 5 of 1,131 | 0.87 | 1.68E−02 |
| GO:0005886 | Plasma membrane | 9 of 4,328 | 0.55 | 1.68E−02 |
| KEGG pathways | ||||
| mmu04062 | Chemokine signaling pathway | 6 of 179 | 1.75 | 1.73E−08 |
| mmu04060 | Cytokine-cytokine receptor interaction | 5 of 252 | 1.53 | 4.06E−06 |
| Reactome pathways | ||||
| MMU-162582 | Signal transduction | 10 of 1,459 | 1.07 | 7.91E−10 |
| MMU-109582 | Hemostasis | 3 of 484 | 1.02 | 2.60E−03 |
| Protein domains and features (InterPro) | ||||
| IPR000827 | CC chemokine, conserved site | 3 of 18 | 2.45 | 1.90E−06 |
| IPR039809 | Chemokine beta/gamma/delta | 3 of 24 | 2.33 | 3.13E−06 |
| IPR036048 | Chemokine interleukin-8-like superfamily | 4 of 39 | 2.24 | 2.38E−07 |
| IPR001811 | Chemokine interleukin-8-like domain | 4 of 39 | 2.24 | 2.38E−07 |
| IPR000276 | G protein-coupled receptor, rhodopsin-like | 6 of 1,398 | 0.86 | 4.10E−04 |
FDR, false discovery rate.
Hub Genes Analysis
Based on the MCC algorithm, ten hub genes were further identified by Cytoscape APP Cytohubba, including Gng2, Ccl6, Ccl9, Anxa1, Lpar3, Pf4, C3ar1, Sucnr1, Gpsm3, and Gpr18 (Fig. 4a). We further investigated the interaction network of these hub genes and their neighboring genes using GeneMANIA database. As shown in Figure 4b, these interaction networks existed correlations of co-expression (65.99%), predicted (13.23%), shared protein domains (10.40%), and co-localization (10.38%).
Fig. 4.
Interactions and mRNA expression levels of hub genes. a Top ten hub genes were identified based on MCC algorithm. b Gene-gene interaction network of top ten hub genes and its neighboring genes manifest different correlations. c The mRNA expression levels of hub genes in GSE121190 are presented. *p < 0.05.
The mRNA expression levels of these ten hub genes were validated in the dataset GSE121190. The expression levels of Gng2, Ccl9, and Pf4 were significantly upregulated, while the expression levels of Lpar3 were dramatically downregulated in the UUO group (Fig. 4c).
Gene Expression Detection after UUO
To figure out the expression changes of the four key genes during renal fibrosis, we established the UUO mouse model for 7 days (7d) and 14 days (14d). We found that damaged tubular number and interstitial fibrotic percentage were significantly increased in both UUO 7d and 14d compared to kidneys from Con, as shown by hematoxylin and eosin and Sirius red staining (Fig. 5a–b). The expression of the fibrotic markers, FN and α-SMA, were dramatically augment in UUO-induced mice compared to those in Con mice as examined by immunofluorescence staining (Fig. 5c). More severe fibrotic lesions were found in UUO 14d compared to those in UUO 7d (Fig. 5b–c). To further confirm above data, we investigated mRNA and protein levels of the fibrotic markers. mRNA and protein expressions of α-SMA and FN were significantly increased in both UUO 7d and UUO 14d compared to those in Con (Fig. 6a–b). We then investigated mRNA levels of the four key genes in our established UUO mice. Consistent with the data of datasets, the mRNA levels of Gng2 and Pf4 were markedly upregulated in both UUO 7d and UUO 14d compared with those in Con. Higher expression levels of Pf4 mRNA were manifested in UUO 14d than UUO 7d. Unexpectedly, the mRNA level of Ccl9 was significantly downregulated in both UUO 7d and 14d. Nevertheless, no significant change of Lpar3 mRNA expression level was observed among these groups (Fig. 6c).
Fig. 5.
Tubular damage and fibrotic level after UUO. Representative images of H&E (a) and Sirius red (b) from the indicated groups in left panel. Semi-quantitative data of tubular damage and interstitial fibrosis in right panel. c Representative images of IF staining for FN (green) and α-SMA (green) from the indicated groups in left panel. DAPI (blue) is co-stained for visualizing cell nuclei. Scale bar, 50 μm for up panel of H&E and Sirius red, 20 μm for FN and α-SMA staining, and down panel of H&E and Sirius red. The positive areas of FN and α-SMA are semi-quantitative in right panel. *p < 0.05, **p < 0.01, and ***p < 0.001. H&E, hematoxylin and eosin; IF, immunofluorescence.
Fig. 6.
The expressions of the fibrotic markers and key genes. The mRNA (a) and protein (b) levels of the fibrotic markers in the whole kidney at 7 and 14 days after UUO operation, respectively. c The mRNA levels of the key gene, Gng2, Pf4, Ccl9, and Lpar3 in the whole kidney lysis at 7 and 14 days after UUO, respectively. *p < 0.05, **p < 0.01, and ***p < 0.001.
Discussion
Although there have been numerous explorations of the pathogenesis in CKD, there is still an urgent need to discover effective targets for preventing the development of CKD. In this study, we analyzed and identified the potential novel gene targets or biomarkers in CKD based on bioinformatic analysis of microarray datasets. By integrative analysis of three datasets, GSE38117, GSE87212, and GSE125015, 315 shared DEGs between UUO and control groups were identified. Ten top hub genes, including Gng2, Ccl6, Ccl9, Anxa1, Lpar3, Pf4, C3ar1, Sucnr1, Gpsm3, and Gpr18, ranked the highest MCC score. Subsequently, Gng2, Ccl9, Lpar3, and Pf4 were validated by the other dataset GSE121190 and our UUO-induced mouse model. The mRNA levels of Gng2 and Pf4 were upregulated with the development of CKD; however, the mRNA level of Ccl9 was downregulated in UUO mice. Together, our findings suggest that GNG2 and PF4 may be as potential molecular biomarkers or targets for the development of CKD.
Heterotrimeric guanine nucleotide binding proteins (G proteins) are crucial molecular switches for transmitting signal from G protein-coupled receptor (GPCR) to various downstream effectors [22]. The G proteins, composed of α, β, and γ subunits, are involved in a variety of BPs, including cell proliferation, inflammation, and immune response [23]. The first key gene, G protein subunit gamma 2 (Gng2)-encoded protein GNG2, is a member of the Gγ subunit. It has been reported that GNG2 regulated the inflammatory response during the progression of abdominal aortic aneurysm via interacting with chemokine CXCL1 and its receptor CCR7 [24]. Although the 3’ untranslated region polymorphism of GNG2 is associated with the risk of IgA nephritis in the Chinese Han population [25], there is no direct evidence that showed the role of GNG2 in renal inflammation and fibrosis. Systemic treatment of gallein, an inhibitor of Gβγ subunit-dependent signaling, downregulated renal inflammation and finally protected renal function in AKI and cardiorenal syndrome type 2 models [26, 27]. Therefore, specific inhibition of G proteins, even Gβγ subunits, may be a good alternative strategy for treating multiple diseases [23, 28, 29]. Regarding the role of GNG2 in renal inflammation, further exploration is still needed.
Platelet factor 4 (PF4), also known as C-X-C motif ligand 4 (CXCL4), is a chemokine abundantly expressed in platelet α-granule [30]. It is also expressed in various inflammatory cells, such as monocytes, activated T cells, and plasmacytoid dendritic cells (pDCs) [31, 32]. Accumulated evidence has demonstrated that PF4 plays a key role in a variety of pathophysiological processes, including inflammation, angiogenesis, and cancer [32]. PF4 derived from platelets and other cells participates in the inflammatory response and/or fibrosis in many organs [31–33]. In CCL4-and thioacetamide-induced chronic liver fibrosis model, knockout PF4 increased expression levels of hepatic stellate cells and platelet-derived PF4 in lesions related to the liver inflammatory response and fibrosis progression [33]. The deficiency of PF4 reduced the infiltration of neutrophils and CD8-positive T cells and ultimately moderated liver fibrosis [33]. In a primary myelofibrosis (a type of myeloproliferative tumor that leads to progressive myelofibrosis) model, specific knockout of PF4 in hematopoietic stem and progenitor cells inhibited the activation of JAK/STAT signaling pathway, and reduced IL6 expression. Then, inhibition of IL6 promoted the myofibroblast phenotype manifested Gli1+ mesenchymal stromal cells, ultimately moderated the severity of myelofibrosis and reduced progressive anemia [32]. Furthermore, the complex of PF4 and DNA activates pDC via binding to TLR9 on pDC, which in turn cause inflammatory response of the system hardened skin [31]. However, administration of exogenous rat-derived PF4 can reduce the production of IL17 in Th17 cells and limit the differentiation of Th17 to alleviate inflammation and renal interstitial fibrosis in rat allogenic kidney transplantation [34]. Although the relationship between PF4 and inflammatory response has been studied for more than 30 years, the role of PF4 in inflammatory response is still contradictory. Therefore, the mechanism of PF4 in CKD and UUO animal models needs to be explored.
C-C motif chemokine ligand 9 (Ccl9) is a murine CC chemokine, and the corresponding human ortholog is Ccl15[35]. Ccl9/Ccl15 encoded protein is a member of the macrophage inflammatory protein-1 family that binds to CCR1 and participates in the regulation of the pathophysiological process in a variety of diseases, including inflammatory response of the asthmatic airway and metastasis of cancer cells [36, 37]. Studies have demonstrated that the increased expression of CCL15 in the circulating blood of patients with CKD is associated with renal damage and impaired renal function [38]. However, the mRNA level of Ccl9 was downregulated in our UUO model. The reasons leading to opposite result may be due to different sample source and expression level. Therefore, the role and biological mechanism of CCL9/CCL15 in the inflammatory response and fibrosis progression of CKD still need to be studied.
While we utilized other datasets and carried out in vivo experiments to confirm the results obtained by bioinformatics analyses, the molecular mechanisms underlying increased Gng2 and Pf4 mRNAs in the kidney of the CKD mouse model were not verified in this study. Expression changes in different cell types, roles, and downstream targets of GNG2 and PF4 need to be further investigated in the kidney of mice with CKD.
Conclusion
We constructed a gene network representing the potential molecular mechanism of CKD in the UUO mouse model. Ten hub genes are promising biomarkers. After validating by using the dataset GSE121190 and our UUO mice, two key genes, Gng2 and Pf4, were seen as potential targets for diagnosing or alleviating the progression of CKD. These findings provide evidence for further studying the progression of CKD.
Acknowledgments
We appreciate all participants in this study.
Statement of Ethics
This study was performed in line with the guidelines of the National Health and Medical Research Council of China. All animal experiments were approved by the Ethics Committee of Tongren Hospital, approval number [SY2021-020].
Conflict of Interest Statement
The authors declare that there are no conflicts of interests.
Funding Sources
This work was supported by grants from the Hubei Key Laboratory Opening Project, Wuhan, Hubei, China (Grant No.: 2021KFY045), National Natural Science Foundation of China (Grant No.: 81770688), and Hubei Leading Talent Program in Medicine, and Application Foundation and Frontier Project of Wuhan (Grant No.: 2020020601012209). The funding organization did not participate in the design of study, analysis of data, and decision of manuscript.
Author Contributions
Kai Zhu designed this study, analyzed the data, and discussed and wrote manuscript. Xinxin Li performed experiments and analyzed the data. Likun Gao, Mengyao Ji, Xu huang, Yu Zhao, Wenxiu Diao, Yanqin Fan, and Xinghua Chen analyzed the data. Lei Shen, Lili Li, and Pengcheng Luo discussed and wrote manuscript. All authors have saw and approved the final manuscript.
Funding Statement
This work was supported by grants from the Hubei Key Laboratory Opening Project, Wuhan, Hubei, China (Grant No.: 2021KFY045), National Natural Science Foundation of China (Grant No.: 81770688), and Hubei Leading Talent Program in Medicine, and Application Foundation and Frontier Project of Wuhan (Grant No.: 2020020601012209). The funding organization did not participate in the design of study, analysis of data, and decision of manuscript.
Data Availability Statement
All data generated or analyzed during this study are included in this article. Further inquiries can be directed to the corresponding author.
References
- 1. Chevalier RL. Evolution, kidney development, and chronic kidney disease. Semin Cell Dev Biol. 2019 Jul;91:119–31. 10.1016/j.semcdb.2018.05.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Ruiz-Ortega M, Rayego-Mateos S, Lamas S, Ortiz A, Rodrigues-Diez RR. Targeting the progression of chronic kidney disease. Nat Rev Nephrol. 2020 May;16(5):269–88. 10.1038/s41581-019-0248-y. [DOI] [PubMed] [Google Scholar]
- 3. Ruiz S, Pergola PE, Zager RA, Vaziri ND. Targeting the transcription factor Nrf2 to ameliorate oxidative stress and inflammation in chronic kidney disease. Kidney Int. 2013 Jun;83(6):1029–41. 10.1038/ki.2012.439. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Lv W, Booz GW, Wang Y, Fan F, Roman RJ. Inflammation and renal fibrosis: recent developments on key signaling molecules as potential therapeutic targets. Eur J Pharmacol. 2018 Feb 5;820:65–76. 10.1016/j.ejphar.2017.12.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Syed-Ahmed M, Narayanan M. Immune dysfunction and risk of infection in chronic kidney disease. Adv Chronic Kidney Dis. 2019 Jan;26(1):8–15. 10.1053/j.ackd.2019.01.004. [DOI] [PubMed] [Google Scholar]
- 6. Sato Y, Yanagita M. Immune cells and inflammation in AKI to CKD progression. Am J Physiol Ren Physiol. 2018 Dec 1;315(6):F1501–12. 10.1152/ajprenal.00195.2018. [DOI] [PubMed] [Google Scholar]
- 7. Andrade-Oliveira V, Foresto-Neto O, Watanabe IKM, Zatz R, Camara NOS. Inflammation in renal diseases: new and old players. Front Pharmacol. 2019;10:1192. 10.3389/fphar.2019.01192. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Wu F, Sun C, Lu J. The role of chemokine receptors in renal fibrosis. Rev Physiol Biochem Pharmacol. 2020;177:1–24. [DOI] [PubMed] [Google Scholar]
- 9. Chung ACK, Lan HY. Chemokines in renal injury. J Am Soc Nephrol. 2011 May;22(5):802–9. 10.1681/ASN.2010050510. [DOI] [PubMed] [Google Scholar]
- 10. Hsieh YH, Wang WC, Hung TW, Lee CC, Tsai JP. C-C motif chemokine ligand-17 as a novel biomarker and regulator of epithelial mesenchymal transition in renal fibrogenesis. Cells. 2021;10(12):3345. 10.3390/cells10123345. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Puthumana J, Thiessen-Philbrook H, Xu L, Coca SG, Garg AX, Himmelfarb J, et al. Biomarkers of inflammation and repair in kidney disease progression. J Clin Invest. 2021;131(3):e139927. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Kashyap S, Osman M, Ferguson CM, Nath MC, Roy B, Lien KR, et al. Ccl2 deficiency protects against chronic renal injury in murine renovascular hypertension. Sci Rep. 2018 Jun 5;8(1):8598. 10.1038/s41598-018-26870-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Cormican S, Griffin MD. Fractalkine (CX3CL1) and its receptor CX3CR1: a promising therapeutic target in chronic kidney disease? Front Immunol. 2021;12:664202. 10.3389/fimmu.2021.664202. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Diboun I, Wernisch L, Orengo CA, Koltzenburg M. Microarray analysis after RNA amplification can detect pronounced differences in gene expression using limma. BMC Genomics. 2006 Oct 9;7:252. 10.1186/1471-2164-7-252. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Huang DW, Sherman BT, Tan Q, Collins JR, Alvord WG, Roayaei J, et al. The DAVID Gene Functional Classification Tool: a novel biological module-centric algorithm to functionally analyze large gene lists. Genome Biol. 2007;8(9):R183. 10.1186/gb-2007-8-9-r183. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Mering CV, Huynen M, Jaeggi D, Schmidt S, Bork P, Snel B. STRING: a database of predicted functional associations between proteins. Nucleic Acids Res. 2003 Jan 1;31(1):258–61. 10.1093/nar/gkg034. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res. 2003 Nov;13(11):2498–504. 10.1101/gr.1239303. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Bader GD, Hogue CWV. An automated method for finding molecular complexes in large protein interaction networks. BMC Bioinformatics. 2003 Jan 13;4:2. 10.1186/1471-2105-4-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Warde-Farley D, Donaldson SL, Comes O, Zuberi K, Badrawi R, Chao P, et al. The GeneMANIA prediction server: biological network integration for gene prioritization and predicting gene function. Nucleic Acids Res. 2010 Jul;38(Web Server issue):W214–20. 10.1093/nar/gkq537. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Zhu K, Kakehi T, Matsumoto M, Iwata K, Ibi M, Ohshima Y, et al. NADPH oxidase NOX1 is involved in activation of protein kinase C and premature senescence in early stage diabetic kidney. Free Radic Biol Med. 2015 Jun;83:21–30. 10.1016/j.freeradbiomed.2015.02.009. [DOI] [PubMed] [Google Scholar]
- 21. Yan Q, Zhu K, Zhang L, Fu Q, Chen Z, Liu S, et al. A negative feedback loop between JNK-associated leucine zipper protein and TGF-β1 regulates kidney fibrosis. Commun Biol. 2020 Jun 5;3(1):288. 10.1038/s42003-020-1008-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Xie Y, Nan Y, Atif A, Hu W, Zhang Y, Tian H, et al. Molecular identification of the G-protein genes and their expression profiles in response to nitrogen deprivation in Brassica napus. Int J Mol Sci. 2022 Jul 24;23(15):8151. 10.3390/ijms23158151. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Campbell AP, Smrcka AV. Targeting G protein-coupled receptor signalling by blocking G proteins. Nat Rev Drug Discov. 2018 Nov;17(11):789–803. 10.1038/nrd.2018.135. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Gan S, Pan Y, Mao J. miR-30a-GNG2 and miR-15b-ACSS2 interaction pairs may Be potentially crucial for development of abdominal aortic aneurysm by influencing inflammation. DNA Cell Biol. 2019 Dec;38(12):1540–56. 10.1089/dna.2019.4994. [DOI] [PubMed] [Google Scholar]
- 25. Feng Y, Su Y, Ma C, Jing Z, Yang X, Zhang D, et al. 3’UTR variants of TNS3, PHLDB1, NTN4, and GNG2 genes are associated with IgA nephropathy risk in Chinese Han population. Int Immunopharmacol. 2019 Jun;71:295–300. 10.1016/j.intimp.2019.03.041. [DOI] [PubMed] [Google Scholar]
- 26. White SM, North LM, Haines E, Goldberg M, Sullivan LM, Pressly JD, et al. G-protein βγ subunit dimers modulate kidney repair after ischemia-reperfusion injury in rats. Mol Pharmacol. 2014 Oct;86(4):369–77. 10.1124/mol.114.092346. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Kamal FA, Travers JG, Schafer AE, Ma Q, Devarajan P, Blaxall BCG. G protein-coupled receptor-G-protein βγ-subunit signaling mediates renal dysfunction and fibrosis in heart failure. J Am Soc Nephrol. 2017 Jan;28(1):197–208. 10.1681/ASN.2015080852. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Kihara Y, Mizuno H, Chun J. Lysophospholipid receptors in drug discovery. Exp Cell Res. 2015 May 1;333(2):171–7. 10.1016/j.yexcr.2014.11.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Li J, Ge Y, Huang JX, Stromgaard K, Zhang X, Xiong XF. Heterotrimeric G proteins as therapeutic targets in drug discovery. J Med Chem. 2020 May 28;63(10):5013–30. 10.1021/acs.jmedchem.9b01452. [DOI] [PubMed] [Google Scholar]
- 30. Aneja K, Jalagadugula G, Mao G, Singh A, Rao AK. Mechanism of platelet factor 4 (PF4) deficiency with RUNX1 haplodeficiency: RUNX1 is a transcriptional regulator of PF4. J Thromb Haemost. 2011 Feb;9(2):383–91. 10.1111/j.1538-7836.2010.04154.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Lande R, Lee EY, Palazzo R, Marinari B, Pietraforte I, Santos GS, et al. CXCL4 assembles DNA into liquid crystalline complexes to amplify TLR9-mediated interferon-alpha production in systemic sclerosis. Nat Commun. 2019 May 1;10(1):1731. 10.1038/s41467-019-09683-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Gleitz HFE, Dugourd AJF, Leimkuhler NB, Snoeren IAM, Fuchs SNR, Menzel S, et al. Increased CXCL4 expression in hematopoietic cells links inflammation and progression of bone marrow fibrosis in MPN. Blood. 2020 Oct 29;136(18):2051–64. 10.1182/blood.2019004095. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Zaldivar MM, Pauels K, von Hundelshausen P, Berres ML, Schmitz P, Bornemann J, et al. CXC chemokine ligand 4 (Cxcl4) is a platelet-derived mediator of experimental liver fibrosis. Hepatology. 2010 Apr;51(4):1345–53. 10.1002/hep.23435. [DOI] [PubMed] [Google Scholar]
- 34. Zhang L, Zhu Y, Zhang D, Zhang J, Tian Y. Platelet factor 4 protects kidney allograft in a rat kidney transplantation model. Inflammation. 2015 Apr;38(2):520–6. 10.1007/s10753-014-9958-2. [DOI] [PubMed] [Google Scholar]
- 35. Du J, Flynn R, Paz K, Ren HG, Ogata Y, Zhang Q, et al. Murine chronic graft-versus-host disease proteome profiling discovers CCL15 as a novel biomarker in patients. Blood. 2018 Apr 12;131(15):1743–54. 10.1182/blood-2017-08-800623. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Shimizu Y, Dobashi K. CC-chemokine CCL15 expression and possible implications for the pathogenesis of IgE-related severe asthma. Mediators Inflamm. 2012;2012:475253. 10.1155/2012/475253. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Itatani Y, Kawada K, Fujishita T, Kakizaki F, Hirai H, Matsumoto T, et al. Loss of SMAD4 from colorectal cancer cells promotes CCL15 expression to recruit CCR1+ myeloid cells and facilitate liver metastasis. Gastroenterology. 2013 Nov;145(5):1064–75.e11. 10.1053/j.gastro.2013.07.033. [DOI] [PubMed] [Google Scholar]
- 38. Richter R, Forssmann U, Henschler R, Escher S, Frimpong-Boateng A, Forssmann WG. Increase of expression and activation of chemokine CCL15 in chronic renal failure. Biochem Biophys Res Commun. 2006 Jul 14;345(4):1504–12. 10.1016/j.bbrc.2006.05.057. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data generated or analyzed during this study are included in this article. Further inquiries can be directed to the corresponding author.






