Skip to main content
NCBI home page
Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology logoLink to Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology
. 2022 Oct 23;47(1):68–72. doi: 10.1007/s12639-022-01540-z

Molecular prevalence of tick-borne haemoprotozoan diseases in cattle of North Eastern state of Tripura, India

Mritunjay Kumar 1,✉, Jowel Debnath 2, Apurba Debbarma 3, H Lalrinkima 4
PMCID: PMC9998742  PMID: 36910315

Abstract

The tick-borne haemoprotozoan diseases are major constraint in the health and production of cattle and causes substantial losses to the livestock industry throughout the world. Tripura is a northeastern state of India characterized by a warm humid tropical climate and high rainfall which is conducive to the multiplication of vector-ticks of haemoprotozoan diseases. A total of 320 tick-infested cattle (22 male and 298 female) of either sex was selected randomly from different district of Tripura for the detection of carrier cattle infected with tick-borne haemoparasites from July, 2017 to June, 2019. Out of 320 tick-infected cattle, 4.69% prevalence of B. bigemina infection in cattle was found while Theleria spp. was not prevalent in the collected blood sample by using polymerase chain reaction. The prevalence of B. bigemina was significantly (< 0.05) higher in cattle more than 3 years of age (6.72%) compared to the 1–3 years age group (3.97%) and < 1 year age groups (1.66%). Sex-wise B. bigemina infection was significantly (< 0.05) seen only in female (5.03%) cattle infested with ticks. The district-wise B. bigemina prevalence (%) in Tripura was as in cattle; Dhalai (0.63), Sipahijala (0.31), Khowai (0.31), Gomati (0.31), South Tripura (0.63), North Tripura (0.31), Unakoti (0.31) and West Tripura (1.87) respectively. The use of PCR assays for the detection of B. bigemina and Theileria spp. in the North Eastern state of Tripura of India showed prevalence of 4.69% and 0%, respectively in tick-infested cattle. This study is the first report about the prevalence of tick-borne haemoprotozoan diseases from cattle of Tripura and suggest that babesiosis is more common disease as compared to theileriosis and is more prevalent in adult female tick-infested cattle in Tripura.

Keywords: Babesia, Cattle, Haemoprotozoan, Molecular, Prevalence, Tick-borne

Tick-borne haemoprotozoan diseases (TBHD) have a major impact on livestock production in tropical and subtropical areas (Mehlhorn and Schein 1984). The survival and development of tick- vector are more favourablee in the hot and humid climate and is thus a constant source of infection to susceptible animals (Chaudhury et al. 2006). Tick-borne haemoprotozoan diseases viz., babesiosis shows inappetence to anorexia, pyrexia, anaemia, haemoglobinuria and decrease milk production (Kumar et al 2018b) while theileriosis shows pyrexia, inappetence to anorexia and enlarged lymph nodes as major clinical signs. Babesiosis is a hemolytic disease in cattle, which is transmitted by Rhiphicephallus (Boophilus) ticks and have ability to evade the immune systems of the vertebrate hosts causing persistent infection. The main cause of pathogenicity of high percent of mortality in non-immune cattle-herd infected with haemoprotozoan diseases is marked anaemia (Choramo and Ibrahim 2017). The tick and tick-borne diseases are major constraints for existence of the exotic and cross-bred cattle in India (Soundarajan and Rajavela 2006) and cause a diminution in working capacity and increased cost of control measures (Senthil Kumar and Yasotha 2015). Ticks play important role in the transmission of babesiosis and theileriosis from carrier animals to healthy animals and also in its epidemiology. In India, such economic losses due to vector-borne haemoprotozoan diseases are of great importance as major population are dependent on dairy product as a main source of protein (Anon 2016) and cattle play a major role in Indian economy through the production of milk, meat, hide, fuel and draught power. Animals that survive infection generally become low-level carriers of the parasite and serve as a reservoir for transmission (Fahrimal et al. 1992).

Tripura is a northeastern state of India situated between 22°7’ and 24°2’ north latitudes and 91°0’ and 92°0’ east longitudes with tropic of cancer passing through it and characterized by a warm and humid tropical climate, high rainfall with adequate water resources which is conducive for the survival and breeding of tick population which hinder the profitable cattle production (Debbarma et al. 2018). Prevalence of tick-borne haemoprotozoan parasites has been reported from the different states of India even though the exact status of haemoprotozoan diseases has not been explored in cattle from Tripura. Microscopic examination of blood smears stained with Giemsa stain is usually adequate for the detection of acute infections, but not for detection of carrier animals, where parasitaemia may be low (Friedhoff and Bose 1994). The epidemiological studies of diseases are dependent on the diagnosis of low-level infections with the parasite in animals (Fahrimal et al. 1992). PCR has proven to be sensitive in detecting haemoprotozoan diseases in carrier cattle (Calder et al. 1996). Hence, considering the importance of cattle husbandry in the economy of the state of Tripura, present study was undertaken to investigate the prevalence of carrier cattle infected with tick-borne haemoprotozoan diseases viz., babesiosis and theileriosis in tick- infested cattle in Tripura.

Materials and methods

Area and duration of study

The present study was conducted in all eight (8) districts of Tripura state; namely Dhalai, Sipahijala, Khowai, Gomati, Unakoti, North Tripura, South Tripura and West Tripura to gather information on the prevalence of TBHD in cattle of Tripura from July, 2017 to June, 2019. The climate in the Tripura state of India is characterized by a warm and humid tropical climate with five distinct seasons, namely, spring, summer, monsoon, autumn and winter.

Selection of animals

The crossbred cattle in the age group of 6 months to 8 years were randomly selected in the present study for infection with tick-borne haemoprotozoan diseases. A total of 320 cattle (22 male and 298 female) of either sex was selected randomly from different district of Tripura. Besides, 25 blood samples were collected from healthy cattle without any tick infestation as healthy control. Out of 320 tick-infested cattle, 60 were of less than 1 year (younger age group), 126 were between 1 and 3 years (young adult) and 134 were above 3 years of age. The cattle selected for the present study were clinically healthy except for tick infestation. The molecular prevalence of TBHD was recorded based on age and sex of cattle.

Collection of blood sample

A total of 320 blood samples were collected randomly from apparently healthy tick-infested cattle in the summer season when the ticks are more populous from all 8 districts of Tripura. Out of which, forty blood samples collected randomly from tick-infested cattle from each district of Tripura. The whole blood sample was collected from jugular vein-puncture of the cattle in EDTA-containing vacutainers. The blood samples were stored at − 20 °C until DNA extraction. The DNA samples were extracted from the whole blood of cattle using GSure Blood DNA Mini Kit (GCC Biotech, Kolkota).

Amplification of DNA

In the present study, B. bigemina and Theileria spp were selected which are being reported in the neighboringcountry Bangladesh (Mahmud et al. 2015). The presence of Theileria annulata is considered unlikely due to the non-reporting of its intermediate host, Hyalomma anatolicum in notheastern states. But, Theileria orientalis is being reported from Mizoram and Assam. Species-specific amplification was performed in B. bigemina whereas genus-specific amplification was done for the case of Theileria spp. The oligonucleotide primer pair used for Babesia bigemina were, Forward Primer (FP) CATCTAATTTCTCTCCATACCCCTCC and Reverse Primer (RP) CCTCGGCTTCAACTCTGATGCCAAAG having product amplicon size, 278 bp and for Theileria spp were, Forward primer (FP) CCTGAGAAACGGCTACCACATCT and Reverse Primer GGACTACGACGGTATCTGATCG having product amplicon size, 584 bp. Polymerase chain reaction (PCR) amplification of haemoprotozoan DNA fragment was performed in the conditions as suggested by Guido et al. (2002). The reaction mixture for 4 samples was made by mixing forward primer (5 µl), reverse primer (5 µl), 10 × buffer (10 µl)), MgCl2 (6 µl), dNTPs (2 µl), Taq Polymerase (1 µl), Genomic DNA (4 µl) and nuclease free water (67 µl). PCR amplification of DNA was performed to obtain the 584 bp and 278 bp amplified products over 35 cycles by 95 °C for 5 min, 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s and completed with a final extension step of 10 min at 72 °C. Finally, the amplified DNA fragments were analyzed after electrophoresis on pre-stained agarose gel (1.2%) with ethidium bromide.

Statistical analysis

Sex and age-wise data of Babesia bigemina in cattle were statistically analyzed by Tukey method (One-Way ANOVA) and significance was recorded at a 5% level (p ≤ 0.05). Statistical analysis was made by Sigma plot Software version 11.1.

Result

Molecular prevalence of TBHD in cattle

The prevalence of tick-borne haemoprotozoan parasites in different districts was studied by collection and examination of blood from 320 randomly selected cattle infested with ticks. Molecular identification (Fig. 1) by PCR revealed 4.69% (15/320) prevalence of B. bigemina infection in cattle; which consist of sample from Dhalai (2 nos), Sipahijala (1 no), Khowai (1 no), Gomati (1 no), South Tripura (2 nos), North Tripura (1 no), Unakoti (1 no) and West Tripura (6 nos) district of Tripura respectively (Fig. 2). However, the present studies did not show Theileria spp infection in the collected blood sample from crossbred cattle of different districts of Tripura.

Fig. 1.

Fig. 1

Open in a new tab

PCR amplification of gene of Babesia bigemina Lane 1: PCR amplification of microscopically positive control blood sample (B. bigemina) Lane 2: PCR amplification of positive blood sample (B. bigemina) Lane 3 & 4: PCR amplification of blood sample from random tick infested cattle (Theileria spp.) Lane M: 100 bp DNA ladder

Fig. 2.

Fig. 2

Open in a new tab

District wise prevalance percentage (%) of Babesia in Tripura

Sex-wise molecular prevalence

The prevalence of tick-borne haemoprotozoan diseases were compared between sexes of animal and found that B. bigemina infection was seen only in female cattle (5.03%) whereas the infection in male animals was found to be nil (p ≤ 0.05). Out of 298 tick-infested female cattle, 15 female cattle were detected carrier while out of 15 male tick-infested cattle, none of them were detected carrier for Babesia bigemina infection by PCR.

Age-wise molecular prevalence

Tick-borne haemoprotozoan carriers in cattle varied among the different age groups of animals selected for the present study. The prevalence of B. bigemina was significantly (p ≤ 0.05) higher in tick-infested cattle of more than 3 years of age compared to other groups although the different age groups were also having significant differences (p ≤ 0.05) in B. bigemina infections. The tick-infested cattle of < 1 year age group (1/60) showed prevalence of 1.66% while tick-infested cattle between age group of 1 to 3 years (5/126) showed prevalence of 3.97%. The tick-infested cattle of 3 years and above age group (9/134) showed the prevalence of 6.73%.

Discussion

Vector-borne haemoprotozoan disease is one of the significant animal diseases which significantly affects animal health, production and welfare (Uilenberg 1995). The detection of the carrier status of an animal without any apparent clinical signs by Giemsa stain is not sensitive at the same time the role of these carrier animals in the transmission and spread of infection to a susceptible animal population in an endemic area is not to be ruled out. Detection of these carrier animal is as important as the detection of diseased animals from the epidemiological point of view for the execution of effective and stringent treatment and at the same time vector control. The PCR is considered one of the most sensitive tools for the detection of haemoprotozoan diseases in carrier animals compared to the traditional Giemsa staining method (Happi et al. 2020). In the present study, amplification of parasite DNA fragment by PCR revealed the prevalence of B. bigemina infection in 15 crossbred cattle (4.69%) from all 8 districts of Tripura. This study also highlights that Theileria spp. infection in cattle of Tripura was nil which could be due to the absence of intermediate host even though T. orientalis infection was detected in the neighbouring states. The variation in prevalence within Tripura states may be due to climate disparity, sampling variations, seasonal differences and variation in the distribution of ticks and B. bigemina organism across different districts. The cattle recovered from haemoprotozoan disease may act as a carrier for these diseases (Callow 1984). Priya et al. (2017) reported the prevalence of theileriosis as 72 (57.6%) while of B. bigemina as two (1.6%) based on PCR detection. The absence of Theileria spp. detection using PCR in tick infested cattle may be due to differential distribution of ticks or absence of vector ticks for theileriosis in collected samples. The prevalence of B. bigemina was 6.73% in tick-infested cattle of more than 3 years of age-group, 3.97% in tick-infested cattle of 1 to 3 years age-group and 1.66% in tick-infested cattle of less than 1 year of age-group in our study was in concurrence with the findings of Kumar et al. (2018a). The high incidence of carrier stage of babesiosis was present in adult tick-infested cattle as old animals can maintain immunity and are less prone to re-current infections. The low incidence of carrier stage of babesiosis in young calf as it possesses a strong innate immunity against babesia infection that last approximately 6 months after birth (Kumar et al. 2018a). The molecular prevalence of B. bigemina in female and male cattle was 5.03% and 0%, respectively. The detection of haemoprotozoan diseases at low level is helpful in designing effective control measures. In contrast to our study, high incidence of bovine babesiosis (29%) was reported using PCR in Pakistan (Chaudhry et al. 2010) and India (Singh et al. 2007). The high incidence of babesiosis in female cattle may be due to a very larger sample size of female cattle as compared to male cattle. The high incidence in female cattle may also be due to physiological and immunological changes associated during pregnancy and lactation (Khansari et al. 1990). The no incidence of Theileria spp. in our study needs further evaluation with regard to vector detection and distribution and host resistance.

Conclusions

The use of PCR assays for the detection of B. bigemina and Theileria spp. in the North Eastern state of Tripura of India showed prevalence of 4.69% and 0%, respectively. The present study revealed that babesiosis is a common disease in comparison to theileriosis in tick-infested cattle in Tripura. The babesiosis is more prevalent in adult female tick-infested cattle in Tripura. This is the first-time study in Tripura emphasizes the significance of a further inclusive study on theileriosis that will likely be very beneficial for the management and control programs of the tick borne haemoparasites infections in cattle.

Acknowledgements

Authors are grateful to Science and Engineering Research Council, DST, GOI for providing fund and Principal, College of Veterinary Sciences & A. H., R. K. Nagar for providing necessary amenities.

Authors contributions

All authors contributed to the study conception and design. Material preparation, sample collections, PCR was done by MK, AD, HL and analysis of data was performed by JD and HL. The first draft of the manuscript was written by MK and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Funding

This work was funded by Science and Engineering Research Council, DST, GOI.

Declarations

Conflict of interest

Authors declared that there is no conflict of interest among the authors.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Anon . Global agricultural information network, Report No. IN6126. Sarah Hoffman, USA: USDA Foreign Agricultural Service; 2006. [Google Scholar]
  2. Calder JAM, Reddy GR, Chieves L, Courtney CH, Littell R, Livengood JR, Norval RAI, Smith G, Dame JB. Monitoring Babesia bovis in cattle using PCR-based tests. J Clin Microbiol. 1996;34:2748–2755. doi: 10.1128/jcm.34.11.2748-2755.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Callow LL. Protozoan and rickettsial diseases. Aust Bur Anim Health Anim Health Aust. 1984;5:121–216. [Google Scholar]
  4. Chaudhry ZI, Suleman M, Younus M, Aslim A. Molecular detection of Babesia bigemina and Babesia bovis in crossbred carrier cattle through PCR. Pakistan J Zool. 2010;42:201–204. [Google Scholar]
  5. Chaudhury S, Hossain MA, Barua SR, Islam S. Occurrence of common blood parasites of cattle in Serajgong Sadar area of Bangladesh. Bangladesh J Vet Med. 2006;4(2):143–145. doi: 10.3329/bjvm.v4i2.1300. [DOI] [Google Scholar]
  6. Choramo A, Ibrahim N. Prevalence of Babesiois in cattle in and around Jimma Town, Orimea Region. South Westrn Ethiopia Acta Parasitologica Globalis. 2017;8(2):96–100. [Google Scholar]
  7. Debbarma A, Pandit S, Jas R, Baidya S, Mandal SC, Jana PS, Das M. Prevalence of tick-borne haemoparasitic diseases in cattle of West Bengal India. Biol Rhythm Res. 2018 doi: 10.1080/09291016.2018.1528693. [DOI] [Google Scholar]
  8. Fahrimal Y, Goff W, Jasmer DP. Detection of Babesia bovis carrier cattle by using Polymerase chain reaction amplification of parasite DNA. J Clin Microbiol. 1992;30:1374–1379. doi: 10.1128/jcm.30.6.1374-1379.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Friedhoff K, Bose R (1994) Recent developments in diagnostics of some tick-borne diseases. In: Uilenberg G, Permin A, Hansen JW (eds) Use of applicable biotechnological methods for diagnosing haemoparasites. Proceedings of the expert consultation, Merida, Mexico, 4–6 October 1993. Food and Agriculture Organisation of the United Nations (FAO), Rome, Italy, pp 46–57
  10. Guido FCL, Angela PS, Lloyd HL, Claudio RM. Assessment of primers designed from the small ribosomal subunit RNA for specific discrimination between Babesia bigemina and B. bovis by PCR. Cien Anim Brasil. 2002;3:27–32. [Google Scholar]
  11. Happi AN, Osifade O, Oluniyi PE, Ogunro BN. Comparison of light microscopy and polymerase chain reaction for the detection of haemoparasites in cattle in Nigeria. Acta Parasit. 2020;65:44–56. doi: 10.2478/s11686-019-00123-y. [DOI] [PubMed] [Google Scholar]
  12. Khansari DN, Murgo AJ, Faith RE. Effects of stress on the immune system. Immunol Today. 1990;11:170–175. doi: 10.1016/0167-5699(90)90069-L. [DOI] [PubMed] [Google Scholar]
  13. Kumar B, Mondal DB, Jithin MV. Prevalence of Babesiois in cattle in Patna Region. India Int J Curr Microbiol App Sci. 2018;7:5167–5174. [Google Scholar]
  14. Kumar M, Sharma CS, Nath AK, Monsang SW. Prevalence of haemoparasites among crossbred cattle of West Tripura. Intas Polivet. 2018;19(1):1–2. [Google Scholar]
  15. Mahmud A, Belal S, Hossain A. Prevalence of theileriosis and babesiosis in cattle in Sirajganj district of Bangladesh. Res Agricu Livest Fish. 2015;2:79–86. doi: 10.3329/ralf.v2i1.23032. [DOI] [Google Scholar]
  16. Mehlhorn H, Schein E. The piroplasms: life cycle and sexual stages. Adv Parasitol. 1984;23:37–103. doi: 10.1016/S0065-308X(08)60285-7. [DOI] [PubMed] [Google Scholar]
  17. Priya MN, Jain JK, Sujith S, Kalarikkal DC, Ajith Kumar KG, Lakshaman B, Ravindran R. Molecular identification of carrier status of theileriosis and babesiosis in dairy cattle in Kerela. Int J Sci Environ Technol. 2017;4:2712–2717. [Google Scholar]
  18. Senthil Kumar A, Yasotha A. Clinical management of babesiosis in crossbred dairy cattle. Int J Sci Environ Technol. 2015;4(4):1438–1441. [Google Scholar]
  19. Singh H, Mishra AK, Rao JR, Cheema PS, Sankar M. Polymerase chain reaction for diagnosis of Babesia bigemina. Indian Vet J. 2007;84:346–348. [Google Scholar]
  20. Soundarajan C, Rajavelu G. Prevalence of haemoprotozoan among cattle and buffaloes. Indian Vet J. 2006;83:1258–1260. [Google Scholar]
  21. Uilenberg G. International collaborative research: significance of tick-borne hemoparasitic diseases to world animal health. Vet Parasitol. 1995;57:19–41. doi: 10.1016/0304-4017(94)03107-8. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology are provided here courtesy of Springer

RESOURCES