Antibiotic resistance, pathotypes, and pathogen-host interactions in Escherichia coli from hospital wastewater in Bulawayo, Zimbabwe

Joshua Mbanga; Nokukhanya P Kodzai; Wilhem F Oosthuysen

doi:10.1371/journal.pone.0282273

. 2023 Mar 2;18(3):e0282273. doi: 10.1371/journal.pone.0282273

Antibiotic resistance, pathotypes, and pathogen-host interactions in Escherichia coli from hospital wastewater in Bulawayo, Zimbabwe

Joshua Mbanga ^1,^*, Nokukhanya P Kodzai ¹, Wilhem F Oosthuysen ²

Editor: Sherin Reda Rouby³

PMCID: PMC9980749 PMID: 36862713

Abstract

This study aimed to characterise E. coli strains isolated from hospital wastewater effluent in Bulawayo, Zimbabwe, using both molecular and cytological approaches. Wastewater samples were aseptically collected from the sewerage mains of a major public referral hospital in Bulawayo province weekly for one month. A total of 94 isolates were isolated and confirmed as E. coli through biotyping and PCR targeting the uidA housekeeping gene. A total of 7 genes (eagg, eaeA, stx, flicH7, ipaH, lt, and st genes) coding for virulence in diarrheagenic E. coli were targeted. Antibiotic susceptibility of E. coli was determined against a panel of 12 antibiotics through the disk diffusion assay. The infectivity status of the observed pathotypes was investigated using HeLa cells through adherence, invasion, and intracellular assay. None of the 94 isolates tested positive for the ipaH and flicH7genes. However, 48 (53.3%) isolates were enterotoxigenic E. coli (ETEC) (lt gene positive), 2 (2.13%) isolates were enteroaggregative E. coli (EAEC) (eagg gene), and 1 (1.06%) isolate was enterohaemorrhagic E. coli (EHEC) (stx and eaeA). A high level of sensitivity was observed in E. coli against ertapenem (98.9%), and Azithromycin (75.5%). The highest resistance was against ampicillin (92.6%) and sulphamethoxazole—trimethoprim (90.4%). Seventy-nine (84%) E. coli isolates exhibited multidrug resistance. The infectivity study results indicated that environmentally isolated pathotypes were as infective as the clinically isolated pathotypes for all three parameters. No adherent cells were observed using ETEC, and no cells were observed in the intracellular survival assay using EAEC. This study revealed that hospital wastewater is a hotspot for pathogenic E. coli and that the environmentally isolated pathotypes maintained their ability to colonise and infect mammalian cells.

Introduction

Antibiotic resistance (AR) is an unprecedented global public health concern as it has implications for the successful treatment of human and animal infections [1, 2]. Hospital wastewater is recognised to be among the major reservoirs of antibiotic-resistant bacteria (ARB) and antibiotic-resistance genes (ARGs), as it possesses higher levels of antibiotics, disinfectants, and patient excrement. The exposure of these pathogens to a wide range of biocides and antibiotics may result in pathogenic bacteria that harbour resistant genes to biocides, heavy metals, and antibiotics [3]. The hospital wastewater environment is a potential source of multidrug resistant pathogenic bacteria, including methicillin-resistant S. aureus (MRSA), vancomycin-resistant Enterococcus (VRE), and extended-spectrum beta-lactamase (ESBL) producing Gram-negative bacteria. Hospital wastewater can provide a suitable environment for the interaction between different bacteria, facilitating the exchange of ARGs between clinical and environmental bacterial strains [4]. This can result in significant public health and epidemiological consequences that extend beyond hospitals into neighbouring communities [5, 6].

While most strains of E. coli are commensal, virulent strains that can cause a variety of intra-intestinal diseases, such as diarrhoea, and extra-intestinal diseases, such as urinary tract infections, exist [7, 8]. At present, the enteric E. coli pathotypes, also known as Diarrhoeagenic E. coli (DEC), are divided into six groups based on their serological virulence- characteristics and other phenotypic traits. The six groups are enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), enterohaemorrhagic E. coli (EHEC), or Verotoxin or Shiga toxin-producing E. coli (VTEC/STEC) enteroinvasive E. coli (EIEC), diffusely adherent E. coli (DAEC), and enteroaggregative E. coli (EAEC) [9, 10].

Although using molecular methods to examine and characterise E. coli pathotypes and other bacteria is essential, these methods provide only a partial understanding of these bacterial strains. Cytological approaches have been employed to enhance the understanding of these pathotypes and their behaviour when interacting with human cells [11, 12]. The first step in understanding the effect of pathogenic bacteria on the human body is to examine their impact on human cell lines, and this is done through adherence, invasion, and intracellular survival assays, also known as infectivity studies [13]. These assays may be used to categorise different E. coli pathotypes based on their ability to adhere, invade and survive inside human cells. For example, enteroaggregative and diffusely adhering E. coli may be defined by their degree of adherence to HeLa cells and their cytotoxic activity in vitro [7, 14].

A lot of studies have been done on E. coli characterisation based on cytological and molecular studies, with more studies done in Europe and Asia [15, 16]. Therefore, this study focused on the identification of DEC strains in hospital wastewater and investigated their infectivity status using a human cell line.

Materials and methods

Ethical approval

Ethical approval for this study was obtained from the NUST Institution Research Board (NUST/IRB/202/34).

Study site and sample collection

Wastewater samples were aseptically collected from sewerage mains located at the western wing of a major public referral hospital in Bulawayo province, Zimbabwe. The hospital is one of two principal referral centres in the Southern part of Zimbabwe and has a bed capacity of 650. The sampled sewerage mains receives liquid waste from the Casualty department, Burns ward, Intensive Care Unit (ICU), Female ward, and Children’s ward. Sample collection was done once a week for one month from February to March 2020. Sample collection was done using grab water sampling into a 500ml sterile plastic container. A total of 4 wastewater samples were collected in duplicate and transported in a cooler box on ice to the NUST Microbiology laboratory for analysis. The duplicate samples were pooled before analysis to make a composite sample. Some images of the sampling site are shown in S1 Fig. All collected samples were processed within 2h of collection, and the remaining samples were stored at 4° C until all analysis was complete.

Isolation of E. coli

Ten-fold serial dilutions of the collected samples were carried out by diluting 1ml of the collected samples in 9ml of autoclaved distilled water for dilutions 10⁻¹ up to 10⁻⁵. After that, 100μl of the 10⁻¹, 10⁻², 10⁻³, 10^−4, and 10⁻⁵ dilutions were cultured in duplicates using the spread plate method on Levine Eosin Methylene Blue (EMB) Agar (HiMedia Labs, India). Inoculated plates were incubated for 24 h at 37°C, thereafter, typically metallic green sheen colonies were sub-cultured as presumptive E. coli isolates. To subculture the isolates, 10 single colonies were randomly picked per sampling time point from the 10⁻³, 10^−4, and 10⁻⁵ plates and triple streaked on Plate Count Agar plates, before incubation at 37°C for 24 hours. After 24 h, the Gram stain and the oxidase tests were done on the presumed E. coli isolates. Presumptive isolates were stored in 30% glycerol stocks at -70°C until further use.

Molecular confirmation of E. coli

E. coli DNA was extracted using a standard heat lysis protocol [17]. To check for purity the crude DNA was run on a ethidium bromide stained 1% agarose gel (Sigma-Aldrich, St Louis,

USA) with a 100bp DNA ladder (Thermo Scientific, Johannesburg, SA) in 1x TBE buffer for 1hr at 100V and then viewed using a Uvipro-Silver Gel Documentation System (Uvitec, UK). The concentration of DNA was estimated by comparing the band light intensity to the band intensity on the 100 bp ladder on the Uvipro-Silver Gel Documentation System. Crude DNA between 5 – 10ng/μl was used for PCR reactions. The uidA (β-D glucuronidase) gene was used to confirm E. coli using conventional PCR [18]. The PCR reaction consisted of a total reaction mixture of 10uL with 5 μL of 2x Dreamtaq master mix (New England Biolabs, UK), 0.16 μL (0.4 μM) forward primer (AAAACGGCAAGAAAAAGCAG), 0.16 μL (0.4 μM) reverse primer (ACGCGTGGTTAACAGTCTTGCC) (Inqaba Biotech, Pretoria, SA), 2.6 μL nuclease-free water (New England Biolabs, UK) and 2 μL of DNA template was prepared and run on a MiniAmp^TM Plus Thermal Cycler (Applied Biosystems, Thermo Fisher Scientific, USA). The negative control comprised nuclease-free water in place of template DNA. The PCR profile was as follows: Initial denaturation at 95°C for 3 minutes, 30 Cycles {denaturation at 95°C for 30 seconds, annealing temperatures at 50°C for 30 seconds, extension at 72°C for 1 minute} and then the final extension at 72°C for 5 minutes. E. coli ATCC^® 25922 was used as a positive control.

Pathotyping of E. coli

E. coli was pathotyped via conventional PCR. The pathotypes assayed for included EHEC, EPEC, EIEC, EAEC, and ETEC. E. coli DSM reference strains (DSM 8695, DSM 10 973, DSM 10 974, DSM 9025, O157H7) were included in the assays as internal positive controls for the targeted E. coli pathotypes. The virulence gene primers and reference strains used in this study are shown in S1 Table. The PCR comprised of a reaction mixture of 10uL consisting of 5 μL of 2x Dreamtaq master mix (New England Biolabs, UK), 0.16 μL (0.4 μM) forward primer, 0.16 μL (0.4 μM) reverse primer (Inqaba Biotech, Pretoria, SA), 2.6 μL nuclease-free water (New England Biolabs, UK) and 2 μL of DNA template was prepared and run on a MiniAmp^TM Plus Thermal Cycler (Applied Biosystems, Thermo Fisher Scientific, USA). The negative control comprised nuclease-free water in place of template DNA. The PCR profile was as follows: Initial denaturation at 95°C for 3 minutes, 30 Cycles {denaturation at 95°C for 30 seconds, the following annealing temperatures were used; 42°C for stx, 48°C for flicH 7 and lt, 50°C for ipaH genes, 53.5°C for eaeA, 55°C for eagg, and 63°C for st, for 30–45 seconds; extension at 72°C for 1 minute} and then the final extension at 72°C for 5 minutes. The PCR products were all electrophoresed in a 1% agarose gel containing 0.5mg/l ethidium bromide (Sigma-Aldrich, St. Louis, USA) for 50 min at 100V in 1x TBE buffer. Amplicon sizes were then visualized using a UV transilluminator (Uvitec, Cambridge, UK) and run alongside a Invitrogen 1kb plus DNA ladder (Thermo Scientific, Johannesburg, SA) as a standard molecular weight marker.

Antibiotic susceptibility testing of E. coli

Antibiotic susceptibility of E. coli was determined against a panel of 12 antibiotics through the disk diffusion assay. A 0.5% McFarland’s standard was used to standardize all innocula prior to carrying out the antibiotic susceptibility test. The commercial antibiotic discs included ampicillin (AMP, 10μg), azithromycin (AZM, 15μg), amoxicillin-clavulanic acid (AMC, 30μg), cefotaxime (CTX, 30μg), cefepime (FEP, 10μg), ceftriaxone (CRO, 30μg), cefixime (CFM, 5μg), ciprofloxacin (CIP, 5μg), ertapenem (ETP, 10μg), tetracycline (TET, 30μg), trimethoprim-sulfamethoxazole (SXT, 1.25μg/23.75μg), and chloramphenicol (CHL, 30μg) (MAST group, United Kingdom). Antibiotic susceptibility testing and interpretation of results were done following the Clinical and Laboratory Standards Institute (CLSI) guidelines and interpretative charts [19, 20]. E. coli ATCC 25922 was used as a reference strain. Multidrug resistance (MDR) was defined as resistance to one or more antibiotics in three or more antibiotic classes [21].

Adherence and invasion assay

Three isolates belonging to the ETEC (BHE16), EAEC (BHE59), and EHEC (BHE94) pathotypes were used for the assays. The environmental isolates were randomly chosen except for BHE94, which was the only EHEC isolate. The characteristics of the chosen isolates are shown in Table 1. The positive controls of the corresponding pathotypes were also used for comparison. The assays were done according to Sinha et al. [22] with modifications. Briefly, HeLa cells were seeded at 1.5 × 10⁶ cells/well in a 24-well plate and cultured at 37°C/5% in an EC 160 CO₂ humidified incubator (Nüve, Turkey) for 24h to allow for the formation of a monolayer. All adherence and invasion experiments were performed in duplicate per strain, time point, and multiplicity of infection (MOI). Three independent experiments were performed. A volume of 1 ml invasion medium (DMEM with bacteria at the MOI of 10) was added to each well and incubated at 37°C/5% CO₂ in a humidified incubator for two-time points. Adherence and invasion were investigated at the 1h and 2h time points after the addition of the invasion medium to the cellular monolayers. Following incubation, infected cellular monolayers were washed 3× with DMEM, trypsinized with 200μl trypsin, and incubated for 10 min at room temperature. Trypsinized cells were neutralised by 600μl DMEM/10% FCS, removed from each well, and collected in a 1.5ml tube. The cellular suspension was centrifuged at 800rpm for 10 min to separate bacterial cells from human cells, the supernatant was then transferred to a new 1.5ml tube for bacterial adherence, and the cellular pellet was used for bacterial invasion.

Table 1. Antibiotic susceptibility and pathotypes of three E. coli isolates used in the infectivity study.

Isolate ID	Pathotype	ETP	SXT	CTX	CRO	FEP	CFM	TET	CIP	AMP	AZM	CHL	AMC	Resistance pattern
BHE16	ETEC	S	R	R	R	I	R	I	I	R	S	R	R	SXT-CTX-CRO-CFM-AMP-CHL-AMC
BHE59	EAEC	S	R	S	I	S	S	S	S	R	S	S	S	SXT-AMP
BHE94	EHEC	S	R	R	I	I	S	S	S	R	R	S	R	SXT-CTX-AMP-AZM-AMC

Open in a new tab

KEY: S- susceptible; I- intermediate; R–Resistant; ampicillin (AMP), Azithromycin (AZM), amoxicillin-clavulanic acid (AMC), cefepime (FEP), cefotaxime (CTX), ceftriaxone (CRO), cefixime (CFM), chloramphenicol (CHL), ertapenem (ETP), trimethoprim-sulfamethoxazole (SXT) ETEC–Enterotoxigenic E. coli; EAEC–Enteroaggregative E. coli; EHEC–Enterohaemorrhagic E. coli.

To determine bacterial adherence, the supernatant was collected into a new tube and centrifuged at 12 000 rpm for 10 min. The supernatant was aspirated, and the bacterial pellet was re-suspended in 200 μl PBS, transferred to a 96-well plate, and serially diluted. A total of 20 μl of the 10⁻³–10⁻⁶ dilutions were plated on LB agar plates and incubated at 37°C for 24 hours. Following the incubation, the plates were left at room temperature for 1h to dry before counting the colony-forming units (CFUs).

To determine bacterial invasion, the bacterial pellet from the original tube was re-suspended in 200 μl 1% Triton-X and incubated for 10 min at 37°C. Following the incubation, 20 μl was serially diluted as described for bacterial adherence. The same dilutions 10⁻³–10⁻⁶ were plated on LB agar and incubated before counting the CFUs.

Intracellular survival

Utilising the same time points used for bacterial adherence and invasion, the invasion medium was removed, and the cellular monolayer was washed 3× with DMEM. A total of 1ml DMEM containing PENSTREP 20/25 (100μg/μl) was added to each well, and the plates were incubated for an additional 2h at 37°C/5% CO₂ in a humidified incubator to lyse any remaining adherent and invasive organism and obtain those which survived intracellularly. Following the 2h incubation, the medium was removed, and the cellular monolayer was washed 3× with DMEM. A total of 200μl 1% Triton-X was added to each well and incubated for 10 min at 37°C/5% CO₂ in a humidified incubator to lyse the human cells and release any surviving intracellular organisms. Serial dilutions were prepared, and 10⁻¹–10⁻⁴ dilutions were plated on LB agar plates. LB plates were incubated as described, and bacterial CFUs were enumerated following incubation.

Statistical analysis

Statistical analysis was done on Microsoft Excel 2018 and GraphPad Prism 8.4.3 software. GraphPad Prism was used to analyse the adherence, invasion, and survival assays by performing a two-way ANOVA at a 95% Confidence Interval (p = 0.05).

Results

Isolation and identification of E. coli

From 120 presumptive E. coli, a total of 94 (week 1, 25; week 2, 23; week 3, 30; week 4, 16) isolates were confirmed as E. coli using conventional PCR of the uidA gene.

Antibiotic susceptibility of E. coli

The sensitivity of E. coli to the assayed antibiotics is presented in Table 2. For all tested isolates, a high level of sensitivity was observed against ETP 93(98.9%) and AZM 71(75.5%). Elevated resistance was observed against most of the tested antibiotics, with AMP 87(92.6%), SXT 85(90.4%), and CTX 78(83%) having the highest resistance. Elevated levels of multidrug resistance were observed, with 79 (84%) E. coli isolates exhibiting resistance to antibiotics from at least three classes. A total of 24 MDR patterns were observed across all isolates, with the most common being pattern A (SXT-CTX-CRO-CFM-TET-AMP-CHL-AMC), which occurred in 24 isolates (Table 3). One isolate was resistant to 11 out of 12 antibiotics used in this study. Most E. coli belonging to the identified pathotypes were multidrug resistant (Table 4). A ETEC isolate (BHE72) was susceptible to all tested antibiotics, whilst another isolate (BHE73) was only resistant to TS. The occurrence of multidrug resistant E. coli pathotypes in the hospital wastewater suggests that these may be widespread in the hospital environment.

Table 2. Antibiotic sensitivity of confirmed E. coli isolates from hospital wastewater.

Antibiotic (μg)	Resistant no. (%)	Intermediate no. (%)	Susceptible no. (%)
Ertapenem (10)	0(0)	1(1.1)	93(98.9)
Trimethoprim-Sulfamethoxazole (1.25/23.75)	85(90.4)	1(1.1)	8(8.5)
Cefotaxime (30)	78(83)	6(6.4)	10(10.6)
Ceftriaxone (30)	75(79.8)	10(10.6)	9(9.6)
Cefepime (10)	40(42.6)	42(44.7)	12(12.7)
Cefexime (5)	73(77.7)	0(0)	21(22.3)
Tetracycline (30)	69(73.4)	5(5.4)	20(21.2)
Ciprofloxacin (5)	13(13.8)	54(57.5)	27(28.7)
Ampicillin (10)	87(92.6)	3(3.2)	4(4.2)
Amoxicillin-clavulanate (30)	73(77.7)	1(1.1)	20(21.2)
Azithromycin (15)	23(24.5)	0(0)	71(75.5)
Chloramphenicol (30)	64(68.1)	1(1.1)	29(30.8)

Open in a new tab

Table 3. Antibiotic resistance patterns of E. coli isolates from hospital wastewater.

Pattern	Number of isolates	Resistance pattern
A	24	SXT,CTX,CRO,CFM,TET,AMP,CHL,AMC
B	13	SXT,CTX,CRO,FEP,CFM, TET, AMP,AZM, CHL, AMC
C	10	SXT,CTX,CRO, FEP,CFM, TET, AMP, CHL, AMC
D	5	SXT,CTX,CRO, FEP,CFM, TET,CIP, AMP, AZM, AMC
E	4	SXT,CTX,CRO,CFM, AMP, CHL, AMC
F	2	CTX,CRO,CFM, TET,CIP, AMP, CHL, AMC
G	2	SXT,CTX,CRO, FEP,CFM, TET,CIP, AMP, CHL, AMC
H	2	SXT,CTX,CRO, AMP
I	2	SXT,CTX, AMP
J	1	SXT,CTX,CRO,CFM, TET,CHL,AMC
K	1	CTX,CRO,CFM,TET, AMP,CHL, AMC
L	1	CFM, TET, AMC
M	1	CTX,CFM, TET,AMP,AMC
N	1	SXT,CTX,CRO,CFM, TET,CIP, AMP, CHL, AMC
O	1	CTX,CRO, FEP,CFM, TET, AMP, CHL, AMC
P	1	CTX,CRO, FEP,CFM, TET, AMP, AZM, CHL, AMC
Q	1	SXT,CTX,CRO,CFM, TET, AMP, AZM, CHL, AMC
R	1	SXT,CRO, FEP
S	1	SXT, CTX,CRO, FEP,CFM,TET, AMP, AZM, AMC
T	1	SXT,CTX,CRO, FEP,CFM,TET,CIP, AMP, AZM,CHL,AMC
U	1	SXT,CTX,CRO, FEP,CFM,TET,CIP, AMP,AMC
V	1	SXT,CTX,CRO, FEP,AMP
W	1	SXT, FEP, AMP
X	1	SXT,CTX, AMP, AZM, AMC

Open in a new tab

Key: ampicillin (AMP), Azithromycin (AZM), amoxicillin-clavulanic acid (AMC), cefepime (FEP), cefotaxime (CTX), ceftriaxone (CRO), cefixime (CFM), chloramphenicol (CHL), ertapenem (ETP), trimethoprim-sulfamethoxazole (SXT), tetracycline (TET), ciprofloxacin (CIP).

Table 4. Antibiotic resistance patterns of pathogenic E. coli pathotypes.

Isolate ID	Virulence gene present	Pathotype	Antibiogram
BHE1	lt	ETEC	TS,CTX,CRO,CPM,CFM,T,AP,C,AUG
BHE2	lt	ETEC	TS,CTX,CRO,CPM,CFM,T,AP,C,AUG
BHE3	lt	ETEC	TS,CTX,CRO,CFM,T,AP,C,AUG
BHE4	eagg	EAEC	TS,CTX,CRO,CFM,T,AP,C,AUG
BHE5	lt	ETEC	TS,CTX,CRO,CFMT,AP,C,AUG
BHE6	lt	ETEC	TS,CTX,CRO,CPM,CFM,T,AP,C,AUG
BHE7	lt	ETEC	TS,CTX,CRO,CFM,T,AP,C,AUG
BHE8	lt	ETEC	TS,CTX,CRO,CPM,CFM,T,AP,C,AUG
BHE9	lt	ETEC	TS,CTX,CRO,CFM,T,AP,C,AUG
BHE10	lt	ETEC	TS,CTX,CRO,CFM,T,AP,C,AUG
BHE11	lt	ETEC	TS,CTX,CRO,CFM,T,AP,C,AUG
BHE12	lt	ETEC	TS,CTX,CRO,CFM,T,AP,C,AUG
BHE13	lt	ETEC	TS,CTX,CRO,CFM,T,AP,C,AUG
BHE14	lt	ETEC	TS,CTX,CRO,CFM,T,AP,C,AUG
BHE15	lt	ETEC	TS,CTX,CRO,CFM,T,AP,C,AUG
BHE16	lt	ETEC	TS,CTX,CRO,CFM,AP,C,AUG
BHE18	lt	ETEC	TS,CTX,CRO,CFM,AP,C,AUG
BHE19	lt	ETEC	TS,CTX,CRO,CFM,T,AP,C,AUG
BHE20	lt	ETEC	TS,CTX,CRO,CFM,AP,C,AUG
BHE21	lt	ETEC	TS, CTX,CRO,CFM,T,C,AUG
BHE22	lt	ETEC	TS, CTX,CRO,CFM,T,AP,C,AUG
BHE23	lt	ETEC	CTX, CRO,CFM,T,AP,C,AUG
BHE24	lt	ETEC	CFM, T,AUG
BHE25	lt	ETEC	CTX, CFM,T,AP,AUG
BHE26	lt	ETEC	CTX, CRO,CFM,T,CIP,AP,C,AUG
BHE27	lt	ETEC	TS, CTX,CRO,CFM,T,AP,C,AUG
BHE28	lt	ETEC	TS, CTX,CRO,CFM,T,AP,C,AUG
BHE29	lt	ETEC	TS, CTX,CRO,CFM,T,CIP,AP,C,AUG
BHE30	lt	ETEC	TS, CTX,CRO,CFM,T,AP,C,AUG
BHE31	lt	ETEC	TS, CTX,CRO,CPM,CFM,T,AP,C,AUG
BHE33	lt	ETEC	TS, CTX,CRO,CFM,T,AP,C,AUG
BHE36	lt	ETEC	TS, CTX,CRO,CFM,T,AP,C,AUG
BHE46	lt	ETEC	TS, CTX,CRO,CFM,T,AP,C,AUG
BHE48	lt	ETEC	TS, CTX,CRO,CPM,CFM,T,AP,C,AUG
BHE50	lt	ETEC	TS, CTX,CRO,CPM,CFM,T,AP,ATH,C,AUG
BHE56	lt	ETEC	TS, CTX,CRO,CPM,CFM,T,CIP,AP,ATH,,AUG
BHE58	lt	ETEC	TS, CTX,CRO,CPM,CFM,T,CIP,AP,ATH,,AUG
BHE59	eagg	EAEC	TS, AP
BHE64	lt	ETEC	TS,CTX,CRO,CPM,CFM,T,AP,ATH,C,AUG
BHE68	lt	ETEC	TS,CTX,CRO,CPM,CFM,T,AP,ATH,C,AUG
BHE69	lt	ETEC	TS,CTX,CRO,CPM,CFM,T,AP,ATH,C,AUG
BHE70	lt	ETEC	TS,CTX,CRO,CPM,CFM,T,CIP,AP,ATH,,AUG
BHE72	lt	ETEC
BHE73	lt	ETEC	TS
BHE76	lt	ETEC	TS,CTX,CRO,CPM,CFM,T,AP,ATH,,AUG
BHE79	lt	ETEC	TS,CTX,CRO,CPM,CFM,T,CIP,AP,AUG
BHE94	eaeA, sxt	EHEC	TS,CTX,AP,ATH,AUG

Open in a new tab

Distribution of E. coli pathotypes

E. coli pathotype distribution showed that ETEC was the most prevalent, with 48 isolates (51.1%), followed by EAEC with two isolates (2.1%) (Fig 1). The least observed pathotype was the EHEC, with 1 (1.1%) isolate. No isolates tested positive for EPEC and EIEC pathotypes. Weekly distribution showed a general increase in the number of pathotypes detected over one month, with the ETEC pathotype being consistently seen throughout (Fig 2).

Fig 2 — **Key:** ETEC–Enterotoxigenic E. *coli*; EAEC–Enteroaggregative E. *coli*; EHEC–Enterohaemorrhagic E. *coli*; DEC- diarrhoeagenic E. *coli*.

Adherence, invasion, and intracellular survival of E. coli pathotypes

The adherence, invasion, and survival of the three pathotypes observed in this study (ETEC, EAEC, and EHEC) were investigated using HeLa cells. The results were analysed using a two-way ANOVA at 95% Confidence Interval (p = 0.05). None of the EAEC strains survived inside the HeLa cells, and none of the ETEC adhered to the cells. The results generally showed no significant difference in the level of infectivity between the clinical control strain and the corresponding environmental isolate (Fig 3). However, there was a generally significantly higher level of infectivity after 2 hours of exposure. Only EHEC and EAEC adhered to Hela cells. There was no significant difference in the adherence of both pathotypes’ clinical and environmental isolates at the two time points (Fig 3A). However, adherence was significantly higher after 2 hours for the EAEC, with a mean of 6.978 and 7.39 log CFU/ml for the clinical and environmental isolate respectively. All pathotypes were invasive (Fig 3B) with EAEC and ETEC showing no significant difference between invasion by the experimental and clinical isolates at both time points. There, however, was a significant difference in invasion by the clinical and experimental EHEC isolates at both time points. Invasion of Hela cells increased significantly for the EHEC and EAEC after 2 hours (Fig 3B). Intracellular survival was observed for the EHEC and ETEC pathotypes (Fig 3C). There was no significant difference in intracellular survival of the ETEC clinical and environmental isolates. The clinical and environmental EHEC isolates were significantly different. Notably, only the clinical isolate increased significantly intracellularly after 2 hours.

Fig 3 — (a-c) Infectivity of Hela cells by clinical (positive control) and environmental strains of pathogenic E. *coli*. a. Adherence of clinical and environmental EAEC and EHEC to Hela cells. ETEC was negative for adhesion. b. Invasion of Hela cells by clinical and environmental ETEC, EAEC, and EHEC. c. Intracellular survival of clinical and environmental ETEC and EHEC in Hela cells. EAEC was negative for intracellular survival. Clinical strains refer to positive controls, and the environmental isolates to representative isolates (BHE16, ETEC; BHE59, EAEC; BHE94, EHEC) obtained in this study. At each time point, bars with similar lowercase letters indicate that adherence, invasion, or intracellular activity are not significantly different (p > 0.05) between the two strains. For each strain, bars with different upper case letters indicate that adherence, invasion, or intracellular activity are significantly different (p < 0.05) between the two time points.

Discussion

Antibiotic resistance profiles of E. coli

Most of the E. coli isolates had high susceptibility to ertapenem (98.9%) and azithromycin (73%) (Table 2). Ertapenem is a carbapenem and is not routinely used in Zimbabwe as it is considered a last-resort antibiotic that is reserved for serious infections. Azithromycin is a macrolide that can help treat a wide range of bacterial infections and has been shown to still be effective against endemic pathogens like Salmonella Typhi [23]. The E. coli isolates showed the highest resistance to AMP (92.6%), SXT (90.4%), and CTX (83%) (Table 2). The current findings were similar to those reported in other studies on untreated hospital wastewater from Ethiopia [24, 25]. Both studies reported elevated resistance to ampicillin amongst isolated E. coli. As expected, a high number of isolated E. coli 79 (84%) were multidrug resistant; this was much higher than that reported by King et al. [26], who isolated Klebsiella spp. in untreated effluent from an urban and rural hospital in KwaZulu-Natal province in South Africa, and reported that 23% (urban hospital) and 9% (rural hospital) of the isolates were MDR.

Prevalence of diarrhoeagenic E. coli in hospital wastewater

Among the five DEC pathotypes profiled from the 94 confirmed E. coli isolates, the ETEC pathotype was the most prevalent 48 (51.1%). However, all isolates only had the lt gene (Fig 1). These findings are similar to work done in Iran on the prevalence of enterotoxigenic E. coli strains in three (Imam, Mohammad Kermanshahi, and Farabi) hospital wastewater treatment plants. The study reported that from a total of 31 E. coli isolates, 8 pathogenic E. coli strains were isolated, and from the 8 pathogenic E. coli, a total of 25.8% of all E. coli strains were ETEC and harboured only the lt virulence gene [27]. In another study, done in South Africa in 2010, on the occurrence of pathogenic E. coli in South African wastewater, pathogenic E. coli were evaluated in 6 wastewater treatment plants, and 80% of the samples (from influent and effluent of wastewater treatment) were ETEC strains only harbouring the lt gene [28]. The high prevalence of the ETEC strains observed in these studies may be because these studies were done in developing countries, where ETEC is the second highest causative agent of acute diarrhoea affecting paediatrics after Shigella spp. [8]. However, the observed differences with our study could be due to the difference in sample size and in, the primers used in the respective studies, and geographic differences. With regards to investigating the prevalence of E. coli pathotypes in environmental samples, fewer studies have been done compared to clinical studies. However, ETEC prevalence in wastewater may mirror the clinical prevalence of ETEC since ETEC is associated with most hospitalised E. coli-associated diarrhoea [12].

EAEC, with 2 isolates (2.13%), was observed at a very low frequency as compared to ETEC (Fig 2). However, despite being at a low frequency in this study, EAEC has been reported by other studies to occur at higher frequencies in water environments [29]. A study done in Southern Brazil on the prevalence of diarrheagenic E. coli carrying toxin-encoding genes isolated from children and adults reported that from 56 children and 74 adults, EAEC was the most prevalent pathotype, with 23% of the isolates testing positive for EAEC virulent genes [30].

EHEC was the least prevalent pathotype with one isolate (1.06%) (Fig 2). These results were expected as EHEC usually originates in animals, such as cattle, therefore it is usually an issue in developed countries as they have lots of petting zoos and is rarely reported in developing countries [8].

The distribution observed in this study implies that hospital wastewater serves as a reservoir for some DEC pathotypes at varied levels. The high percentage of ETEC observed in this current study might be because the sampling point included wastewater from the paediatric wing in the hospital, and ETEC has been reported to be responsible for over 25% of hospitalised childhood infections in developing countries [27]. However, the difference in the frequency of these pathotypes in the different studies may be due to differences in the detection methods, geographical distribution, demographics of the areas where the studies are being done, and a difference in the sample source.

Pathogen host interactions

Colonization of the host epithelia by pathogenic E. coli is primarily subject to the ability of the bacteria to interact with host surfaces. Despite knowing the prevalence of pathogenic E. coli in hospital wastewater, knowledge on the infectivity of such isolates remains scarce. The infectivity status of the environmental pathotypes obtained in this study was compared to clinically isolated pathotypes. The infectivity study looked at the adherence, invasion, and intracellular survival of randomly selected pathotypes (EHEC, ETEC, and EAEC) using Hela cells. The selected isolates were assayed and compared to positive controls using a 2-way ANOVA (p = 0.05).

The most prevalent pathotype in this study (ETEC), indicated that there was no significant difference in the invasion and intracellular survival (Fig 3A and 3C) between the clinical (positive control) and the environmental strain. No adherent cells were observed on the HeLa cell surface. However, there was a significantly higher number of E. coli cells that intracellularly survived in the cells after 2 hours of exposure compared to after 1 hour of exposure. There was also no significant difference in the invasion of the E. coli cells between the two timelines. The high level of invasion was expected since ETEC is an invasive pathotype, and these results correlate to the results observed in a study done by Rappelli et al. [31]. The increase in the number of cells that survived intracellularly with an increase in time of exposure may be attributed to the possibility of multiplication of the E. coli cells while inside the cells.

Results for the EAEC pathotype indicated no significant difference in the adherence and invasion (Fig 3A and 3B) between the EAEC clinical sample (positive control) and the environmental isolate. However, there was a significantly higher number of E. coli cells that adhered and invaded, a the Hela cells after 2 hours of exposure, compared to after 1 hour of exposure. These results were expected since this pathotype is characterised by its adherence to human cells [32]. These results also correlate to the results observed in a study conducted by Marinescu et al. [1], which indicated that 81% of E. coli expressed aggregative/stacked brick and localised adherence patterns, meaning that these strains were either EAEC (aggregative/stacked brick adherence patterns) or EPEC (localised adherence patterns). Intracellular survival was not observed in this pathotype. This is because none of the cells were able to proliferate and survive inside the HeLa cells. The increase in the number of the cells that adhered to the cells with an increase in the time of exposure is because more bacteria managed to adhere, and multiply during that period.

Results for the EHEC pathotypes indicated no significant difference in the adherence of the EHEC clinical (positive control) and environmental isolate (Fig 3A). However, there was no significant increase in the number of E. coli cells that adhered to the Hela cells after 2 hours of exposure, as compared to after 1 hour of exposure. The number of EHEC that adhered to the cell surface was considerably lower than that observed for EAEC suggesting that EHEC are a less adherent pathotype. The results of this study suggest that the environmentally isolated strains remain infective even after release into the environment. The differences in the degree of infectivity as time increases are in agreement with the results observed by Vazquez-Juarez et al. [33]. The invasion of the EHEC strains is attributed to the presence of the stx gene, which is a gene coding for Shiga toxins or verotoxins produced by the EHEC strains, while the adhesion of the EHEC to the HeLa cells may be attributed to the presence of the eaeA gene which is responsible for coding for adhesins. The high level of intracellular survival observed in EHEC is attributed to the fact that EHEC is an invasive pathotype [8]. The increase in the number of cells that survived intracellularly with an increase in time of exposure may be attributed to the possibility of multiplication of the E. coli cells while inside the cells.

One of the limitations of the present study was the sample size of the study and the length of the sampling period, making this a “snapshot” of the true picture of the prevalence of pathogenic E. coli in hospital wastewater. Since there are limited studies on the surveillance of pathogenic bacteria in the environment in Zimbabwe, there is a need for broader monitoring in different regions of the country to get a better and more accurate assessment of the prevalence of pathogenic E. coli in the environment.

Conclusion

Analysis of the hospital wastewater with molecular methods revealed that the hospital is a hotspot for pathogenic E. coli such as ETEC, and the infectivity study revealed that the environmentally isolated pathotypes maintained their ability to colonise and infect mammalian cells through adherence and invasion of the cells even after release into the environment. The infectivity study showed that these environmentally isolated pathotypes are as infective as the clinical pathotypes, making them a potential public health concern. This suggests that there is a possibility of the transfer of these pathogens from hospital wastewater into the community through farming and drinking water contamination if the water is not treated properly. Due to this, the wastewater of the hospitals needs to be rehabilitated to an optimal level of health with suitable treatment before release into the environment.

Supporting information

S1 Table. E. coli primers and reference strains used in PCR reactions.

(DOCX)

Click here for additional data file.^{(16.2KB, docx)}

S1 Fig

Sample collection was done from site F, the intersection point of A (Children’s ward sewer), B (Intensive Care Unit sewer), C (Burns ward sewer), D (Casualty sewer), and E (Female ward sewer).

(DOCX)

Click here for additional data file.^{(200.4KB, docx)}

S2 Fig. Representative amplicons obtained by PCR for isolates tested for the lt gene, with the expected size of 708bp.

(DOCX)

Click here for additional data file.^{(224.6KB, docx)}

S3 Fig. Amplicons obtained by PCR for isolates tested for eagg gene with the expected size of 194bp.

(DOCX)

Click here for additional data file.^{(156.1KB, docx)}

S4 Fig. Amplicons obtained by PCR for isolates tested for the eaeA and stx gene, with the expected size of 248bp and 478bp.

(DOCX)

Click here for additional data file.^{(83.6KB, docx)}

S5 Fig. Amplicons obtained by PCR for isolates tested for the eaeA with the expected size of 248bp.

(DOCX)

Click here for additional data file.^{(192.2KB, docx)}

Acknowledgments

Mpilo Medical School Physiology laboratory staff for assisting us with the cell culturing section of this project. Vaccine-Preventable Diseases Respiratory and Meningeal Pathogens Research Unit (RMPRU) (South Africa) for providing us with the HeLa cells and the cell culturing reagents used in this project.

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This work is based on the research supported by the National University of Science and Technology (NUST) Research Board grant # RB17/43 and the kind support of the Vaccine-Preventable Diseases Respiratory and Meningeal Pathogens Research Unit (RMPRU), South Africa. The funders had no role in study design, data collection, and analysis, decision to publish, or preparation of the manuscript.

References

1.Marinescu F, Marutescu L, Chifiriuc, Mariana C, Savin I, Lazar V. Virulence markers of Escherichia coli strains isolated from hospital and poultry wastewater. Biointerface Res Appl Chem. 2016;6:1612–20. [Google Scholar]
2.Julian TR. Environmental transmission of diarrheal pathogens in low and middle income countries. Environ Sci Process Impacts. 2016;18:944–55. doi: 10.1039/c6em00222f [DOI] [PubMed] [Google Scholar]
3.Pal C, Bengtsson-Palme J, Kristiansson E, Larsson DGJ. Co-occurrence of resistance genes to antibiotics, biocides and metals reveals novel insights into their co-selection potential. BMC Genomics. 2015;16:1–14. doi: 10.1186/s12864-015-2153-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Huijbers PMC, Flach CF, Larsson DGJ. A conceptual framework for the environmental surveillance of antibiotics and antibiotic resistance. Environ Int. 2019;130 June:104880. doi: 10.1016/j.envint.2019.05.074 [DOI] [PubMed] [Google Scholar]
5.Zhang S, Huang J, Zhao Z, Cao Y, Li B. Hospital Wastewater as a Reservoir for Antibiotic Resistance Genes: A Meta-Analysis. Front Public Heal. 2020;8 October:1–12. doi: 10.3389/fpubh.2020.574968 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Fouz N, Pangesti KNA, Yasir M, Al‐Malki AL, Azhar EI, Hill‐Cawthorne GA, et al. The contribution of wastewater to the transmission of antimicrobial resistance in the environment: Implications of mass gathering settings. Trop Med Infect Dis. 2020;5. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Nataro PJ, Kaper BJ. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11:142–201. [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Gomes TAT, Elias WP, Scaletsky ICA, Guth BEC, Rodrigues JF, Piazza RMF, et al. Diarrheagenic Escherichia coli. Brazilian J Microbiol. 2016;47:3–30. doi: 10.1016/j.bjm.2016.10.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Campos LC, Franzolin MR, Trabulsi LR. Diarrheagenic Escherichia coli categories among the traditional enteropathogenic E. coli O serogroups—A review. Mem Inst Oswaldo Cruz. 2004;99:545–52. doi: 10.1590/s0074-02762004000600001 [DOI] [PubMed] [Google Scholar]
10.Omar KB, Barnard TG. Detection of diarrhoeagenic Escherichia coli in clinical and environmental water sources in South Africa using single-step 11-gene m-PCR. World J Microbiol Biotechnol. 2014;30:2663–71. doi: 10.1007/s11274-014-1690-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Mayorgas A, Dotti I, Martínez-Picola M, Esteller M, Bonet-Rossinyol Q, Ricart E, et al. A Novel Strategy to Study the Invasive Capability of Adherent-Invasive Escherichia coli by Using Human Primary Organoid-Derived Epithelial Monolayers. Front Immunol. 2021;12 March:1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Croxen MA, Law RJ, Scholz R, Keeney KM, Wlodarska M, Finlay BB. Recent advances in understanding enteric pathogenic Escherichia coli. Clin Microbiol Rev. 2013;26:822–80. doi: 10.1128/CMR.00022-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Backert S, Hofreuter D. Molecular methods to investigate adhesion, transmigration, invasion and intracellular survival of the foodborne pathogen campylobacter jejuni. J Microbiol Methods. 2013;95:8–23. doi: 10.1016/j.mimet.2013.06.031 [DOI] [PubMed] [Google Scholar]
14.Liberatore AMA, Tomita SK, Vieira MAM, Toti C, Heckmaier J, Gomes TAT. Expression of aggregative adherence to HeLa cells by Escherichia coli strains isolated from sick horses. Brazilian J Microbiol. 2007;38:9–13. [Google Scholar]
15.Barrila J, Crabbé A, Yang J, Franco K, Nydam SD, Forsyth RJ, et al. Modeling host-pathogen interactions in the context of the microenvironment: Three-dimensional cell culture comes of age. Infect Immun. 2018;86. doi: 10.1128/IAI.00282-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Chue-Gonçalves M, Custódio CC, Pelayo JS, Nakazato G, Kobayashi RKT. New approach for detection of Escherichia coli invasion to HeLa cells. J Microbiol Methods. 2018;152 July:31–5. doi: 10.1016/j.mimet.2018.07.011 [DOI] [PubMed] [Google Scholar]
17.Mbanga J, Sibanda A, Rubayah S, Buwerimwe F, Mambodza K. Multi-Drug Resistant (MDR) Bacterial Isolates on Close Contact Surfaces and Health Care Workers in Intensive Care Units of a Tertiary Hospital in Bulawayo, Zimbabwe. J Adv Med Med Res. 2018;27:1–15. [Google Scholar]
18.Janezic KJ, Ferry B, Hendricks EW, Janiga BA, Johnson T, Murphy S, et al. Phenotypic and Genotypic Characterization of Escherichia coli Isolated from Untreated Surface Waters. Open Microbiol J. 2013;7:9–19. doi: 10.2174/1874285801307010009 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Clinical and Laboratory Standards Institute. M100S Performance Standards for Antimicrobial. 26th edition. Wayne, PA; 2016. www.clsi.org standard@clsi.org. [Google Scholar]
20.CLSI. CLSI M100-ED30:2020 Performance Standards for Antimicrobial Susceptibility Testing, 30th Edition. Wayne, PA; 2020. http://em100.edaptivedocs.net/GetDoc.aspx?doc=CLSIM100ED30:2020 [Google Scholar]
21.Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18:268–81. doi: 10.1111/j.1469-0691.2011.03570.x [DOI] [PubMed] [Google Scholar]
22.Sinha B, François PP, Nüße O, Foti M, Hartford OM, Vaudaux P, et al. Fibronectin-binding protein acts as Staphylococcus aureus invasin via fibronectin bridging to integrin α5β1. Cell Microbiol. 1999;1:101–17. [DOI] [PubMed] [Google Scholar]
23.Mashe T, Gudza-Mugabe M, Tarupiwa A, Munemo E, Mtapuri-Zinyowera S, Smouse SL, et al. Laboratory characterisation of Salmonella enterica serotype Typhi isolates from Zimbabwe, 2009–2017. BMC Infect Dis. 2019;19:487. doi: 10.1186/s12879-019-4114-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Fekadu S, Merid Y, Beyene H, Teshome W, Gebre-Selassie S. Assessment of antibiotic- and disinfectant-resistant bacteria in hospital wastewater, South Ethiopia: A cross-sectional study. J Infect Dev Ctries. 2015;9:149–56. doi: 10.3855/jidc.4808 [DOI] [PubMed] [Google Scholar]
25.Moges F, Endris M, Belyhun Y, Worku W. Isolation and characterization of multiple drug resistance bacterial pathogens from waste water in hospital and non-hospital environments, Northwest Ethiopia. BMC Res Notes. 2014;7:1–6. doi: 10.1186/1756-0500-7-215 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.King TLB, Schmidt S, Essack SY. Antibiotic resistant Klebsiella spp. from a hospital, hospital effluents and wastewater treatment plants in the uMgungundlovu District, KwaZulu-Natal, South Africa. Sci Total Environ. 2020;712:135550. doi: 10.1016/j.scitotenv.2019.135550 [DOI] [PubMed] [Google Scholar]
27.Shokoohizadeha MJ, Almasia A, Pirsaheba M, Khamutiana R, Mohajeric P, Shokoohizadehd L, et al. Prevalence of entrotoxigenic Escherichia coli strains in hospital wastewater treatment plant-A case study in Iran Prevalence of entrotoxigenic Escherichia coli strains in hospital wastewater treatment plant-A case study in Iran. Int J Curr Sci. 2016;19:13–9. [Google Scholar]
28.Omar KB, Barnard TG. The occurrence of pathogenic Escherichia coli in South African wastewater treatment plants as detected by multiplex PCR. Water SA. 2010;36:172–6. [Google Scholar]
29.Mbanga J, Abia ALK, Amoako DG, Essack SY. Quantitative microbial risk assessment for waterborne pathogens in a wastewater treatment plant and its receiving surface water body. BMC Microbiol. 2020;20:1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Spano LC, da Cunha KF, Monfardini MV, de Cássia Bergamaschi Fonseca R, Scaletsky ICA. High prevalence of diarrheagenic Escherichia coli carrying toxin-encoding genes isolated from children and adults in southeastern Brazil. BMC Infect Dis. 2017;17:1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Rappelli P, Folgosa E, Solinas ML, DaCosta JL, Pisanu C, Sidat M, et al. Pathogenic enteric Escherichia coli in children with and without diarrhea in Maputo, Mozambique. FEMS Immunol Med Microbiol. 2005;43:67–72. doi: 10.1016/j.femsim.2004.07.006 [DOI] [PubMed] [Google Scholar]
32.Dias RCB, Tanabe RHS, Vieira MA, Cergole-Novella MC, dos Santos LF, Gomes TAT, et al. Analysis of the Virulence Profile and Phenotypic Features of Typical and Atypical Enteroaggregative Escherichia coli (EAEC) Isolated From Diarrheal Patients in Brazil. Front Cell Infect Microbiol. 2020;10 April:1–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Vazquez-Juarez RC, Kuriakose JA, Rasko DA, Ritchie JM, Kendall MM, Slater TM, et al. CadA negatively regulates Escherichia coli O157:H7 adherence and intestinal colonization. Infect Immun. 2008;76:5072–81. doi: 10.1128/IAI.00677-08 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0282273.r001

Decision Letter 0

Sherin Reda Rouby

Transfer Alert

This paper was transferred from another journal. As a result, its full editorial history (including decision letters, peer reviews and author responses) may not be present.

15 Nov 2022

PONE-D-22-26831Antibiotic resistance, pathotypes and pathogen-host interactions in Escherichia coli from hospital wastewater in Bulawayo, ZimbabwePLOS ONE

Dear Dr. Mbanga,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Dec 30 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Sherin Reda Rouby, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf.

2. Thank you for stating the following in the Funding Section of your manuscript:

"This work is based on the research supported by the National University of Science and Technology (NUST) Research Board grant # RB17/43 and the kind support of the Vaccine-Preventable Diseases Respiratory and Meningeal Pathogens Research Unit (RMPRU), South Africa."

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

"The author(s) received no specific funding for this work."

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

3. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please ensure that your ethics statement is included in your manuscript, as the ethics statement entered into the online submission form will not be published alongside your manuscript.

4. Please include your tables as part of your main manuscript and remove the individual files. Please note that supplementary tables (should remain/ be uploaded) as separate "supporting information" files.

Additional Editor Comments:

The paper need some major revisions before its fully acceptance

The paper need grammatical corrections. Please do it using a native English speaker.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: COMMENTS TO AUTHORS:

Manuscript Number: PONE-D-22-26831

Article Type: Research Article

Full Title: Antibiotic resistance, pathotypes and pathogen-host interactions in Escherichia coli

from hospital wastewater in Bulawayo, Zimbabwe

Short Title: Pathotypes and pathogen-host interactions in Escherichia coli from hospital

wastewater

Keywords: Antibiotic Resistance; Hospital wastewater; Zimbabwe; Escherichia coli; HeLa cells

Well, this is an original research article about the antibiotic resistance, pathotypes and pathogen-host interactions in Escherichia coli from hospital wastewater in Bulawayo, Zimbabwe. This study aimed to characterise E. coli strains, isolated from hospital wastewater effluent in Bulawayo, Zimbabwe, using both molecular and cytological approaches. In this survey, wastewater samples were aseptically collected from the sewerage mains of a major public referral hospital in Bulawayo province weekly for one month. A total of 94 isolates were isolated and confirmed as E. coli, through biotyping and PCR targeting the uidA housekeeping gene. A total of 7 genes (eagg, eaeA, stx, flicH7, ipaH, lt, and st genes) coding for virulence in diarrheagenic E. coli were targeted. Antibiotic susceptibility of E. coli was determined against a panel of 12 antibiotics through the disk diffusion assay. The infectivity status of the observed pathotypes was investigated using HeLa cells through the adherence, invasion, and intracellular assay. None of the 94 isolates tested positive for the ipaH and flicH7genes. However, 48 (53.3%) isolates were enterotoxigenic E. coli (ETEC) (lt gene positive), 2 (2.13 %) isolates were enteroaggregative E. coli (EAEC) (eagg gene), and 1 (1.06%) isolate was enterohaemorrhagic E. coli (EHEC) (stx and eaeA). A high level of sensitivity was observed in E. coli against ertapenem (98.9%), and azithromycin (75.5%). The highest resistance was against ampicillin (92.6%) and sulphamethoxazole - trimethoprim (90.4%). Seventy-nine (84%) E. coli isolates exhibited multi-drug resistance. The infectivity study results indicated that environmentally isolated pathotypes were as infective as the clinically isolated pathotypes for all three parameters. No adherent cells were observed using ETEC and no cells were observed in the intracellular survival assay using EAEC. This study revealed that hospital wastewater is a hotspot for pathogenic E. coli and, that the environmentally isolated pathotypes maintained their ability to colonise and infect mammalian cells. This is a public health concern.

The study was well-designed and interesting. However, some major revisions are required before its fully acceptance. Thus, please address my following comments one by one and re-submit the corrected manuscript.

Comments to authors:

1-Some parts of the text need grammatical and topographical corrections. Please do it using a native English speaker.

2-How many samples were collected?

3-How the sample size was measured?

4-In the method section, there was no information about the type of collected samples (liquid or solid wastewater), method of sampling, number of samples, and other information.

5-The authors utilized only the Gram staining and oxidase test to approve E. coli isolates. It is not enough to carefully confirm the E. coli isolates.

6-Why did the authors use uidA (β-D glucuronidase) gene for E. coli identification? Why they didn’t use 16SrRNA?

7-Please completely determined the method used for DNA extraction.

8-How the quality and quantity of extracted DNA samples were determined?

9-Are you sure that E. coli ATCC® 25922 is positive for the uidA gene?

10-What about the negative control in the first PCR?

11-Please add positive and negative controls for the pathotyping of E. coli strains.

12-Please add the findings of disk diffusion for your applied control E. coli ATCC 25922.

13-In my opinion, both supplementary files (table and figure) should add to the text of the paper not as supplementary.

14-In the method used for pathotyping, the pathotypes assayed for included EHEC, EPEC, EIEC, EAEC, and ETEC were identified only by PCR. However, it was not enough. Because the authors determined the EHEC/EPEC strains as those that contained eaeA gene (and stx and fliCH7 for the EHEC strains (However, how do they differentiate from EHEC and EPEC?)), EAEC as those contained the eagg gene, EIEC gene as those contained ipaH gene, ETEC those contained st and lt genes (it is not determined that both of them or only one of them?). In my opinion, the method should do with more accurate details. It is also important to add controls.

15-Please add the PCR figure of genes.

16-Which bacterial concentration was used in the disk diffusion?

17-Please determine the antibiotic resistance pattern based on the pathotype of E. coli strains, too.

18-As Chloramphenicol is a forbidden antibiotic. Why 68.1% of isolates harbored resistance against it?

19-Please add more details about the exact meaning of week 1, week 2 , …

20-Please add the study limitation.

21-Please add more interpretations about the findings of the study in the discussion section.

Cheers

Dr. Farhad Safarpoor Dehkordi

Reviewer #2: The authors describe from a short-term (1 month) study, E.coli strains isolated from hospital wastewater effluent using spread plate method on EMB agar following a serial dilution. They used conventional PCR targeting uidA gene for confirmation of the strains. The confirmed strains were subsequently pathotyped by PCR using primers targeting 7 virulence genes that categorize the isolates into 5 subgroups of DEC. A total of 94 confirmed E.coli isolates were screened for antibiotic susceptibility using disk diffusion assay. Only three isolates ETEC (BHE16), EAEC (BHE59), and EHEC (BHE94) were selected for adherence and invasion assay using HeLa cells.

Overall, the manuscript is well written and informative. I have comments and suggestions below to improve the manuscript

Comments:

Results are very brief, mostly just a few sentences followed by Table or Figure. I suggest the authors to combine the results and discussion, especially that they still reference figures in the discussion section.

The authors included the statistical analysis in the methods, but interrogation is lacking in the text, statistically significant results must be clearly highlighted within text and in the figures/tables

Abstract

Statement of public health concern should be removed from the last line and revised to fit as first sentence in the abstract, followed by the aims of the study.

Introduction

Line 63-64: remove “acting as a hotspot for” and replace with “facilitating”. Use ARGs acronym as already defined in line 58.

Line 77: Predatory bacteria; is defined as bacteria the eat other bacteria, I do not think it was used here in that context. Consider a most suitable term

Sample collection:

Not clear what the duplicate samples were collected for, were they all analyzed independently?

Line 95: Supplementary Figure S1, not sure what is being described in the figure? Is this the original photo, maybe a diagram will depict better

The figure shows different sites, A-F, the results will be more interesting if the samples were collected from each site?

Isolation and confirmation of E. coli:

Authors mention that the effluent sample was serially diluted from -1 to -10, 100uL was spread-plated for only -1 to -5, why was -6 up to -10 was not plated or the point of dilution upto -10

Line 114: Is there a reference for the standard heat lysis protocol? If not briefly describe the protocol.

adherence and invasion assay

line 153-154: specify the strains of positive controls used, were they ATCC or obtained elsewhere. Are these the ones mentioned as clinical strains in Figure 3, 4 and 5?

Why is ETEC (BHE16) not tested for adherence?

Why is EAEC(BHE95) not tested for intracellular survival?

Results and discussion

Line 197, 252, 257 : incorporate n=…, to clearly indicate the number of isolates

Line 264, 298 name of the genes and strains should be in italics

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Dr. Farhad Safarpoor Dehkordi

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2023 Mar 2;18(3):e0282273. doi: 10.1371/journal.pone.0282273.r002

Author response to Decision Letter 0

22 Dec 2022

RE: Rebuttal letter

Title: Antibiotic resistance, pathotypes, and pathogen-host interactions in Escherichia coli from hospital wastewater in Bulawayo, Zimbabwe. PONE-D-22-26831.

Please find below a Table in response to the comments of both reviewers. The changes to the manuscript are indicated in the text by tracked changes (reviewer 1) and in tracked changes and yellow highlight (reviewer 2).

Reviewer’s comments Response/Rebuttal

Editor’s comments

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming We have made the necessary amendments to meet PLOS ONE style requirements

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

"The author(s) received no specific funding for this work."

Please include your amended statements within your cover letter; we will change the online submission form on your behalf. The funding information has been removed from the Acknowledgement section. We have included the amended funding statement in the cover letter.

Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please ensure that your ethics statement is included in your manuscript, as the ethics statement entered into the online submission form will not be published alongside your manuscript. The Ethics statement has been moved to the Methods and materials section.

Please include your tables as part of your main manuscript and remove the individual files. Please note that supplementary tables (should remain/ be uploaded) as separate "supporting information" files. The tables have been included in the main manuscript.

Reviewer 1

Some parts of the text need grammatical and topographical corrections. Please do it using a native English speaker. We used a language editor Grammarly to edit the manuscript & sought additional assistance to improve the grammar

How many samples were collected? Four wastewater samples were collected (duplicate samples per week for a month). This is mentioned in line 108.

In the method section, there was no information about the type of collected samples (liquid or solid wastewater), method of sampling, number of samples, and other information The type of collected sample is mentioned. line 105 ” The sampled sewerage mains receives liquid waste…”

Method of sampling has been added – line 108

Number of samples – line 108

The authors utilized only the Gram staining and oxidase test to approve E. coli isolates. It is not enough to carefully confirm the E. coli isolates The selective media Eosin Methylene blue was used for isolation, and confirmation was primarily based on the PCR. More biochemical tests could have been necessary had we not done molecular confirmation.

Why did the authors use uidA (β-D glucuronidase) gene for E. coli identification? Why they didn’t use 16SrRNA? The uidA gene sequence is unique to E. coli (Bej et al., 1991, Appl Environ Microbiol 57:1013–1017). This means it can be routinely used for the identification of E. coli species {Green et al. 1991, https://doi.org/10.1016/0167-7012(91)90046-S } {Maheux et al. 2009, Water Res 43:3019–3028}, {Janezic et al. 2013, Open Microbiol. J. 7:9–19.}, { Naganandhini et al. 2015, 10.1371/journal.pone.0130038}, {Mbanga et al., 2021, 10.1089/mdr.2020.0380}

- I6SrRNA works for molecular identification if it is married with PCR amplicon sequencing.

Please completely determined the method used for DNA extraction. Heat lysis protocol is the boiling method a reference has been added. Line 133.

How the quality and quantity of extracted DNA samples were determined? The quality and quantity of DNA were determined using gel electrophoresis and a molecular weight marker. This has been included in the manuscript. Lines 133 – 139.

Are you sure that E. coli ATCC® 25922 is positive for the uidA gene? Yes. Very positive. As previously reported in many papers. (Titilawo et al., 2015, https://doi.org/10.1186/s12866-015-0540-3), { Naganandhini et al. 2015, 10.1371/journal.pone.0130038}, {Mbanga et al., 2021, 10.1089/mdr.2020.0380},

What about the negative control in the first PCR? The negative control is mentioned in line 145

Please add positive and negative controls for the pathotyping of E. coli strains. The positive controls are referred to as reference strains in line 152. To ensure there is no ambiguity we have added positive controls to the sentence in lines 152 – 153.

The negative control is mentioned in line 160.

Please add the findings of disk diffusion for your applied control E. coli ATCC 25922. We feel it is unnecessary to include this result in the main manuscript as the results of the disc diffusion assay for this control strain are well known. The isolate is susceptible to most antibiotics. Should the reviewer insist on seeing these results, they can be availed via email.

In my opinion, both supplementary files (Table and figure) should add to the text of the paper not as supplementary As suggested, we have included supplementary table S2 in the main text as Table 1. We, however, do not see the value of including supplementary Table S1 in the main text as the Table was previously published as supplementary material (Mbanga et al., 2020, https://doi.org/10.1186/s12866-020-02036-7 ). S1 Fig. is a picture of the wastewater collection site (drainage) in the main sewer of the hospital and is hardly referred to in the main text. Hence, we believe it is appropriately placed in the supplementary materials section.

-In the method used for pathotyping, the pathotypes assayed for included EHEC, EPEC, EIEC, EAEC, and ETEC were identified only by PCR. However, it was not enough. Because the authors determined the EHEC/EPEC strains as those that contained eaeA gene (and stx and fliCH7 for the EHEC strains (However, how do they differentiate from EHEC and EPEC?)), EAEC as those contained the eagg gene, EIEC gene as those contained ipaH gene, ETEC those contained st and lt genes (it is not determined that both of them or only one of them?). In my opinion, the method should do with more accurate details. It is also important to add controls. The method used to pathotype E. coli in our study is a standard protocol that has been reported in several studies. We list a few below.

• https://doi.org/10.1016/j.scitotenv.2016.05.155.

• https://doi.org/10.1111/1469-0691.12646.

• https://doi.org/10.1186/s13099-019-0290-0.

• Omar and Barnard, 2014, World J Microbiol Biotechnol. 2014;30(10):2663–71

• Adesifoye et al. 2016, Microbiology open. 2016;5(1):143–51

We stand guided on what additional assays the reviewer feels should have been done.

Please add the PCR figure of genes. These have been added as supplementary material.

Which bacterial concentration was used in the disk diffusion? The antibiotic susceptibility testing and interpretation of results were done according to CLSI guidelines. This has been clarified in lines 182 -183. Bacterial concentration should be equivalent to a 0.5 MacFarland standard.

Please determine the antibiotic resistance pattern based on the pathotype of E. coli strains, too. The manuscript includes antibiotic resistance patterns based on the E. coli pathotype in Table 4.

As Chloramphenicol is a forbidden antibiotic. Why 68.1% of isolates harbored resistance against it? We need clarification on the question. Is the expectation that there should be no resistance to chloramphenicol because it is banned? Resistance mechanisms are determined by a myriad of factors, including mobile genetic elements which carry a variety of resistant determinants that work against a plethora of antibiotics. Antibiotic resistance is influenced by many factors we might not fully understand for instance, why we find antibiotic-resistant bacteria in pristine environments.

Please add more details about the exact meaning of week 1, week 2 , … This request is not clear. We sampled for four weeks, from week 1 to week 4.

Please add the study limitation Limitations are mentioned in lines 451 – 456.

Please add more interpretations about the findings of the study in the discussion section. The discussion has been expanded as suggested.

Reviewer 2

Limitation in sample size…, why is only one of each pathotype selected for the adherence and invasion assays? I suggest it to be done in triplicate where possible, that will add more validation to support the conclusions Thank you for your comment. Indeed using more isolates would have improved the validity of the results. However, we used one isolate from each pathotype mainly because we had only one EHEC isolate. We reasoned that our experimental isolates and the positive controls used in the study would give us reliable results.

Results are very brief, mostly just a few sentences followed by a Table or Figure. I suggest the authors to combine the results and discussion, especially that they still reference figures in the discussion section. We have added two tables to the manuscript and expanded the results section. We hope this is sufficient for the manuscript to retain the individual results and discussion sections.

Abstract

Statement of public health concern should be removed from the last line and revised to fit as first sentence in the abstract, followed by the aims of the study. The statement has been removed from the abstract entirely.

Introduction

Line 63-64: remove “acting as a hotspot for” and replace with “facilitating”. Use ARGs acronym as already defined in line 58 The suggestions have been implemented, facilitating added - line 67. ARG acronym used – line 67

Line 77: Predatory bacteria; is defined as bacteria that eat other bacteria, I do not think it was used here in that context. Consider a most suitable term The term predatory has been replaced by pathogenic – line 83

Sample collection:

Not clear what the duplicate samples were collected for, were they all analyzed independently? The duplicate samples were pooled and analysed as one composite sample. Lines 110 – 111.

Line 95: Supplementary Figure S1, not sure what is being described in the figure? Is this the original photo, maybe a diagram will depict better

The figure shows different sites, A-F, the results will be more interesting if the samples were collected from each site? Figure S1 is a photograph of the main sewer where wastewater was collected. It shows that effluent from different wards merges into one at the sampled point. We concur that the wastewater could have been sampled per respective ward, however, this was out of the scope of this study but should be considered in future studies.

Authors mention that the effluent sample was serially diluted from -1 to -10, 100uL was spread-plated for only -1 to -5, why was -6 up to -10 was not plated or the point of dilution upto -10 Thank you for this observation. We made dilutions up to -5 not -10 the mistake has been corrected. – Line 121.

Line 114: Is there a reference for the standard heat lysis protocol? If not briefly describe the protocol.

adherence and invasion assay A reference has been added – line 133

line 153-154: specify the strains of positive controls used, were they ATCC or obtained elsewhere. Are these the ones mentioned as clinical strains in Figure 3, 4, and 5? A statement specifying the positive controls/reference strains has been added. DSM isolates were used. Lines 152 -154. The same reference isolates were used for the infectivity study.

Figures 3-5 should also be combined into 1 figure, Figure 3 to be 3A, figure 4 to be 3B, and figure 5 to be figure 3C, and all graphs should use the same scale (e.g. 0.0 logcfu/mL to 10 logcfu/mL for adherence, invasion, and 0.0 to 5.0 logcfy/mL for intracellular survival ) for better comparison among the different pathotypes in three different assays Because of the differences in the results of the assayed pathotypes the software gave us the best output by determining the scale for the Y-axis. We have, however, reorganised the Figs to 3a. showing the adherence assay, 3b. showing the invasion assay and 3c. showing the intracellular survival assay for easy comparison among the different pathotypes in the three different assays. Fig.3a-c.

Why is ETEC (BHE16) not tested for adherence? The isolate was tested for adherence but yielded negative results. Lines 302-303

Why is EAEC(BHE95) not tested for intracellular survival? The isolate was tested for adherence but yielded negative results. Lines 306-307

Results and discussion

Line 197, 252, 257 : incorporate n=…, to clearly indicate the number of isolates This has been amended lines 263 – 265.

Line 264, 298 name of the genes and strains should be in italics This has been amended in the entire document.

Attachment

Submitted filename: PLOS ONE REBUTTAL.docx

Click here for additional data file.^{(25.1KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0282273.r003

Decision Letter 1

Sherin Reda Rouby

23 Jan 2023

PONE-D-22-26831R1Antibiotic resistance, pathotypes and pathogen-host interactions in Escherichia coli from hospital wastewater in Bulawayo, ZimbabwePLOS ONE

Dear Dr. Mbanga,

==============================

ACADEMIC EDITOR: Authors should change the manuscript carefully according to reviewer recommendations to be suitable for publication. />==============================

Please submit your revised manuscript by one month ,Mar 09 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Sherin Reda Rouby, PhD

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: No

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: I Don't Know

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: No

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #1: Manuscript Number: PONE-D-22-26831R1

Manuscript Title: Antibiotic resistance, pathotypes and pathogen-host interactions in Escherichia coli from hospital wastewater in Bulawayo, Zimbabwe

Journal: Plos One

Comments to authors:

Well, this is an original research study about the Antibiotic resistance properties, pathotypes distribution and pathogen-host interactions in Escherichia coli strains isolated from hospital wastewater in Bulawayo, Zimbabwe.

Some of my comments have been addressed. However, important items should clearly identify before the acceptance of the paper.

1-The authors mentioned that Casualty department, Burns ward, Intensive Care Unit (ICU), Female ward, and Children’s ward were targeted. Is there any differences between properties your assessed or not?

2-How the sample size (A total of 4 wastewater samples were collected in duplicate) was determined?

3-Add reference for the molecular confirmation of E. coli. Add primers

4-I have a question, are all E. coli strains harbored the uidA (β-D glucuronidase) genes? In total I mean.

5-How the pathotypes were determined? We need to know more about primers and related genes. Please add its table in the text. Additionally, please clearly explained that which two or one genes correspond for each pathotypes?

6-S4 fig: In my opinion your figure is not correspond for these genes. It is because of your ladder is not 100 bp ladder. If a ladder was 100 pb, the 500 bp stair should clearly highlighted and more predominant!!!! Similar to S2, S3, S5. This is the main figure of 100bp ladder:

Pay attention to my points (unfortunately I couldn't attached file here, Check the exact 100 bp ladder here: https://international.neb.com/products/n3231-100-bp-dna-ladder#Product%20Information)

7-As far as we know, the EHEC strains are mainly coming from animals. How did you interprate this?

8-Which bacterial concentration was used in disk diffusion?

9-What differences were performed to growth each pathotypes in the Muller Hinton agar?

10-I checked the CLSI version you used in this study. The mean diameter of the growth inhibition zone of azithromycin was not determined in this version.

11-Please also add the results of positive and negative controls for all disks, genes, and …

12-As I said before, remove the text and add all PCR conditions including targeted genes, sequence of primers, size of products, Thermal cycling and volumes in tables.

13-The method used for bacterial isolation using culture is not accurately determined. There were no biochemical tests. Additionally, the authors tried to measure the bacterial colonies in each millimeter of the swage samples but their results are not presented.

14-Additionally, if the authors did bacterial count, they should compared them with standard of Europe and their country and also US FDA.

Sincerely

FSD

Reviewer #2: The authors have sufficiently addressed most of the comments raised by the reviewers. Only one reservation is on the negative control. In my view the negative control in this case must be bacterial DNA that is known to be negative of the gene that is targeted. Using nuclease free water as negative only confirms that there is no contamination.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Dr. Farhad Safarpoor Dehkordi (FSD)

Reviewer #2: No

**********

PLoS One. 2023 Mar 2;18(3):e0282273. doi: 10.1371/journal.pone.0282273.r004

Author response to Decision Letter 1

1 Feb 2023

Dear Dr. Rouby

Academic Editor: PLOS ONE

RE: Rebuttal letter

Title: Antibiotic resistance, pathotypes, and pathogen-host interactions in Escherichia coli from hospital wastewater in Bulawayo, Zimbabwe. PONE-D-22-26831.

Reviewer’s comments Response/Rebuttal

Reviewer 1

The authors mentioned that Casualty department, Burns ward, Intensive Care Unit (ICU), Female ward, and Children’s ward were targeted. Is there any differences between properties your assessed or not? We sampled from the sewer mains that receives sewage from the casualty department, burns ward, Intensive care unit, female ward, and Children’s wards. We did not collect samples from the sewers of each ward independently and thus could not make comparisons based on the different wards. We hope this is clear.

How the sample size (A total of 4 wastewater samples were collected in duplicate) was determined? Determination of sample size was not calculated statistically but based on referring to other similar cross sectional studies on the environment. This was notably a limitation but we believe the sample size did not mask the resultant findings revealed by the cytology part of the study. We did mention that sample size was a limitation of the study. Line 418 -419.

Add reference for the molecular confirmation of E. coli. Add primers A reference has been inserted in line 138.

Primer sequences have been added. lines 140 & 141.

I have a question, are all E. coli strains harbored the uidA (β-D glucuronidase) genes? In total I mean. Typically upwards of 95% of E. coli possess the β-D glucuronidase gene hence its wide use for the detection of the microorganism. The uidA gene sequence is unique to E. coli (Bej et al., 1991, Appl Environ Microbiol 57:1013–1017). This means it can be routinely used for the identification of E. coli species {Green et al. 1991, https://doi.org/10.1016/0167-7012(91)90046-S } {Maheux et al. 2009, Water Res 43:3019–3028}, {Janezic et al. 2013, Open Microbiol. J. 7:9–19.}, { Naganandhini et al. 2015, 10.1371/journal.pone.0130038}, {Mbanga et al., 2021, 10.1089/mdr.2020.0380}

How the pathotypes were determined? We need to know more about primers and related genes. Please add its table in the text. Additionally, please clearly explained that which two or one genes correspond for each pathotypes? Pathotyping of E. coli is detailed in the manuscript. Lines 150 – 168. Primers and positive controls are provided in the supplementary materials SI Table. Line 154. The genes and their corresponding pathotypes are provided in the S1 Table.

S4 fig: In my opinion your figure is not correspond for these genes. It is because of your ladder is not 100 bp ladder. If a ladder was 100 pb, the 500 bp stair should clearly highlighted and more predominant!!!! Similar to S2, S3, S5. This is the main figure of 100bp ladder: Pay attention to my points (unfortunately I couldn't attached file here, Check the exact 100 bp ladder here: https://international.neb.com/products/n3231-100-bp-dna-ladder#Product%20Information) We thank the reviewer for the sharp observation. We have cross-checked and can confirm that the correct ladder we used was the Invitrogen 1kb plus ladder from Thermo Fisher Scientific whose brightest band is the 1.5kb band (https://assets.fishersci.com/TFS-Assets/LSG/manuals/1Kb_Plus_DNA_ladder_man.pdf). The error has been corrected in the manuscript and Figs. The gene sizes are correct.

As far as we know, the EHEC strains are mainly coming from animals. How did you interprate this? The EHEC group has been recognized as the universal cause of serious human gastrointestinal diseases Griffin et al. 1991 Epidemiol Rev. 1991;13:60–98. We have previously reported EHEC in the water environment Mbanga et al., 2020 (BMC Microbiology 20:346. Although it is predominantly found in animals it does occur in clinical settings and in the environment. As our study was in a clinical setting we can only assume that there were patients infected with EHEC during our sampling period.

Which bacterial concentration was used in disk diffusion? Bacterial concentration was equivalent to a 0.5 MacFarland standard. This provides an optical density comparable to the density of a bacterial suspension 1.5x 10^8 colony-forming units (CFU/ml). This has been added. Line 174 – 175.

What differences were performed to growth each pathotypes in the Muller Hinton agar? We, unfortunately, do not understand this question. Is the reviewer asking if there were differences observed on MUELLER Hinton depending on the pathotype?

I checked the CLSI version you used in this study. The mean diameter of the growth inhibition zone of azithromycin was not determined in this version. We have added a reference to an older version of the CLSI guidelines that gave zone diametres for Enterobacteriaceae. Line 182.

Please also add the results of positive and negative controls for all disks, genes, and… We believe this is adequately done throughout the manuscript.

As I said before, remove the text and add all PCR conditions including targeted genes, sequence of primers, size of products, Thermal cycling and volumes in tables. We thank the reviewer once again for this suggestion. We, however, still believe our PCR conditions and volumes are amply described in text format. We have tabulated primer sequences and the expected amplicon sizes in S1 Table.

The method used for bacterial isolation using culture is not accurately determined. There were no biochemical tests. Additionally, the authors tried to measure the bacterial colonies in each millimeter of the swage samples but their results are not presented. We used the Eosin methylene blue agar to culture the E. coli. Presumptive E. coli colonies with a metallic green sheen were subjected to the Gram stain and oxidase test (Biochemical tests). Lines 120 - 127

We did not measure or try to measure bacterial colonies in each millimetre of sewage samples. We are confused by what the reviewer is referring to here. We report that we randomly picked colonies from each sewage sample such that we had 10 representative isolates for each sample. This was not an attempt to ‘measure’or count the colonies. Lines 123 -126.

Additionally, if the authors did bacterial count, they should compared them with standard of Europe and their country and also US FDA. We did not do any bacterial counts.

Reviewer 2

The authors have sufficiently addressed most of the comments raised by the reviewers. Only one reservation is on the negative control. In my view the negative control in this case must be bacterial DNA that is known to be negative of the gene that is targeted. Using nuclease free water as negative only confirms that there is no contamination. Thank you for your comment. Indeed that is correct. The nuclease-free water does indicate that there was no contamination during the PCR and that the positive results were most likely due to the DNA template used. We will make sure to add DNA from a known negative in future studies.

PLoS One. doi: 10.1371/journal.pone.0282273.r005

Decision Letter 2

Sherin Reda Rouby

13 Feb 2023

Antibiotic resistance, pathotypes and pathogen-host interactions in Escherichia coli from hospital wastewater in Bulawayo, Zimbabwe

PONE-D-22-26831R2

Dear Dr. Joshua Mbanga,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Sherin Reda Rouby, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0282273.r006

Acceptance letter

Sherin Reda Rouby

17 Feb 2023

PONE-D-22-26831R2

Antibiotic resistance, pathotypes, and pathogen-host interactions in Escherichia coli from hospital wastewater in Bulawayo, Zimbabwe

Dear Dr. Mbanga:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Professor Sherin Reda Rouby

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. E. coli primers and reference strains used in PCR reactions.

(DOCX)

Click here for additional data file.^{(16.2KB, docx)}

S1 Fig

Sample collection was done from site F, the intersection point of A (Children’s ward sewer), B (Intensive Care Unit sewer), C (Burns ward sewer), D (Casualty sewer), and E (Female ward sewer).

(DOCX)

Click here for additional data file.^{(200.4KB, docx)}

S2 Fig. Representative amplicons obtained by PCR for isolates tested for the lt gene, with the expected size of 708bp.

(DOCX)

Click here for additional data file.^{(224.6KB, docx)}

S3 Fig. Amplicons obtained by PCR for isolates tested for eagg gene with the expected size of 194bp.

(DOCX)

Click here for additional data file.^{(156.1KB, docx)}

S4 Fig. Amplicons obtained by PCR for isolates tested for the eaeA and stx gene, with the expected size of 248bp and 478bp.

(DOCX)

Click here for additional data file.^{(83.6KB, docx)}

S5 Fig. Amplicons obtained by PCR for isolates tested for the eaeA with the expected size of 248bp.

(DOCX)

Click here for additional data file.^{(192.2KB, docx)}

Attachment

Submitted filename: PLOS ONE REBUTTAL.docx

Click here for additional data file.^{(25.1KB, docx)}

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.

[pone.0282273.ref001] 1.Marinescu F, Marutescu L, Chifiriuc, Mariana C, Savin I, Lazar V. Virulence markers of Escherichia coli strains isolated from hospital and poultry wastewater. Biointerface Res Appl Chem. 2016;6:1612–20. [Google Scholar]

[pone.0282273.ref002] 2.Julian TR. Environmental transmission of diarrheal pathogens in low and middle income countries. Environ Sci Process Impacts. 2016;18:944–55. doi: 10.1039/c6em00222f [DOI] [PubMed] [Google Scholar]

[pone.0282273.ref003] 3.Pal C, Bengtsson-Palme J, Kristiansson E, Larsson DGJ. Co-occurrence of resistance genes to antibiotics, biocides and metals reveals novel insights into their co-selection potential. BMC Genomics. 2015;16:1–14. doi: 10.1186/s12864-015-2153-5 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0282273.ref004] 4.Huijbers PMC, Flach CF, Larsson DGJ. A conceptual framework for the environmental surveillance of antibiotics and antibiotic resistance. Environ Int. 2019;130 June:104880. doi: 10.1016/j.envint.2019.05.074 [DOI] [PubMed] [Google Scholar]

[pone.0282273.ref005] 5.Zhang S, Huang J, Zhao Z, Cao Y, Li B. Hospital Wastewater as a Reservoir for Antibiotic Resistance Genes: A Meta-Analysis. Front Public Heal. 2020;8 October:1–12. doi: 10.3389/fpubh.2020.574968 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0282273.ref006] 6.Fouz N, Pangesti KNA, Yasir M, Al‐Malki AL, Azhar EI, Hill‐Cawthorne GA, et al. The contribution of wastewater to the transmission of antimicrobial resistance in the environment: Implications of mass gathering settings. Trop Med Infect Dis. 2020;5. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0282273.ref007] 7.Nataro PJ, Kaper BJ. Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998;11:142–201. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0282273.ref008] 8.Gomes TAT, Elias WP, Scaletsky ICA, Guth BEC, Rodrigues JF, Piazza RMF, et al. Diarrheagenic Escherichia coli. Brazilian J Microbiol. 2016;47:3–30. doi: 10.1016/j.bjm.2016.10.015 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0282273.ref009] 9.Campos LC, Franzolin MR, Trabulsi LR. Diarrheagenic Escherichia coli categories among the traditional enteropathogenic E. coli O serogroups—A review. Mem Inst Oswaldo Cruz. 2004;99:545–52. doi: 10.1590/s0074-02762004000600001 [DOI] [PubMed] [Google Scholar]

[pone.0282273.ref010] 10.Omar KB, Barnard TG. Detection of diarrhoeagenic Escherichia coli in clinical and environmental water sources in South Africa using single-step 11-gene m-PCR. World J Microbiol Biotechnol. 2014;30:2663–71. doi: 10.1007/s11274-014-1690-4 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0282273.ref011] 11.Mayorgas A, Dotti I, Martínez-Picola M, Esteller M, Bonet-Rossinyol Q, Ricart E, et al. A Novel Strategy to Study the Invasive Capability of Adherent-Invasive Escherichia coli by Using Human Primary Organoid-Derived Epithelial Monolayers. Front Immunol. 2021;12 March:1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0282273.ref012] 12.Croxen MA, Law RJ, Scholz R, Keeney KM, Wlodarska M, Finlay BB. Recent advances in understanding enteric pathogenic Escherichia coli. Clin Microbiol Rev. 2013;26:822–80. doi: 10.1128/CMR.00022-13 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0282273.ref013] 13.Backert S, Hofreuter D. Molecular methods to investigate adhesion, transmigration, invasion and intracellular survival of the foodborne pathogen campylobacter jejuni. J Microbiol Methods. 2013;95:8–23. doi: 10.1016/j.mimet.2013.06.031 [DOI] [PubMed] [Google Scholar]

[pone.0282273.ref014] 14.Liberatore AMA, Tomita SK, Vieira MAM, Toti C, Heckmaier J, Gomes TAT. Expression of aggregative adherence to HeLa cells by Escherichia coli strains isolated from sick horses. Brazilian J Microbiol. 2007;38:9–13. [Google Scholar]

[pone.0282273.ref015] 15.Barrila J, Crabbé A, Yang J, Franco K, Nydam SD, Forsyth RJ, et al. Modeling host-pathogen interactions in the context of the microenvironment: Three-dimensional cell culture comes of age. Infect Immun. 2018;86. doi: 10.1128/IAI.00282-18 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0282273.ref016] 16.Chue-Gonçalves M, Custódio CC, Pelayo JS, Nakazato G, Kobayashi RKT. New approach for detection of Escherichia coli invasion to HeLa cells. J Microbiol Methods. 2018;152 July:31–5. doi: 10.1016/j.mimet.2018.07.011 [DOI] [PubMed] [Google Scholar]

[pone.0282273.ref017] 17.Mbanga J, Sibanda A, Rubayah S, Buwerimwe F, Mambodza K. Multi-Drug Resistant (MDR) Bacterial Isolates on Close Contact Surfaces and Health Care Workers in Intensive Care Units of a Tertiary Hospital in Bulawayo, Zimbabwe. J Adv Med Med Res. 2018;27:1–15. [Google Scholar]

[pone.0282273.ref018] 18.Janezic KJ, Ferry B, Hendricks EW, Janiga BA, Johnson T, Murphy S, et al. Phenotypic and Genotypic Characterization of Escherichia coli Isolated from Untreated Surface Waters. Open Microbiol J. 2013;7:9–19. doi: 10.2174/1874285801307010009 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0282273.ref019] 19.Clinical and Laboratory Standards Institute. M100S Performance Standards for Antimicrobial. 26th edition. Wayne, PA; 2016. www.clsi.org standard@clsi.org. [Google Scholar]

[pone.0282273.ref020] 20.CLSI. CLSI M100-ED30:2020 Performance Standards for Antimicrobial Susceptibility Testing, 30th Edition. Wayne, PA; 2020. http://em100.edaptivedocs.net/GetDoc.aspx?doc=CLSIM100ED30:2020 [Google Scholar]

[pone.0282273.ref021] 21.Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18:268–81. doi: 10.1111/j.1469-0691.2011.03570.x [DOI] [PubMed] [Google Scholar]

[pone.0282273.ref022] 22.Sinha B, François PP, Nüße O, Foti M, Hartford OM, Vaudaux P, et al. Fibronectin-binding protein acts as Staphylococcus aureus invasin via fibronectin bridging to integrin α5β1. Cell Microbiol. 1999;1:101–17. [DOI] [PubMed] [Google Scholar]

[pone.0282273.ref023] 23.Mashe T, Gudza-Mugabe M, Tarupiwa A, Munemo E, Mtapuri-Zinyowera S, Smouse SL, et al. Laboratory characterisation of Salmonella enterica serotype Typhi isolates from Zimbabwe, 2009–2017. BMC Infect Dis. 2019;19:487. doi: 10.1186/s12879-019-4114-0 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0282273.ref024] 24.Fekadu S, Merid Y, Beyene H, Teshome W, Gebre-Selassie S. Assessment of antibiotic- and disinfectant-resistant bacteria in hospital wastewater, South Ethiopia: A cross-sectional study. J Infect Dev Ctries. 2015;9:149–56. doi: 10.3855/jidc.4808 [DOI] [PubMed] [Google Scholar]

[pone.0282273.ref025] 25.Moges F, Endris M, Belyhun Y, Worku W. Isolation and characterization of multiple drug resistance bacterial pathogens from waste water in hospital and non-hospital environments, Northwest Ethiopia. BMC Res Notes. 2014;7:1–6. doi: 10.1186/1756-0500-7-215 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0282273.ref026] 26.King TLB, Schmidt S, Essack SY. Antibiotic resistant Klebsiella spp. from a hospital, hospital effluents and wastewater treatment plants in the uMgungundlovu District, KwaZulu-Natal, South Africa. Sci Total Environ. 2020;712:135550. doi: 10.1016/j.scitotenv.2019.135550 [DOI] [PubMed] [Google Scholar]

[pone.0282273.ref027] 27.Shokoohizadeha MJ, Almasia A, Pirsaheba M, Khamutiana R, Mohajeric P, Shokoohizadehd L, et al. Prevalence of entrotoxigenic Escherichia coli strains in hospital wastewater treatment plant-A case study in Iran Prevalence of entrotoxigenic Escherichia coli strains in hospital wastewater treatment plant-A case study in Iran. Int J Curr Sci. 2016;19:13–9. [Google Scholar]

[pone.0282273.ref028] 28.Omar KB, Barnard TG. The occurrence of pathogenic Escherichia coli in South African wastewater treatment plants as detected by multiplex PCR. Water SA. 2010;36:172–6. [Google Scholar]

[pone.0282273.ref029] 29.Mbanga J, Abia ALK, Amoako DG, Essack SY. Quantitative microbial risk assessment for waterborne pathogens in a wastewater treatment plant and its receiving surface water body. BMC Microbiol. 2020;20:1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0282273.ref030] 30.Spano LC, da Cunha KF, Monfardini MV, de Cássia Bergamaschi Fonseca R, Scaletsky ICA. High prevalence of diarrheagenic Escherichia coli carrying toxin-encoding genes isolated from children and adults in southeastern Brazil. BMC Infect Dis. 2017;17:1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0282273.ref031] 31.Rappelli P, Folgosa E, Solinas ML, DaCosta JL, Pisanu C, Sidat M, et al. Pathogenic enteric Escherichia coli in children with and without diarrhea in Maputo, Mozambique. FEMS Immunol Med Microbiol. 2005;43:67–72. doi: 10.1016/j.femsim.2004.07.006 [DOI] [PubMed] [Google Scholar]

[pone.0282273.ref032] 32.Dias RCB, Tanabe RHS, Vieira MA, Cergole-Novella MC, dos Santos LF, Gomes TAT, et al. Analysis of the Virulence Profile and Phenotypic Features of Typical and Atypical Enteroaggregative Escherichia coli (EAEC) Isolated From Diarrheal Patients in Brazil. Front Cell Infect Microbiol. 2020;10 April:1–10. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0282273.ref033] 33.Vazquez-Juarez RC, Kuriakose JA, Rasko DA, Ritchie JM, Kendall MM, Slater TM, et al. CadA negatively regulates Escherichia coli O157:H7 adherence and intestinal colonization. Infect Immun. 2008;76:5072–81. doi: 10.1128/IAI.00677-08 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Antibiotic resistance, pathotypes, and pathogen-host interactions in Escherichia coli from hospital wastewater in Bulawayo, Zimbabwe

Joshua Mbanga

Nokukhanya P Kodzai

Wilhem F Oosthuysen

Roles

Abstract

Introduction

Materials and methods

Ethical approval

Study site and sample collection

Isolation of E. coli

Molecular confirmation of E. coli

Pathotyping of E. coli

Antibiotic susceptibility testing of E. coli

Adherence and invasion assay

Table 1. Antibiotic susceptibility and pathotypes of three E. coli isolates used in the infectivity study.

Intracellular survival

Statistical analysis

Results

Isolation and identification of E. coli

Antibiotic susceptibility of E. coli

Table 2. Antibiotic sensitivity of confirmed E. coli isolates from hospital wastewater.

Table 3. Antibiotic resistance patterns of E. coli isolates from hospital wastewater.

Table 4. Antibiotic resistance patterns of pathogenic E. coli pathotypes.

Distribution of E. coli pathotypes

Fig 1. Distribution of E. coli pathotypes isolated from hospital wastewater over one month.

Fig 2. Weekly distribution of E. coli pathotypes obtained from hospital effluent.

Adherence, invasion, and intracellular survival of E. coli pathotypes

Fig 3.

Discussion

Antibiotic resistance profiles of E. coli

Prevalence of diarrhoeagenic E. coli in hospital wastewater

Pathogen host interactions

Conclusion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Sherin Reda Rouby

Roles

Transfer Alert

Author response to Decision Letter 0

Decision Letter 1

Sherin Reda Rouby

Roles

Author response to Decision Letter 1

Decision Letter 2

Sherin Reda Rouby

Roles

Acceptance letter

Sherin Reda Rouby

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases