Abstract
Trichloroethene (TCE), an organic solvent extensively used for degreasing metals, can cause inflammatory autoimmune disorders [i.e., systemic lupus erythematosus (SLE) and autoimmune hepatitis] from both environmental and occupational exposure. Autophagy has emerged as a pivotal pathogenic factor in various autoimmune diseases. However, role of autophagy dysregulation in TCE-mediated autoimmunity is largely unknown. Here, we investigate whether autophagy dysregulation contributes to pathogenesis of TCE-mediated autoimmune responses. Using our established mouse model, we observed TCE-treated mice had elevated MDA-protein adducts, microtubule-associated protein light chain 3 conversion (LC3-II/LC3-I), beclin-1, phosphorylation of AMP-activated protein kinase (AMPK) and inhibition of mammalian target of rapamycin (mTOR) phosphorylation in the livers of MRL+/+ mice. Suppression of oxidative stress with antioxidant N-acetylcysteine (NAC) effectively blocked TCE-mediated induction of autophagy markers. On the other hand, pharmacological autophagy induction with rapamycin significantly reduced TCE-mediated hepatic inflammation (NLRP3, ASC, Caspase1 and IL1-β mRNA levels), systemic cytokines (IL-12 and IL-17) and autoimmune responses (ANA and anti-dsDNA levels). Taken together, these results suggest that autophagy plays a protective role against TCE-mediated hepatic inflammation and autoimmunity in MRL+/+ mice. These novel findings on the regulation of autophagy could help in designing therapeutic strategies for chemical exposure-mediated autoimmune responses.
Keywords: Autophagy, trichloroethene, oxidative stress, inflammation, autoimmunity
Introduction
Trichloroethene (TCE), an industrial solvent and ubiquitous environmental pollutant, is associated with the development of various autoimmune diseases (ADs), including systemic lupus erythematosus (SLE) and autoimmune hepatitis (AIH) (Cai et al. 2008; Griffin et al. 2000; Khan et al. 1995; Khan and Wang 2019). TCE exposure happens worldwide through inhalation from the waste disposal sites or consuming contaminated drinking water, resulting in hypersensitivity and systemic inflammatory responses including SLE and hepatitis in humans (Anagnostopoulos et al. 2004; Flindt-Hansen and Isager 1987; Goon et al. 2001; Kamijima et al. 2007; Kamijima et al. 2008; Kilburn and Warshaw 1992; Pantucharoensri et al. 2004; Purdue et al. 2022). SLE is a multifactorial disease characterized by aberrant autoimmune responses against self-antigens. The cause of SLE is unknown, but genetic and environmental factors have been implicated in the disease progression (Kamen 2014; Khan and Wang 2018). Even though a number of mechanisms/pathways have been delineated in the pathogenesis of TCE-mediated SLE disease, including systemic oxidative stress, apoptosis, reduced clearance of apoptotic bodies, inflammasome activation (Wang et al. 2008; Wang et al. 2019a; Wang et al. 2018; Wang et al. 2019b), imbalances in NRF2/NF-kB/MAPK activation (Banerjee et al. 2021; Banerjee et al. 2020), yet there are still significant knowledge gaps regarding specific mechanisms, especially the contribution of autophagy.
Autophagy is an evolutionarily conserved biological process that degrades intracellular proteins and organelles via the formation of autophagosomes which fuse with lysosomes to form mature autolysosomes (Gan and Zhou 2022; Mizushima 2007). Autophagy can regulate core inflammatory responses (e.g., inflammasome activation, interferon production and cytokine maturation) and contribute to efferocytosis, antigen presentation, T cell maturation, B cell survival, regulation of antibody production, and eventually could lead to AD progression (Deretic et al. 2013; Levine et al. 2011; Yin et al. 2018). Genome-wide association studies have linked several autophagy-related genes (ATG5, CDKN1B, ATG7, MAP1LC3B and ATG16L2) to SLE susceptibility (Dang et al. 2016; Qi et al. 2019). Perturbations in autophagy-associated genes, such as Atg5 gene deficiency, play an important role in the regulation of negative thymic selection, pro-inflammatory cytokine production and clearance of dying cells (Ye et al. 2018). Notably, autophagy is considered as a critical pathological factor in SLE by regulating immune system (Clarke et al. 2015). Despite a number of other mechanistic discoveries (Banerjee et al. 2020; Wang et al. 2015; Wang et al. 2020; Wang et al. 2021), the regulation and contribution of autophagy in TCE-mediated autoimmunity remains elusive.
Although autophagy has been considered as a potential contributory mechanism and also therapeutic target in ADs, chemicals and drugs seem to show different responses on autophagy modulation compared to conventional responses observed in human SLE (Chao et al. 2018; Clarke et al. 2015; Ni et al. 2012; Ni et al. 2016), and require thorough investigation of specific mechanisms. Rapamycin, an FDA approved immunosuppressive agent and also a key inducer of autophagy, is known to efficiently inhibit lupus flare in mice and patients (Oaks et al. 2016; Song et al. 2021). On the other hand, the most commonly used SLE drug, hydroxychloroquine, can in fact inhibit autophagy (Ponticelli and Moroni 2017). A growing body of evidence suggests that exposure to chemicals and drugs, such as ethanol and acetaminophen, can induce autophagy dysregulation. In these models, pharmacological inhibition of autophagy exacerbated hepatotoxicity, conversely, promotion of autophagy alleviated liver injuries (Chao et al. 2018; Ni et al. 2012; Ni et al. 2016). Furthermore, studies identified a key role for the transcription factors EB in autophagy and lysosomal biogenesis during the development of alcohol-induced hepatitis and pancreatitis (Chao et al. 2018; Wang et al. 2019c). Thus, status and regulation of autophagy in a chemical-mediated autoimmune response will lead to emergence of a novel molecular mechanism in the pathogenesis of SLE, identify targets and help in devising strategies for rational therapeutic intervention.
We have clearly established that oxidative stress (OS) is an important contributor to TCE-mediated inflammatory and autoimmune response, and OS could also be critical for autophagy and inflammation (Filomeni et al. 2015; Wang et al. 2013b). We have consistently shown that TCE exposure via drinking water in our established mouse model (MRL+/+) results in OS, inflammasome activation and inflammation (Banerjee et al. 2020; Wang et al. 2015; Wang et al. 2020; Wang et al. 2019b). Our findings have led us to hypothesize that TCE exposure results in autophagy dysregulation, resulting in pro-inflammatory response that contributes to disease pathogenesis. Results of this investigation provide evidence that chronic TCE exposure leads to dysregulation of autophagy and mammalian target of rapamycin (mTOR)/AMP-activated protein kinase (AMPK) signaling pathways. More importantly, modulation of autophagy by rapamycin markedly attenuated TCE-mediated inflammation and autoimmune responses. Our studies, apart from delineating the mechanistic role of autophagy in TCE-mediated ADs, also provide valuable therapeutic option of controlling ADs via targeting autophagy.
Materials and methods:
Animals
Five-week old female MRL+/+ mice were purchased from the Jackson Laboratory (Bar Harbor, ME) and maintained under specific pathogen-free facility and acclimatized for one week prior to any treatment. All animal research protocols were approved by the Institutional Animal Care and Use Committee of the University of Texas Medical Branch at Galveston (UTMB). All animal experiments are complied with the Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines and carried out in accordance with the National Research Council’s Guide for the Care and Use of Laboratory Animals.
Experimental design
We used three different approaches to: i) demonstrate autophagy responses during SLE disease, ii) provide evidence that antioxidant plays a role in autophagy regulation, and iii) establish that induction of autophagy provides protection against TCE-mediated autoimmunity. Approach 1: Groups of female MRL+/+ mice were treated with 0.5 mg/ml TCE (~50 mg/kg/day, Sigma, St. Louis, MO), dissolved in drinking water containing 1% Alkamuls EL-620 emulsifier, ad-libitum for 52 weeks, an experimental condition known to induce SLE-like disease in MRL+/+ mice (Cai et al. 2008; Wang et al. 2021); controls received drinking water containing 1% Alkamuls EL-620 emulsifier only. TCE exposure via drinking water averaged 40–50 mg/kg/day and is lower than the Permissible Exposure Limit [established by the Occupational Safety and Health Administration (OSHA)] for TCE of approximately 76 mg/kg/day (Gilbert et al. 2016). Approach 2: To evaluate the role of OS in TCE-mediated autophagy regulation, groups of mice were treated with TCE along with or without antioxidant N-acetylcysteine (NAC) for 6 weeks [TCE, 1.3 g/kg (10 mmol/kg), i.p., every 4th day; NAC, 250 mg/kg/day via drinking water] (Wang et al. 2019b). Approach 3: In this set of experiment involving rapamycin-mediated autophagy modulation, mice were divided into four groups: control group (CON), TCE alone (TCE), TCE along with rapamycin (TR), and rapamycin alone (R) group [TCE, 1.3 g/kg (10 mmol/kg), in corn oil, i.p., every fourth day; rapamycin (Sigma-Aldrich), 2 mg/kg in corn oil; i.p., every other day] (Ni et al. 2012). Liver tissues obtained following various treatments were stored at −80°C for further analysis. Sera obtained from blood samples were stored in small aliquots at −80°C until further analysis.
Enzyme-linked immunosorbent assays (ELISAs) and Bio-Plex assay
Serum autoantibodies were determined by using mouse-specific ELISA kits for antinuclear antibodies (ANA) and anti-dsDNA antibodies (Alpha Diagnostic Int’l, San Antonio, TX) (Wang et al. 2015; Wang et al. 2019b). MDA-protein adducts in the liver tissues were analyzed according to our earlier published ELISA method (Wang et al. 2008; Wang et al. 2012a; Wang et al. 2012b). Serum cytokines were determined using Cytokine 17-Plex Mouse ProcartaPlex Panel (Invitrogen, Carlsbad, CA) by following the manufacturer’s instructions.
Quantitative reverse transcriptase PCR (qRT-PCR) analysis
RNA was extracted from liver samples using RNeasy mini kit followed by treatment with Qiagen DNase I (Qiagen, Hilden, Germany). cDNA was prepared using iScript reverse transcription supermix (Bio-Rad, Hercules, CA). qPCR was performed using universal SYBR green supermix kit (Bio-Rad) on a Bio-Rad CFX96 real-time PCR machine. The mRNA expression of selected genes related to inflammasome activation were analyzed. The primer sequences for the genes analyzed are as follows:
NLRP3: F5′ATGCTGCTTCGACATCTCCT3′, R5′AACCAATGCGAGATCCTGAC3’;
ASC: F5′CTTGTCAGGGGATGAACTCAAAA3′, R5′GCCATACGACTCCAGATAGTAGC3’;
Caspase-1: F 5′AGATGGCACATTTCCAGGAC3′, R5′GATCCTCCAGCAGCAACTTC3’;
IL-1β: F5′CAGGCAGGCAGTATCACTCA3′, R 5′AGGCCACAGGTATTTTGTCG3’.
Mouse glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the housekeeping reference gene. The reference genes (18S RNA, actin and GAPDH) were determined for the reference gene stability (Suppl. Table1).
Western blot analysis
Liver tissues were homogenized in T-PER lysis buffer containing 1% protease inhibitor cocktail (Sigma) and protein concentration was determined by Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA). Western blot analysis was done to analyze autophagy markers and related proteins. Briefly, 10 μg protein per lane was loaded onto 4–15% Tris-glycine gradient gel (Thermo Fisher Scientific) and transferred to PVDF membrane. The membrane was blotted with primary antibodies at 4°C overnight. Antibody detection was accomplished using horseradish peroxidase conjugated secondary antibodies and visualized with ECL (Wang et al. 2019b). The signal intensity was quantified with Image J.
Statistical analysis
Statistical analysis was performed using GraphPad Prism software 7.0 (GraphPad, La Jolla, CA). Data shown are means ± SEM, and were analyzed using the two-tailed Student’s t test when comparison was made between two groups. One-way analysis of variance (ANOVA) followed by Tukey-Kramer test was used for multiple group comparisons. The p values <0.05 were considered to be statistically significant. *p < 0.05; **p < 0.01.
Results:
TCE exposure induced hepatic autophagy/mTOR/AMPK dysregulation in MRL +/+ mice
Autophagy activation has been reported as a contributory factor in human SLE and other ADs (Feng et al. 2018; Qi et al. 2019). Autophagy dysregulation is also known to play a significant role in acetaminophen and alcohol induced liver injuries (Chao et al. 2018; Ni et al. 2016). Here, we first examined autophagy modifications in MRL+/+ mice after a chronic (52W) and occupationally relevant dose of TCE exposure, which is associated with AD manifestations (Cai et al. 2008; Wang et al. 2021). Consistent with earlier findings (Wang et al. 2008; Wang et al. 2012b), TCE exposure led to significantly increased malondialdehyde (MDA)-protein adducts in the liver tissue, indicating increased OS. Interestingly, TCE exposure markedly increased beclin-1 and LC3II (standard markers for autophagosomes) but reduced autophagy-related 16 (Atg16) levels, suggesting that TCE exposure induces autophagy dysregulation (Fig. 1). Autophagy is promoted by AMPK, and conversely inhibited by mTOR (Kim et al. 2011). We observed significantly elevated p-AMPK and reduced p-mTOR levels in TCE-exposed liver tissues (Fig. 1), further supporting the contribution of these pathways in TCE-mediated autophagy dysregulation. Taken together, low dose chronic TCE exposure induced OS and autophagy dysregulation in the livers.
Fig. 1.

Chronic TCE exposure modified hepatic lipid peroxidation and autophagy-related signaling pathways in female MRL+/+ mice. Mice were exposed to TCE (50 mg/kg) in drinking water for 52 weeks, and liver tissues were evaluated for oxidative stress and autophagy-related markers. A. Malondialdehyde (MDA)-protein adducts in the livers of CON and TCE-exposed mice. B. Autophagy markers in the liver tissues; each Western blot lane represents one animal. C. Quantification of the signal intensity of the Western blot bands. N=5 in control group; N=6 in TCE group; *p<0.05; **p<0.01.
TCE-mediated oxidative stress contributes to autophagy dysregulation
Autophagy has been reported to be associated with excessive ROS production (Filomeni et al. 2015), and ROS/OS are major contributors in TCE-mediated autoimmune responses (Wang et al. 2015; Wang et al. 2012b; Wang et al. 2019b). To test whether ROS is a key mediator of autophagy dysregulation, we conducted our well-established short-term TCE exposure studies for mechanistic investigations (Wang et al. 2013a; Wang et al. 2019b). Consistent with chronic studies, short-term TCE exposure also led to significantly increased hepatic autophagy marker LC3II levels, and this response was attenuated in antioxidant NAC only group (Fig. 2). However, NAC treatment exhibited slight amelioration of TCE-induced LC3II (statistically not significant). Interestingly, beclin-1 (an essential mediator of autophagy initiation) was significantly reduced in the livers of NAC+TCE-treated mice (Fig. 2). These results suggest that OS is a significant contributor of TCE-mediated autophagy dysregulation. The NAC-mediated modification of TCE-induced autophagy responses are also in agreement and supportive of a diminished inflammasome (NLRP3) activation and reduced levels of autoantibodies reported earlier (Wang et al. 2019b).
Fig. 2.

TCE-mediated hepatic autophagy dysregulation was blocked by antioxidant NAC. Mice were treated with TCE w/wo NAC, and designated as CON (C), TCE (T), NAC (N) or NAC + TCE (NT) groups. A. Representative Western blot for autophagy flux in the liver tissues from C, T, N and NT mice. B. Densitometry of LC3II and beclin-1 protein bands. N=5 in each group. # p<0.1; *p<0.05; **p<0.01.
Modulation of autophagy by specific activator (Rapamycin) and its impact on TCE-mediated hepatic inflammasome activation
Previous studies have shown that rapamycin improves inflammation and SLE disease activity by normalizing T cell activities (Fernandez et al. 2006; Song et al. 2021). Therefore, we investigated if rapamycin treatment could provide protection against TCE-mediated inflammatory responses in MRL+/+ mice. Although TCE exposure only showed increasing trend for LC3II and p-AMPK levels (probably due to different route and duration of exposure), it was observed that rapamycin treatment exacerbated TCE-mediated autophagy modifications, as evident from further increases in Beclin-1 and LC3II levels (Fig. 3). The rapamycin-induced autophagic responses were clearly associated with markedly attenuated TCE-induced liver inflammation, evidenced by decreased inflammasome markers (NLRP3, caspase1, ASC and IL-1β) in the liver tissues of TR group compared to TCE-exposed mice (Fig. 4). These results provide strong evidence and support that rapamycin could reduce the hepatic inflammasome activation and inflammatory response by further inducing the TCE-mediated autophagy.
Fig. 3.

Modulation of autophagy by its activator (rapamycin) in TCE-mediated autoimmunity. Mice were exposed to TCE w/wo rapamycin, and named as CON, TCE, TR and R groups. A. Autophagy markers in the liver tissues; each Western blot lane represents one animal. B. Densitometry of LC3II, beclin-1, p62, p-mTOR and p-AMPK protein bands. N=3 in CON and R groups, N=4 in TCE and TR groups. # p<0.1; *p<0.05; **p<0.01.
Fig. 4.

Rapamycin treatment led to reduction in TCE-mediated hepatic inflammasome activation. Liver tissues were used for RNA extraction followed by cDNA synthesis. mRNA levels of hepatic inflammasome markers were determined. N=4 in each group. *p<0.05 and **p<0.01.
Activation of autophagy attenuates TCE-mediated inflammation and autoimmune response
We further analyzed the serum pro-inflammatory cytokines and autoimmune markers [anti-nuclear antibodies (ANA) and anti-dsDNA antibodies] to determine the protective effect of rapamycin in TCE-mediated autoimmune responses. Remarkably, rapamycin treatment in MRL+/+ mice led to significant reductions in IL-12, ANA and anti-dsDNA levels compared to control MRL+/+ mice. Consistent with our earlier findings (Banerjee et al. 2020; Wang et al. 2020; Wang et al. 2019b), TCE exposure induced inflammatory and autoimmune responses, evidenced by increased IL-12, IL-17, ANA and anti-dsDNA levels. Remarkably, rapamycin treatment effectively reduced TCE-mediated induction of cytokines and autoantibodies (Fig. 5 and 6). Our data, thus, suggest that autophagy induction provides a protective effect in TCE-induced inflammation and autoimmunity.
Fig. 5.

Rapamycin treatment provided protection against TCE-mediated autoimmune responses. Using sera from control, TCE-treated, TCE + rapamycin-treated and rapamycin alone mice, we determined: (A) Antinuclear antibodies, (B) Anti-dsDNA antibodies. N=8 in control and TCE-treated group, N=7 in TR group, N=5 in R group. *p<0.05; **p<0.01.
Fig. 6.

Modulation of TCE-induced inflammatory response (cytokines) by rapamycin. Serum levels of IL-12 (A) and IL-17 (B) were measured. N=8 in control and TCE-treated group, N=7 in TR group, N=5 in R group. *p<0.05; **p<0.01.
Discussion
TCE exposure is associated with the induction of a number of ADs (Goon et al. 2001; Griffin et al. 2000; Khan et al. 1995; Pantucharoensri et al. 2004; Sexton et al. 2005), and OS plays a critical role in TCE-mediated inflammatory and autoimmune response (Banerjee et al. 2020; Wang et al. 2015; Wang et al. 2020; Wang et al. 2012b; Wang et al. 2019b). Autophagy, an important player in innate and adaptive immune responses, has been indicated in the pathogenesis and progression of ADs (Gan and Zhou 2022; Levine et al. 2011). Despite the potential of a number of environmental chemicals (TCE, silica, Hg, etc.) in eliciting an autoimmune response (Khan and Wang 2019), there is significant knowledge gap regarding the role of autophagy in the initiation and/or progression of chemical-induced autoimmunity/ADs. In view of its impact on immune cell functions, it is not surprising that autophagy has been considered as a potential therapeutic target for ADs (Keller et al. 2017; Weindel et al. 2017; Yin et al. 2018). Therefore, we attempted to establish if autophagy is a critical regulator of TCE-mediated autoimmunity. Here we report that chronic low-dose TCE exposure indeed induces autophagy dysregulation in the livers of MRL+/+ mice, in an experimental condition also associated with increased autoimmune response (Wang et al. 2021; Wang et al. 2019b). We also provide evidence that treatment with an antioxidant effectively inhibits TCE-induced autophagy, implicating that OS is an effective contributor to autophagy induction during stressed conditions. More importantly, attenuation of TCE-mediated autoimmunity following rapamycin treatment clearly provides evidence for a critical role of autophagy in the regulation of autoimmunity.
Autophagy, a highly conserved lysosome-mediated protein degradation process, is essential in controlling immune homeostasis. Perturbation in autophagy has been implicated in the pathogenesis of ADs, including SLE (Pierdominici et al. 2012). Autophagy activation was reported to be important in B cell survival and maturation in SLE patients (Clarke et al. 2015; Weindel et al. 2017). Studies in MRL-lpr mice revealed an association of increased autophagy with lupus nephritis (Qi et al. 2018). The amount of LC3II is usually quantified to evaluate the autophagosome formation (Mizushima and Yoshimori 2007). Our data indicated that TCE exposure led to increased formation of autophagosome, evidenced by increased beclin-1 and LC3II in the liver tissues. ATG16L1 can function as a negative regulator of the nod-like receptors (Nod1 and Nod2) and suppresses the nod-driven inflammatory cytokine responses (Sorbara et al. 2013). Here, the observed reduction in the hepatic ATG16 level could be indicative of its anti-inflammatory role in TCE-mediated autoimmunity, further strengthening the mechanistic link between autophagy dysregulation and inflammation.
Our earlier studies have shown that TCE exposure induces time-dependent increased formation of lipid peroxidation-derived aldehydes in the liver and serum (Wang et al. 2012b), and those reactive aldehydes could contribute to tissue damage and induce an inflammatory or autoimmune response (Wang et al. 2008). Our current finding of increased MDA-protein adducts in the liver after chronic TCE exposure further suggests that oxidative damage and/or oxidative modification of proteins could be a contributary factor in TCE-mediated autophagy dysregulation and inflammation. More importantly, NAC treatment markedly attenuated the TCE-mediated increases in LC3II and beclin-1 levels, implying that ROS serves as a critical trigger factor in autophagosome formation and thiol redox signaling could be an important regulator of autophagy.
The mTOR is a ubiquitous serine/threonine protein kinase and an intracellular metabolism sensor for growth factor and nutrient signals (Kim and Guan 2015). It has emerged as an important biomarker of pro-inflammatory signature of immune cells that underlies the pathogenesis of ADs (Perl 2018). AMPK is activated by low energy state, and plays an important role in autophagosome maturation and lysosomal fusion (Jang et al. 2018). Indeed, AMPK activates while mTORC1 inhibits autophagy (Kim et al. 2011). We found that TCE exposure decreased the phosphorylation of mTOR, whereas it increased the phosphorylation of AMPK in the liver tissues, suggesting that cellular energy metabolism could be a potential trigger for TCE-mediated autophagy dysregulation. These findings thus suggest a crosstalk between mTOR/AMPK and autophagy, as well as their contribution in TCE-mediated systemic inflammation and autoimmune response.
Increasing evidence suggest an inverse relationship between NLRP3 inflammasome and autophagy in various diseases (Biasizzo and Kopitar-Jerala 2020; Sun et al. 2017). Our data reveal that induction of autophagy by rapamycin markedly inhibited hepatic inflammasome activation after TCE exposure, suggesting that autophagy might act as protective mechanism in TCE-mediated inflammation. Rapamycin reduces SLE disease activity by inhibition of hyperactivated T and B cells (Fernandez et al. 2006; Perl 2018; Song et al. 2021). In fact, we also observed significantly reduced splenic immune cells in rapamycin treated group (unpublished data). In addition, the rapamycin treatment exhibited its anti-inflammatory role through marked inhibition of proinflammatory cytokines IL-12 and IL-17 levels. The exact role of autophagy induction in TCE-mediated immune cell function and cytokine production still needs further investigation. More importantly, rapamycin treatment provided protection against TCE-induced systemic autoimmune responses, evident from reduced levels of ANA and anti-dsDNA antibodies. Our findings are also in agreement with studies showing therapeutic effect of autophagy enhancement via rapamycin in animal models and SLE patients (Fernandez et al. 2006; Song et al. 2021). Our data provide a possible link between chemical-induced autophagy dysregulation and inflammatory/autoimmune responses.
In conclusion, our studies uncover the protective role of autophagy in TCE-mediated inflammation and autoimmune responses in lupus-prone MRL+/+ mice. Moreover, our studies also support that OS is a key checkpoint in the induction of autophagy and inflammasome, and there seems an inverse relationship between autophagy and inflammasome. Even though additional mechanistic studies will be needed to further evaluate the complex role of lysosomal and mitophagy activities, our studies clearly support a therapeutic role of autophagy induction in the treatment of TCE-mediated autoimmunity.
Supplementary Material
Highlights:
TCE exposure leads to increased LC3-II, phos-AMPK, and inhibition of mTOR
TCE-induced hepatic autophagy markers (Beclin-1 and LC3-II) were attenuated by NAC
Autophagy inducer rapamycin attenuated TCE-mediated hepatic NLRP3 inflammasome activation
Rapamycin inhibited systemic cytokines and autoantibodies (ANA, anti-dsDNA)
Acknowledgements
This work was supported by RO1 grants [ES016302 and ES026887] from the National Institute of Environmental Health Sciences (NIEHS), NIH. The contents are solely the responsibility of the authors and do not necessarily represent the official views of the NIEHS, NIH.
Footnotes
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Declaration of interests
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Reference
- Anagnostopoulos G, Sakorafas GH, Grigoriadis K, Margantinis G, Kostopoulos P, Tsiakos S, Arvanitidis D, 2004. Hepatitis caused by occupational chronic exposure to trichloroethylene. Acta Gastroenterol Belg 67, 355–357. [PubMed] [Google Scholar]
- Banerjee N, Wang H, Wang G, Boor PJ, Khan MF, 2021. Redox-sensitive Nrf2 and MAPK signaling pathways contribute to trichloroethene-mediated autoimmune disease progression. Toxicology 457, 152804. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Banerjee N, Wang H, Wang G, Khan MF, 2020. Enhancing the Nrf2 antioxidant signaling provides protection against trichloroethene-mediated inflammation and autoimmune response. Toxicol Sci 175, 64–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Biasizzo M, Kopitar-Jerala N, 2020. Interplay between NLRP3 inflammasome and autophagy. Front Immunol 11, 591803. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cai P, Konig R, Boor PJ, Kondraganti S, Kaphalia BS, Khan MF, Ansari GA, 2008. Chronic exposure to trichloroethene causes early onset of SLE-like disease in female MRL +/+ mice. Toxicol Appl Pharmacol 228, 68–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chao X, Wang S, Zhao K, Li Y, Williams JA, Li T, Chavan H, Krishnamurthy P, He XC, Li L, Ballabio A, Ni HM, Ding WX, 2018. Impaired TFEB-mediated lysosome biogenesis and autophagy promote chronic ethanol-induced liver injury and steatosis in mice. Gastroenterology 155, 865–879 e812. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Clarke AJ, Ellinghaus U, Cortini A, Stranks A, Simon AK, Botto M, Vyse TJ, 2015. Autophagy is activated in systemic lupus erythematosus and required for plasmablast development. Ann Rheum Dis 74, 912–920. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dang J, Li J, Xin Q, Shan S, Bian X, Yuan Q, Liu N, Ma X, Li Y, Liu Q, 2016. Gene-gene interaction of ATG5, ATG7, BLK and BANK1 in systemic lupus erythematosus. Int J Rheum Dis 19, 1284–1293. [DOI] [PubMed] [Google Scholar]
- Deretic V, Saitoh T, Akira S, 2013. Autophagy in infection, inflammation and immunity. Nat Rev Immunol 13, 722–737. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Feng Y, Li B, Li XY, Wu ZB, 2018. The role of autophagy in rheumatic disease. Curr Drug Targets 19, 1009–1017. [DOI] [PubMed] [Google Scholar]
- Fernandez D, Bonilla E, Mirza N, Niland B, Perl A, 2006. Rapamycin reduces disease activity and normalizes T cell activation-induced calcium fluxing in patients with systemic lupus erythematosus. Arthritis Rheum 54, 2983–2988. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Filomeni G, De Zio D, Cecconi F, 2015. Oxidative stress and autophagy: the clash between damage and metabolic needs. Cell Death Differ 22, 377–388. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Flindt-Hansen H, Isager H, 1987. Scleroderma after occupational exposure to trichlorethylene and trichlorethane. Acta Derm Venereol 67, 263–264. [PubMed] [Google Scholar]
- Gan T, Zhou XJ, 2022. Chapter 2 - Autophagy in autoimmunity. Translational Autoimmunity 1, 13–29. [Google Scholar]
- Gilbert KM, Blossom SJ, Erickson SW, Broadfoot B, West K, Bai S, Li J, Cooney CA, 2016. Chronic exposure to trichloroethylene increases DNA methylation of the Ifng promoter in CD4(+) T cells. Toxicol Lett 260, 1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Goon AT, Lee LT, Tay YK, Yosipovitch G, Ng SK, Giam YC, 2001. A case of trichloroethylene hypersensitivity syndrome. Arch Dermatol 137, 274–276. [PubMed] [Google Scholar]
- Griffin JM, Gilbert KM, Lamps LW, Pumford NR, 2000. CD4(+) T-cell activation and induction of autoimmune hepatitis following trichloroethylene treatment in MRL+/+ mice. Toxicol Sci 57, 345–352. [DOI] [PubMed] [Google Scholar]
- Jang M, Park R, Kim H, Namkoong S, Jo D, Huh YH, Jang IS, Lee JI, Park J, 2018. AMPK contributes to autophagosome maturation and lysosomal fusion. Sci Rep 8, 12637. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kamen DL, 2014. Environmental influences on systemic lupus erythematosus expression. Rheum Dis Clin North Am 40, 401–412, vii. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kamijima M, Hisanaga N, Wang H, Nakajima T, 2007. Occupational trichloroethylene exposure as a cause of idiosyncratic generalized skin disorders and accompanying hepatitis similar to drug hypersensitivities. Int Arch Occup Environ Health 80, 357–370. [DOI] [PubMed] [Google Scholar]
- Kamijima M, Wang H, Huang H, Li L, Shibata E, Lin B, Sakai K, Liu H, Tsuchiyama F, Chen J, Okamura A, Huang X, Hisanaga N, Huang Z, Ito Y, Takeuchi Y, Nakajima T 2008., Trichloroethylene causes generalized hypersensitivity skin disorders complicated by hepatitis. J Occup Health 50, 328–338. [DOI] [PubMed] [Google Scholar]
- Keller CW, Sina C, Kotur MB, Ramelli G, Mundt S, Quast I, Ligeon LA, Weber P, Becher B, Munz C, Lunemann JD, 2017. ATG-dependent phagocytosis in dendritic cells drives myelin-specific CD4(+) T cell pathogenicity during CNS inflammation. Proc Natl Acad Sci U S A 114, E11228–E11237. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Khan MF, Kaphalia BS, Prabhakar BS, Kanz MF, Ansari GA, 1995. Trichloroethene-induced autoimmune response in female MRL +/+ mice. Toxicol Appl Pharmacol 134, 155–160. [DOI] [PubMed] [Google Scholar]
- Khan MF, Wang G, 2018. Environmental agents, oxidative stress and autoimmunity. Curr Opin Toxicol 7, 22–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Khan MF, Wang H, 2019. Environmental exposures and autoimmune diseases: contribution of gut microbiome. Front Immunol 10, 3094. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kilburn KH, Warshaw RH, 1992. Prevalence of symptoms of systemic lupus erythematosus (SLE) and of fluorescent antinuclear antibodies associated with chronic exposure to trichloroethylene and other chemicals in well water. Environ Res 57, 1–9. [DOI] [PubMed] [Google Scholar]
- Kim J, Kundu M, Viollet B, Guan KL, 2011. AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat Cell Biol 13, 132–141. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kim YC, Guan KL, 2015. mTOR: a pharmacologic target for autophagy regulation. J Clin Invest 125, 25–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Levine B, Mizushima N, Virgin HW, 2011. Autophagy in immunity and inflammation. Nature 469, 323–335. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mizushima N, 2007. Autophagy: process and function. Genes Dev 21, 2861–2873. [DOI] [PubMed] [Google Scholar]
- Mizushima N, Yoshimori T, 2007. How to interpret LC3 immunoblotting. Autophagy 3, 542–545. [DOI] [PubMed] [Google Scholar]
- Ni HM, Bockus A, Boggess N, Jaeschke H, Ding WX, 2012. Activation of autophagy protects against acetaminophen-induced hepatotoxicity. Hepatology 55, 222–232. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ni HM, McGill MR, Chao X, Du K, Williams JA, Xie Y, Jaeschke H, Ding WX, 2016. Removal of acetaminophen protein adducts by autophagy protects against acetaminophen-induced liver injury in mice. J Hepatol 65, 354–362. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Oaks Z, Winans T, Huang N, Banki K, Perl A, 2016. Activation of the mechanistic target of rapamycin in sle: explosion of evidence in the last five years. Curr Rheumatol Rep 18, 73. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pantucharoensri S, Boontee P, Likhitsan P, Padungtod C, Prasartsansoui S, 2004. Generalized eruption accompanied by hepatitis in two Thai metal cleaners exposed to trichloroethylene. Ind Health 42, 385–388. [DOI] [PubMed] [Google Scholar]
- Perl A, 2018. mTOR-dependent autophagy contributes to end-organ resistance and serves as target for treatment in autoimmune disease. EBioMedicine 36, 12–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pierdominici M, Vomero M, Barbati C, Colasanti T, Maselli A, Vacirca D, Giovannetti A, Malorni W, Ortona E, 2012. Role of autophagy in immunity and autoimmunity, with a special focus on systemic lupus erythematosus. FASEB J 26, 1400–1412. [DOI] [PubMed] [Google Scholar]
- Ponticelli C, Moroni G, 2017. Hydroxychloroquine in systemic lupus erythematosus (SLE). Expert Opin Drug Saf 16, 411–419. [DOI] [PubMed] [Google Scholar]
- Purdue M, Zhang L, Vermeulen R, Smith MT, Hu W, Rhee J, Wen C, Huang Y, Tang X, Berndt SI, Frazer-Abel AA, Deane KD, Rothman N, Lan Q, 2022. Occupational trichloroethylene exposure and antinuclear antibodies: a cross-sectional study in China. Occup Environ Med 79, 717–720. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Qi YY, Zhou XJ, Cheng FJ, Hou P, Ren YL, Wang SX, Zhao MH, Yang L, Martinez J, Zhang H, 2018. Increased autophagy is cytoprotective against podocyte injury induced by antibody and interferon-alpha in lupus nephritis. Ann Rheum Dis 77, 1799–1809. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Qi YY, Zhou XJ, Zhang H, 2019. Autophagy and immunological aberrations in systemic lupus erythematosus. Eur J Immunol 49, 523–533. [DOI] [PubMed] [Google Scholar]
- Sexton K, Adgate JL, Church TR, Ashley DL, Needham LL, Ramachandran G, Fredrickson AL, Ryan AD, 2005. Children’s exposure to volatile organic compounds as determined by longitudinal measurements in blood. Environ Health Perspect 113, 342–349. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Song X, Gao J, Liu H, Liu X, Tang K, 2021. Rapamycin alleviates renal damage in mice with systemic lupus erythematosus through improving immune response and function. Biomed Pharmacother 137, 111289. [DOI] [PubMed] [Google Scholar]
- Sorbara MT, Ellison LK, Ramjeet M, Travassos LH, Jones NL, Girardin SE, Philpott DJ, 2013. The protein ATG16L1 suppresses inflammatory cytokines induced by the intracellular sensors Nod1 and Nod2 in an autophagy-independent manner. Immunity 39, 858–873. [DOI] [PubMed] [Google Scholar]
- Sun Q, Fan J, Billiar TR, Scott MJ, 2017. Inflammasome and autophagy regulation - a two-way street. Mol Med 23, 188–195. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang G, Konig R, Ansari GA, Khan MF, 2008. Lipid peroxidation-derived aldehyde-protein adducts contribute to trichloroethene-mediated autoimmunity via activation of CD4+ T cells. Free Radic Biol Med 44, 1475–1482. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang G, Li H, Khan MF, 2012a. Differential oxidative modification of proteins in MRL+/+ and MRL/lpr mice: Increased formation of lipid peroxidation-derived aldehyde-protein adducts may contribute to accelerated onset of autoimmune response. Free Radic Res 46, 1472–1481. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang G, Ma H, Wang J, Khan MF, 2019a. Contribution of poly(ADP-ribose)polymerase-1 activation and apoptosis in trichloroethene-mediated autoimmunity. Toxicol Appl Pharmacol 362, 28–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang G, Wakamiya M, Wang J, Ansari GA, Khan MF, 2015. iNOS null MRL+/+ mice show attenuation of trichloroethene-mediated autoimmunity: contribution of reactive nitrogen species and lipid-derived reactive aldehydes. Free Radic Biol Med 89, 770–776. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang G, Wang H, Banerjee N, Khan MF, 2020. Interplay and roles of oxidative stress, toll-like receptor 4 and Nrf2 in trichloroethene-mediated autoimmunity. Toxicol Appl Pharmacol 408, 115258. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang G, Wang J, Fan X, Ansari GA, Khan MF, 2012b. Protein adducts of malondialdehyde and 4-hydroxynonenal contribute to trichloroethene-mediated autoimmunity via activating Th17 cells: dose- and time-response studies in female MRL+/+ mice. Toxicology 292, 113–122. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang G, Wang J, Ma H, Ansari GA, Khan MF, 2013a. N-Acetylcysteine protects against trichloroethene-mediated autoimmunity by attenuating oxidative stress. Toxicol Appl Pharmacol 273, 189–195. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang H, Banerjee N, Liang Y, Wang G, Hoffman KL, Khan MF, 2021. Gut microbiome-host interactions in driving environmental pollutant trichloroethene-mediated autoimmunity. Toxicol Appl Pharmacol 424, 115597. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang H, Wang G, Ansari GAS, Khan MF, 2018. Trichloroethene metabolite dichloroacetyl chloride induces apoptosis and compromises phagocytosis in Kupffer cells: activation of inflammasome and MAPKs. PLoS One 13, e0210200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang H, Wang G, Liang Y, Du X, Boor PJ, Sun J , Khan MF, 2019b. Redox regulation of hepatic NLRP3 inflammasome activation and immune dysregulation in trichloroethene-mediated autoimmunity. Free Radic Biol Med 143, 223–231. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang S, Ni HM, Chao X, Wang H, Bridges B, Kumer S, Schmitt T, Mareninova O, Gukovskaya A, De Lisle RC, Ballabio A, Pacher P , Ding WX, 2019c. Impaired TFEB-mediated lysosomal biogenesis promotes the development of pancreatitis in mice and is associated with human pancreatitis. Autophagy 15, 1954–1969. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Y, Li YB, Yin JJ, Wang Y, Zhu LB, Xie GY, Pan SH, 2013b. Autophagy regulates inflammation following oxidative injury in diabetes. Autophagy 9, 272–277. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Weindel CG, Richey LJ, Mehta AJ, Shah M, Huber BT, 2017. autophagy in dendritic cells and b cells is critical for the inflammatory state of TLR7-mediated autoimmunity. J Immunol 198, 1081–1092. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ye X, Zhou XJ, Zhang H, 2018. Exploring the role of autophagy-related gene 5 (ATG5) yields important insights into autophagy in autoimmune/autoinflammatory diseases. Front Immunol 9, 2334. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yin H, Wu H, Chen Y, Zhang J, Zheng M, Chen G, Li L, Lu Q, 2018. The therapeutic and pathogenic role of autophagy in autoimmune diseases. Front Immunol 9, 1512. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
