Neutralizing peripheral circulating IL1β slows the progression of ALS in a lentivirus‐infected OPTN^E478G mouse model

Abstract

Background

Amyotrophic lateral sclerosis (ALS) is irreversible and fatal within 3–5 years, with limited options for treatment. It is imperative to develop a symptom‐based treatment that may increase the survival of ALS patients and improve their quality of life. Inflammation status, especially elevated interleukin 1β (IL1β), has been reported to play a critical role in ALS progression. Our study determined that neutralizing circulating IL1β slows down the progression of ALS in an ALS mouse model.

Methods

The ALS mouse model was developed by microinjection of lentivirus‐carrying OPTN^E478G (optineurin, a mutation from ALS patients) into the intra‐motor cortex of mice. Peripheral circulating IL1β was neutralized by injecting anti‐IL1β antibody into the tail vein. Enzyme‐linked immunosorbent assay (ELISA) and real‐time polymerase chain reaction (RT‐PCR) were carried out to determine the protein and gene expression levels of IL1β. TUNEL assay was used to assess the neural cell death. Immunofluorescent staining of MAP2 and CASP3 was accomplished to evaluate neuronal cell apoptosis. Glial fibrillary acidic protein staining was performed to analyze the number of astrocytes. Rotarod test, grip strength test, balance beam test, and footprint test were conducted to assess the locomotive function after anti‐IL1β treatment.

Results

The model revealed that neuroinflammation contributes to ALS progression. ALS mice exhibited elevated neuroinflammation and IL1β secretion. After anti‐IL1β treatment, ALS mice revealed decreased neural cell death and astrogliosis and gained improved muscle strength and motor ability.

Conclusions

Blocking IL1β is a promising strategy to slow down the progression of ALS.

Blocking IL1β is a promising strategy to slow down the progression of ALS. Upon anti‐IL1β treatment, ALS mice showed lower neuronal cell death and astrogliosis, but improved muscle strength and motor ability.

1. INTRODUCTION

Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease that is fatal to patients within 3–5 years of onset. ¹ Although the control of ALS progression has attracted much attention, there is no efficient curative strategy to deal with this devastating neurodegenerative disease. Riluzole and edaravone are the only drugs approved by the U.S. Food and Drug Administration for ALS treatment, which may prolong survival by several months. ² Thus, it is imperative to develop new drugs and curative strategies to advance the motor behavior of ALS patients.

Inflammation has been found to play a critical role in ALS progression. ³ For instance, elevated interleukin 1β (IL1β) secretion was associated with ALS progression in a transgenic mouse model with SOD1^G93A (mutant superoxide dismutase 1). ⁴ A recent study demonstrated that polymorphisms of IL1β showed higher ALS susceptibility and high rate of disease progression. ⁵ In our previous study, we revealed that mice infected with lentivirus‐carrying OPTN^E478G, a mutation that was identified in ALS patients, had elevated neuroinflammation and increased IL1β secretion. This inflammation state resulted in neuronal cell death and impaired mobility of mice. ⁶ These studies suggest that blocking IL1β is beneficial for maintaining neuronal cell survival and improving ALS patients' quality of life.

IL1β, also known as leukocytic pyrogen, is a fever‐producing cytokine and is an important mediator of the inflammatory response. Here, we scrutinize the effects of blocking IL1β in our ALS mouse model. Our results reveal that blocking peripheral IL1β with the IL1β antibody significantly enhanced motor ability in the ALS mouse model. The outcomes suggest that blocking peripheral IL1β can ameliorate the impaired motor ability of ALS patients and improve their quality of life.

2. MATERIALS AND METHODS

2.1. Animal management

Male mice weighing 18–25 g were purchased from Hunan SJA Laboratory Animal Co., Ltd. The mice were randomly allocated to three groups (n ≥ 3 per group): the CTRL + PBS (phosphate‐buffered saline) group (control virus only), OPTN^E478G + PBS group, and OPTN^E478G + anti‐IL1β group. Five mice per cage were housed at 22°C and 50% humidity under a 12‐h light–dark cycle; 2.0 μl of lentivirus was injected into the intra‐motor cortex using a small animal stereotaxic instrument (Yuyan, Shanghai, China). Ten days after surgery, anti‐IL1β antibody (Bio X Cell BE0246, Lebanon, NH, USA) treatments were performed once a week and lasted for 1 month, which was reconstituted with PBS (200 μg/ml) followed by tail vein injection at a concentration of 1 μg/g bodyweight. Behavioral tests were carried out for 5 days. C.‐G.H. monitored the group assignment at the different stages of the experiment (during assignment, experiment, outcome evaluation, and data analysis). Mice were euthanized after behavioral tests; 0.3% pentobarbital sodium (20 μl/g) was used to anesthetize mice. Then, heart perfusion was conducted with 30 ml of saline and 40 ml of 4% PFA (paraformaldehyde) in sequence. The brains were quickly obtained and postfixed for 4–6 h in 4% PFA. All animal experiments were performed according to the instructions of animal welfare designated by the World Organization for Animal Health.

2.2. Intra‐motor cortex delivery

Male mice (C57BL/6) (age: 10 weeks; weight: 18–25 g) were used to develop the ALS mouse model by intra‐motor cortex microinjection (Yuyan), as reported previously. ⁶ Briefly, we anesthetized the mice with 0.3% pentobarbital sodium (20 μl/g), stabilized them, and shaved the hair on the skull. Midline incision was executed. The syringe was inserted to reach the motor cortex region (2.0 mm anterior to the bregma, 1.5 mm farther from the midline, and 2.0 mm in depth); 2 μl of the virus was infused into the motor cortex (flow rate: 1.0 μl/3 min). Suture the skin and disinfection with iodophor.

2.3. Tail vein injection

We used tail veil injection to deliver the anti‐IL‐1β antibody to the mice. The mice were stabilized on a mouse fixator. The tail vein was exposed to wipe with alcohol. The needle (with a hosepipe connected to a 1‐ml syringe) was inserted into the tail vein at a small angle. It was confirmed that the needle was inserted into the vein by pumping back before infusion. The maximum liquid for tail vein injection was 100 μl per mouse.

2.4. Packaging of lentivirus

Lentivirus production was carried out as described in previous studies. ⁶ , ⁷ 293T cells were transfected with 10 μg of pCDH‐OPTN^E478G with auxiliary plasmids (∆8.91, VSVG) in a 10‐cm plate. After 24‐h transfection, the supernatants were collected, filtered, and concentrated (with one‐fourth V pre‐cold PEG8000 concentration buffer [146.1 g/L NaCl, 200 g/L PEG8000] for 4 h). After the pellets were centrifuged at 4000 rpm for 20 min, they were resuspended in 100 μl of PBS; 1 × 10⁸ TU/ml of lentivirus was used in this study.

2.5. Quantitative real‐time PCR

Quantitative real‐time polymerase chain reaction (qrt‐PCR) was performed on an FTC‐3000 real‐time PCR machine (Funglyn Biotech, Toronto, Canada). GoScript Reverse Transcriptase (Promega, A5001) was used to synthesize cDNA after Trizol extraction of total RNA. Quantitative PCR amplification of IL1β was performed using GAPDH (glyceraldehyde 3‐phosphate dehydrogenase) as an internal control. The primer sequences are listed as follows:

m‐IL1β: 5′‐AAGGAGAACCAAGCAACGACAAAA‐3′, 5′‐TGGGGAACTCTGCAGACTCAAACT‐3′; m‐GAPDH: 5′‐AGGTCGGTGTGAACGGATTTG‐3′, 5′‐TGTAGACCATGTAGTTGAGGTCA‐3′.

2.6. Rotarod test

Balance and motor coordination were assessed using rotarod test, as reported before. ⁸ The accelerating rate was set to 5.0 for 2 min on a DXP‐3 accelerating rotarod (Chinese Academy of Medical Sciences). The accelerating rate was kept at 50.0 rpm for further 2 min. The time was recorded before falling off from the apparatus. Three trials with a 20‐min break were conducted for mice per day, and the trials were performed for 5 days.

2.7. Balance beam test

Balance maintenance was investigated as reported before. ⁸ , ⁹ A balance beam (0.9 × 0.9 × 50 cm horizontal wooden bar) was positioned above the ground (40 cm) with a cage beneath. A dark box was kept at the terminal end encouraging the mouse to run toward it. The time taken to cross the beam was recorded, and the speed was calculated. Three trials with a 20‐min break were conducted per day, and the trials were performed for 5 days.

2.8. Footprint test

Footprint test was performed as reported previously with minor modifications. ⁶ , ⁸ A tunnel (10.0 × 10.0 × 70.0 cm) was prepared with a white paper beneath. The mouse's paws were painted with red (forepaws) or black (hind paws) pigments. We recorded the length of the hindlimb stride, the length of the forelimb stride, the width of the front base, the width of the hind base, the speed to traverse the tunnel, and the overlap between the hindlimb and forelimb.

2.9. Grip strength test

Grip strength test was carried out as previously reported. ⁶ , ¹⁰ A steel wire (diameter: 9.0 mm, length: 50.0 mm) was hung above the ground (40.0 cm). A mouse was hung on the wire. The time that the mouse could hold on to the wire was recorded for a maximum of 5 min. Three trials with a 20‐min break were conducted per day, and the trials were performed for 5 days.

2.10. Enzyme‐linked immunosorbent assay

Mice brain tissue homogenates were harvested after the anti‐IL1β antibody treatment. Enzyme‐linked immunosorbent assay (ELISA) was performed as described in previous studies. ⁶ , ¹¹ Briefly, we measured IL1β using the mouse IL1β Valukine ELISA kit (VAL601, R&D, USA). A Varioskan LUX multimode microplate reader (Thermo Fisher Scientific) was used to analyze chemiluminescence. Cytokine concentration (pg cytokine/mg total protein) was calculated by fitting the standard curve.

2.11. TUNEL assay

The TUNEL cell apoptosis detection kit (Beyotime C1091, China) was used to examine neuronal cell death, as reported before. ⁶ The paraffinized brain tissue slices were deparaffinized and rehydrated. They were digested with proteinase K (20.0 mg/ml) at room temperature for 20 min. Endogenous peroxidase was inactivated using H₂O₂ (3% in PBS) at room temperature for 20 min. The slices were incubated with biotinylated dUTP in TdT enzyme buffer for 1 h at 37°C. Then, the reaction was stopped; the slices were washed with PBS, incubated with anti‐digoxigenin peroxidase conjugate at room temperature for 30 min in a humid chamber, and subject to chromogenic reaction using diaminobenzidine. Finally, the slices were rinsed, stained with hematoxylin, dehydrated, and sealed for microscopic observation. ¹² The positive‐staining cells and the total number of cells were counted on Image‐Pro; the average ratio of TUNEL+ cells to the proportion of the total number of cells in each visual field in the brain per section was calculated.

2.12. Immunohistochemistry

Immunohistochemical examinations were carried out as reported before ⁶ ; 0.3% sodium pentobarbital (20 μl/g) was used to anesthetize the mice. The brains were obtained after heart perfusion and cryoprotected in 30% sucrose for examining the frozen sections. The samples were embedded in optimal cutting temperature and quick‐freezed in liquid nitrogen. Then, they were sectioned into 4.0‐μm slices using a Cryostat Microtome. The slices were incubated with anti–glial fibrillary acidic protein (GFAP) antibody (BIOSS) overnight at 4°C. The slices were washed in PBS thrice (5 min each time), incubated with secondary goat‐anti‐rabbit IgG (Cy3) (1:2000, Abcam) antibody for 4.0 h at room temperature, washed thrice (5 min each time) in PBS, mounted using Fluoro‐Gel, and examined using a LEIKA fluorescence microscope. Co‐immunofluorescent staining was carried out with anti‐CASP3 (1:200, Santa Cruz, sc‐7148) and anti‐MAP2 (1:200, Abcam, ab5392) staining using the same steps. The positive‐staining cells and the total number of cells were counted on Image‐Pro, and the average ratio of GFAP+ cells to the proportion of the total number of cells and the average ratio of CASP3+ to MAP2+ cells in each visual field in the brain per section were calculated.

2.13. Statistical analysis

GraphPad Prism 7 was used for data analysis. Data are presented as mean ± standard deviation. Distribution style was checked using Shapiro–Wilk normality test. Multiple comparisons were carried out using analysis of variance (ANOVA), with one‐way ANOVA test employed when only one variance was present and two‐way ANOVA employed when more than one variance was present. Dunnett's multiple post‐hoc comparison tests were performed to address statistical differences. Results were presented based on the median value and its quartiles in the whisker boxplots. Statistical significance was considered when p‐value ≤0.05. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, and ****p ≤ 0.0001; “ns” means no significance.

3. RESULTS

3.1. IL1β was neutralized in the brain of lentivirus‐infected OPTN^E478G mice after anti‐IL1β treatment

Preventing the progress of ALS remains a challenge. IL1β, an inflammatory factor, is elevated in disease conditions. The increased production of IL1β has been found in ALS, ⁴ , ⁶ and IL1β has been investigated as a potential therapeutic target for the treatment of ALS. ¹³ However, the effects the of anti‐IL1β antibody treatment for ALS have not been investigated. To determine the therapeutic effects of the anti‐IL1β treatment on ALS, we treated a previously established ALS mouse model with an anti‐IL1β antibody. The mouse model was developed by microinjecting lentivirus‐carrying OPTN^E478G into the intra‐motor cortex of mice. ⁶ OPTN^E478G was found to be mutated in ALS patients and led to the elevated IL1β level in the mouse model. ⁶ , ¹⁴ Anti‐IL1β (Bio X Cell BE0246) was reconstituted with PBS (200 μg/ml) and then injected into the tail vein of mice (1 μg/g bodyweight) to neutralize the peripheral IL1β after 10 days of lentivirus microinjection. Anti‐IL1β antibody treatments were performed once a week four times. Behavior tests were conducted 7 days after the last anti‐IL1β treatment to evaluate the effects of neutralization of IL1β on the ALS mouse model, and the samples were harvested after these tests. The time schedule is shown in Figure 1A. The intra‐motor cortex injection site is shown in Figure 2B. We found that IL1β was neutralized to the basal level after the anti‐IL1β treatment (Figure 1C). The mRNA expression of IL1β was also determined using qrt‐PCR, showing that there was no difference with or without anti‐IL1β treatment in the ALS mouse model. The results suggest that the anti‐IL1β antibody efficiently downregulated IL1β in brain tissue in the ALS mouse model.

FIGURE 1.

Anti‐IL1β treatment can reduce IL1β (interleukin 1β) in mouse brain tissue. (A) Diagram of the treatment of mice for subsequent analysis. Anti‐IL1β infusion started after 10 days of lentivirus microinjection. Anti‐IL1β treatment was performed once a week and lasted for 1 month. Assessments of movements started 7 days after last anti‐IL1β treatment. The assessments were performed for five consecutive days. (B) The intra‐motor cortex injection site is present by referring the mouse brain in stereotaxic coordinates (2 mm anterior to the bregma, 1.5 mm beside the midline, 2 mm in depth from the pia). ²⁰ (C) IL1β in the brain tissue was analyzed using ELISA (enzyme‐linked immunosorbent assay, left) and qPCR (quantitative polymerase chain reaction, right) after anti‐IL1β treatment. Values are expressed as mean ± standard deviation, n = 3. Data analysis was performed by comparing CTRL and OPTN^E478G + IL1β to the OPTN^E478G group using one‐way ANOVA (analysis of variance) with Dunnett's post‐hoc test. ***p < 0.001; the absence of asterisks means no significance p > 0.05.

FIGURE 2.

Anti‐IL1β treatment reduced neuronal cell death and astrogliosis caused by OPTN^E478G. (A) Neuronal cell death was measured using TUNEL assay in mouse brain after anti‐IL1β treatment. (B) Quantification of TUNEL‐positive cells. Values are expressed as mean ± standard deviation (SD), n = 3. Data analysis was performed by comparing CTRL and OPTN^E478G + IL1β to the OPTN^E478G group using one‐way ANOVA (analysis of variance) with Dunnett's post‐hoc test. ***p < 0.001. (C) Double immunofluorescent staining of CASP3 and MAP2 in mouse brain after the anti‐IL1β treatment in lentivirus‐infected OPTN^E478G mice. DAPI staining depicts the nucleus in blue, MAP2 in red, and CASP3 in green. (D) Percentage of CASP3+/MAP2+ cells. Values are presented as mean ± SD, n = 5. Data analysis was performed by comparing CTRL and OPTN^E478G + anti‐IL1β to the OPTN^E478G group using one‐way ANOVA with Dunnett's post‐hoc test. ****p ≤ 0.0001. (E) Immunofluorescent staining of GFAP (glial fibrillary acidic protein) to analyze the aggregation of astrocytes after the anti‐IL1β treatment. (F) Quantification of GFAP‐positive cells. Values are expressed as mean ± SD, n = 5. Data analysis was performed by comparing CTRL and OPTN^E478G + IL1β to the OPTN^E478G group using one‐way ANOVA with Dunnett's post‐hoc test. ****p ≤ 0.0001.

3.2. Anti‐IL1β treatment reduced neuronal cell death and astrogliosis caused by OPTN^E478G

To investigate the effects of anti‐IL1β treatment on neural cells, we evaluated neural cell death and astrogliosis, which were the pathogenic features of the OPTN^E478G mouse model. After the anti‐IL1β treatment, OPTN^E478G mice exhibited decreased neuronal cell death, as evidenced by TUNEL assay (Figure 2A,B). Immunofluorescent staining of MAP2 and CASP3, which were markers of neuronal cell and apoptosis, respectively, revealed that the ratio of CASP3⁺ to MAP2⁺ cells decreased by 50% when OPTN^E478G mice were treated with the anti‐IL1β antibody (Figure 2C,D). Immunofluorescent staining of GFAP (an astrocyte marker) was substantially decreased, indicating alleviated astrogliosis around the degenerating motor neurons after the anti‐IL1β treatment (Figure 2E,F). These results suggest that neutralizing peripheral IL1β with an anti‐IL1β antibody can ameliorate the inflammatory effects on neuronal cell death in the OPTN^E478G mouse model.

3.3. Anti‐IL1β treatment improved the motor ability of OPTN^E478G mice

To investigate whether OPTN^E478G mice could benefit from the anti‐IL1β treatment, we performed an accelerating‐rotarod test and a balance beam test to evaluate motor coordination and balance, a grip strength test to determine muscle tension, and a footprint test to evaluate mouse gait. After the anti‐IL1β treatment, the latency to fall increased significantly, as measured by the accelerating‐rotarod test (Figure 3A); muscle tension also improved, as evidenced by longer latency to fall in the grip strength test (Figure 3B); the speed of crossing the beam was faster in the balance beam test (Figure 3C); the speed, forelimb stride length (FL), hindlimb stride length (HL), and overlap between hindlimb and forelimb (OV) increased; and hind base width (HW) and front base width (FW) decreased in the footprint tests (Figure 3D–I). These results indicate that inflammatory inhibition with an anti‐IL1β antibody can promote neuronal cell survival and improve motor ability in the lentivirus‐infected OPTN^E478G ALS mouse model.

FIGURE 3.

Anti‐IL1β treatment improved the motor ability caused by OPTN^E478G. Movement of mice was evaluated using (A) rotarod test, (B) grip strength test, and (C) balance beam test after the anti‐IL1β treatment (n ≥ 3). Values are presented as mean ± SD (standard deviation) (n ≥ 9; three repeats for each mouse). Data were analyzed using two‐way ANOVA (analysis of variance) with Dunnett's post‐hoc test, * means significance between OPTN^E478G group and OPTN^E478G + anti‐IL1β group, + means significance between OPTN^E478G group and CTRL group. ****, ++++ p ≤ 0.0001; ***, +++ p ≤ 0.001; **, ++ p ≤ 0.01; + p ≤ 0.05; the absence of asterisks means no significance p > 0.05. (D–I) Movement of mice was measured using footprint test. Whisker boxplots show various parameters measured in footprint test after intra‐motor cortex microinjection (n ≥ 3). Values are presented based on the median and quartiles, n ≥ 9 (three repeats for each mouse). Data were analyzed using one‐way ANOVA with Dunnett's post‐hoc test. FL, forelimb stride length; FW, front base width; HL, hindlimb stride length; HW, hind base width; OV, overlap between hindlimb and forelimb. ****p ≤ 0.0001, ***p ≤ 0.001, **p ≤ 0.01, *p ≤ 0.05; absence of asterisks means no significance, p > 0.05.

4. DISCUSSION

Our previous study observed significantly elevated IL1β secretion in our ALS mouse model, which carried an ALS‐associated mutation (OPTN^E478G) by lentivirus infection. This inflammation condition led to neuronal cell death and affected mouse mobility. ⁶ Here, we further determined that blocking IL1β was a promising method to maintain neuronal cell survival and improve motor ability in the ALS mouse model.

Here the effects of anti‐IL1β antibody were determined in the lentivirus‐infected OPTN^E478G ALS mouse model. Compared with a genetically modified mouse model, our model's advantage is that the dominant negative effect of OPTN^E478G, which was introduced by intra‐motor cortex injection, was only in the brain and did not affect other organs. The limitations of our model, such as the side effects of the surgery, the competition of OPTN^WT expression, and the life span of mice, should not be ignored when we interpret data obtained from this mouse model. Furthermore, the effects of anti‐IL1β antibody would be more reliably and convincingly demonstrated using all available ALS mouse models, including SOD1^G93A. Interferences from other significantly changed inflammatory cytokines, such as IL6 and tumor necrosis factor, should also be considered.

Using the lentivirus‐infected OPTN^E478G ALS mouse model, previous studies found that neuroinflammation contributes to ALS progression. ⁶ IL1β was elevated in SOD1^G93A mice, which was an ALS point mutation mouse model. ⁴ Studies have demonstrated that IL1β was elevated in samples, such as peripheral blood mononuclear cells, spinal fluid, and cerebrospinal fluid, from ALS patients. ¹⁵ , ¹⁶ By contrast, Ehrhart et al. depicted that levels of IL1β in sera from ALS patients did not significantly differ from controls but were elevated during disease progression. ¹⁷ In our study, we infused the anti‐IL1β antibody into the peripheral circulating system and improved athletic ability in the OPTN^E478G mouse model. It is remarkable that even with very low permeation into the cerebrospinal fluid, blocking IL1β with an anti‐IL1β antibody was effective in slowing down ALS progression. This effect is expected to improve by using the intra‐motor cortex microinjection approach. Another explanation is that perhaps the inflammation regulation in the peripheral system indirectly affects the central nerve system. Increased IL1β in brain tissue may (1) disrupt the permeability and integrity of blood‐brain barrier ¹⁸ or (2) be transported to the peripheral system through the cytokine transporter. ¹⁸ Anti‐IL1β treatment (intravenous) may exert its function on the central nervous system by (1) transducing the decreased IL1β signaling to the hypothalamus through vagal afferents or (2) preventing production of second messengers such as nitric oxide and prostaglandin. ¹⁹ Overall, our study suggests that blocking IL1β is a promising strategy to slow down the progression of ALS.

5. CONCLUSIONS

This study suggests that the inhibition of inflammation with an anti‐IL1β antibody can benefit neuronal cell survival and ameliorate ALS progression in mice infected with lentivirus‐carrying OPTN^E478G. Thus, curing ALS by targeting IL1β is a promising treatment.

AUTHOR CONTRIBUTIONS

Zheng‐Zhao Liu and Wen‐Bao Hu conceived the study, designed the experimental procedures, analyzed the data, prepared the manuscript, and supervised the project. Xin Wang, Zhi‐Lin Pang, and Chun‐Gu Hong performed the experiments and analyzed data. Ran Duan prepared the manuscript.

CONFLICT OF INTEREST

The authors have no conflicts of interest to declare.

ETHICS STATEMENT

The Ethical Review Board at Xiangya Hospital of Central South University approved the animal experiments (no. 201803512).

Hu W‐B, Wang X, Pang Z‐L, Duan R, Hong C‐G, Liu Z‐Z. Neutralizing peripheral circulating IL1β slows the progression of ALS in a lentivirus‐infected OPTN^E478G mouse model. Anim Models Exp Med. 2023;6:18‐25. doi: 10.1002/ame2.12297