Appendix 1—key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Total OXPHOS Rodent WB Antibody Cocktail (Mouse monoclonal) | Abcam | Cat# ab110413, RRID:AB_2629281 | (1:1000) |
| Antibody | anti-GAPDH (Mouse monoclonal) | Millipore Sigma | Cat# MAB374, RRID:AB_2107445 | (1:5000) |
| Antibody | MCU (D2Z3B) (Rabbit monoclonal) | Cell Signaling Technologies | Cat# 14997, RRID:AB_2721812 | (1:2000) |
| Antibody | α-Tubulin (DM1A) (Mouse monoclonal) | Cell Signaling Technologies | Cat# 3873, RRID:AB_1904178 | (1:5000) |
| Antibody | NFAT1 Antibody (Rabbit polyclonal) |
Cell Signaling Technologies | Cat# 4389, RRID:AB_1950418 | (1:1000) |
| Antibody | NFAT1 (D43B1) XP (Rabbit monoclonal) (Alexa Fluor 488 Conjugate) | Cell Signaling Technologies | Cat# 14324, RRID:AB_2798450 | (1:50) |
| Antibody | NFAT2 (D15F1) (Rabbit monoclonal) | Cell Signaling Technologies | Cat# 8032, RRID:AB_10829466 | (1:1000) |
| Antibody | Phospho-CREB (Ser133) (87G3) (Rabbit monoclonal) | Cell Signaling Technologies | Cat# 9198, RRID:AB_2561044 | (1:1000) |
| Antibody | CREB (86B10) (Mouse monoclonal) | Cell Signaling Technologies | Cat# 9104, RRID:AB_490881 | (1:1000) |
| Antibody | IRDye 680RD Goat anti-Mouse IgG antibody | LI-COR Biosciences | Cat# 925–68070, RRID:AB_2651128 | (1:10,000) |
| Antibody | IRDye 800CW Donkey anti-Rabbit IgG antibody | LI-COR Biosciences | Cat# 926–32213, RRID:AB_621848 | (1:5000) |
| Antibody | anti-Orai1 (Rabbit polyclonal) | Feske Lab | (1:200) | |
| Antibody | Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 | Thermo Fisher Scientific | Cat# A-21244, RRID:AB_2535812 | (1:1000) |
| Antibody | AffiniPure F(ab')₂ Fragment Goat Anti-Mouse IgM, µ chain specific (Goat polyclonal) | Jackson ImmunoResearch | Cat# 115-006-020 | (20 ug/mL) |
| Antibody | Rabbit anti-Mouse IgG (H&L) - Affinity Pure | Tonbo Biosciences | Cat# 70–8076 M002 | (10 ug/mL) |
| Antibody | InVivoMAb anti-mouse CD40 FGK4.5/FGK45 (Rat monoclonal) | Bio X Cell | Cat# BE0016-2 | (10 ug/mL) |
| Antibody | Brilliant Violet 605 anti-mouse/human CD45R/B220 Antibody (Rat monoclonal) | Biolegend | Cat# 103243 | (1:200) |
| Antibody | PE/Cyanine5 anti-mouse CD86 Antibody (Rat monoclonal) | Biolegend | Cat# 105015 | (1:100) |
| Antibody | PE/Cyanine7 anti-mouse I-A/I-E Antibody (Rat monoclonal) | Biolegend | Cat# 107629 | (1:800) |
| Antibody | CD3e Monoclonal Antibody (145–2 C11), PE (Hamster monoclonal) | Thermo Fisher Scientific | Cat# 12-0031-82 | (1:200) |
| Antibody | V500 Rat anti-Mouse CD8a (Rat monoclonal) | BD Biosciences | Cat# 560776 | (1:200) |
| Antibody | BB700 Rat Anti-Mouse CD4 (Rat monoclonal) | BD Biosciences | Cat# 566408 | (1:200) |
| Antibody | APC Rat Anti-Mouse CD24 (Rat monoclonal) | BD Biosciences | Cat# 562349 | (1:200) |
| Antibody | FITC Rat Anti-Mouse CD23 (Rat monoclonal) | BD Biosciences | Cat# 553138 | (1:200) |
| Antibody | IgM Monoclonal Antibody (eB121-15F9) (Rat monoclonal) | Thermo Fisher Scientific | Cat# 12-5890-82 | (1:200) |
| Antibody | CD93 (AA4.1) Monoclonal Antibody (AA4.1), APC (Rat monoclonal) | Thermo Fisher Scientific | Cat# 17-5892-82 | (1:200) |
| Antibody | PE/Cyanine5 Streptavidin | Biolegend | Cat# 405205 | (1:200) |
| Antibody | Pacific Blue anti-mouse/human CD45R/B220 Antibody (Rat monoclonal) | Biolegend | Cat# 103230 | (1:200) |
| Cell line (Mus musculus) | A20 | ATCC | ATCC Cat# TIB-208, RRID:CVCL_1940 | |
| Chemical compound, drug | FK506 | STEMCELL Technologies | Cat# 74152 | |
| Chemical compound, drug | CRAC Channel Inhibitor IV, GSK-7975A | Sigma Aldrich | Cat# 5343510001 | |
| Chemical compound, drug | 2-APB | Tocris Bioscience | Cat# 1224 | |
| Chemical compound, drug | Thapsigargin | Thermo Fisher Scientific | Cat# T7458 | |
| Chemical compound, drug | 5 (6)-CFDA, SE; CFSE (5-(and-6)-Carboxyfluorescein Diacetate, Succinimidyl Ester), mixed isomers | Thermo Fisher Scientific | Cat# C1157 | |
| Chemical compound, drug | Gadolinium(III) Chloride | ACROS Organics | Cat# AC383560050 | |
| Commercial assay or kit | cDNA Reverse Transcription Kit | Applied Biosystems | Cat# 4368814 | |
| Commercial assay or kit | Seahorse XF Cell Mito Stress Test Kit | Agilent Technologies | Cat# 103015–100 | |
| Commercial assay or kit | Pierce Rapid Gold BCA Protein Assay Kit | Thermo Fisher Scientific | Cat# A53225 | |
| Commercial assay or kit | Tetramethylrhodamine, Ethyl Ester, Perchlorate (TMRE) |
Thermo Fisher Scientific | Cat# T669 | |
| Commercial assay or kit | MitoTracker Green FM - Special Packaging | Thermo Fisher Scientific | Cat# M7514 | |
| Commercial assay or kit | Cell Line Nucleofector Kit V | Lonza | Cat# VCA-1003 | |
| Commercial assay or kit | StrataClone Blunt PCR Cloning Kit | Agilent Technologies | Cat# 240207 | |
| Commercial assay or kit | EasySep Mouse B Cell Isolation Kit | STEMCELL Technologies | Cat# 19854 | |
| Commercial assay or kit | eBioscience Foxp3 /Transcription Factor Staining Buffer Set | Thermo Fisher Scientific | Cat# 00-5523-00 | |
| Commercial assay or kit | RNeasy Mini Kit | Qiagen | Cat# 74106 | |
| Commercial assay or kit | LIVE/DEAD Fixable Near-IR Dead Cell Stain Kit | Thermo Fisher Scientific | Cat# L34975 | |
| Recombinant DNA reagent | pSpCas9(BB)–2A-GFP (PX458) | Addgene | Cat# 48138 | |
| Recombinant DNA reagent | pU6-(BbsI)_CBh-Cas9-T2A-mCherry | Addgene | Cat# 64324 | |
| Genetic Reagent (Mus musculus) | B6.C(Cg)-Cd79atm1(cre)Reth/EhobJ | Jackson Laboratory | Strain #:020505 RRID:IMSR_JAX:020505 | Mb1-Cre on C57BL/6 |
| Genetic Reagent (Mus musculus) | Orai1fl/fl | Ahuja et al., 2017 PMID:28273482 | ||
| Genetic Reagent (Mus musculus) | Orai3fl/fl |
Gammons et al., 2021
PMID:33849280 |
||
| Genetic Reagent (Mus musculus) | Orai1fl/fl Mb1cre/+ | This paper | Orai1fl/fl mice crossed with Mb1-Cre on C57BL/6 | |
| Genetic Reagent (Mus musculus) | Orai3fl/fl Mb1cre/+ | This paper | Orai3fl/fl mice crossed with Mb1-Cre on C57BL/6 | |
| Genetic Reagent (Mus musculus) | Orai1/Orai3fl/fl Mb1cre/+ | This paper | Orai1/Orai3fl/fl mice crossed with Mb1-Cre on C57BL/6 | |
| Chemical compound, drug | Fura-2, AM, cell permeant | Thermo Fisher Scientific | Cat# F1221 | |
| Other | SYBR Select Master Mix | Thermo Fisher Scientific | Cat# 4472920 | Master mix for qRT-PCR |
| Other | Lipopolysaccharides from Escherichia coli O111:B4 |
Sigma Aldrich | Cat# L2630-10MG | Stimulation of primary B lymphocytes |
| Other | Intercept (TBS) Blocking Buffer | LI-COR Biosciences | Cat# 927–60001 | Western blot blocking buffer |
| Other | Halt Protease and Phosphatase Inhibitor | Thermo Fisher Scientific | Cat# PI78443 | Western blot lysis buffer component |
| Other | RIPA Buffer | Sigma Aldrich | Cat# R0278-50ML | Western blot lysis buffer component |
| Other | DAPI | Sigma Aldrich | Cat# D9542 | Nuclear localization staining for ImageStream |
| Other | EasySep Buffer | STEMCELL Technologies | Cat# 20144 | B cell isolation kit buffer |
| Other | NuPAGE 4 to 12%, Bis-Tris, 1.0–1.5 mm, Mini Protein Gels | Thermo Fisher Scientific | Cat# NP0321BOX | Western blot denaturing gels |
| Other | Poly-L-lysine solution | Sigma Aldrich | Cat# P4832-50ML | Attachment of suspension cells to coverslips |
| Sequence-based Reagent | mOrai1n | This paper | gRNA primers for mouse Orai1 CRISPR knockout | GCCTTCGGATCCGGTGCGTC |
| Sequence-based Reagent | mOrai1c | This paper | gRNA primers for mouse Orai1 CRISPR knockout | CACAGGCCGTCCTCCGGACT |
| Sequence-based Reagent | mOrai3n | This paper | gRNA primers for mouse Orai3 CRISPR knockout | GCGTCCGTAACTGTTCCCGC |
| Sequence-based Reagent | mOrai3c | This paper | gRNA primers for mouse Orai3 CRISPR knockout | GAAGGAGGTCTGTCGATCCC |
| Sequence-based Reagent | Mb1 Cre Common Primer | This paper | PCR primers for genotyping Mb1 Cre | ACT GAG GCA GGA GGA TTG G |
| Sequence-based Reagent | Wild Type Forward Primer | This paper | PCR primers for genotyping Mb1 Cre | CTC TTT ACC TTC CAA GCA CTG A |
| Sequence-based Reagent | Mutant Forward Primer | This paper | PCR primers for genotyping Mb1 Cre | CAT TTT CGA GGG AGC TTC A |
| Sequence-based Reagent | Orai1 fl/fl Forward | This paper | PCR primers for genotyping Orai1 flox | ACC CAT GTG GTG GAA AGA AA |
| Sequence-based Reagent | Orai1 fl/fl Reverse | This paper | PCR primers for genotyping Orai1 flox | TGC AGG CAC TAA AGA CGA TG |
| Sequence-based Reagent | Orai3 fl/fl Forward | This paper | PCR primers for genotyping Orai3 flox | GAG CTG GGA TTA AAG GTG TAT GCC |
| Sequence-based Reagent | Orai3 fl/fl Reverse | This paper | PCR primers for genotyping Orai3 flox | TGA CTT CAC CTC AGT CTC AAA GGG G |
| Sequence-based Reagent | mOrai1 F | This paper | RT-PCR primers | CCA AGC TCA AAG CTT CCA GC |
| Sequence-based Reagent | mOrai1 R | This paper | RT-PCR primers | GCA CTA AAG ACG ATG AGC AAC C |
| Sequence-based Reagent | mOrai2 F | This paper | RT-PCR primers | GCAGCTACCTGGAACTCGTC |
| Sequence-based Reagent | mOrai2 R | This paper | RT-PCR primers | GTTGTGGATGTTGCTCACCG |
| Sequence-based Reagent | mOrai3 F | This paper | RT-PCR primers | ACC AAC GAC TGC ACA GAT AC |
| Sequence-based Reagent | mOrai3 R | This paper | RT-PCR primers | CCA ATG GGC ACA AAC TTG AC |
| Sequence-based Reagent | mGAPDH F | This paper | RT-PCR primers | GTG GCA AAG TGG AGA TTG TTG |
| Sequence-based Reagent | mGAPDH R | This paper | RT-PCR primers | CGT TGA ATT TGC CGT GAG TG |
| Software, algorithm | Image J | https://imagej.net/ | RRID:SCR_003070 | |
| Software, algorithm | Graphpad Prism | http://www.graphpad.com/ | RRID:SCR_002798 | |
| Software, algorithm | Leica Application Suite X | https://www.leica-microsystems.com/ | RRID:SCR_016555 | |
| Software, algorithm | Image Studio Lite | https://www.licor.com/bio/image-studio-lite/download | RRID:SCR_013715 | |
| Software, algorithm | FlowJo 9.9.6 | https://www.flowjo.com/solutions/flowjo | RRID:SCR_008520 |