Synergistic premalignant effects of chronic ethanol exposure and insulin receptor substrate-1 overexpression in liver

Abstract

Aim:

Insulin receptor substrate, type 1 (IRS-1) transmits growth and survival signals, and is overexpressed in more than 90% of hepatocellular carcinomas (HCCs). However, experimental overexpression of IRS-1 in the liver was found not to be sufficient to cause HCC. Since chronic alcohol abuse is a risk factor for HCC, we evaluated potential interactions between IRS-1 overexpression and chronic ethanol exposure by assessing premalignant alterations in gene expression.

Methods:

Wild-type (wt) or IRS-1 transgenic (Tg) mice, constitutively overexpressing the human (h) transgene in the liver, were pair-fed isocaloric liquid diets containing 0% or 24% ethanol for 8 weeks. The livers were used for histopathologic study and gene expression analysis, focusing on insulin, insulin-like growth factor (IGF) and wingless (WNT)–Frizzled (FZD) pathways, given their known roles in HCC.

Results:

In wt mice, chronic ethanol exposure caused hepatocellular microsteatosis with focal chronic inflammation, reduced expression of proliferating cell nuclear antigen (PCNA) and increased expression of IGF-I and IGF-I receptor. In hIRS-1 Tg mice, chronic ethanol exposure caused hepatic micro- and macrosteatosis, focal chronic inflammation, apoptosis and disordered lobular architecture. These effects of ethanol in hIRS-1 Tg mice were associated with significantly increased expression of IGF-II, insulin, IRS-4, aspartyl–asparaginyl β hydroxylase (AAH), WNT-1 and FZD 7, as occurs in HCC.

Conclusion:

In otherwise normal liver, chronic ethanol exposure mainly causes liver injury and inflammation with impaired DNA synthesis. In contrast, in the context of hIRS-1 overexpression, chronic ethanol exposure may serve as a cofactor in the pathogenesis of HCC by promoting expression of growth factors, receptors and signaling molecules known to be associated with hepatocellular transformation.

INTRODUCTION

INSULIN RECEPTOR SUBSTRATE, type 1 (IRS-1) is a key molecule in the insulin and insulin-like growth factor (IGF) signal transduction cascade. Insulin and IGF transmit pro-growth and pro-survival signals by activating intrinsic receptor tyrosine kinases, which tyrosine phosphorylate IRS-1.^1-3 Tyrosyl phosphorylated IRS-1 signals downstream by interacting with molecules that contain src homology domains, including Grb2 and the p85 subunit of PI3 kinase. Such interactions promote mitogenesis, cell survival, gene expression, energy metabolism and motility, which are needed for liver regeneration and remodeling after injury.^1-3

Overexpression of IRS-1 causes persistent hepatocellular growth^4,5 and hepatomegaly due to increased DNA synthesis mediated by enhanced signaling through Erk MAPK and PI3 kinase.^5,6 In addition, IRS-1 overexpression in NIH 3T3 cells promotes transformation, as manifested by tumor foci formation in soft agar and tumor growth in nude mice.^7,8 Most importantly, IRS-1 is overexpressed in over 90% of human hepatocellular carcinomas (HCCs) and HCC cell lines.⁹ Despite the wealth of data pointing toward IRS-1 as a major mediator of cellular transformation and HCC development, after more than two years of study, none of the hIRS-1 transgenic (Tg) mice ever developed HCC.^5,7-13 This suggests that overexpression of IRS-1 in the otherwise normal liver is not sufficient to promote hepatocellular transformation, and that a cofactor or second hit is required to mediate the process.

Ethanol-induced liver injury substantially impairs the capacity for liver repair and regeneration due to the inhibition of insulin and IGF-stimulated DNA synthesis and growth mechanisms,^14-16 together with increased oxidative injury, DNA damage, mitochondrial dysfunction and apoptosis.^17-19 In this regard, ethanol inhibits insulin-stimulated tyrosine phosphorylation of its receptor, activation of the intrinsic insulin receptor tyrosine kinase and tyrosyl phosphorylation of IRS-1.^6,20-22 Consequently, chronic ethanol exposure leads to reduced activation of Erk MAPK,^6,20-23 which mediates cell growth and DNA synthesis, and decreased signaling through PI3 kinase-Akt,^6,19 which mediates cell survival, growth, glucose utilization and energy metabolism.^24-28 Moreover, chronic ethanol exposure causes increased oxidative stress, DNA damage and lipid peroxidation in hepatocytes,^17-19 effects that are partly mediated by upregulation of pro-apoptosis mechanisms, including increased expression and activation of phosphatase and tensin homolog deleted in chromosome 10 (PTEN), p53, FasR and caspases.¹⁹ These potent antisurvival and cellular injury effects of ethanol may have a critical role in rendering hepatocytes more susceptible to a “second hit.”¹⁹ Therefore, it is not entirely surprising that despite its overall inhibitory effects on hepatocellular growth, chronic alcohol abuse is also a cofactor in the pathogenesis of HCC.^29-33

Potential mechanisms in which chronic ethanol exposure could serve as a cofactor in HCC development include: (1) increased DNA damage, oxidative stress and lipid peroxidation, which raise the likelihood of random mutations leading to proto-oncogene activation or onco-suppressor gene silencing; and (2) interactions between ethanol and growth signaling mechanisms such as those activated by viral or other factors, for example IRS-1 overexpression, may become uncoupled, resulting in both increased growth and DNA damage with heightened cell turnover. In this study, we investigated possible synergistic effects of chronic ethanol exposure and IRS-1 overexpression in the liver. The main objective was to determine whether the combined effects of these two cofactors would be sufficient to promote a premalignant phenotype, at least with respect to altered gene expression associated with HCC. Our investigations focused on measuring gene expression involving both IRS-1-dependent and IRS-1-independent pathways and convergent downstream genes activated by these signaling mechanisms. In this regard, we measured expression of insulin and IGF polypeptide and receptor genes, three isoforms of IRS, downstream target genes that mediate growth (proliferating cell nuclear antigen; PCNA), energy metabolism (glyceraldehydes-3-phosphate dehydrogenase; GAPDH), and motility/remodeling (aspartyl-asparaginyl-β-hydroxylase; AAH), and genes involved with wingless (WNT) and Frizzled (FZD) signaling, which regulate growth and motility during development and with malignant transformation. Finally, the possible involvement of inflammatory response was investigated by measuring the mRNA levels of tumor necrosis factor-alpha (TNF-α) and interleukins 1β (IL-1β) and interleukin-6 (IL-6).

METHODS

Transgenic mouse model

TRANSGENIC MICE THAT overexpress hIRS-1 complementary DNA (cDNA) under the control of the mouse albumin promoter/enhancer element (Tg-hIRS-1) were used to assess the potential role of ethanol on growth factor stimulated signaling through IRS-1-dependent and IRS-1-independent pathways in the liver. Genotypes were determined by polymerase chain reaction (PCR) analysis of genomic DNA, as reported previously.⁵ Diagnostic primer pairs corresponding to the human IRS-1 and SV40 sequences present in the transgene, amplified a specific 398 base-pair product in the hIRS-1 Tg mice. The Tg-hIRS1 line was maintained, as previously reported.⁵

Chronic ethanol feeding regimen

Adult male wild type (wt) BALB/c (n = 5 per group) and FVB Tg-hIRS-1 (n = 11 per group) mice were pair-fed ethanol-containing or isocaloric control liquid diets (BioServ, Frenchtown, NJ, USA) for 8 weeks. After a 1-week period of gradual adaptation, ethanol-fed mice were maintained on a 24% ethanol-containing (caloric content) diet, which produced serum ethanol levels of ~50 mM. Mice were monitored daily. Mice were killed by i.p. injection of 120 mg/kg sodium pentobarbital, and liver tissue samples were snap-frozen or fixed in Histochoice (Amresco, Solon, OH, USA). This protocol was approved by the Institutional Animal Care and Use Committee at the Lifespan–Rhode Island Hospital and conforms to guidelines established by the National Institutes of Health.

Histopathological studies

Paraffin-embedded sections were stained with hematoxylin–eosin (HE), and adjacent sections were immunostained to detect 8-hydroxydeoxyguanosine (8-OHdG) or 4-hydroxynonenol (HNE) as indices of DNA damage and lipid peroxidation/oxidative stress, as previously described,^4,19 except that immunoreactivity was detected with horseradish peroxidase (HRP) conjugated polymer-tagged antibodies (Abcam, Cambridge, MA, USA) and diaminobenzidine as the chromogen. The specimens were counterstained with hematoxylin and examined under code.

Quantitative (Q) RT–PCR assays

Total RNA isolated from liver tissue was reverse transcribed and the resulting cDNA templates were used to measure gene expression by qPCR with gene specific primers (Table 1), as previously described.^4,19 Ribosomal 18S RNA levels were used to calculate the relative abundance of each mRNA transcript.¹⁹ PCR amplifications were performed with QuantiTect SYBR Green PCR Mix (Qiagen, Valencia, CA, USA). Amplified signals were detected continuously with the BIO-RAD iCycler iQ Multi-Color RealTime PCR Detection System (Bio-Rad, Hercules, CA, USA), as previously reported.¹⁹ Annealing temperatures were optimized using the temperature gradient program provided with the iCycler software.

Table 1.

Primer pairs used for quantitative RT–PCR

Primers	Sequence 5′-3′	Amplicon	Position (nt)
hIRS-1 For	TGCTGGGGGTTTGGAGAATG	68	4527
hIRS-1 Rev	GGCACTGTTTGAAGTCCTTGACC		4594
18S rRNA For	GGACACGGACAGGATTGACA	50	1274
18S rRNA Rev	ACCCACGGAATCGAGAAAGA		1323
Insulin For	GCAAGCAGGTCATTGTTTCA	211	39
Insulin Rev	CACTTGTGGGTCCTCCACTT		249
Insulin R For	TCCTGGATTCTGTGGAGGAC	178	536
Insulin R Rev	ATGGTTGGGCAAACTTTCTG		713
IGF-I For	CTGGGCTAGGAACTGTGAGC	198	1833
IGF-I Rev	TAAGTGCCGTATCCCAGAGG		2030
IGF-I R For	CACTCAGGACACAAGGCTGA	191	3976
IGF-I R Rev	GGCACACACGTTACTGTTGG		4166
IGF-II For	GAGTTCAGAGAGGCCAAACG	190	1567
IGF-II Rev	TTAGTGTGGGACGTGATGGA		1756
IGF-II R For	TATGTGAACGGCTCTGCTTG	200	2713
IGF-II R Rev	GAGCAAGCCTGGTCTGTTTC		2912
m IRS-1 For	GATACCGATGGCTTCTCAGACG	134	940
m IRS-1 Rev	TCGTTCTCATAATACTCCAGGCG		1073
IRS-2 For	GAAGCGGCTAAGTCTCATGG	160	3282
IRS-2 Rev	GACGGTGGTGGTAGAGGAAA		3441
IRS-4 For	ATCCCACAGCCTGAAGATGTCC	143	1346
IRS-4 Rev	TTTCCTGAGCCCCAGTTGTTC		1488
AAH For	GCATTCGCCTACAGGAAATCAC	118	5478
AAH Rev	CGTGTTGCTTGTCAGACCATCAG		5595
PCNA For	GGGTTGGTAGTTGTCGCTGT	172	23
PCNA Rev	TCCAGCACCTTCTTCAGGAT		194
GAPDH For	GACAAAATGGTGAAGGTCGGTG	256	45
GAPDH Rev	TGATGTTAGTGGGGTCTCGCTC		300
FZD-3 For	CCAGGAACCTGACTTTGCTC	154	1893
FZD-3 Rev	GACACTCCCTGCTTTGCTTC		2046
FZD-7 For	ATCATCTTCCTGTCGGGTTG	165	1003
FZD-7 Rev	AAGCACCATGAAGAGGATGG		1167
WNT-1 For	ATAGCCTCCTCCACGAACCT	175	439
WNT-1 Rev	GGAATTGCCATTTGCACTCT		613
WNT-3 For	CGCTCAGCTATGAACAAGCA	202	592
WNT-3 Rev	GGTGTTTCTCCACCACCATC		793
TNF-α For	GCTGAGCTCAAACCCTGGTA	118	715
TNF-α Rev	CGGACTCCGCAAAGTCTAAG		832
IL-1β For	GAGCCCATCCTCTGTGACTC	131	366
IL-1β Rev	AGCTCATATGGGTCCGACAG		496
IL-6 For	GTTCTCTGGGAAATCGTGGA	53	203
IL-6 Rev	CAGAATTGCCATTGCACAAC		254

AAH, aspartyl-(asparaginyl)-β-hydroxylase; For, forward primer; FZD, Frizzled homolog; GAPDH, glyceraldehyde-3-phosphate-dehydrogenase; h=human; IL, interleukin; m=murine; IRS-1, insulin receptor substrate 1; IGF, insulin-like growth factor; PCNA, proliferating cell nuclear antigen; Rev, reverse primer; RT–PCR, reverse transcriptase polymerase chain reaction; TNF, tumor necrosis factor; WNT, wingless integrated.

Source of reagents

QuantiTect SYBR Green PCR Mix was obtained from Qiagen. Polyclonal antibodies to 8-OHdG and HNE were purchased from Chemicon (Tecumsula, CA, USA). Reagents for immunohistochemical staining were purchased from Abcam or Vector Laboratories (Burlingame, CA, USA). All other fine chemicals were purchased from CalBiochem (Carlsbad, CA, USA) or Sigma-Aldrich (St Louis, MO, USA).

Statistical analysis

Data depicted in the graphs represent the means ± SEM for each group. Inter-group comparisons were made using Student’s t-tests. Statistical analyses were performed using the Number Cruncher Statistical System (Dr Jerry L. Hintze, Kaysville, UT, USA). The computer software generated significant P-values are indicated over the graphs.

RESULTS

Hepatocellular steatosis with increased lipid peroxidation and DNA damage in livers from ethanol-fed Balb/c wt mice

HISTOLOGICAL SECTIONS OF liver revealed mild diffuse microvesicular steatosis in hepatocytes of ethanol-fed mice relative to control mice (Fig. 1a-c), as previously described.⁶ In addition, ethanol-exposed livers had scattered small foci of intralobular lymphomononuclear cell inflammation and rare drop-out of hepatocytes (Fig. 1d), but no appreciable necrosis. Despite these abnormalities, the hepatic lobular architecture remained relatively intact. Immunohistochemical staining revealed higher levels of HNE and 8-OHdG in ethanol-exposed relative to control livers (Fig. 1e-h). Increased 8-OHdG was mainly localized in cytoplasm, reflecting mitochondrial as opposed to nuclear DNA damage.

Figure 1.

Chronic ethanol feeding causes mild microsteatosis, focal chronic inflammation, lipid peroxidation and DNA damage in wild-type mice livers. Wild-type Balb/c mice were pair-fed for 8 weeks with isocaloric liquid diets containing 0% (a, b, e, f) or 24% (c, d, g, h) ethanol by caloric content. (a–d) Histological sections of paraffin-embedded liver (5 μM thick) were stained with hematoxylin–eosin (HE) and examined under code. The vacuolated appearance in panel c represents diffuse microsteatosis. The arrows in panel d show focal chronic inflammation (left) and microsteatosis and individual hepatocyte drop-out (right). (e–h) Adjacent histological sections were immunostained with polyclonal antibodies to (e, g) 4-hydroxynonenol (HNE) or (f, h) 8-hydroxydeoxyguanosine (8-OHdG) to detect lipid peroxidation or DNA damage, respectively. Immunoreactivity was detected with horseradish peroxidase (HRP)-conjugated polymer and DAB substrate (brown precipitate). Sections were lightly counter-stained with HE. Magnifications: a, c, ×100; b, d, ×400; e–h, ×650.

Effects of chronic ethanol feeding on insulin and IGF signaling mechanisms

To characterize the mechanisms by which ethanol impairs insulin/IGF signaling in the liver, we measured mRNA levels of insulin, IGF-I, IGF-II, their corresponding receptors and IRS-1, IRS-2 and IRS-4 by quantitative reverse transcriptase polymerase chain reaction (qRT–PCR). Among the growth factors, IGF-I was most abundantly expressed, followed by IGF-II and then insulin (Fig. 2a-c). Although the mean level of each growth factor was higher in ethanol-exposed relative to control livers, the inter-group differences were statistically significant only with respect to IGF-I. The qRT–PCR analyses demonstrated that insulin receptor was most abundantly expressed, followed by IGF-II receptor and then IGF-I receptor (Fig. 2d-f). Chronic ethanol feeding significantly increased the mean level of IGF-I receptor mRNA, but had no effect on insulin or IGF-II receptor expression.

Figure 2.

Effects of chronic ethanol feeding on hepatic mRNA expression of: (a) IGF-I, (b) IGF-II, (c) insulin, (d) IGF-I receptor (R), (e) IGF-IIR, (f) insulin-R, (g) insulin receptor substrate, type 1 (IRS-1), (h) IRS-2 and (i) IRS-4. RNA extracted from livers of wild-type mice that were pair-fed with isocaloric liquid diets containing 0% or 24% ethanol (caloric content) for 8 weeks, was reverse transcribed, and the cDNAs were used for quantitative reverse transcriptase polymerase chain reaction (qRT–PCR) analysis gene expression using gene-specific primers (Table 1). Results were normalized to 18S rRNA (see Methods, above). The graphs depict mean ± SEM levels of mRNA measured in five mice per group. Inter-group comparisons were made using Student’s t-tests. Significant inter-group differences are indicated with P-values above the bars.

IRS-1, IRS-2 and IRS-4 mRNAs were measured because their roles in relation to insulin- and IGF-stimulated signaling of growth and metabolism are non-overlapping. In this regard, genetic depletion of IRS-1 impairs liver and body growth, whereas IRS-2 depletion causes liver insulin resistance³⁴ and IRS-4, which lacks a major role in the normal adult liver (note the low levels of its mRNA), is significantly upregulated with liver regeneration and in HCC.^3,35-38 In wt mice, IRS-2 was the most abundant of the IRS transcripts, followed by IRS-1 and then IRS-4 (Fig. 2g-i). Chronic ethanol exposure did not significantly alter the mean levels of IRS-1, IRS-2 or IRS-4 mRNA in wt liver.

Effects of chronic ethanol feeding on genes in the WNT–FZD pathway

In addition to increased signaling through the insulin/IGF/IRS pathways, HCC is associated with increased activation of the WNT/FZD pathway, even in the absence of mutations in axin or its effector, β-catenin.^39-42 The WNT–FZD signaling pathways are also relevant because they mediate cell growth and motility,⁴³ which are critical for expansion and progression of malignant neoplasms. In preliminary studies, we determined that the WNT-1, WNT-3, FZD-3 and FZD-7 isoforms were expressed in the liver. In wt control mice, WNT-1 was more abundantly expressed than WNT-3, and FZD-7 was more abundantly expressed than FZD-3 (Fig. 3). Chronic ethanol feeding had no significant effect on the mean levels of any of the WNT or FZD genes studied (Fig. 3).

Figure 3.

Effects of chronic ethanol feeding on hepatic mRNA expression of: (a) WNT-1, (b) WNT-3, (c) Frizzled 3 (FZD-3) and (d) FZD-7 as demonstrated using quantitative reverse transcriptase polymerase chain reaction (qRT–PCR) analysis (see Fig. 2 legend). The graphs depict mean ± SEM levels of mRNA measured in five mice per group. Inter-group comparisons were made using Student’s t-tests.

Effects of ethanol on downstream gene expression

AAH is an α-ketoglutarate-dependent enzyme that hydroxylates aspartyl and asparaginyl residues present in epidermal growth factors (EGF)-like domains of proteins such as Notch and Jagged, which have known roles in regulating cell motility.^44-46 Previous studies showed that AAH is regulated by insulin and IGF signaling through IRS-dependent pathways.^4,35,47 GAPDH is an insulin-responsive gene that regulates energy metabolism.^48,49 PCNA mediates DNA synthesis and is used as a marker of proliferative potential. The qRT-PCR studies demonstrated significantly reduced PCNA expression in livers of chronic ethanol-fed mice, but similar levels of GAPDH and AAH mRNAs in control and ethanol-exposed livers (Fig. 4a-c).

Figure 4.

Effects of chronic ethanol feeding on hepatic mRNA expression of: (a) glyceraldehydes-3-phosphate dehydrogenase (GAPDH), (b) proliferating cell nuclear antigen (PCNA), (c) aspartyl–asparaginyl β hydroxylase (AAH), (d) tumor necrosis factor-alpha (TNF-α), (e) interleukin (IL)-1β and (e) IL-6, as demonstrated using quantitative reverse transcriptase polymerase chain reaction (qRT–PCR) analysis (see Fig. 2 legend). Graphs depict mean ± SEM levels of mRNA measured in five mice per group. Inter-group comparisons were made using Student’s t-tests. Significant inter-group differences are indicated with P-values above the bars.

Effects of chronic ethanol exposure on pro-inflammatory cytokines TNF-α, IL-1β and IL-6

It was of interest to determine whether the ethanol-induced hepatocellular injury and steatosis were associated with increased expression of pro-inflammatory cytokines. To address this question, TNF-α, IL-1β and IL-6 mRNA levels were measured by qRT-PCR. The studies demonstrated similar mean levels of TNF-α, IL-1β, or IL-6 mRNAs in control and ethanol-exposed livers (Fig. 4d-f).

Constitutive overexpression of hIRS-1 increases insulin and IGF signaling mechanisms in liver

Comparisons between wt and hIRS-1 Tg mouse livers and the effects of chronic ethanol feeding on liver growth, histopathology and insulin-IRS-1 signaling mechanisms have been well-characterized in previous reports.^4-6,13 Therefore, the analyses herein are focused on the new findings, particularly those pertaining to the effects of ethanol as a cofactor in the pathogenesis of HCC. Comparing wt to hIRS-1 controls, constitutive overexpression of hIRS-1 significantly increased mRNA levels of IGF-I, IGF-II, insulin, IGF-I receptor, IRS-4, WNT-1, WNT-3, FZD-3 and IL-6, and significantly reduced the hepatic mRNA levels of IGF-II receptor, insulin receptor, murine IRS-1, IRS-2, PCNA and FZD-7 (Table 2). Therefore, constitutive overexpression of IRS-1 in the liver resulted in increased expression of several growth factor and signaling pathways mediating growth, energy metabolism and inflammation.

Table 2.

Comparison of growth pathway gene expression levels^† in wild-type and IRS-1 transgenic mice livers

Gene	Wild-type	Tg-IRS-1	P-value
IGF-I	3.34 ± 1.08	8.82 ± 0.62	0.0004
IGF-II	0.03 ± 0.01	0.19 ± 0.02	0.0001
Insulin	0.004 ± 0.002	0.536 ± 0.11	0.014
IGF-I R	0.49 ± 0.11	0.82 ± 0.05	0.005
IGF-II R	3.32 ± 0.48	2.66 ± 0.12	0.004
Insulin R	18.35 ± 2.13	11.67 ± 1.11	0.015
IRS-1	2.22 ± 0.23	0.84 ± 0.12	0.05
IRS-2	8.68 ± 1.42	1.48 ± 0.25	0.0001
IRS-4	0.03 ± 0.003	0.32 ± 0.03	0.0001
PCNA	17.03 ± 2.32	7.64 ± 1.10	0.0003
WNT-1	0.03 ± 0.01	0.09 ± 0.01	0.002
WNT-3	0.006 ± 0.001	0.016 ± 0.002	0.03
FZD-3	0.07 ± 0.003	0.37 ± 0.07	0.018
FZD-7	1.45 ± 0.26	0.73 ± 0.06	0.0005
TNF-a	0.02 ± 0.01	0.03 ± 0.01	NS
IL-1 β	0.18 ± 0.03	0.2 ± 0.05	NS
IL-6	0.001 ± 0.0001	0.012 ± 0.003	0.02

^†Gene expression levels were measured by quantitive reverse transcriptase polymerase chain reaction with results normalized to 18S rRNA. The values represent the mRNA/18S ratio ×10⁶. Between-group statistical comparisons were made by Student’s t-test analysis.

FZD, Frizzled homolog; IL, interleukin; IGF, insulin-like growth factor; IRS, insulin receptor substrate; PCNA proliferating cell nuclear antigen; Tg, transgenic; TNF, tumor necrosis factor; WNT, wingless integrated.

Chronic ethanol exposure enhances liver injury, steatosis, lipid peroxidation and DNA damage in hIRS-1 Tg mice

Histological sections of the control hIRS-1 Tg mice livers revealed evidence of increased cell turnover manifested by hepatocellular crowding, disorganization of the lobular architecture, anisocoria, prominent and enlarged, hyperchromatic, bi-nucleated and tetra-nucleated cells, increased nuclear-cytoplasmic ratios, conspicuous nuclear mitoses (in hepatocytes) and foci of apoptosis/necrosis (Fig. 5), consistent with previous reports.^5,13 Chronic ethanol feeding increased micro- and macrosteatosis, anisocoria, inflammation and apoptosis (Fig. 5). Immunohistochemical staining demonstrated higher levels of HNE and 8-OHdG in ethanol-fed relative to control hIRS-1 Tg livers, and increased 8-OHdG immunoreactivity in hepatic cytoplasm (Fig. 5). In addition, hepatic steatosis and HNE and 8-OHdG immunoreactivity were increased in ethanol-fed hIRS-1-Tg than in ethanol-fed wt mice.

Figure 5.

Chronic ethanol feeding causes hepatic lobular disarray with prominent steatosis, chronic inflammation, apoptosis, lipid peroxidation and DNA damage in human insulin receptor substrate (hIRS)-1 transgenic mice. hIRS-1 transgenic mice were pair-fed for 8 weeks with isocaloric liquid diets containing 0% or 24% ethanol by caloric content. (a–d) Histological sections of paraffin-embedded liver (5 mM thick) were stained with hematoxylin–eosin (HE) and examined under code. The vacuolated appearance in panel c represents diffuse microsteatosis. The arrows in panel d show focal chronic inflammation (left) and microsteatosis and individual hepatocyte drop-out (right). (e–h) Adjacent histological sections were immunostained with polyclonal antibodies to (e, g) 4-hydroxynonenol (HNE) or (f, h) 8-hydroxydeoxyguanosine (8-OHdG) to detect lipid peroxidation or DNA damage, respectively. Immunoreactivity was detected with horseradish peroxidase (HRP)-conjugated polymer and DAB substrate (brown precipitate). Sections were lightly counterstained with HE. Magnifications: a, c, ×100; b, d, ×400; e–h, ×650.

Effects of chronic ethanol feeding on insulin and IGF signaling mechanisms in hIRS-1 Tg mice livers

In control hIRS-1 Tg livers, IGF-I mRNA was most abundant, followed by insulin and then IGF-II. Chronic ethanol feeding increased the mean levels of all three growth factor mRNAs; however, the inter-group differences were statistically significant for insulin and IGF-II, but not IGF-I (Fig. 6a-c). Among the growth factor receptors, insulin receptor mRNA was most abundant, followed by IGF-II receptor and then IGF-I receptor (Fig. 6d-f). Chronic ethanol feeding had no significant effect on the mean mRNA levels of these three receptors. IRS-2 was most abundantly expressed, followed by IRS-1 (murine endogenous), and then IRS-4 (Fig. 6g-i). Chronic ethanol feeding significantly increased the mean expression of IRS-4, but had no significant effect on IRS-1 or IRS-2 mRNA levels.

Figure 6.

Effects of chronic ethanol feeding on human insulin receptor substrate (hIRS)-1 transgenic mice hepatic mRNA expression of: (a) insulin-like growth factor (IGF)-I, (b) IGF-II, (c) insulin, (d) IGF-I receptor (R), (e) IGF-IIR, (f) insulin-R, (g) IRS-1, (h) IRS-2 and (i) IRS-4. RNA extracted from the livers of hIRS-1 transgenic mice that were pair-fed with isocaloric liquid diets containing 0% or 24% ethanol (caloric content) for 8 weeks, was reverse transcribed and the cDNAs were used for quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) analysis gene expression using gene-specific primers (Table 1). The results were normalized to 18S rRNA (see Methods, above). The graphs depict mean ± SEM levels of mRNA measured in 11 mice per group. Inter-group comparisons were made using Student’s t-tests. Significant inter-group differences are indicated with P-values above the bars.

Effects of chronic ethanol feeding on WNT–FZD genes and downstream targets in hIRS-Tg mouse livers

In control hIRS-1 Tg mouse livers, WNT 1 was more abundantly expressed than WNT-3, and FZD-7 mRNA was more abundant than FZD-3 mRNA, similar to the findings in wt mice. Chronic ethanol feeding significantly increased the mean levels of both WNT-1 and FZD-7 mRNA (Fig. 7). Although the mean level of FZD-3 mRNA was also higher in ethanol-exposed relative to control livers, the difference failed to reach statistical significance. The qRT–PCR studies also demonstrated similar mean levels of PCNA and GAPDH in control and ethanol exposed livers, and significantly higher levels of AAH mRNA in the ethanol-exposed Tg-hIRS-1 livers (Fig. 8a-c).

Figure 7.

Effects of chronic ethanol feeding on human insulin receptor substrate (hIRS)-1 transgenic mice hepatic mRNA expression of: (a) wingless (WNT)-1, (b) WNT-3, (c) Frizzled 3 (FZD-3) and (d) FZD-7, as demonstrated using quantitative reverse transcriptase polymerase chain reaction (qRT–PCR) analysis (see Fig. 6 legend). The graphs depict mean ± SEM levels of mRNA measured in 11 mice per group. Inter-group comparisons were made using Student’s t-tests.

Figure 8.

Effects of chronic ethanol feeding on human insulin receptor substrate (hIRS)-1 transgenic mice hepatic mRNA expression of: (a) glyceraldehydes-3-phosphate dehydrogenase (GAPDH), (b) proliferating cell nuclear antigen (PCNA), (c) aspartyl-asparaginyl β hydroxylase (AAH), (d) tumor necrosis factor-alpha (TNF-α), (e) interleukin (IL)-1β and (e) IL, as demonstrated using quantitative reverse transcriptase polymerase chain reaction (qRT–PCR) analysis (see Fig. 6 legend). The graphs depict mean ± SEM levels of mRNA measured in 11 mice per group. Inter-group comparisons were made using Student’s t-tests. Significant inter-group differences are indicated with P-values above the bars.

Effects of chronic ethanol exposure on pro-inflammatory cytokines TNF-α, IL-1β and IL-6

The qRT–PCR studies demonstrated higher mean levels of TNF-α and IL-1α in ethanol-exposed relative to control livers, but the inter-group differences were not statistically significant. IL-6 mRNA levels were slightly reduced by chronic ethanol exposure, but the difference from control was not statistically significant (Fig. 8d-f).

DISCUSSION

THE MAJOR GOAL of this research was to investigate in vivo effects of ethanol on insulin, IGF and IRS-mediated signaling in the context of constitutive IRS-1 overexpression in liver, in order to better understand the mechanisms by which chronic ethanol exposure serves as a cofactor in the pathogenesis of HCC. The results showed that chronic ethanol feeding caused liver injury characterized by hepatic steatosis, inflammation and apoptosis, and that the degrees of ethanol-mediated liver injury and impairment of DNA synthesis were greater in Tg-hIRS-1 than in wt mice. The associated increases in IGF-I/IGF-I receptor gene expression in ethanol-exposed Tg-hIRS-1 livers may represent a robust/compensatory response to the greater severities of DNA damage and impaired DNA synthesis. Correspondingly, downstream genes responsive to insulin, IGF-I and IGF-II, namely AAH and GAPDH (data not shown), were also significantly upregulated in livers of Tg-hIRS-1 mice, similar to the findings in HCC.

Contribution of hIRS-1 overexpression to the premalignant phenotype

Constitutive overexpression of hIRS-1 in the liver increased hepatocellular disarray, apoptosis, DNA damage and mRNA levels of insulin, IGF-I and IGF-II polypeptides, receptors and IRS1, 2 and 4. The multi-pronged increases in the expression of genes that mediate growth correspond with the increased levels of PCNA detected herein, and the persistently increased DNA synthesis and cell turnover previously described in this model.^4,5,10,13 At the same time, the increased expression of IL-6 in the Tg-IRS-1 livers provides supportive evidence for a pro-inflammatory/injury effect of constitutive IRS-1 overexpression in liver. The aggregate results suggest that a key mechanism of persistent hepatocellular proliferation vis-à-vis ongoing DNA damage as occurs in HCC^35,50,51 is constitutive overexpression of IRS-1. The finding of increased WNT-1, WNT-3 and FZD-3 mRNA levels in Tg-hIRS-1 livers indicates that the pro-growth signaling would be transmitted downstream through these additional pathways, which also mediate motility, energy metabolism and cell survival. Moreover, the upregulated expression of IRS-4, WNT and FZD genes, which are primarily expressed during normal development^{3,34,43,52-54} but reactivated in HCC,^35,41 provides further evidence that constitutive overexpression of IRS-1 in liver promotes a premalignant phenotype.

Role of chronic ethanol feeding in gene expression and hepatocellular injury related to HCC

Chronic ethanol feeding produced liver injury with conspicuously increased levels of HNE and 8-OHdG immunoreactivity. Therefore, chronic ethanol exposure increased lipid peroxidation and DNA damage in the liver. DNA damage is a consistent feature in HCC pathogenesis. The significantly increased mean level of IGF-I and IGF-I receptor mRNA transcripts in ethanol-exposed livers is of interest because: (1) this response could represent a compensatory effort to help preserve insulin and IGF-I-dependent signaling; and (2) increased signaling through IGF receptors is a consistent feature in human HCCs.^35,51 Despite increased IGF-I/IGF-I receptor expression, PCNA mRNA levels were significantly reduced, indicating impaired DNA synthesis despite the potential for increased activation of growth promoting pathways in ethanol-exposed livers. No significant alterations in WNT/FZD signaling mechanisms were produced by chronic ethanol exposure alone. In essence, the overall major contribution of chronic ethanol exposure to hepatocellular transformation is to increase DNA damage and increase potential for signaling through IGF-I receptor, which mediates cellular proliferation.

Evidence of synergy between hIRS-1 overexpression and chronic ethanol feeding in HCC pathogenesis

Chronic ethanol feeding produced greater severities of liver injury and conspicuously higher levels of HNE and 8-OHdG immunoreactivity in hIRS1 Tg versus wt mice. In this regard, livers of ethanol-fed hIRS1-Tg mice exhibited disorganization of the lobular architecture, marked variability in hepatocellular morphology and conspicuous macro- and microsteatosis, apoptosis and inflammation. However, the absence of dysplasia or tumor formation suggests that, even with chronic ethanol exposure as a “second hit,” constitutive overexpression of IRS-1 in the liver is not sufficient to cause hepatocellular transformation, as occurs in other Tg models, for example double overexpression of hepatitis B virus X gene with c-myc. ⁴² In addition to increased liver injury, the hIRS-1 + ethanol fed group had significantly higher hepatic mRNA levels of insulin, IGF-II, IRS-4, WNT-1, FZD-7 and AAH relative to all other groups, similar to the findings in HCC.^35,41-43 Moreover, the combined effects of increased liver injury with lipid peroxidation, DNA damage and pro-growth signaling through both IRS and WNT-FZD pathways are consistent features of HCC. The finding that hIRS-1 overexpression increased both WNT-1 and FZD-7 expression relative to wt livers, and that chronic ethanol exposure further increased the mRNA levels of these genes in hIRS-1 Tg livers, suggests that IRS-1 overexpression and chronic alcohol abuse can act synergistically to increase WNT/β-catenin signaling, as occurs in HCC.

The importance of the finding that chronic ethanol exposure increases expression of WNT-1 and FZD-7 in hIRS-1 Tg livers is that the canonical WNT/FZD/β-catenin signaling pathway, which has a crucial role in regulating cell fate and tissue patterning during development, is also frequently dysregulated in both malignant and preneoplastic states.^40,50,55,56 Ordinarily, glycogen synthase kinase 3β (GSK-3β) constitutively phosphorylates and thereby targets β-catenin for degradation through the ubiquitin-mediated proteosomal pathway. However, upregulation of WNT results in phosphorylation and inactivation of GSK-3β, and attendant destabilization of the CK1-β-catenin-axin-APC (adenomatous polyposis coli)-GSK-3β pentameric regulatory complex, leading to β-catenin accumulation and subsequent gene activation⁵⁷ through nuclear translocation and binding of β-catenin to the TCF/LEF-1 family of transcription factors.⁵⁴ Upregulation of WNT-1 in the hIRS-1 + ethanol exposure group is of further interest, given the probable role of WNT-1 in oval cell activation^58,59 and, in general, WNT signaling of stem cell renewal.⁶⁰ The relevance of these points to the overall discussion is that hepatic oval cells can be tumorigenic⁶¹ and some HCCs are thought to originate from oval stem cell populations.⁶² Consequences of increased WNT signaling include increased expression of c-myc and cyclin D1,⁶³ which promote cell cycle progression and growth.

Previous studies showed that AAH is overexpressed in the majority of HCCs,³⁵ and regulated by insulin and IGF signaling through IRS-dependent pathways;^35,47 and overexpression of AAH is sufficient to promote cellular transformation.⁶⁴ The results herein show that in the context of hIRS-1 overexpression in the liver, chronic ethanol exposure significantly increases AAH mRNA expression, whereas in the absence of hIRS-1 overexpression, ethanol does not increase AAH expression. Given the demonstrated role of AAH in relation to cell motility,^4,35,65,66 and the fact that cell motility is required for tissue remodeling after injury, the markedly disordered lobular architecture observed in the ethanol-exposed livers may have been partly due to significantly increased levels of AAH expression and associated increased capacity for hepatocellular proliferation. Note that disordered lobular architecture is a feature of premalignancy in the liver.

Together, the results suggest that chronic alcohol abuse serves as a cofactor in the pathogenesis of HCC when a premalignant state is established, such as constitutive overexpression of hIRS-1 in which hepatocellular turnover and DNA damage are increased.^4,5 Since similar states exist with chronic hepatitis B or C virus infection, these disease processes may also act synergistically with chronic alcohol abuse to promote hepatocellular transformation. The findings herein could also be interpreted to indicate that molecular analysis of liver biopsy specimens to detect “signature” increases in the expression of insulin, IGF-II, IRS-4, AAH, WNT-1 and FZD-7 may aid in the prediction of individuals at increased risk for developing HCC.