Skip to main content
Journal of Animal Science logoLink to Journal of Animal Science
. 2023 Feb 8;101:skad045. doi: 10.1093/jas/skad045

Alleviation effect of conjugated linoleic acid on estradiol benzoate induced fatty liver hemorrhage syndrome in Hy-line male chickens

Anqi Wang 1, Kexin Zhang 2, Chunyan Fu 3,4,5, Changming Zhou 6, Zhengui Yan 7,, Xuelan Liu 8,9,10,
PMCID: PMC9985313  PMID: 36751705

Abstract

The purpose of this study was to explore whether conjugated linoleic acid (CLA) could alleviate fatty liver hemorrhagic syndrome (FLHS) induced by estradiol benzoate intramuscular injection in laying hens. One hundred male Hy-Line white chickens were randomly divided into two groups, namely, the control (CON) and estradiol benzoate (E) groups, and both groups were fed the same basal diet. After injections of estradiol benzoate at 2 mg/kg every two days for a total of 7 times, chickens in the E group showed FLHS symptoms, including liver enlargement, hemorrhage, and steatosis. Then half of the chickens in the E group received an additional diet containing 5000 mg/kg CLA for 8 weeks. The results of morphological observations, hematoxylin and eosin staining, and Oil Red O staining showed that CLA alleviated liver enlargement, hemorrhage, and lipid accumulation in FLHS chickens. In addition, we measured liver function and lipid metabolism indicators, including ALT, AST, TG, TCH, HDL-C, and LDL-C, which further suggested that CLA mitigated the disturbance of serum and liver metabolism in FLHS chickens. Mechanistically, CLA inhibited hepatic de novo lipogenesis, cholesterol synthesis, and TG accumulation and increased TG hydrolysis in FLHS chickens by regulating the gene expression of CD36, ACC, FAS, SCD 1, DGAT2, LIPE, ATGL, CPT1A, SREBP-1c, SREBP-2, PPARγ, and PPARα. Furthermore, CLA ameliorated hepatic oxidative stress and inhibited NF-κB signaling pathway-mediated inflammation in FLHS chickens. In conclusion, CLA regulated lipid metabolism, thus further alleviating oxidative stress and inflammation to alleviate FLHS induced by estrogen in chickens.

Keywords: conjugated linoleic acid, fatty liver hemorrhage syndrome, inflammation, laying hens, lipid metabolism, oxidative stress


We successfully replicated the FLHS pathological model by intramuscular injection of estradiol benzoate. Most importantly, dietary CLA alleviated FLHS by alleviating hepatic lipid metabolism disorders, oxidative stress injury, and inflammation.

Introduction

Fatty liver hemorrhagic syndrome (FLHS) is a common nutritional metabolic disease in large-scale farming, and mainly occurs in caged hens at the peak of egg production (Shini et al., 2019). FLHS is typically characterized by severe fatty degeneration of the liver accompanied by hepatic hemorrhage and even sudden death due to liver rupture (Trott et al., 2014). FLHS causes a sharp drop in the rate of egg ­production and shortens the peak egg-laying period, leading to large economic losses to the chicken industry (Shini et al., 2019). Many factors contribute to the development of FLHS, such as nutrition (Rozenboim et al., 2016), hormones (Akiba et al., 1982), genetics (Feng et al., 2021), environment (Squires and Leeson, 1988), and toxins (Trott et al., 2014). During egg production, estrogen levels in hens increase to meet yolk fat requirements, and consequently, the elevated estrogen enhances liver fat production (Akiba et al., 1982; Cherian, 2015). Previous reports have shown that using exogenous estradiol benzoate or a high-energy and low-protein diet can trigger FLHS in chickens (Choi et al., 2012; Rozenboim et al., 2016; Shini et al., 2020). However, the pathogenesis of FLHS has not yet been fully elucidated, and there is a lack of effective treatment.

As a chronic liver disease, FLHS is similar to mammalian nonalcoholic fatty liver disease (NAFLD) in terms of pathological processes, namely, the presence of steatosis, lipotoxicity, and inflammation (Hamid et al., 2019; Wu et al., 2019). In the chicken liver, the metabolic product of glucose is converted into fatty acids through de novo fat synthesis (Liu et al., 2018), which plays a vital role in the pathogenesis of FLHS. This process consists of three steps: fatty acid synthesis, fatty acid extension, and assembly into triglycerides (Moore et al., 2014), achieved by the expression of related genes, including acetyl coenzyme A carboxylase (ACC) (Alves-Bezerra and Cohen, 2017), fatty acid synthase (FAS), stearoyl-CoA desaturase 1 (SCD 1), and diacylglycerol acyltransferase 2 (DGAT2) (Alves-Bezerra and Cohen, 2017). Triglyceride lipase (ATGL) and hormone-sensitive lipase (LIPE) are the key enzymes that catalyze TG hydrolysis (Moore et al., 2014). Lipid accumulation in liver cells may trigger a number of reactions, including oxidative stress, inflammation, and hepatocyte dysfunction (Friedman et al., 2018; Bessone et al., 2019). Unfortunately, these reactions indirectly promote the development of hepatic steatosis, thus creating a vicious positive feedback cycle (Qiu et al., 2021). Therefore, the application of antioxidants to reduce inflammation might reduce the occurrence and progression of FLHS.

Conjugated linoleic acid (CLA) is a group of geometric and positional isomers of the polyunsaturated fatty acid linoleic acid, mainly found in ruminant meat and dairy products, with antioxidant and anti-inflammatory properties (Shokryzadan et al., 2017; Mrugala et al., 2021). Recent studies have found that CLA has lipid-lowering, antidiabetic, anticardiovascular, and antiatherosclerotic disease functions (Tous et al., 2012; Bruen et al., 2017). Previous reports have shown that functional milk fat enriched in CLA prevents high-fat diet induced hepatic lipid accumulation in rats (Gerstner et al., 2021). CLA supplementation in breeder chicks reduced liver lipid synthesis in offspring chicks (Fu et al., 2022). However, up to date, there is no report about the efficacy and application of CLA on FLHS in laying hens. Based on the fact that disorders of lipid metabolism, oxidative stress, and inflammation are involved in FLHS, CLA might be a potential therapeutic agent for the treatment of FLHS by interrupting lipid accumulation, oxidative stress, and inflammation.

In the present study, we established a model of FLHS by exogenous injection of estradiol benzoate. To explore the alleviating effect of CLA on FLHS, we analyzed hepatic lipid metabolism, oxidative stress and inflammation in FLHS chickens before and after feeding CLA. This study further explored the mechanism of CLA alleviation of FLHS.

Materials and Methods

Animals and treatments

All experimental procedures in this study were approved by the Institutional Animal Care and Use Committee of the Shandong Academy of Agricultural Sciences. One hundred clinically healthy 120-day-old male Hy-Line white chickens were randomly divided into a control group (CON) and an estradiol benzoate group (E) (n = 50) and all chickens were fed the same basal diet. All birds were acclimated to basal diets and the environment for 1 week. To eliminate the effect of self-secreted estrogen (autocrine estrogen), we chose male chickens to establish the FLHS model. Each chicken in the E group received intramuscular injections of estradiol benzoate (Ningbo Second Hormone Factory, Ningbo, China) (2 mg/kg) every 2 days for a total of 7 times. Then, half of the chickens in the E group were separated and named the E + CLA group, and these chickens received an additional diet containing 5000 mg/kg CLA (Shandong Penglai Ocean, Shandong, China) for 8 weeks. All chickens had free access to water and food during the trial. The basal diet used in the trial was formulated according to the National Research Council standard nutritional requirements NY/T33 (2004) and its composition is shown in Table 1.

Table 1.

Diet composition and nutrient concentration levels (air-dry basis) %.

Composition of diet Basal diet CLA diet1
Soybean meal 17.20 17.20
Corn 71.10 71.10
Premix2 5.00 5.00
Medical stone 6.70 6.20
CLA 0 0.50
Total 100 100
Nutrient level
CP 14.79 14.79
Met 0.37 0.37
Lys 1.00 1.00
Calcium 0.90 0.90
TP 0.70 0.70
AP 0.40 0.40
Energy (kcal/kg) 2751 2751

Abbreviations: CP, crude protein; Met, methionine; Lys, lysine; TP, total phosphorus; AP, available phosphorus.

1 CLA diet: 0.5% CLA mixture substituted for medical stone in basal diet.

2 Supplied with the following nutrients per kg of diet: Cu, 25 mg; Fe, 100 mg; Zn, 200 mg; Mn, 125 mg; NaCl, 0.9 mg; Niacinamide, 350 mg; VB1, 0.35 mg; VB2, 7.5 mg; VB5, 20 mg; VD3, 10 mg; VA, 20 mg; VK, 5 mg; Dl-a-tocopherol acetate, 50 mg.

Sample collection

On the 14th and 70th days of the formal experiment, six birds were randomly selected from each group after fasting for 12 h. Blood samples (10 mL) were collected from the saphenous vein located in the chicken wing into a vacuum coagulation tube, and left at 4 °C for 2 h. The supernatant was centrifuged at 4 °C and stored at −20 °C. After weighing the chickens, they were euthanized by intravenous injection of sodium pentobarbital at the dose of 100 mg/kg (Nembutal; Abbott Laboratories, Chicago, IL). Fresh livers were weighed to calculate the liver index (liver index (%) = liver weight/body weight × 100%). The liver tissue of the same size was subtracted at the same location of the liver with sterile surgical scissors, washed with 0.9% saline, and divided into 3 parts. One part of the sample was fixed in 4% paraformaldehyde solution (Solarbio Technology Co., Ltd., Beijing, China) for 48 hours for hematoxylin-eosin (H&E) and oil red O staining. One portion was placed in lyophilization tubes and immediately frozen in liquid nitrogen for biochemical analysis and determination of liver-related gene mRNA and protein relative expression, while the remaining portion of the liver was stored at −20 °C for measurement of liver fat percentage.

H&E and Oil Red O staining

Liver tissue specimens were washed with saline and then fixed with paraformaldehyde solution for one week. Then the fixed samples were routinely processed and embedded in paraffin, cut into thin slices (5 μm) and stained with H&E. Then, the sections were washed with xylene and fixed with neutral resin. Frozen liver tissue sections were stained with Oil Red O ethanol stain, fractionated using ethanol, stained with hematoxylin, and finally fixed with neutral resin. Afterward, sections were observed with a light microscope and photographed.

Blood biochemical analysis

Serum concentrations of triglyceride (TG), cholesterol (TCH), aspartate aminotransferase (AST), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) were assessed using corresponding commercial kits (Nanjing Jiancheng Institute of Biological Engineering, Nanjing, China) according to the manufacturer’s instructions.

Liver tissue biochemical and oxidative stress index analysis

The liver tissue samples were homogenized at a tissue weight (g): ice saline volume (mL) ratio of 1:9 and then centrifuged at 3000 rpm/min for 10 min, and then the supernatant was transferred to a new centrifuge tube for analysis. The levels of TG, TCH, glutathione transaminase (ALT), HDL-C, LDL-C, malondialdehyde (MDA), glutathione peroxidase (GSH-Px), catalase (CAT), and superoxide dismutase (SOD) in liver tissues were assessed using corresponding commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

Liver fat percentage determination

The Soxhlet extraction method was used to remove crude liver fat for liver fat percentage calculation (Krishan et al., 2014). Liver tissue samples were ground into tissue homogenate and then ground into powder after vacuum freeze-drying with a freeze-dryer (Qingdao Yonghe Chuangxin Electronic Technology, Qingdao, China). Two grams of lyophilized liver powder was accurately weighed, placed in filter paper packets and sealed. Three technical replicates of each lyophilized liver sample were collected, and the weight of the filter paper packets was recorded. Then, the samples were placed into a Soxhlet extractor (Hangzhou Jutong Electronics, Hangzhou, China), in a water bath between 70 and 80 °C and extracted with ether for 6 h. After the residual ether of the paper package was evaporated completely, the remaining samples were placed in a blast drying oven at 105 °C for 2 h, cooled in a desiccator for 0.5 h and then weighed. The liver fat percentage was calculated using the following formula: (filter paper packet weight before extraction—filter paper packet weight after extraction)/ lyophilized liver powder weight × 100%.

Quantitative real-time PCR (qPCR) analysis

Total RNA was extracted from 20 to 30 mg tissue samples using TRIzol reagent (Invitrogen, Carlsbad, CA). The concentration and purity of total RNA were determined by measuring the 260/280 nm absorbance ratio using an ultramicro spectrophotometer (Shanghai Woyuan Technology, Shanghai, China). The RNAs were then reverse transcribed into first-strand complementary DNA (cDNA) using a first-strand reverse transcription kit (Invitrogen, CA, USA). The primers were designed and synthesized by Shanghai Biotechnology Co., Ltd (Shanghai, China) and the primer sequences are detailed in Table 2. The qPCRs were performed using a LightCycler 96 amplification and detection system (Basel, Switzerland). The results were processed by the 2-ΔΔCt method and expressed as fold changes relative to the expression of β-actin (Livak and Schmittgen, 2001).

Table 2.

Primers used for quantitative real-time PCR.

Gene Forward primer (5ʹ-3ʹ) Reverse primer (3ʹ-5ʹ)
CD36 GCGATTTGGTTAATGGCACTGATGG TCCCTTCACGGTCTTACTGGTCTG
ACC TCCAGCAGAACCGCATTGACAC GTATGAGCAGGCAGGACTTGGC
FAS AATCTGCCGTCTGGAACTGAATGG CATCCTGTGACTGGTCGTGTTCTC
SCD 1 CACATGGCTTGGCTGCTGGTAC CTTGTAGTATCTCCGCTGGAACATCAC
DGAT2 CCGTGAACCGTGACAGCATAGAC TGCTCCTCCCACCACGATGATG
HMGCR AGGCGTAGCAGGACCACTATACC ACGGCTCCTTGCTCCTCCAC
LIPE CATCCTGTCCGTCGATTACTCCTTG CAGCAGTAGGCGTAGAAGCACTC
ATGL AAGTCCTGCTGGTCCTCTCCTTG AGTGTTGTCCTCCATCTGGTCCTC
CPT1A CGAGTCAGACACCACAGCAACAC CACCGTAACCATCATCAGCCACAG
SREBP-1c TGGTGGTGGACGCCGAGAAG GTCGTTGATGGATGAGCGGTAGC
SREBP-2 CTCGTGAATGGTGTGATCGTCCTC GCTTGCGGTGCCTCCAGAAC
PPARα TGCTGTGGAGATCGTCCTGGTC CTGTGACAAGTTGCCGGAGGTC
PPARγ GTCCTTCCCGCTGACCAAAG TGTTCTGTTCCTGCAGTGGT
NF-κB GGTGGTATGTGGGAAGGCTTTGG CAGATGCTGGCTTTGTGATGTTGAC
INOS GTGGTATGCTCTGCCTGCTGTTG GTCTCGCACTCCAATCTCTGTTCC
TNF-α CCCAGTTCAGATGAGTTGCCCTTC GCCACCACACGACAGCCAAG
COX-2 CCGTGTTCCTGTCATTCGCCTTC TCTGGGTTAGCAAATGCCTTCTTCC
IL-1β TTCATCTTCTACCGCCTGGACAG GCTTGTAGGTGGCGATGTTGAC
β-actin CCAGCCATGTATGTAGCCATCC CACCATCACCAGAGTCCATCAC

Western blotting

Total proteins were extracted from 20 mg liver tissues using RIPA lysis buffer (Beijing Applygen Technologies Inc., Beijing, China). Protein concentrations were determined by the BCA method. Based on the measured concentrations, 200 μg of protein samples were mixed with loading buffer (5 ×) and boiled at 100 °C for 5 min. Twenty μg of the prepared protein samples were separated by SDS-PAGE gel electrophoresis and transferred to polyvinylidene fluoride (PVDF) membranes. The membranes were blocked in Tris-buffered saline (TBST) with 5% skim milk powder for 1.5 h. The PVDF membranes were then incubated overnight at 4°C with primary antibodies (ABclonal Technology Limited Company, Wuhan, China) against nuclear factor kappa-B (NF-κB) (1:1000 dilution), tumor necrosis factor-α (TNF-α) (1:1000 dilution), interleukin-1 β (IL-1β) (1:1000 dilution), and β-actin (1:10000 dilution). PVDF membranes were washed three times with TBST for 8 min, followed by incubation with secondary antibodies. The signals were detected using an enhanced chemiluminescence system (Cheml Scope 5300, Clinx Science Instruments, Shanghai, China). Image J (Version 1.48, NIH) image analysis software was used to process the chemiluminescence bands and obtain data.

Statistical analysis

Data from this trial were statistically and analytically processed using SPSS 25.0 (SPSS Inc., Chicago, IL) and the data are expressed as the mean ± SEM. Significance tests were performed using one-way ANOVA, and multiple comparisons were performed using the LSD method. P < 0.05 was considered to indicate statistical significance.

Results

Estradiol benzoate induces fatty liver hemorrhagic syndrome in chickens

Elevated estrogen levels in hens during egg production stimulate increased hepatic lipogenesis, which induces FLHS. We successfully established a model of FLHS in chickens by regular injection of estradiol benzoate with reference to previous studies (Polin and Wolford, 1977). The results showed an increase in body weight, liver index, and liver fat percentage in E group chickens (P < 0.05), which indicated liver enlargement and lipid accumulation (Figure 1A-C).

Figure 1.

Figure 1.

Effect of estradiol benzoate injection on body weight (A), liver index (B) and liver fat percentage (C) of chickens. Data are expressed as the mean ± SEM. * P < 0.05, * * P < 0.01.

Liver lipid accumulation may lead to hepatic injury and FLHS, and we compared images of liver morphology, H&E staining, and Oil Red O staining. Consistent with expectations, dissection showed that chickens in the E group had enlarged, yellowish-brown, and greasy livers with punctate and streaky hemorrhages on the liver surface (Figure 2A-B). As shown in Figure 2C-D, compared with the CON group, the E group showed a significant accumulation of lipid droplets in the hepatocyte plasma and fatty lesions. Notably, H&E staining showed severe hepatic vacuolization, disorganized hepatocyte structure and inflammatory cell infiltration in the E group (Figure 2F). These results suggested that estradiol benzoate induced lipid accumulation led to liver injury.

Figure 2.

Figure 2.

Morphological and pathological observations of the liver after estradiol benzoate injection. (A-B) Histomorphological observation. (C-D) Oil Red O staining (magnification: 400×). (E and F) H&E staining (magnification: 400×).

To further clarify that estradiol benzoate injection could cause liver injury and lipid metabolism disorders, we examined several essential lipid metabolism and liver injury indicators in serum and liver (Tables 3 and 4). We found that estradiol benzoate injection significantly increased serum TG, TCH, and LDL-C levels and decreased HDL-C levels (P < 0.05), indicating increased serum lipid content in the chickens. The serum AST was significantly increased in the E group compared to the CON group (P < 0.05), suggesting that the E group chickens possessed damaged livers. Hepatic TG, TCH, ALT, and LDL-C levels were significantly higher and hepatic HDL-C levels were significantly lower in the E group than in the CON group (P < 0.05). Taken together, the serum and hepatic tissue analysis results suggested that the FLHS model induced by intramuscular estradiol benzoate injection was successfully established.

Table 3.

Effect of estradiol benzoate injection on serum levels of TG, TCH, AST, HDL-C and LDL-C in chickens.

Items TG
(mmol/L)
TCH
(mmol/L)
AST
(U/L)
HDL-C
(mmol/L)
LDL-C
(mmol/L)
CON 0.82 ± 0.09b 2.62 ± 0.11b 14.27 ± 0.22b 3.39 ± 0.33a 0.68 ± 0.09b
E 3.59 ± 0.28a 191.43 ± 51.44a 162.08 ± 9.74a 1.08 ± 0.39b 2.73 ± 0.09a

Data are expressed as the mean ± SEM. Different superscripts within the same column are significantly different (P < 0.05).

Table 4.

Effect of estradiol benzoate injection on TG, TCH, ALT, HDL-C and LDL-C levels in liver tissue.

Items TG
(mmol/gprot)
TCH
(mmol/gprot)
ALT
(U/gprot)
HDL-C
(mmol/gprot)
LDL-C
(mmol/gprot)
CON 0.16 ± 0.02b 1.72 ± 0.07b 1.19 ± 0.57b 0.26 ± 0.02a 0.02 ± 0.00b
E 0.61 ± 0.13a 4.69 ± 0.57a 5.65 ± 0.91a 0.15 ± 0.02b 0.09 ± 0.02a

Data are expressed as the mean ± SEM. Different superscripts within the same column are significantly different (P < 0.05).

CLA ameliorates liver lipid metabolism disorders and damage in FLHS chickens

To evaluate the potential protective effect of CLA on liver lipid accumulation and injury in FLHS chickens, we recorded body weight, liver index, and liver fat percentage before and after CLA treatment (Figure 3A-C). Morphological observation, H&E staining, and Oil Red O staining images are shown in Figure 4A-I. CLA treatment reduced body weight, liver index, and fat percentage in FLHS chickens and alleviated hepatic damage, steatosis, and inflammatory cell infiltration in the liver of FLHS chickens.

Figure 3.

Figure 3.

Effect of CLA on body weight (A), liver index (B) and liver fat percentage (C) in FLHS chickens. Data are expressed as the mean ± SEM. * P < 0.05, * * P < 0.01, NS. differences are not significant.

Figure 4.

Figure 4.

Morphological and pathological findings of CLA on the liver of FLHS chickens. (A-C) Histomorphological observation. (D-F) Oil Red O staining (magnification: 400×). (G-I) H&E staining (magnification: 400×).

To further clarify the effect of CLA on liver lipid metabolism in FLHS chickens, we also examined the biochemical indicators in serum. As shown in Table 5, CLA treatment significantly decreased serum TG, TCH, AST, and LDL-C levels and increased serum HDL-C levels (P < 0.05), indicating that the addition of dietary CLA improved lipid accumulation in the serum and liver damage in FLHS chickens. Biochemical indices in the liver also showed that CLA notably reduced liver TG, ALT, and LDL-C levels and elevated liver HDL-C levels (P < 0.05) (Table 6). These results suggested that CLA alleviates lipid accumulation in the liver.

Table 5.

Effect of CLA on serum levels of TG, TCH, AST, HDL-C and LDL-C in FLHS chickens.

Items TG
(mmol/L)
TCH
(mmol/L)
AST
(U/L)
HDL-C
(mmol/L)
LDL-C
(mmol/L)
CON 0.16 ± 0.07b 3.63 ± 0.42b 16.02 ± 3.03c 4.44 ± 0.24a 0.96 ± 0.01b
E 0.42 ± 0.02a 4.83 ± 0.06a 33.79 ± 1.34a 2.92 ± 0.4c 2.06 ± 0.25a
E + CLA 0.17 ± 0.02b 4.09 ± 0.23b 21.76 ± 2.25b 3.61 ± 0.27b 1.17 ± 0.17b

Data are expressed as the mean ± SEM. Different superscripts within the same column are significantly different (P < 0.05).

Table 6.

Effect of CLA on TG, ALT, HDL-C and LDL-C levels in liver tissue of FLHS chickens.

Items TG
(mmol/gprot)
ALT
(U/gprot)
HDL-C
(mmol/gprot)
LDL-C
(mmol/gprot)
CON 0.09 ± 0.01b 6.35 ± 0.79c 0.18 ± 0.02a 0.07 ± 0.01c
E 0.14 ± 0.02a 56.62 ± 0.78a 0.09 ± 0.03b 0.13 ± 0.01a
E + CLA 0.11 ± 0.01b 12.60 ± 3.10b 0.14 ± 0.00b 0.10 ± 0.00b

Data are expressed as the mean ± SEM. Different superscripts within the same column are significantly different (P < 0.05).

CLA alleviates liver lipid metabolism-associated genetic disorders in FLHS chickens

To investigate the mechanism of liver lipid metabolism disorders and ameliorative effects of CLA in FLHS chickens, we measured the expression of genes related to lipid metabolism in the liver (Figure 5A-B). CLA significantly reversed the upregulated mRNA expression of ACC, FAS, and SCD 1, enzymes associated with lipid de novo synthesis (P < 0.01). The upregulation of DGAT2 and 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGR) in the liver of FLHS chickens at the mRNA level was also notably alleviated by CLA (P < 0.01). In addition, changes in the mRNA expression of LIPE and ATGL, which are related to TG hydrolysis, and carnitine palmitoyl transferase 1A (CPT1A), which catalyzes fatty acid β-oxidation, were also significantly reversed by CLA (P < 0.01).

Figure 5.

Figure 5.

Effect of CLA on the mRNA expression of CD36, ACC, FAS, SCD 1, DGAT2 and HMGR (A), LIPE, ATGL and CPT1A (B), SREBP-1c, SREBP-2, PPARα and PPARγ (C) in liver tissue of FLHS chickens. Data are expressed as the mean ± SEM. * P < 0.05, * * P < 0.01, NS. differences are not significant.

We further focused on transcriptional regulators associated with lipid metabolism in the liver. As shown in Figure 5C, compared with the CON group, the mRNA expression of sterol regulatory element binding protein-1c (SREBP-1c), sterol regulatory element binding protein-2 (SREBP-2), and peroxidase proliferator activate receptor γ (PPARγ) was significantly upregulated, and peroxidase proliferators activate receptor α (PPARα) expression was significantly repressed in FLHS chickens (P < 0.01). However, these effects were partially eliminated by CLA (P < 0.01).

CLA alleviates liver oxidative stress in FLHS chickens

Hepatic lipid accumulation may lead to oxidative stress (Bessone et al., 2019). To further investigate whether CLA has a protective effect against oxidative stress in the liver of FLHS chickens, we measured several oxidative stress parameters. The results showed that liver tissue GSH-Px, CAT, and SOD activities were significantly lower and the MDA content was significantly higher in the E group than in the CON group (P < 0.01) (Figure 6). However, CLA treatment significantly increased GSH-Px, CAT, and SOD activities and decreased the MDA content. These results indicated that CLA ameliorated oxidative stress in the liver tissue of FLHS chickens.

Figure 6.

Figure 6.

Effect of CLA on the concentrations of GSH-Px (A), CAT (B), SOD (C) and MDA (D) in the liver tissue of FLHS chickens. Data are expressed as the mean ± SEM. * P < 0.05, * * P < 0.01, NS. differences are not significant.

CLA inhibits liver inflammation in FLHS chickens

Growing evidence has indicated that hepatic lipid accumulation is inextricably linked to inflammatory responses in FLHS chickens. In addition, oxidative stress can mediate inflammation, so we investigated the effect of CLA on liver inflammation. As shown in Figure 7A, CLA treatment effectively reduced the upregulated mRNA expression of NF-κB, iNOS, TNF-α, and COX-2 in the liver of FLHS chickens (P < 0.01). In addition, CLA also notably attenuated the upregulated expression of NF-κB, TNF-α, and IL-1β proteins in the liver of FLHS chickens (P < 0.01) (Figure 7B-E). The results indicated that CLA alleviated liver inflammation in FLHS chickens by regulating the NF-κB signaling pathway.

Figure 7.

Figure 7.

Effect of CLA on the mRNA expression of NF-κB, INOS, TNF-α, COX-2 and IL-1β (A). Effect of CLA on the protein expression of NF-κB, TNF-α, IL-1β and β-actin (B-E) in liver tissue of FLHS chickens. β-actin was used as a loading control. Data are expressed as the mean ± SEM. * P < 0.05, * * P < 0.01, NS. differences are not significant.

Discussion

FLHS has become one of the most common noninfectious diseases that contribute to laying hen mortality (Mete et al., 2013; Shini et al., 2019). Considerable evidence indicates that hens suffering from FLHS develop lipid metabolism disorders, oxidative stress, and inflammation leading to liver dysfunction (Lv et al., 2018; Xing et al., 2020; Yao et al., 2022). Previous reports have revealed that CLA shows antioxidant, anti-inflammatory, and lipid regulation properties (Yang et al., 2017; Aydın et al., 2021). In this study, an FLHS chicken model was established using an intramuscular injection of estradiol benzoate. We found that CLA has a mitigating effect on hepatic lipid metabolism disturbance in FLHS chickens. In addition, CLA ameliorated inflammatory damage in the livers of FLHS chickens by inhibiting oxidative stress and inflammation.

As one of the essential metabolic organs, the liver plays a vital role in regulating systemic lipid metabolism (Zaefarian et al., 2019; Ren et al., 2021). Lipid accumulation is frequently caused by an imbalance between lipid synthesis and catabolism, which is closely linked to the expression of related genes (Lv et al., 2018). There is abundant evidence that CLA reduces lipid synthesis and increases lipolysis in organisms (Wang et al., 2019; Fu et al., 2020). The expression of ACC, FAS, and SCD 1 was upregulated in the liver of FLHS chickens in a study by Miao et al. (Miao et al., 2021), and is consistent with the results of the present study. The uptake of fatty acids by the liver is facilitated by fatty acid translocase (FAT/CD36), leading to lipid accumulation in the liver (Park, 2014). There is evidence that hepatic TG accumulates when CD36 is overexpressed (Pepino et al., 2014). The expression of HMGR, the rate-limiting enzyme for cholesterol synthesis in the liver, represents the rate of cholesterol synthesis (Nakamuta et al., 2009). In this study, the expression of genes related to lipid synthesis was significantly upregulated in FLHS chicken livers. In addition, the expression of genes related to TG hydrolysis was significantly downregulated, and these effects were significantly ameliorated by CLA supplementation. The results of this study suggested that CLA ameliorates lipid metabolism disorders in the liver of FLHS chickens by reducing de novo lipogenesis, cholesterol synthesis, and TG accumulation and increasing TG hydrolysis in the liver.

In addition, we focused on the role of lipid metabolism-related transcription factors in CLA-mediated FLHS. SREBP2 and SREBP-1c belong to the same SREBP heterodimer, where the nuclear translocation of SREBP-1c upregulates all genes in fatty acid biosynthesis, and SREBP2 is mainly involved in the transcriptional regulation of target genes involved in cholesterol synthesis (Musso et al., 2013; Cobbina and Akhlaghi, 2017). PPARα and PPARγ are peroxisome proliferator-activated receptors (PPARs), which are part of the ligand-activated transcription family of nuclear receptors that regulate the transcription of lipid metabolism genes (Lv et al., 2018). There is evidence that PPARα expression is reduced in the liver of FLHS chickens (Miao et al., 2021). In the present study, PPARα expression was reduced in the liver of FLHS chickens and dietary CLA alleviated this phenomenon. Previous studies have shown that activated PPARα promotes the expression of genes that mediate fatty acid oxidation, such as CPT1A (Pawlak et al., 2015). Interestingly, CPT1A expression was elevated in the livers of FLHS chickens in the present study, which might suggest a compensatory effect of lipid accumulation (Gao et al., 2021). PPARγ, when overexpressed ectopically in mouse hepatocytes, has been reported to cause hepatocyte steatosis (Wang et al., 2020). Moreover, it has been suggested that CLA supplementation can reduce body fat levels by inhibiting PPARγ expression (Lehnen et al., 2015). In concordance with the results of this experiment, SREBP-1c, SREBP-2, and PPARγ mRNA expression increased in FLHS chickens, and the mRNA expression of these genes decreased after CLA treatment, which is consistent with previous studies (Lehnen et al., 2015; Miao et al., 2021).

Lipid accumulation can further lead to liver injury by triggering oxidative stress and inflammation (Xing et al., 2020). The activities of CAT, SOD, and GSH-Px are indicators of the body’s ability to resist oxidative damage and MDA is a product of lipid peroxidation (Mrugala et al., 2021). In the present study, CLA treatment alleviated the increase in MDA levels and restored the activities of SOD, CAT, and GSH-Px in the liver of FLHS chickens. These results suggested that CLA alleviated oxidative stress in the liver of FLHS chickens. Oxidative stress can mediate the activation of inflammation and the NF-κB transcription factor is an essential mediator between oxidative stress and inflammation (Fan et al., 2020). Activation of NF-κB by oxidative stress promotes COX-2 initiation, iNOS expression and proinflammatory cytokine release (Han et al., 2020). In the present study, we explored hepatic NF-κB signaling pathway inhibition by CLA in FLHS chickens from an inflammatory perspective. In agreement with previous research, our data suggested that the NF-κB signaling pathway is activated and triggers the release of specific inflammatory cytokines, such as TNF-α, COX-2, and IL-1β, in the FLHS chicken liver. Additionally, the antioxidant property of CLA suggests that it has potential anti-inflammatory effects, and these anti-inflammatory effects have been confirmed by several previous studies. Riera et al. demonstrated that CLA can fight inflammation by inhibiting the activation of NF-κB (Bassaganya-Riera et al., 2004). CLA has also been reported to alleviate inflammation-induced insulin resistance in mice (Tan et al., 2019). Similarly, our data show that estrogen induced the chicken liver NF-κB signaling pathway by upregulating related gene mRNA expression and protein expression. Furthermore, CLA ameliorated FLHS chicken liver inflammation by inhibiting the NF-κB signaling pathway.

Conclusion

In conclusion, we successfully replicated the FLHS pathological model by intramuscular injection of estradiol benzoate. Most importantly, dietary CLA alleviated hepatic lipid metabolism disorders in FLHS chickens by reducing lipid uptake and synthesis, and increasing lipolysis. Furthermore, CLA supplementation alleviated oxidative stress injury and inflammation in chickens. Our results provide new evidence and insights for applying CLA as an effective treatment for FLHS.

Acknowledgments

This project was supported by the National Science Foundation of China (31902176), the Natural Science Foundation of Shandong Province (ZR2019BC005), and the Major Scientific and Technological Innovation Project of Shandong Province (2019JZZY020602, 2019JZZY020611).

Glossary

Abbreviations

ACC

acetyl coenzyme A carboxylase

ALT

alanine aminotransferase

AST

aspartate aminotransferase

ATGL

adipose triglyceride lipase

CAT

vatalase

CD36

fatty acid transferase

CLA

conjugated linoleic acid

COX-2

cyclooxygenase-2

CPT1A

carnitine palmitoyl transferase 1A

DGAT2

diacylgycerol acyltransferase 2

FAS

fatty acid synthase

FLHS

fatty liver hemorrhagic syndrome

GSH-Px

glutathione peroxidase

HDL-C

high density lipoprotein cholesterol

H&E

hematoxylin and eosin

IL-1β

interleukin-1β

iNOS

inducible nitric oxide synthase

LDL-C

low density lipoprotein cholesterol

LIPE

hormone-sensitive lipase

MDA

malondialdehyde

NAFLD

nonalcoholic fatty liver disease

NEFA

nonesterified fatty acids

NF-κB

nuclear factor kappa B

PPARα

peroxidase proliferators activate receptors α

PPARγ

peroxidase proliferators activate receptors γ

PVDF

polyvinylidene fluoride

ROS

reactive oxygen species

SCD 1

stearoyl coenzyme A desaturase 1

SOD

superoxide dismutase

SREBP-1c

sterol regulatory element binding protein-1c

TBST

Tris buffered saline tween

TCH

total Cholesterol

TG

triglycerides

TNF-α

tumor necrosis factor-α

Contributor Information

Anqi Wang, College of Animal Science and Technology, Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, Shandong Agricultural University, Taian 271018, China.

Kexin Zhang, College of Animal Science and Technology, Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, Shandong Agricultural University, Taian 271018, China.

Chunyan Fu, Poultry Institute, Shandong Academy of Agricultural Sciences, Jinan 250100, China; Shandong Provincial Key Laboratory of Poultry Diseases Diagnosis and Immunology, Jinan 250100, China; Poultry Breeding Engineering Technology Center of Shandong Province, Jinan 250100, China.

Changming Zhou, College of Pharmacy, Heze University, Heze 274015, China.

Zhengui Yan, College of Animal Science and Technology, Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, Shandong Agricultural University, Taian 271018, China.

Xuelan Liu, Poultry Institute, Shandong Academy of Agricultural Sciences, Jinan 250100, China; Shandong Provincial Key Laboratory of Poultry Diseases Diagnosis and Immunology, Jinan 250100, China; Poultry Breeding Engineering Technology Center of Shandong Province, Jinan 250100, China.

Conflict of interest statement

The authors declare no real or perceived conflicts of interest.

Literature cited

  1. Akiba, Y., Jensen L. S., Barb C. R., and Kraeling R. R.. . 1982. Plasma estradiol, thyroid hormones, and liver lipid content in laying hens fed different isocaloric diets. J. Nutr. 112:299–308. doi: 10.1093/jn/112.2.299. [DOI] [PubMed] [Google Scholar]
  2. Alves-Bezerra, M., and Cohen D. E.. . 2017. Triglyceride metabolism in the liver. Compr. Physiol. 8:1–8. doi: 10.1002/cphy.c170012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Aydın, B., Güler Şahin C., Şekeroğlu V., and Atlı Şekeroğlu Z.. . 2021. Conjugated linoleic acid protects brain mitochondrial function in acrolein induced male rats. Toxicol. Mech. Methods. 31:674–679. doi: 10.1080/15376516.2021.1952673. [DOI] [PubMed] [Google Scholar]
  4. Bassaganya-Riera, J., Reynolds K., Martino-Catt S., Cui Y., Hennighausen L., Gonzalez F., Rohrer J., Benninghoff A. U., and Hontecillas R.. . 2004. Activation of PPAR gamma and delta by conjugated linoleic acid mediates protection from experimental inflammatory bowel disease. Gastroenterology. 127:777–791. doi: 10.1053/j.gastro.2004.06.049. [DOI] [PubMed] [Google Scholar]
  5. Bessone, F., Razori M. V., and Roma M. G.. . 2019. Molecular pathways of nonalcoholic fatty liver disease development and progression. Cell. Mol. Life Sci. 76:99–128. doi: 10.1007/s00018-018-2947-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bruen, R., Fitzsimons S., and Belton O.. . 2017. Atheroprotective effects of conjugated linoleic acid. Br. J. Clin. Pharmacol. 83:46–53. doi: 10.1111/bcp.12948. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cherian, G. 2015. Nutrition and metabolism in poultry: role of lipids in early diet. J. Anim. Sci. Biotechnol. 6:28. doi: 10.1186/s40104-015-0029-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Choi, Y. I., Ahn H. J., Lee B. K., Oh S. T., An B. K., and Kang C. W.. . 2012. Nutritional and hormonal induction of fatty liver syndrome and effects of dietary lipotropic factors in egg-type male chicks. Asian-Australas. J. Anim. Sci. 25:1145–1152. doi: 10.5713/ajas.2011.11418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cobbina, E., and Akhlaghi F.. . 2017. Non-alcoholic fatty liver disease (NAFLD) - pathogenesis, classification, and effect on drug metabolizing enzymes and transporters. Drug Metab. Rev. 49:197–211. doi: 10.1080/03602532.2017.1293683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Fan, R. F., Liu J. X., Yan Y. X., Wang L., and Wang Z. Y.. . 2020. Selenium relieves oxidative stress, inflammation, and apoptosis within spleen of chicken exposed to mercuric chloride. Poult. Sci. 99:5430–5439. doi: 10.1016/j.psj.2020.08.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Feng, Y., Li Y., Jiang W., Hu Y., Jia Y., and Zhao R.. . 2021. GR-mediated transcriptional regulation of m (6)A metabolic genes contributes to diet-induced fatty liver in hens. J. Anim. Sci. Biotechnol. 12:117. doi: 10.1186/s40104-021-00642-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Friedman, S. L., Neuschwander-Tetri B. A., Rinella M., and Sanyal A. J.. . 2018. Mechanisms of NAFLD development and therapeutic strategies. Nat. Med. 24:908–922. doi: 10.1038/s41591-018-0104-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Fu, C. Y., Zhang Y., Wang W. B., Shi T. H., Liu X. L., Wei X. F., and Yan P. P.. . 2022. Supplementing conjugated linoleic acid in breeder hens diet increased conjugated linoleic acid incorporation in liver and alters hepatic lipid metabolism in chick offspring. Br. J. Nutr. 127:1443–1454. doi: 10.1017/S0007114521000763. [DOI] [PubMed] [Google Scholar]
  14. Fu, C., Zhang Y., Yao Q., Wei X., Shi T., Yan P., and Liu X.. . 2020. Maternal conjugated linoleic acid alters hepatic lipid metabolism via the AMPK signaling pathway in chick embryos. Poult. Sci. 99:224–234. doi: 10.3382/ps/pez462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gao, P. C., Chu J. H., Chen X. W., Li L. X., and Fan R. F.. . 2021. Selenium alleviates mercury chloride-induced liver injury by regulating ­mitochondrial dynamics to inhibit the crosstalk between energy metabolism disorder and NF-κB/NLRP3 inflammasome-mediated inflammation. Ecotoxicol. Environ. Saf. 228:113018. doi: 10.1016/j.ecoenv.2021.113018. [DOI] [PubMed] [Google Scholar]
  16. Gerstner, C., Saín J., Lavandera J., González M., and Bernal C.. . 2021. Functional milk fat enriched in conjugated linoleic acid prevented liver lipid accumulation induced by a high-fat diet in male rats. Food Funct. 12:5051–5065. doi: 10.1039/d0fo03296d. [DOI] [PubMed] [Google Scholar]
  17. Hamid, H., Zhang J. Y., Li W. X., Liu C., Li M. L., Zhao L. H., Ji C., and Ma Q. G.. . 2019. Interactions between the cecal microbiota and non-alcoholic steatohepatitis using laying hens as the model. Poult. Sci. 98:2509–2521. doi: 10.3382/ps/pey596. [DOI] [PubMed] [Google Scholar]
  18. Han, H., Zhang J., Chen Y., Shen M., Yan E., Wei C., Yu C., Zhang L., and Wang T.. . 2020. Dietary taurine supplementation attenuates lipopolysaccharide-induced inflammatory responses and oxidative stress of broiler chickens at an early age. J. Anim. Sci. 98. doi: 10.1093/jas/skaa311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Krishan, R., Kandasamy G. M., and Faizal B.. . 2014. An evaluation of the efficacy of using selected solvents for the extraction of lipids from algal biomass by the soxhlet extraction method. Fuel. 116(1):103–108. doi: 10.1016/j.fuel.2013.07.118. [DOI] [Google Scholar]
  20. Lehnen, T. E., da Silva M. R., Camacho A., Marcadenti A., and Lehnen A. M.. . 2015. A review on effects of conjugated linoleic fatty acid (CLA) upon body composition and energetic metabolism. J. Int. Soc. Sports Nutr. 12:36. doi: 10.1186/s12970-015-0097-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Liu, Y., Shen J., Yang X., Sun Q., and Yang X.. . 2018. Folic acid reduced triglycerides deposition in primary chicken hepatocytes. J. Agric. Food Chem. 66:13162–13172. doi: 10.1021/acs.jafc.8b05193. [DOI] [PubMed] [Google Scholar]
  22. Livak, K. J., and Schmittgen T. D.. . 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C (T)) method. Methods. 25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  23. Lv, Z., Xing K., Li G., Liu D., and Guo Y.. . 2018. Dietary genistein alleviates lipid metabolism disorder and inflammatory response in laying hens with fatty liver syndrome. Front. Physiol. 9:1493. doi: 10.3389/fphys.2018.01493. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Mete, A., Giannitti F., Barr B., Woods L., and Anderson M.. . 2013. Causes of mortality in backyard chickens in northern California: 2007-2011. Avian Dis. 57:311–315. doi: 10.1637/10382-092312-Case.1. [DOI] [PubMed] [Google Scholar]
  25. Miao, Y. F., Gao X. N., Xu D. N., Li M. C., Gao Z. S., Tang Z. H., Mhlambi N. H., Wang W. J., Fan W. T., Shi X. Z., . et al. 2021. Protective effect of the new prepared Atractylodes macrocephala Koidz polysaccharide on fatty liver hemorrhagic syndrome in laying hens. Poult. Sci. 100:938–948. doi: 10.1016/j.psj.2020.11.036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Moore, J. B., Gunn P. J., and Fielding B. A.. . 2014. The role of dietary sugars and de novo lipogenesis in non-alcoholic fatty liver disease. Nutrients. 6:5679–5703. doi: 10.3390/nu6125679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Mrugala, D., Leatherwood J. L., Morris E. F., Dickson E. C., Latham C. M., Owen R. N., Beverly M. M., Kelley S. F., and White-Springer S. H.. . 2021. Dietary conjugated linoleic acid supplementation alters skeletal muscle mitochondria and antioxidant status in young horses. J. Anim. Sci. 99. doi: 10.1093/jas/skab037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Musso, G., Gambino R., and Cassader M.. . 2013. Cholesterol metabolism and the pathogenesis of non-alcoholic steatohepatitis. Prog. Lipid Res. 52:175–191. doi: 10.1016/j.plipres.2012.11.002. [DOI] [PubMed] [Google Scholar]
  29. Nakamuta, M., Fujino T., Yada R., Yada M., Yasutake K., Yoshimoto T., Harada N., Higuchi N., Kato M., Kohjima M., . et al. 2009. Impact of cholesterol metabolism and the LXRalpha-SREBP-1c pathway on nonalcoholic fatty liver disease. Int. J. Mol. Med. 23:603–608. doi: 10.3892/ijmm_00000170. [DOI] [PubMed] [Google Scholar]
  30. Park, Y. M. 2014. CD36, a scavenger receptor implicated in atherosclerosis. Exp. Mol. Med. 46:e99. doi: 10.1038/emm.2014.38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Pawlak, M., Lefebvre P., and Staels B.. . 2015. Molecular mechanism of PPARα action and its impact on lipid metabolism, inflammation and fibrosis in non-alcoholic fatty liver disease. J. Hepatol. 62:720–733. doi: 10.1016/j.jhep.2014.10.039. [DOI] [PubMed] [Google Scholar]
  32. Pepino, M. Y., Kuda O., Samovski D., and Abumrad N. A.. . 2014. Structure-function of CD36 and importance of fatty acid signal transduction in fat metabolism. Annu. Rev. Nutr. 34:281–303. doi: 10.1146/annurev-nutr-071812-161220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Polin, D., and Wolford J. H.. . 1977. Role of estrogen as a cause of fatty liver hemorrhagic syndrome. J. Nutr. 107:873–886. doi: 10.1093/jn/107.5.873. [DOI] [PubMed] [Google Scholar]
  34. Qiu, K., Zhao Q., Wang J., Qi G. H., Wu S. G., and Zhang H. J.. . 2021. Effects of pyrroloquinoline quinone on lipid metabolism and anti-oxidative capacity in a high-fat-diet metabolic dysfunction-associated fatty liver disease chick model. Int. J. Mol. Sci. 22. doi: 10.3390/ijms22031458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Ren, J., Tian W., Jiang K., Wang Z., Wang D., Li Z., Yan F., Wang Y., Tian Y., Ou K., . et al. 2021. Global investigation of estrogen-responsive genes regulating lipid metabolism in the liver of laying hens. BMC Genomics. 22:428. doi: 10.1186/s12864-021-07679-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Rozenboim, I., Mahato J., Cohen N. A., and Tirosh O.. . 2016. Low protein and high-energy diet: a possible natural cause of fatty liver hemorrhagic syndrome in caged White Leghorn laying hens. Poult. Sci. 95:612–621. doi: 10.3382/ps/pev367. [DOI] [PubMed] [Google Scholar]
  37. Shini, A., Shini S., and Bryden W. L.. . 2019. Fatty liver haemorrhagic syndrome occurrence in laying hens: impact of production system. Avian Pathol. 48:25–34. doi: 10.1080/03079457.2018.1538550. [DOI] [PubMed] [Google Scholar]
  38. Shini, S., Shini A., and Bryden W. L.. . 2020. Unravelling fatty liver haemorrhagic syndrome: 1. Oestrogen and inflammation. Avian Pathol. 49:87–98. doi: 10.1080/03079457.2019.1674444. [DOI] [PubMed] [Google Scholar]
  39. Shokryzadan, P., Rajion M. A., Meng G. Y., Boo L. J., Ebrahimi M., Royan M., Sahebi M., Azizi P., Abiri R., and Jahromi M. F.. . 2017. Conjugated linoleic acid: a potent fatty acid linked to animal and human health. Crit. Rev. Food Sci. Nutr. 57:2737–2748. doi: 10.1080/10408398.2015.1060190. [DOI] [PubMed] [Google Scholar]
  40. Squires, E. J., and Leeson S.. . 1988. Aetiology of fatty liver syndrome in laying hens. Br. Vet. J. 144:602–609. doi: 10.1016/0007-1935(88)90031-0. [DOI] [PubMed] [Google Scholar]
  41. Tan, J., Wan L., Chen X., Li X., Hao X., Li X., Li J., and Ding H.. . 2019. Conjugated linoleic acid ameliorates high fructose-induced hyperuricemia and renal inflammation in rats via NLRP3 inflammasome and TLR4 signaling pathway. Mol. Nutr. Food Res. 63:e1801402. doi: 10.1002/mnfr.201801402. [DOI] [PubMed] [Google Scholar]
  42. Tous, N., Theil P. K., Lauridsen C., Lizardo R., Vilà B., and Esteve-Garcia E.. . 2012. Dietary conjugated linoleic acid modify gene expression in liver, muscles, and fat tissues of finishing pigs. J. Anim. Sci. 90:340–342. doi: 10.2527/jas.53768. [DOI] [PubMed] [Google Scholar]
  43. Trott, K. A., Giannitti F., Rimoldi G., Hill A., Woods L., Barr B., Anderson M., and Mete A.. . 2014. Fatty liver hemorrhagic syndrome in the backyard chicken: a retrospective histopathologic case series. Vet. Pathol. 51:787–795. doi: 10.1177/0300985813503569. [DOI] [PubMed] [Google Scholar]
  44. Wang, Y., Nakajima T., Gonzalez F. J., and Tanaka N.. . 2020. PPARs as metabolic regulators in the liver: lessons from liver-specific PPAR-null mice. Int. J. Mol. Sci. 21. doi: 10.3390/ijms21062061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Wang, S. H., Wang W. W., Zhang H. J., Wang J., Chen Y., Wu S. G., and Qi G. H.. . 2019. Conjugated linoleic acid regulates lipid metabolism through the expression of selected hepatic genes in laying hens. Poult. Sci. 98:4632–4639. doi: 10.3382/ps/pez161. [DOI] [PubMed] [Google Scholar]
  46. Wu, Q., Tang H., and Wang H.. . 2019. The anti-oxidation and mechanism of essential oil of Paederia scandens in the NAFLD model of chicken. Animals. 9. doi: 10.3390/ani9100850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Xing, C., Wang Y., Dai X., Yang F., Luo J., Liu P., Zhang C., Cao H., and Hu G.. . 2020. The protective effects of resveratrol on antioxidant function and the mRNA expression of inflammatory cytokines in the ovaries of hens with fatty liver hemorrhagic syndrome. Poult. Sci. 99:1019–1027. doi: 10.1016/j.psj.2019.10.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Yang, B., Gao H., Stanton C., Ross R. P., Zhang H., Chen Y. Q., Chen H., and Chen W.. . 2017. Bacterial conjugated linoleic acid production and their applications. Prog. Lipid Res. 68:26–36. doi: 10.1016/j.plipres.2017.09.002. [DOI] [PubMed] [Google Scholar]
  49. Yao, Y., Wang H., Yang Y., Jiang Z., and Ma H.. . 2022. Dehydroepiandrosterone activates the GPER-mediated AMPK signaling pathway to alleviate the oxidative stress and inflammatory response in laying hens fed with high-energy and low-protein diets. Life Sci. 120926. doi: 10.1016/j.lfs.2022.120926 [DOI] [PubMed] [Google Scholar]
  50. Zaefarian, F., Abdollahi M. R., Cowieson A., and Ravindran V.. . 2019. Avian liver: the forgotten organ. Animals. 9. doi: 10.3390/ani9020063. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Animal Science are provided here courtesy of Oxford University Press

RESOURCES