Abstract
Background
Switchgrass (Panicum virgatum L.) is an important biofuel crop that may contribute to replacing petroleum fuels. However, slow seedling growth and soil salinization affect the growth and development of switchgrass. An increasing number of studies have shown that beneficial microorganisms promote plant growth and increase tolerance to salinity stress. However, the feasibility of inoculating switchgrass with Azorhizobium caulinodans ORS571 to enhance the growth and salt tolerance of its seedlings is unclear. Our previous study showed that A. caulinodans ORS571 could colonize wheat (Triticum aestivum L.) and thereby promote its growth and development and regulate the gene expression levels of microRNAs (miRNAs).
Results
In this study, we systematically studied the impact of A. caulinodans ORS571 on switchgrass growth and development and the response to salinity stress; we also studied the underlying mechanisms during these biological processes. Inoculation with A. caulinodans ORS571 significantly alleviated the effect of salt stress on seedling growth. Under normal conditions, A. caulinodans ORS571 significantly increased fresh plant weight, chlorophyll a content, protein content, and peroxidase (POD) activity in switchgrass seedlings. Under salt stress, the fresh weight, dry weight, shoot and root lengths, and chlorophyll contents were all significantly increased, and some of these parameters even recovered to normal levels after inoculation with A. caulinodans ORS571. Soluble sugar and protein contents and POD and superoxide dismutase (SOD) activities were also significantly increased, contrary to the results for proline. Additionally, A. caulinodans ORS571 may alleviate salt stress by regulating miRNAs. Twelve selected miRNAs were all upregulated to different degrees under salt stress in switchgrass seedlings. However, the levels of miR169, miR171, miR319, miR393, miR535, and miR854 were decreased significantly after inoculation with A. caulinodans ORS571 under salt stress, in contrast to the expression level of miR399.
Conclusion
This study revealed that A. caulinodans ORS571 increased the salt tolerance of switchgrass seedlings by increasing their water content, photosynthetic efficiency, osmotic pressure maintenance, and reactive oxygen species (ROS) scavenging abilities and regulating miRNA expression. This work provides a new, creative idea for improving the salt tolerance of switchgrass seedlings.
Supplementary Information
The online version contains supplementary material available at 10.1186/s13068-023-02286-3.
Keywords: Switchgrass, Beneficial microorganism, Biofuel, MicroRNA, Salinity stress
Background
Switchgrass is a perennial lignocellulose biofuel crop that has been developed as an important bioenergy feedstock due to its high production and viability [1, 2]. By analysing the biomass yield and agricultural input model of switchgrass, it has been found that the energy output of switchgrass is much higher than the energy input it receives, which makes switchgrass an excellent alternative candidate for replacing petroleum fossil fuels [3–5]. However, the slow growth rate of seedlings makes switchgrass less competitive with weeds, which significantly affects the utilization of switchgrass [3]. Improving the competitiveness of seedlings for survival and optimizing the growth of switchgrass are of great significance for increasing its yield and reducing the cost of planting [6, 7].
Soil salinization is one of the major abiotic stresses affecting global agricultural production, and approximately 20% of the world's farmland is severely affected by salt stress [8, 9]. High Na+ concentrations in soil lead to hyperosmotic and hyperionic conditions, which further inhibit plant nutrient intake [10]. A high level of sodium toxicity causes osmotic stress and ionic toxicity in plants and increases oxidative stress in particular. Salt stress induces plants to produce reactive oxygen species (ROS), mainly in the form of singlet oxygen (1O2), superoxide anion (O2−), and hydrogen peroxide (H2O2). These ROS attack lipids and proteins, which causes cell damage and death [11–14]. A series of enzymatic antioxidant defence systems exist in plant cells to remove excessive ROS, including peroxidase (POD) and superoxide dismutase (SOD) [15, 16]. In addition, the levels of various soluble osmotic substances are greatly increased under salt stress, which is extremely important for regulating osmotic pressure in plants [9]. Salt stress also severely affects the biosynthesis of chlorophyll, which in turn affects photosynthesis [17]. Thus, salt stress affects various aspects of plant physiology and anabolic metabolism. MicroRNAs (miRNAs) are a very large class of endogenous small RNAs that are involved in regulating plant development and responses to biotic or abiotic stresses by negatively regulating the expression of their target genes at the mRNA level [18–20]. The main abiotic stresses that plants must face include salt, drought, cold, and heat stress. A series of miRNAs responding to salt stress have been identified, and the discovery of these miRNAs greatly enriched the known salt stress regulatory network of plants [21].
A. caulinodans ORS571 was originally isolated from stem nodules of the tropical leguminous plant Sesbania rostrata and has the ability to nodulate both roots and stems of the host plant [22, 23]. Interestingly, our previous work showed that A. caulinodans ORS571 could colonize wheat and promote the growth of its leaves, roots, and biomass [22, 24]. In recent years, researchers have demonstrated that the colonization of certain microorganisms is beneficial to plant development and growth. The strain Raoultella terrigena R1Gly, which was isolated from tobacco, can colonize switchgrass and promote the development of roots, and Enterobacter sp. SA187 and Piriformospora indica increase the salt tolerance of Arabidopsis and tomato, respectively [25–28]. However, it is unclear whether A. caulinodans ORS571 affects the growth and salt resistance of switchgrass.
This study provided evidence regarding the colonization of switchgrass by A. caulinodans ORS571 and its effects on switchgrass plant growth and development. The changes in physiological indexes and miRNA expression in switchgrass seedlings were also discussed. This will provide a strong basis for promoting switchgrass production and biofuel development.
Methods and materials
Plant growth and inoculation
Switchgrass Alamo seeds were kindly provided by Dr. Neal Stewart at the University of Tennessee at Knoxville. Switchgrass seeds were planted in the Plant Growth Room under 16 h of light at a constant temperature of 28 ℃ and 8 h of dark at 18 ℃. gfp-A. caulinodans ORS571 was kindly provided by Professor Yuxiang Jing of the Institute of Botany, Chinese Academy of Sciences [29]. A. caulinodans ORS571 was cultured in tryptone yeast (TY) liquid medium at 28 ℃ and 140 rpm until the OD600 reached 0.6 and then suspended in sterile water to 108 cells per millilitre [22].
The switchgrass seeds used in this experiment were surface sterilized with 70% ethanol for 90 s and 5% sodium hypochlorite (NaClO) for 10 min, followed by rinsing several times with sterile distilled water [22]. Sterilized seeds were placed in 15-cm-diameter pots filled with sterile vermiculite for germination. Three biological replicates were set up for each experimental group, and 50 seeds were germinated for each replicate. The pots were irrigated with 1/4 strength Hoagland solution (pH 6.5) before planting. After switchgrass germination, 0.5% NaCl was applied for 5 days, followed by 1% NaCl for 10 days [25]. Meanwhile, a 50 mL aliquot of the bacterial solution was inoculated into the root zone at 1 and 6 days. Additionally, sterile water was applied to the controls.
Observation of A. caulinodans ORS571 in root tissue
Two weeks after the treatments, the roots of switchgrass seedlings were observed by laser confocal microscopy (Leica, Bensheim, Germany) at a wavelength of 488 nm to monitor A. caulinodans ORS571 colonization.
Plant growth parameters
The lengths of the shoots and roots and the total biomass of switchgrass seedlings were determined after 15 days of salt stress treatment. The fresh weight and dry weight of the seedlings were measured. The dry weight was measured by placing the washed seedlings in an oven at 80 °C until the weight remained constant [30].
Measurement of chlorophyll and proline contents
Chlorophyll was extracted by using ethanol as the extraction solvent. Switchgrass leaf samples of approximately 0.5 g were washed with distilled water, cut into pieces, added to an appropriate amount of quartz sand and calcium carbonate, and ground in 95% ethanol. After filtering, the grinding liquid was diluted to 25 mL with 95% ethanol and then subjected to measurement in a spectrophotometer at 665 nm and 649 nm [31].
Approximately 0.5 g of switchgrass leaf extract was added to 5 mL of 3% sulfosalicylic acid, and the mixture was placed in a water bath at 100 °C for 10 min. Equal volumes of glacial acetic acid and acidic ninhydrin solution were added to 2 mL of the extract, which was then placed in boiling water for 30 min until the solution turned red. Then, 4 mL of toluene was added, and the mixture was shaken for 30 s and centrifuged at 3000 rpm for 5 min. Finally, the upper liquid layer was collected, and the proline content was measured at a wavelength of 520 nm [32].
Determination of soluble sugar and soluble protein contents
The soluble sugar content was measured via the anthrone colorimetric method. Approximately 0.5 g of fresh leaf was added to 10 mL of distilled water, and this mixture was then placed in boiling water for 30 min and filtered into a 25 mL volumetric flask after cooling. Thereafter, a mixture of 1.5 mL distilled water, 0.5 mL anthrone ethyl acetate, 0.5 mL sample, and 5 mL concentrated sulfuric acid was prepared, shaken vigorously for 30 s, incubated in boiling water for 10 min, and subjected to measurement at a wavelength of 620 nm after cooling down [33].
The Coomassie brilliant blue method was used for the determination of soluble protein content. Approximately 0.5 g of fresh leaf was ground to powder with distilled water, centrifuged to collect the supernatant, and then diluted to 10 mL. Thereafter, 5 mL of Coomassie brilliant blue was mixed with 0.1 mL of the sample, and the mixture was shaken vigorously for 2 min and measured at a 595 nm wavelength [34].
Measurement of antioxidant enzyme activities
Approximately 0.2 g of switchgrass leaf was ground to a powder in 5 mL of potassium phosphate buffer (50 mM, pH 7.8) containing 1% PVP and then centrifuged at 12,000 × g for 10 min at 4 °C. The supernatant was collected for subsequent measurements. The enzymatic activity of SOD was determined according to its ability to inhibit O2−-induced NBT reduction [35]. The activity of POD was assessed according to the rate at which guaiacol was oxidized by hydrogen peroxide, and enzyme activity was calculated by recording the absorbance change at 470 nm [36].
RNA extraction and quantitative real-time PCR (qRT-PCR)
Three switchgrass seedlings from each pots were selected, washed, chopped, and mixed, and the samples were then weighed. Total RNA was extracted by using TRIzol® Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The quality of the extracted total RNA was checked by Nanodrop ND-1000 and gel electrophoresis analyses. Reverse transcription (RT) reactions were implemented with a One Step PrimeScript® miRNA cDNA synthesis kit (TaKaRa, Dalian, China). qRT-PCR was run on a BIO-RAD CFX96TM system, and three biological replicates were performed for each miRNA. The qRT-PCR results were analysed by using the 2−ΔΔCT method [37].
Statistical analysis
All experiments were replicated three times, and the results are presented as the mean ± SD (standard deviation). One-way ANOVA was employed to analyse the significant differences (P < 0.05) among different treatments. The same letters indicate that the results were not significantly different. Student’s t-test was used for the statistical analysis of qRT-PCR results (*P < 0.05, **P < 0.01). Both analyses were performed in GraphPad Prism 8.0.2 software (n ≥ 3).
Results
A. caulinodans ORS571 alleviated salt stress in switchgrass seedlings
To explore the effect of salt stress on seedling development, different salt concentrations (0%, 0.5%, 1%, and 1.5%) were applied in a preliminary experiment. The results showed that 1% NaCl was sufficient to cause significant stress to seedlings (Additional file 1: Figure S1), while the presence of A. caulinodans ORS571 could alleviate the damage caused by salt stress to varying degrees (Fig. 1a; Additional file 1: Figure S2). Two weeks after inoculation, A. caulinodans ORS571 was observed in the roots of switchgrass seedlings (Fig. 1b). Under salt stress treatments, the colonization of A. caulinodans ORS571 resulted in significant increases in the total fresh weight, dry weight, and shoot and root lengths of switchgrass seedlings (Fig. 2). The biomass of seedlings inoculated with A. caulinodans ORS571 was increased by 8.7% and 67.2% under normal and salt stress conditions, respectively, and the fresh weight and water content were also increased (Fig. 2a–c). Salt stress inhibited both shoot and root development, while A. caulinodans ORS571 inoculation significantly increased shoot and root development by 19.8% and 18.3%, respectively (Fig. 2d, e). The colonization of A. caulinodans ORS571 even caused the fresh weight, dry weight, and shoot length of seedlings to recover to nearly normal levels.
Fig. 1.

Colonization of A. Caulinodans ORS571 in switchgrass. a Effects of A. Caulinodans ORS571 on switchgrass seedlings under normal and salt stress; “Ct” means control group without any treatment; b The colonization of A. Caulinodans ORS571 in the roots of switchgrass seedlings
Fig. 2.
Effects of A. Caulinodans ORS571 on the growth status of switchgrass seedlings. a Dry weight; b Fresh weight; c Water content; d Shoot length; e Root length. The same letters indicate that the result is not significant (P < 0.05) according to one-way ANOVA; error bars are standard error (SE) (dry weight, fresh weight, and water content, n = 3; shoot length and root length, n = 10)
A. caulinodans ORS571 significantly increased the contents of chlorophyll, soluble sugar, and protein in switchgrass seedlings under salt stress
Significant increases in the content of chlorophyll a by 9.9% and 38.1% were observed in inoculated seedlings under both normal and salt stress conditions, respectively (Fig. 3a). Although the chlorophyll b content of inoculated seedlings was also significantly increased by 33.2% under salt stress, it was almost unchanged under normal conditions (Fig. 3b). The change in the total chlorophyll contents was consistent with the change in the chlorophyll b content (Fig. 3c). Salt stress significantly increased the contents of soluble sugar and soluble protein by 50.2% and 149.6%, respectively, which were further significantly increased after inoculation with A. caulinodans ORS571 (Fig. 3d, e). In addition, inoculation with A. caulinodans ORS571 under normal conditions resulted in a significant increase in the soluble protein content (Fig. 3e). Proline showed abundant accumulation under salt stress. However, it was noteworthy that the contents of proline were significantly decreased by 40.5% and 13.2% after inoculation under normal and salt stress conditions, respectively (Fig. 3f).
Fig. 3.
A. caulinodans ORS571 promoted the contents of chlorophyll and soluble solids and decreased proline content under salt stress. a Chlorophyll a content; b Chlorophyll b content; c Total chlorophyll content; d Soluble sugar content; e Soluble protein content; f Proline content. The same letters indicate that the result is not significant (P < 0.05) according to one-way ANOVA; error bars are standard error (SE), n = 3
A. caulinodans ORS571 significantly increased POD and SOD activities in switchgrass seedlings under salt stress
POD and SOD are the main enzyme components of plant cells that defend against oxidative damage. The activities of POD and SOD were significantly increased under salt stress, which were further increased by 10.3% and 8.8%, respectively, in A. caulinodans ORS571-colonized plants (Fig. 4). There was a significant increase in the activity of POD after inoculation with A. caulinodans ORS571 under normal conditions, but SOD activity was not affected.
Fig. 4.

A. caulinodans ORS571 improved activities of POD and SOD. a Activity of POD; b Activity of SOD. The same letters indicate that the result is not significant (P < 0.05) according to one-way ANOVA; error bars are standard error (SE), n = 3
A. caulinodans ORS571 affected the differential expression of miRNAs in switchgrass seedlings under salt stress
To study the role of miRNAs in the switchgrass response to A. caulinodans ORS571 and the potential mechanism underlying the increased plant growth and tolerance of A. caulinodans ORS571-infected switchgrass to abiotic stresses, we evaluated the expression of miRNAs associated with plant growth and stress responses. In this study, twelve miRNAs were selected, and we found that all miRNAs were upregulated under salt stress and that miR399 expression was further increased after inoculation with A. caulinodans ORS571 (Fig. 5). The expression levels of miR169, miR171, miR319, miR393, miR535, and miR854 were significantly decreased after treatment with bacteria, and the expression trends of miR171 and miR319 were even downregulated. However, the expression levels of miR156, miR159, miR160, miR162, and miR396 did not change significantly.
Fig. 5.
Differential gene expression level of miRNAs. Significance according to Student’s t-test results (*P < 0.05, **P < 0.01). Error bars are standard error (SE), n = 3. Fold change means the change of gene expression level of miRNAs compared to “Ct” group
Discussion
A. caulinodans ORS571 significantly increased switchgrass seedling biomass under salt stress
There is growing evidence that beneficial microorganisms enhance plant tolerance to various environmental stresses [25, 38, 39]. There are seldom studies on the colonization of plants by A. caulinodans ORS571 and its promotion of plant growth and development, although our previous study demonstrated the colonization of A. caulinodans ORS571 in the roots and leaves of wheat [22, 24]. We further identified the colonization of the roots of switchgrass seedlings by this strain and its positive effect on improving salt tolerance in the present study (Fig. 1b). Salt stress adversely affected the growth and development of switchgrass seedlings, and these effects were significantly alleviated by inoculation with A. caulinodans ORS571 (Fig. 1a), resulting in significant increases in the shoot and root lengths and dry and fresh weights of switchgrass (Fig. 2). Additionally, all of these parameters except root length recovered to nearly normal levels after A. caulinodans ORS571 treatment. Contrary to the results of previous studies in wheat, the biomass and root and shoot lengths of switchgrass seedlings did not change after inoculation with A. caulinodans ORS571 under normal conditions, but their water content was significantly increased (Fig. 2c) [24]. These differences may be due to the slow growth of switchgrass at the seedling stage [3]. The significant increase in water content means that the water retention capacity of switchgrass is increased, which has a positive effect on promoting seedling growth and salinity tolerance [40]. The changes in these growth parameters reflected the positive effect of A. caulinodans ORS571 on the enhancement of salt tolerance in switchgrass seedlings.
Salt stress significantly reduced the contents of chlorophyll a and chlorophyll b in switchgrass seedlings, which were significantly increased after inoculation with A. caulinodans ORS571 (Fig. 3a–c). Chlorophyll content directly determines the photosynthetic efficiency of plants, which is positively correlated with biomass and plant salt tolerance [41]. The observed alleviation of the damage to chlorophyll indicated that A. caulinodans ORS571 increased the tolerance of switchgrass seedlings to salt stress. However, the total chlorophyll contents under normal conditions was not affected by A. caulinodans ORS571, which was consistent with the results for other growth parameters measured in our experiment, suggesting that A. caulinodans ORS571 may only respond specifically to certain stresses in switchgrass seedlings.
A. caulinodans ORS571 significantly increased soluble sugar/protein contents and decreased proline content in switchgrass seedlings under salt stress
Soluble sugar, which is the main product of photosynthesis and the substrate of respiration, plays a critical role in plant growth and metabolism [42–44]. Soluble sugar is also used to maintain the osmotic homeostasis of cells and improve the stress resistance of plants [9, 45]. Soluble proteins usually accumulate under abiotic stresses. In addition to acting as osmotic regulators in plants, soluble proteins are crucial for the precise transmission of stress signals [46]. Consistent with previous research results, salt stress resulted in a significant increase in soluble sugar and protein contents in switchgrass [47], and the contents of soluble sugar and protein increased further after inoculation with A. caulinodans ORS571 (Fig. 3d, e). Under normal conditions, the content of soluble protein was significantly increased by A. caulinodans ORS571 inoculation, which suggests that this bacterium also plays a role in promoting growth by increasing the accumulation of amino acids.
Proline acts as a solute to maintain cellular osmotic balance and protect plant cells from various stresses [15, 48–50]. In this study, the proline content increased significantly under salt stress. Interestingly, inoculation with A. caulinodans ORS571 resulted in a significant decrease in proline content under both salt stress and normal conditions (Fig. 3f), which was different from the effects on soluble sugar and protein contents. Excessive free proline inhibits leaf development and even induces cell death in Arabidopsis [51, 52]. Therefore, A. caulinodans ORS571 may be beneficial for degrading excess proline in plant cells under normal conditions or when salt stress is alleviated.
A. caulinodans ORS571 significantly induced the activities of antioxidant enzymes in switchgrass seedlings under salt stress
Under salt stress, plants produce and accumulate ROS, causing cell damage or death [11–14], and increases in POD and SOD activities are beneficial for scavenging excess ROS [53]. The activities of POD and SOD in Zea mays, Arabidopsis, and Trichoderma longibrachiatum are markedly increased under stress [54–56], consistent with our findings in switchgrass seedlings. Our study evaluated the activities of POD and SOD to explore whether inoculation with A. caulinodans ORS571 improved the tolerance of switchgrass seedlings to salt stress. The results showed that A. caulinodans ORS571 resulted in significant increases in POD and SOD activities under salt stress conditions, and POD activity was significantly increased even under normal conditions (Fig. 4a, b). These results suggest that the enhancement of ROS scavenging ability may be an important reason for the colonization of A. caulinodans ORS571 to alleviate salt toxicity and improve the salt tolerance of seedlings [39].
Differential expression of miRNAs in switchgrass seedlings under salt stress
In previous studies, we identified a series of salt stress-related miRNAs in switchgrass by high-throughput, deep sequencing. Among the 12 miRNAs involved in this study (Table 1), 10 have been shown to respond to multiple abiotic stresses, including miR156, miR159, miR160, miR162, miR169, miR171, miR319, miR393, miR396, and miR399 [57–65]. miR535 and miR854 have been found to be associated with disease resistance in rice and essential oil synthesis in ginger, respectively [66, 67]. Our results showed that the twelve miRNAs were all upregulated to varying degrees under salt stress (Fig. 5). The changes in miR156, miR159, miR162, miR169, miR171, miR393, and miR396 were also consistent with our previous findings in switchgrass [63, 65]. The expression trend of miR160 was consistent with results obtained in peanut and the C4 plant sugarcane [68, 69], while it was opposite to our previous results [63], possibly because the concentration of salt used in the current study was twice that used previously. In previous studies, miR399 has been shown to be upregulated under low-concentration salt stress and slightly downregulated under high-concentration salt stress [65]. Perhaps because of the applied pretreatment, miR399 was still found to be upregulated under 1% NaCl treatment. miR319 was also upregulated, which was consistent with findings in creeping bentgrass [64], and the upregulation of miR535 and miR854 indicated that they may be also associated with salt stress.
Table 1.
Primers of twelve miRNAs for qRT-PCR
| Name of primers | Primer sequence (5′–3′) |
|---|---|
| miR156 | UGACAGAAGAGAGUGAGCAC |
| miR159 | UUUGGAUUGAAGGGAGCUCUA |
| miR160 | UGCCUGGCUCCCUGUAUGCC |
| miR162 | UCGAUAAACCUCUGCAUCCAG |
| miR169 | CAGCCAAGGAUGACUUGCCGA |
| miR171 | UUGAGCCGCGUCAAUAUCUCC |
| miR319 | UUGGACUGAAGGGUGCUCCC |
| miR393 | UCCAAAGGGAUCGCAUAUC |
| miR396 | UCCACAGGCUUUCUUGAACUG |
| miR399 | UGCCAAAGGAGAUUUGCCCUG |
| miR535 | UGACAACGAGAGAGAGCACGC |
| miR854 | GAUGAGGAUAGGGAGGAGGAG |
Under salt stress, the expression of miR156, miR159, miR160, miR162, and miR396 was almost unchanged in switchgrass seedlings after inoculation with A. caulinodans ORS571, indicating that inoculation with A. caulinodans ORS571 did not affect the expression of these miRNAs or their expressions were relatively stable. The significant upregulation of miR399 indicated that inoculation with A. caulinodans ORS571 increased the salt tolerance of switchgrass seedlings. However, miR169, miR393, miR535, and miR854 levels were significantly decreased, probably because salt stress was alleviated. miR171 and miR319 are involved in legume nodulation and arbuscular mycorrhizal symbiosis, and the downregulation of miR171 and miR319 may be related to the A. caulinodans ORS571 colonization of switchgrass [70]. Therefore, A. caulinodans ORS571 increases the salt tolerance of switchgrass seedlings, possibly by regulating the expression of certain miRNAs. Overall, these results provide a foundation for studying the mechanism by which A. caulinodans ORS571 improves the salt tolerance of switchgrass.
Conclusions
In this study, we investigated the effects of inoculation with A. caulinodans ORS571 by analysing growth parameters, physiological indicators, and miRNA expression patterns in switchgrass seedlings under normal and salt stress conditions. Under normal conditions, inoculation with A. caulinodans ORS571 significantly increased fresh weight, chlorophyll a content, protein content, and POD activity in switchgrass seedlings. Under salt stress, the fresh weight, dry weight, shoot and root lengths, and chlorophyll content were all significantly increased, and some of these parameters even recovered to normal levels after inoculation with A. caulinodans ORS571. The contents of soluble sugar and protein and POD and SOD activities were also significantly increased, in contrast to the findings for proline. It was suggested that inoculation with A. caulinodans ORS571 could enhance the salt tolerance of seedlings by increasing their water content, photosynthetic efficiency, osmotic pressure maintenance, and ROS scavenging abilities. Additionally, A. caulinodans ORS571 may alleviate salt stress by regulating miRNAs. Our results revealed that the inoculation of switchgrass with A. caulinodans ORS571 significantly improved salt tolerance and suggested an environmentally friendly solution for improving the competitiveness of seedlings and increasing biomass.
Supplementary Information
Additional file 1: Figure S1. Effects of different NaCl concentrations on the growth status of switchgrass seedlings. a Effects of different NaCl concentrations on the phenotype of shoots; b Shoot length. The same letters indicate that the result is not significant (P<0.05) according to one-way ANOVA; error bars are standard error (SE), n = 10. Figure S2. A. caulinodans ORS571 and the switchgrass seedlings response to different concentrations of NaCl. The same letters indicate that the result is not significant (P<0.05) according to one-way ANOVA; error bars are standard error (SE), n = 10.
Acknowledgements
The authors thank Professor Yuxiang Jing for presenting the gfp-A. caulinodans ORS571 and Dr. Neal Stewart for provision of Switchgrass Alamo seeds.
Author contributions
HL and BZ were the principal investigators and took primary responsibility for this study. PC and QW conceived and designed the experiments. PC, QW, and YY performed the experiments, wrote the paper and prepared figures. LQ and JW prepared experiment materials and analysed the data. PC and QW have contributed equally to this work. All the authors read and approved the final manuscript.
Funding
This work was partially supported by the International Cooperation and Exchanges Project of Shaanxi Province (2018KW-047) and Key Research and Development Plan of Shaanxi Province (2019NY-100).
Availability of data and materials
The authors promise the availability of supporting data, and the data used and analysed during the current study are available from the corresponding author upon reasonable request.
Declarations
Consent for publication
All the authors agreed for publication.
Competing interests
The authors declare that there is no competing interests.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Pengyang Chen and Qiannan Wei contributed equally to this work.
Contributor Information
Baohong Zhang, Email: zhangb@ecu.edu.
Huawei Liu, Email: bioche@nwafu.edu.cn.
References
- 1.Mclaughlin SB, Kiniry JR, Taliaferro CM, La Torre UD. Projecting yield and utilization potential of switchgrass as an energy crop. Adv Agron. 2006;90:267–297. doi: 10.1016/S0065-2113(06)90007-8. [DOI] [Google Scholar]
- 2.Mclaughlin SB, Adams KL. Development of switchgrass (Panicum virgatum) as a bioenergy feedstock in the United States. Biomass Bioenerg. 2005;28(6):515–535. doi: 10.1016/j.biombioe.2004.05.006. [DOI] [Google Scholar]
- 3.Zhang S, Sun F, Wang W, Yang G, Zhang C, Wang Y, Liu S, Xi Y. Comparative transcriptome analysis provides key insights into seedling development in switchgrass (Panicum virgatum L.) Biotechnol Biofuels. 2019;12:193. doi: 10.1186/s13068-019-1534-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Zhang C, Peng X, Guo X, Tang G, Sun F, Liu S, Xi Y. Transcriptional and physiological data reveal the dehydration memory behavior in switchgrass (Panicum virgatum L.) Biotechnol Biofuels. 2018;11:91. doi: 10.1186/s13068-018-1088-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Schmer MR, Vogel KP, Mitchell RB, Perrin RK. Net energy of cellulosic ethanol from switchgrass. Proc Natl Acad Sci USA. 2008;105(2):464–469. doi: 10.1073/pnas.0704767105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Keyser PD, Ashworth AJ, Allen FL, Bates GE. Evaluation of small grain cover crops to enhance switchgrass establishment. Crop Sci. 2016;56(4):2062–2071. doi: 10.2135/cropsci2015.12.0783. [DOI] [Google Scholar]
- 7.Keyser PD, Ashworth AJ, Allen FL, Bates GE. Dormant-season planting and seed-dormancy impacts on switchgrass establishment and yield. Crop Sci. 2016;56(1):474–483. doi: 10.2135/cropsci2015.03.0144. [DOI] [Google Scholar]
- 8.Zhao S, Zhang Q, Liu M, Zhou H, Ma C, Wang P. Regulation of plant responses to salt stress. Int J Mol Sci. 2021;22(9):4609. doi: 10.3390/ijms22094609. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Yang Y, Guo Y. Unraveling salt stress signaling in plants. J Integr Plant Biol. 2018;60(9):796–804. doi: 10.1111/jipb.12689. [DOI] [PubMed] [Google Scholar]
- 10.Yu Z, Duan X, Luo L, Dai S, Ding Z, Xia G. How plant hormones mediate salt stress responses. Trends Plant Sci. 2020;25(11):1117–1130. doi: 10.1016/j.tplants.2020.06.008. [DOI] [PubMed] [Google Scholar]
- 11.Nadarajah KK. ROS homeostasis in abiotic stress tolerance in plants. Int J Mol Sci. 2020;21(15):5208. doi: 10.3390/ijms21155208. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Waszczak C, Carmody M, Kangasjarvi J. Reactive oxygen species in plant signaling. Annu Rev Plant Biol. 2018;69:209–236. doi: 10.1146/annurev-arplant-042817-040322. [DOI] [PubMed] [Google Scholar]
- 13.Zhang G, Zhang M, Zhao Z, Ren Y, Li Q, Wang W. Wheat TaPUB1 modulates plant drought stress resistance by improving antioxidant capability. Sci Rep. 2017;7(1):7549. doi: 10.1038/s41598-017-08181-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Mittler R. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 2002;7(9):405–410. doi: 10.1016/S1360-1385(02)02312-9. [DOI] [PubMed] [Google Scholar]
- 15.Zang D, Wang C, Ji X, Wang Y. Tamarix hispida zinc finger protein ThZFP1 participates in salt and osmotic stress tolerance by increasing proline content and SOD and POD activities. Plant Sci. 2015;235:111–121. doi: 10.1016/j.plantsci.2015.02.016. [DOI] [PubMed] [Google Scholar]
- 16.Li C, Liu Y, Liu X, Mai K, Li J, Guo X, Zhang C, Li H, Kang B, Hwang I, Lu H. Chloroplast thylakoid ascorbate peroxidase ptotapx plays a key role in chloroplast development by decreasing hydrogen peroxide in Populus tomentosa. J Exp Bot. 2021;72(12):4333–4354. doi: 10.1093/jxb/erab173. [DOI] [PubMed] [Google Scholar]
- 17.Liang W, Ma X, Wan P, Liu L. Plant salt-tolerance mechanism: a review. Biochem Biophys Res Commun. 2018;495(1):286–291. doi: 10.1016/j.bbrc.2017.11.043. [DOI] [PubMed] [Google Scholar]
- 18.Zhang B, Wang Q. MicroRNA-based biotechnology for plant improvement. J Cell Physiol. 2015;230(1):1–15. doi: 10.1002/jcp.24685. [DOI] [PubMed] [Google Scholar]
- 19.Sunkar R, Chinnusamy V, Zhu J, Zhu J. Small RNAs as big players in plant abiotic stress responses and nutrient deprivation. Trends Plant Sci. 2007;12(7):301–309. doi: 10.1016/j.tplants.2007.05.001. [DOI] [PubMed] [Google Scholar]
- 20.Sunkar R, Zhu J. Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis. Plant Cell. 2004;16(8):2001–2019. doi: 10.1105/tpc.104.022830. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Gao Z, Ma C, Zheng C, Yao Y, Du Y. Advances in the regulation of plant salt-stress tolerance by miRNA. Mol Biol Rep. 2022;49(6):5041–5055. doi: 10.1007/s11033-022-07179-6. [DOI] [PubMed] [Google Scholar]
- 22.Qiu L, Li Q, Zhang J, Chen Y, Lin X, Sun C, Wang W, Liu H, Zhang B. Migration of endophytic diazotroph Azorhizobium caulinodans ORS571 inside wheat (Triticum aestivum L) and its effect on microRNAs. Funct Integr Genomics. 2017;17(2–3):311–319. doi: 10.1007/s10142-016-0534-8. [DOI] [PubMed] [Google Scholar]
- 23.Dreyfus B, Garcia JL, Gillis M. Characterization of Azorhizobium caulinodans gen nov. sp. nov., a stem-nodulating nitrogen-fixing bacterium isolated from Sesbania rostrata. Int J Syst Evol Microbiol. 1988;38(1):89–98. [Google Scholar]
- 24.Liu H, Wang X, Qi H, Wang Q, Chen Y, Li Q, Zhang Y, Qiu L, Fontana JE, Zhang B, Wang W, Xie Y. The infection and impact of Azorhizobium caulinodans ORS571 on wheat (Triticum aestivum L.) PLoS ONE. 2017;12(11):e0187947. doi: 10.1371/journal.pone.0187947. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Abdelaziz ME, Abdelsattar M, Abdeldaym EA, Atia MAM, Mahmoud AWM, Saad MM, Hirt H. Piriformospora indica alters Na+/K+ homeostasis, antioxidant enzymes and LeNHX1 expression of greenhouse tomato grown under salt stress. Sci Hortic. 2019;256:108532. doi: 10.1016/j.scienta.2019.05.059. [DOI] [Google Scholar]
- 26.de Zelicourt A, Synek L, Saad MM, Alzubaidy H, Jalal R, Xie Y, Andres-Barrao C, Rolli E, Guerard F, Mariappan KG, Daur I, Colcombet J, Benhamed M, Depaepe T, Van Der Straeten D, Hirt H. Ethylene induced plant stress tolerance by Enterobacter sp. Sa187 is mediated by 2-keto-4-methylthiobutyric acid production. PLoS Genet. 2018;14(3):e1007273. doi: 10.1371/journal.pgen.1007273. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Andres-Barrao C, Lafi FF, Alam I, de Zelicourt A, Eida AA, Bokhari A, Alzubaidy H, Bajic VB, Hirt H, Saad MM. Complete genome sequence analysis of Enterobacter sp. Sa187, a plant multi-stress tolerance promoting endophytic bacterium. Front Microbiol. 2017;8:2023. doi: 10.3389/fmicb.2017.02023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Gushgari-Doyle S, Schicklberger M, Li YV, Walker R, Chakraborty R. Plant growth promotion diversity in switchgrass-colonizing, diazotrophic endophytes. Front Microbiol. 2021;12:730440. doi: 10.3389/fmicb.2021.730440. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Chi F, Shen S, Cheng H, Jing Y, Yanni YG, Dazzo FB. Ascending migration of endophytic rhizobia, from roots to leaves, inside rice plants and assessment of benefits to rice growth physiology. Appl Environ Microb. 2005;71(11):7271–7278. doi: 10.1128/AEM.71.11.7271-7278.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Ma G, Mao H, Bu Q, Han L, Shabbir A, Gao F. Effect of compound biochar substrate on the root growth of cucumber plug seedlings. Agronomy. 2020;10(8):1080. doi: 10.3390/agronomy10081080. [DOI] [Google Scholar]
- 31.Qiao L, Tang W, Gao D, Zhao R, An L, Li M, Sun H, Song D. Uav-based chlorophyll content estimation by evaluating vegetation index responses under different crop coverages. Comput Electron Agr. 2022;196:106775. doi: 10.1016/j.compag.2022.106775. [DOI] [Google Scholar]
- 32.Bates LS, Waldren RP, Teare ID. Rapid determination of free proline for water-stress studies. Plant Soil. 1973;39(1):205–207. doi: 10.1007/BF00018060. [DOI] [Google Scholar]
- 33.Tang Y, Ren J, Liu C, Jiang J, Yang H, Li J. Genetic characteristics and QTL analysis of the soluble sugar content in ripe tomato fruits. Sci Hortic. 2021;276:109785. doi: 10.1016/j.scienta.2020.109785. [DOI] [Google Scholar]
- 34.Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72(1):248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
- 35.Fridovich CBAI. Superoxide dismutase: improved assays and an assay applicable to acrylamide gels. Anal Biochem. 1971;44:276–287. doi: 10.1016/0003-2697(71)90370-8. [DOI] [PubMed] [Google Scholar]
- 36.Wang N, Zhang W, Qin M, Li S, Qiao M, Liu Z, Xiang F. Drought tolerance conferred in soybean (Glycine max. L) by GmMYB, a novel R2R3-MYB transcription factor. Plant Cell Physiol. 2017;58(10):1764–76. doi: 10.1093/pcp/pcx111. [DOI] [PubMed] [Google Scholar]
- 37.Caykara B, Ozturk G, Alsaadoni H, Otunctemur A, Pence S. Evaluation of microRNA-124 expression in renal cell carcinoma. Balkan J Med Genet. 2020;23(2):73–78. doi: 10.2478/bjmg-2020-0029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Hashem A, Tabassum B, Fathi AAE. Bacillus subtilis: a plant-growth promoting rhizobacterium that also impacts biotic stress. Saudi J Biol Sci. 2019;26(6):1291–1297. doi: 10.1016/j.sjbs.2019.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Liu Y, Liu X, Dong X, Yan J, Xie Z, Luo Y. The effect of Azorhizobium caulinodans ORS571 and γ-aminobutyric acid on salt tolerance of Sesbania rostrata. Front Plant Sci. 2022;13:926850. doi: 10.3389/fpls.2022.926850. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Parida AK, Das AB. Salt tolerance and salinity effects on plants: a review. Ecotoxicol Environ Saf. 2005;60(3):324–349. doi: 10.1016/j.ecoenv.2004.06.010. [DOI] [PubMed] [Google Scholar]
- 41.Boriboonkaset T, Theerawitaya C, Yamada N, Pichakum A, Supaibulwatana K, Cha-Um S, Takabe T, Kirdmanee C. Regulation of some carbohydrate metabolism-related genes, starch and soluble sugar contents, photosynthetic activities and yield attributes of two contrasting rice genotypes subjected to salt stress. Protoplasma. 2013;250(5):1157–1167. doi: 10.1007/s00709-013-0496-9. [DOI] [PubMed] [Google Scholar]
- 42.Smeekens S. Sugar-induced signal transduction in plants. Annu Rev Plant Physiol Plant Mol Biol. 2000;51:49–81. doi: 10.1146/annurev.arplant.51.1.49. [DOI] [PubMed] [Google Scholar]
- 43.Gibson SI. Plant sugar-response pathways part of a complex regulatory web. Plant Physiol. 2000;124(4):1532–9. doi: 10.1104/pp.124.4.1532. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Price J, Laxmi A, St Martin SK, Jang JC. Global transcription profiling reveals multiple sugar signal transduction mechanisms in Arabidopsis. Plant Cell. 2004;16(8):2128–2150. doi: 10.1105/tpc.104.022616. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Gao Y, Long R, Kang J, Wang Z, Zhang T, Sun H, Li X, Yang Q. Comparative proteomic analysis reveals that antioxidant system and soluble sugar metabolism contribute to salt tolerance in alfalfa (Medicago sativa L.) leaves. J Proteome Res. 2019;18(1):191–203. doi: 10.1021/acs.jproteome.8b00521. [DOI] [PubMed] [Google Scholar]
- 46.Xiong L, Schumaker KS, Zhu J. Cell signaling during cold, drought, and salt stress. Plant Cell. 2002;14(Suppl):S165–S183. doi: 10.1105/tpc.000596. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Guo X, Ahmad N, Zhao S, Zhao C, Zhong W, Wang X, Li G. Effect of salt stress on growth and physiological properties of Asparagus seedlings. Plants. 2022;11(21):2836. doi: 10.3390/plants11212836. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Naliwajski M, Sklodowska M. The relationship between the antioxidant system and proline metabolism in the leaves of cucumber plants acclimated to salt stress. Cells. 2021;10(3):609. doi: 10.3390/cells10030609. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Flowers TJ, Colmer TD. Salinity tolerance in halophytes. New Phytol. 2008;179(4):945–963. doi: 10.1111/j.1469-8137.2008.02531.x. [DOI] [PubMed] [Google Scholar]
- 50.Hayat S, Hayat Q, Alyemeni MN, Wani AS, Pichtel J, Ahmad A. Role of proline under changing environments: a review. Plant Signal Behav. 2012;7(11):1456–1466. doi: 10.4161/psb.21949. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Deuschle K, Funck D, Forlani G, Stransky H, Biehl A, Leister D, van der Graaff E, Kunze R, Frommer WB. The role of [delta]1-pyrroline-5-carboxylate dehydrogenase in proline degradation. Plant Cell. 2004;16(12):3413–3425. doi: 10.1105/tpc.104.023622. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Mani S, Van De Cotte B, Van Montagu M, Verbruggen N. Altered levels of proline dehydrogenase cause hypersensitivity to proline and its analogs in Arabidopsis. Plant Physiol. 2002;128(1):73–83. doi: 10.1104/pp.010572. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Gill SS, Tuteja N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol Biochem. 2010;48(12):909–930. doi: 10.1016/j.plaphy.2010.08.016. [DOI] [PubMed] [Google Scholar]
- 54.Rohman MM, Islam MR, Monsur MB, Amiruzzaman M, Fujita M, Hasanuzzaman M. Trehalose protects maize plants from salt stress and phosphorus deficiency. Plants. 2019;8(12):568. doi: 10.3390/plants8120568. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Zhang P, Wang R, Yang X, Ju Q, Li W, Lu S, Tran LP, Xu J. The R2R3-MYB transcription factor AtMYB49 modulates salt tolerance in Arabidopsis by modulating the cuticle formation and antioxidant defence. Plant Cell Environ. 2020;43(8):1925–1943. doi: 10.1111/pce.13784. [DOI] [PubMed] [Google Scholar]
- 56.Zhang S, Gan Y, Xu B. Application of plant-growth-promoting fungi Trichoderma longibrachiatum T6 enhances tolerance of wheat to salt stress through improvement of antioxidative defense system and gene expression. Front Plant Sci. 2016;7:1405. doi: 10.3389/fpls.2016.01405. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Ma Y, Xue H, Zhang F, Jiang Q, Yang S, Yue P, Wang F, Zhang Y, Li L, He P, Zhang Z. The miR156/SPL module regulates apple salt stress tolerance by activating MdWRKY100 expression. Plant Biotechnol J. 2021;19(2):311–323. doi: 10.1111/pbi.13464. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Chen L, Luan Y, Zhai J. Sp-miR396a-5p acts as a stress-responsive genes regulator by conferring tolerance to abiotic stresses and susceptibility to Phytophthora nicotianae infection in transgenic tobacco. Plant Cell Rep. 2015;34(12):2013–2025. doi: 10.1007/s00299-015-1847-0. [DOI] [PubMed] [Google Scholar]
- 59.Wang B, Sun Y, Song N, Wei J, Wang X, Feng H, Yin Z, Kang Z. MicroRNAs involving in cold, wounding and salt stresses in Triticum aestivum L. Plant Physiol Biochem. 2014;80:90–96. doi: 10.1016/j.plaphy.2014.03.020. [DOI] [PubMed] [Google Scholar]
- 60.Ding D, Zhang L, Wang H, Liu Z, Zhang Z, Zheng Y. Differential expression of miRNAs in response to salt stress in maize roots. Ann Bot. 2009;103(1):29–38. doi: 10.1093/aob/mcn205. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Zhao B, Ge L, Liang R, Li W, Ruan K, Lin H, Jin Y. Members of miR-169 family are induced by high salinity and transiently inhibit the NF-YA transcription factor. BMC Mol Biol. 2009;10:29. doi: 10.1186/1471-2199-10-29. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Liu H, Tian X, Li Y, Wu C, Zheng C. Microarray-based analysis of stress-regulated microRNAs in Arabidopsis thaliana. RNA. 2008;14(5):836–43. doi: 10.1261/rna.895308. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Xie F, Stewart CJ, Taki FA, He Q, Liu H, Zhang B. High-throughput deep sequencing shows that microRNAs play important roles in switchgrass responses to drought and salinity stress. Plant Biotechnol J. 2014;12(3):354–366. doi: 10.1111/pbi.12142. [DOI] [PubMed] [Google Scholar]
- 64.Zhou M, Luo H. Role of microRNA319 in creeping bentgrass salinity and drought stress response. Plant Signal Behav. 2014;9(3):e28700. doi: 10.4161/psb.28700. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Sun G, Stewart CJ, Xiao P, Zhang B. MicroRNA expression analysis in the cellulosic biofuel crop switchgrass (Panicum virgatum) under abiotic stress. PLoS ONE. 2012;7(3):e32017. doi: 10.1371/journal.pone.0032017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Zhang L, Huang Y, Zheng Y, Liu X, Zhou S, Yang X, Liu S, Li Y, Li J, Zhao S, Wang H, Ji Y, Zhang J, Pu M, Zhao Z, Fan J, Wang W. Osa-miR535 targets SQUAMOSA promoter binding protein-like 4 to regulate blast disease resistance in rice. Plant J. 2022;110(1):166–178. doi: 10.1111/tpj.15663. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Singh N, Srivastava S, Sharma A. Identification and analysis of miRNAs and their targets in ginger using bioinformatics approach. Gene. 2016;575(2 Pt 2):570–576. doi: 10.1016/j.gene.2015.09.036. [DOI] [PubMed] [Google Scholar]
- 68.Tang Y, Du G, Xiang J, Hu C, Li X, Wang W, Zhu H, Qiao L, Zhao C, Wang J, Yu S, Sui J. Genome-wide identification of auxin response factor (ARF) gene family and the miR160-ARF18-mediated response to salt stress in peanut (Arachis hypogaea L.) Genomics. 2022;114(1):171–84. doi: 10.1016/j.ygeno.2021.12.015. [DOI] [PubMed] [Google Scholar]
- 69.Mazalmazraei T, Nejadsadeghi L, Mehdi KK, Ahmadi DN. Comparative analysis of differentially expressed miRNAs in leaves of three sugarcanes (Saacharum officinarum L.) cultivars during salinity stress. Mol Biol Rep. 2023;50(1):485–92. doi: 10.1007/s11033-022-07349-6. [DOI] [PubMed] [Google Scholar]
- 70.Kriznik M, Petek M, Dobnik D, Ramsak Z, Baebler S, Pollmann S, Kreuze JF, Zel J, Gruden K. Salicylic acid perturbs sRNA-gibberellin regulatory network in immune response of potato to potato virus Y infection. Front Plant Sci. 2017;8:2192. doi: 10.3389/fpls.2017.02192. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Additional file 1: Figure S1. Effects of different NaCl concentrations on the growth status of switchgrass seedlings. a Effects of different NaCl concentrations on the phenotype of shoots; b Shoot length. The same letters indicate that the result is not significant (P<0.05) according to one-way ANOVA; error bars are standard error (SE), n = 10. Figure S2. A. caulinodans ORS571 and the switchgrass seedlings response to different concentrations of NaCl. The same letters indicate that the result is not significant (P<0.05) according to one-way ANOVA; error bars are standard error (SE), n = 10.
Data Availability Statement
The authors promise the availability of supporting data, and the data used and analysed during the current study are available from the corresponding author upon reasonable request.



