Skip to main content
Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology logoLink to Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology
. 2022 Oct 17;47(1):59–67. doi: 10.1007/s12639-022-01538-7

Pfmdr 1 and kelch 13 genes distribution among children that are 5 years and below in Akure, Nigeria

Olajide Joseph Afolabi 1,✉, Olubanke Rosena Oluwafemi 2, Mobolanle Oladipo Oniya 1
PMCID: PMC9998786  PMID: 36910307

Abstract

Malaria parasite resistant to drugs has been a major barrier to effective treatment of malaria. Therefore, the study aimed to evaluate the distribution of Plasmodium falciparum resistant Kelch protein gene on chromosome 13 (Kelch 13) and multidrug resistant (Pfmdr1) mutant genes among children aged five years and below who attended Mother and Child Hospital, Akure, Nigeria. Thin and thick smears were prepared from the blood collected aseptically through venepuncture from five hundred (500) children. Structured questionnaires were used to obtain demographic data from the respondents. Two hundred malaria positive samples were randomly selected from the 500 samples for PCR analysis to detect Pfmdr1 and Kelch 13 mutant genes. The results showed that of the 500 respondents, 288 (57.6%) were males while 21 (42.4%) were females. Pfmdr1distribution include: mixed group (mutant/wild) 38.5%, mutant gene 35.5%, wild gene 20.5% and the resistant genes were absent in 5.5% of the infected children. The mixed group of Pfmdr1 gene was higher among infants (51.9%), children with birth order 4 (60.0%) and children that have blood group B (51.3%), however, there is no significant difference in the distribution of Pfmdr1 between gender (χ2 = 0.634, df = 1, p > 0.05). There was a point mutation in the codon position 557 where the amino acid Alanine was replaced by Serine in the PfK13. The presence of Pfmdr1 mutant genes and point mutation in the PfK13 gene of P. falciparum among children, calls for development of innovative drugs targeted on these resistant strains.

Keywords: Malaria, Prevalence, Kelch 13, Pfmdr1 gene

Introduction

Malaria is an infectious disease caused by protozoan parasites of the genus Plasmodium. Globally, malaria remains the major cause of morbidity and mortality especially among children and pregnant women (Simon-Oke et al. 2013). The disease causes severe morbidity and mortality in human through several pathological mechanisms with varying degrees. Malaria treatment includes first and second-line antimalarial drugs, adjunctive and supportive measures such as intravenous fluids, blood transfusions, supplemental oxygen and anti-convulsant medications (William et al. 2016). The aims of malaria treatment as outlined by the World Health Organization (WHO) are to prevent death, prevent long term deficits, to reduce the duration of morbidity of an acute episode of illness and to clear the parasites entirely from blood to prevent re-occurrence of infection (WHO 2014). There were 214 million new cases of malaria worldwide in the year 2015 (World Health Organization 2015) and there were an estimated 438,000 malaria deaths worldwide in that year; 90% of the deaths occurred in the African region (Yohanna et al. 2019) 30% and 60% of hospital admission and outpatient visits respectively in Nigeria resulted from malaria infection (Federal Ministry of Health 2010). Plasmodium species is the cause of malaria; however, most severe malaria infection is caused by P. falciparum (Federal Ministry of Health 2010). Emergence of malaria parasite resistance to antimalarial drugs is a major impediment to the successful treatment of malaria and this has elevated global malaria mortality. Resistance to drug has been reported in all the species of Plasmodium, meanwhile P. falciparum has developed resistance to nearly all antimalarial drugs currently in use (WHO 2010). The Roll Back Malaria initiative launched by WHO in 1998 paved way for artemisinin drugs to gain ground as the fastest active antimalarial, but some early cases of recrudescence were also reported (Luxemburger et al. 1998). In view of this, WHO recommended a ban on Artemisinin monotherapy and in 2001, recommended Artemisinin Combination Therapy (ACTs) which is simultaneous use of two or more malaria drugs with independent modes of action and different biochemical targets in the parasite and some of the drugs combined with artemisinin include lumefantrine or amodiaquine, mefloquine, (Ashley et al. 2014). However, emergence and spreading of P. falciparum resistant species to the most commonly available antimalarial drugs including the ACTs hinders effective control of the disease. There is evidence of resistance of P. falciparum malaria to ACT which is caused by mutations in two genes, the P. falciparum multidrug resistance transporter-1 (Pfmdr1) and specifically, P. falciparum kelch protein gene on chromosome 13 (PfKelch 13) (Ashley et al. 2014; Muhammad et al. 2017). In a multi-centre study done across 10 countries in 2014, there was a report of increasing resistance of P. falciparum to the ACTs (Ashley et al. 2014). The study reported that slowly clearing infections (clearance half-life > 5 h) were strongly associated with single point mutations in the “propeller” region of the P. falciparum kelch protein gene on chromosome 13 (Pfkelch13). This present study therefore investigated the distribution of Pfmdr 1 and PfKelch 13 genes among the under-5 children in a secondary health facility, South-West, Nigeria.

Materials and methods

Study site

The study was carried out in the Mother and Child Hospital, Akure (MCHA) from February to July 2019. The hospital (Latitude N 7°255′214″ and Longitude E 5°182′476″) was a busy 100-bedded (60 obstetrics and 40 pediatric beds), ultra-modern public facility which provides specialized and effective health care services to the Ondo State capital, ally communities and neighboring states in the South-Western Nigeria. Akure has two seasons, which includes the rainy (wet) season that ranges from March to October and the dry season that ranges from November to February with an average annual rainfall of 2378 mm, temperature range of 25.2 °C–28.1 °C and relative humidity of 80% (Simon-Oke et al. 2013).

Ethical clearance and informed consent

Prior to the commencement of the research, approval was sought from the Research and Ethics Committee of the Mother and Child Hospital and the State Ministry of Health. Informed consent was also obtained from the parents of the participants after the benefits of the research has been fully explained to them.

Recruitment of study subjects

The study was a cross sectional survey and sampling was done in the hospital on 500 children aged five years and below, recruited from various points of entry into the hospital vis-à-vis emergency room, newborn unit, out-patient department (OPD) and the children’s ward.

Sample collection

Five hundred blood samples were collected by venipuncture for malaria parasite test. Thin and thick smears were prepared on sterile slides, which were subsequently stained with Giemsa stain and view under the light microscope at X100 magnification. Two to three drops of the positive blood sample were spotted on a 3 mm Whatmann filter paper and this was allowed to dry at room temperature (28 ± 2 °C) (Dry Blood Sample [DBS]). Two hundred positive DBS were then randomly selected for the polymerase chain reaction and other molecular analysis. Demographic data such as age, sex, birth orders, ethnicity, religion, parents’ occupation and level of education were collected from the participants and entered into the study questionnaire.

Malaria parasite deoxyribonucleic acid (DNA) extraction from dried blood spots (DBS) using QIAGEN QIAMP DNA extraction mini-kit

Two pieces of 3 mm disk from the Whatman filter paper dry blood spots were punched out using a sterile hole punch and placed into appropriately labeled 1.5 micro-centrifuge tube, to this, 180 µl of animal tissue lysis buffer was added to ensure the pieces of filter paper were soaked before incubation at 85 °C for 10 min followed by addition of 20 µl of proteinase K stock solution. The mixture was vortexed and incubated at 56 °C for 1 h after which lysis buffer (buffer AL) was added to the sample, thoroughly mixed by vortexing and incubated at 70 °C for 10 min. Absolute ethanol (200 μl) was added and thoroughly mixed. The mixture was then added to a amp Mini kit spin column placed in a 2 ml collection tube and centrifuged at 8000 rpm for 1 min. The spin column was removed and placed in a clean 2 ml well labeled collection tube while the filtrate was discarded with the tube, 500 μL of Wash buffer (Buffer AW1) was then added and the mixture centrifuged at 8000 rpm for 1 min. The collection tube containing the filtrate was discarded. Buffer AW2 (500 μl) was added to the spin column and then centrifuged at full speed (20,000 × g or 14,000 rpm) for 3 min. Again, the filtrate was discarded and the spin column was placed in a 1.5 mL microcentrifuge tube. DNA of the malaria parasite was eluted with 150 μl elution buffer AE, incubated at room temperature (28 ± 2 °C) for 1 min and centrifuged at 6000 × g (8000 rpm) for 1 min. The extracted DNA was stored in the refrigerator at − 20 °C until it was needed for subsequent molecular studies (Bioscience 2015). The quality and quantity of extracted DNA yield was 1.87 and 160 ng/μL respectively.

Genotyping of Pf kelch protein gene on chromosome 13 (kelch13) and Pfmdr 1 mutant genes

After the molecular screening of the samples for malaria parasites, genotyping analysis of Pf kelch protein gene on chromosome 13 (kelch13) and Pfmdr 1 mutant genes using PCR technique was carried out only on samples positive (200) for P. falciparum using the concentrations of the mixtures as follows: Magnesium chloride; 1.5 mM, DeoxyNucleotide TriphosphateS (dNTPs); 0.2 mM, forward primer; 0.4 mM, reverse primer; 0.4 mM, Taq polymerase 0.04 mM, DNA sample 160 ng/μL, PCR water 8.8 μL and Buffer 1.5 μL all in a final volume of 15 μL. The genotyping analysis was done using the appropriate set of primers shown in Tables 1 and 2 after which the PCR products were subjected to electrophoresis analysis (Vathsala et al. 2004).

Table 1.

Parasite Genotyping for Pfmdr1 (N86Y) -Asparagine to Tyrosine on position 86

Primary
Genes Primer Sequence (5_–3_) PCR Conditions Size (Base Pair, bp) References
Pfmdr 1 Forward ATGGGTAAAGAGCAGAAAGA

Initial Denaturation: 94 °C for 3 min Denaturation: 92 °C for 30 s

Annealing: 48 °C for 45 s

Extension: 65 °C for 1 min

Final extension: 65 °C for 5 min post hold at 4 °C

All at 25 cycles,

476 (mutant) 256 (wild) 250 (mixed) Vathsala et al. 2004)
Reverse AACGCAAGTAATACATAAAGTCA
Secondary Reaction
Genes Primer Sequence (5_–3_) PCR Conditions Size (Base Pair, bp) References
Pfmdr 1 Forward TGGTAACCTCAGTATCAAAGAA

Initial Denaturation: 94 °C for 3 min Denaturation: 92 °C for 30 s

Annealing: 48 °C for 45 s

Extension: 65 °C for 1 min

Final extension: 65 °C for 5 min post hold at 4 °C

All at 25 cycles,

476 (mutant) 256 (wild) 250 (mixed) Vathsala et al. 2004)
Reverse ATAAACCTAAAAAGGAACTGG

Table 2.

PCR Amplification of Plasmodium falciparum K-13 Propeller Gene (Pfk13) Primer Sequences

Primary
Genes Primer Sequence (5_–3_) PCR Conditions Size (Base Pair, bp) References
K13 Forward CGGAGTGACCAAATCTGGGA Initial Denaturation: 95 °C for 15:00 min, Denaturation: 95 oC for 30 s, Annealing: 58 oC for 2 min, Extension 72 oC for 2 min, Final extension 72 °C for 10 min 849 Biomedical Research Laboratory (BMRL) 2010)
Reverse GGGAATCTGGTGGTAACAGC
Secondary
Genes Primer Sequence (5_–3_) PCR Conditions Size (Base Pair, bp) References
K13 Forward GCCAAGCTGCCATTCATTTG Initial Denaturation: 95 °C for 15:00 min, Denaturation: 95 oC for 30 s, Annealing: 58 oC for 2 min, Extension 72 oC for 2 min, Final extension 72 °C for 10 min 849 Biomedical Research Laboratory (BMRL) 2010)
Reverse GCCTTGTTGAAAGAAGCAGA

The primary amplification reaction from the nested PCR method for the Pfmdr1 involved the use of the primer pair for the forward and the reverse reaction; S 5′-ATGGGTAAAGAGCAGAAAGA-3′ and 5′- AACGCAAGTAATACATAAAGTCA -3′ respectively for a 250–500 base pair product. The PCR product obtained was used as the template for the secondary PCR using the following primer pairs: S 5′-TGGTAACCTCAGTATCAAAGAA-3′ and S 5′- ATAAACCTAAAAAGGAACTGG -3′ for a 250–500 base pair product. The PCR reactions were carried out in a final volume of 15 μl, using a DNA Engine Tetrad PTC-225 thermal cycler (MJ Research, USA) with cycling parameters of an initial denaturation at 94 °C for 3 min (Vathsala et al. 2004) followed by 25 cycles of 92 °C for 30 s, annealing at 48 °C for 45 s, extension at 65 °C for 1 min and a final cycle of extension at 65 °C for 5 min (Table 1). The cycling parameters for the secondary reaction was 94 °C for 3 min for initial denaturation, followed by 25 cycles of 92 °C for 30secs, annealing at 48 °C for 45 s, extension at 65 °C for 1 min and a final cycle at 65 °C for 5 min all at 25 cycles (Table 1).

The primary amplification reaction of the PfK13 on the other hand involved the use of the primer pair for the forward and the reverse reaction; S 5′-CGGAGTGACCAAATCTGGGA-3′ and 5′-GGGAATCTGGTGGTAACAGC-3′ respectively for a 849 base pair product. The PCR reactions were also carried out in a final volume of 15 μl. The PCR product obtained from the primary reaction was used as the template for the secondary PCR using the following primer pairs for the forward and reverse reactions: S 5′- GCCAAGCTGCCATTCATTTG-3′ and S 5′- GCCTTGTTGAAAGAAGCAGA-3′ respectively. The nested PCR was done with initial denaturation at 95 °C for 15 min (BMRL, 2010) followed by 25 cycles of 95 °C for 30 s, annealing at 58 °C for 2 min, extension at 72 °C for 2 min and a final cycle of extension at 72 °C for 2 min (Table 2). The cycling parameters for the secondary reaction was at 95 °C for 15 min for initial denaturation, followed by 25 cycles of 95 °C for 30secs, annealing at 58 °C for 2 min, extension at 72 °C for 2 min and a final cycle at 72 °C for 10 min all at 25 cycles (Table 2).

Data analysis

Carl Pearson Chi-Square was used to determine the significance of resistant genes between gender. Analyses were done using the Statistical Package for the Social Sciences (SPSS) version 20.0 statistical software for Windows (IBM, Armonk, N.Y., United States).

Results

Distribution of Pfmdr 1 and Kelch 13 genes among the age groups, gender, birth orders and blood groups

The molecular study indicated that the Pfmdr1 presented itself in various forms among the subjects examined. The genetic constitutions were classified as mutant, wild, and a mixture of mutant and wild (mixed group). The mixed group (mutant/wild) was the highest being expressed in 77 (38.5%) children infected with malaria, followed by the mutant gene (35.5%, n = 71), wild gene (20.5%, n = 41) and the resistant genes were absent in 11 infected children (5.5%) (Fig. 1). The wild type is the normal chloroquine sensitive genes, while the mutant and the mutant/wild ones are the Pfmdr1 resistant strains.

Fig. 1.

Fig. 1

Phenotypic presentation of P. falciparum

The results further showed that 11 (37.9%) of the neonates had the Pfmdr1 mutant genes, 12 neonates (41.4%) had both mutant and wild genes and 6 neonates (20.6%) had the wild type (Table 3). Among the infants, 30 (37.0%) had the mutant genes, 42 infants (51.9%) had both mutant and wild genes while 9 (11.1%) had the wild type. In the age groups > 12 months to 5 years, 32 children (40.5%) had the mutant genes, 40 children (50.6%) had both the mutant and the wild genes and 7 (8.9%) had the wild genes. Forty-four (38.3%) of the males had the mutant genes, 51 (44.3%) had both the mutant and wild genes and 20 males (17.4%) had the wild genes. Similarly, 29 females (39.2%) had the mutant genes, 30 females (40.5%) had both mutant and wild genes and 15 females (20.3%) had only the wild genes. However, Chi-square analysis showed that there is no significant difference in the distribution of Pfmdr1 between gender (χ2 = 0.634, df = 1, p > 0.05). The distribution of malaria parasite wild mutant genes (Pfmdr1) was present in all birth orders except birth order greater than 5. However, the mutant/wild genes were highest (60%) in birth order 4 and lowest (33.3%) in birth order greater than 5. The wild type was highest (66.7%) in birth order greater 5 and lowest (10%) in birth order 4 (Table 3).

Table 3.

The distribution of malaria parasite resistant genes (Pfmdr1) among various groups

Variables Mutant gene (%) Mutant/wild (%) Wild (%) df P value
Age Groups
Neonates 11(37.9) 12 (41.4) 6 (20.7)
Infants 30 (37.0) 42 (51.9) 9 (11.1) 2 0.005
 > 12 months-5yrs 32 (40.5) 40 (50.6) 7 (8.9)
Gender
Male 44 (38.3) 51 (44.3) 20 (17.4) 1 0.634
Female 29 (39.2) 30 (40.5) 15 (20.3)
Birth Orders
1 37 (44.6) 33 (39.8) 13 (15.6)
2 21 (35.0) 24 (40.0) 15 (25.0) 4 0.003
3 15 (45.5) 13 (39.4) 5 (15.2)
4 3 (30.0) 6 (60.0) 1 (10.0)
 ≥ 5 0 (0.0) 1 (33.3) 2 (66.7)
Blood Groups
A 9 (34.6) 13 (50.0) 4 (15.4)
B 13 (33.3) 20 (51.3) 6 (15.4) 3 0.029
AB 6 (60.0) 1(10.0) 3 (30.0)
O 51 (44.7) 43 (37.7) 20 (17.5)

The result also revealed that mutant gene was highest (60%) among AB blood group and lowest in blood group B. Similarly, the wild type resistant gene was highest (30%) in blood group AB and lowest (15.4%) in both blood group A and B. In contrast, the mixed type (mutant/wild) was highest (51.3%) in blood group B and lowest in blood AB (10%) (Table 3).

The results as presented in Table 4 revealed that there was a point mutation in the codon position 557 where the amino acid Alanine was replaced by Serine in the PfK13 detected in some of the blood samples of the participants in the current study. Table 4 also showed the codon positions in the first column, the second column showed the reference amino acid for the wild type (sensitive), the third column showed the amino acids for the mutant genes and the last column showed the observed amino acids for the test samples. The codon positions 580, 612, 476, 569, 449, 557, 458, 617 and 112 have the amino acids Cysteine (C), Glutamic Acid (E), Methionine (M), Alanine (A), Glycine (G), Alanine (A), Asparagine (N), Alanine (A) and Glycine (G) respectively for the reference amino acids.

Table 4.

Sequence comparison with global reported SNPS in pfk13

Codon position Reference amino acid (wild type) Mutant type amino acid Observed amino acid
580 C Y C
612 E D E
476 M I M
569 A S A
449 G A G
557 A S S
458 N Y N
617 A T A
*112 G E G

*Non-propeller mutation

Number of Mutant alleles Detected = 0 SNPs: single nucleotide polymorphisms Amino Acids: Cysteine (C), Glutamic Acid (E), Methionine (M), Alanine (A), Glycine (G), Asparagine (N), Tyrosine (Y), Aspartic Acid (D), Isoleucine (I), Serine (S), Threonine (T)

Figure 2 showed the screen shot of the PfK13 amino acid sequence alignment and when observed closely, there were point mutations in some of the amino sequences in some of the codon positions, for example, the amino acid Proline had replaced Alanine in the DNA sequence of the PfK13_6 species in the last yellow column, there were also two-point mutations in the 6th and 9th column of the same PfK13 species.

Fig. 2.

Fig. 2

Screen shot of PfK13 amino acid sequence alignment

DNA electrophoresis of Pfmdr1 (N86Y) and PfK13 genes

Two hundred blood samples were randomly selected from the 261 positive samples for molecular tests. The image gel in Fig. 3 showed the electropherogram of Pfmdr1 (N86Y) gene Apo1 digest products resolved on 2% Agarose gel. Restriction enzyme was used to identify the mutated gene and to express the percentages of the manifestation of various genotypes such as mutant, wild and mixed types. Lanes 1 and 10 are the 100 base pairs (bp) DNA Ladder. The loaded wells showed bands that separated from the well to a base pair of 476 bp for the mutant type, 250 bp for the wild type and 226 bp for the mixed type. The 226 bp being the lightest migrated fastest ahead of 250 bp and the 476 bp mutant genes. Lanes 2 to 5, 7 and 9 were the undigested mutant (86Y) strains. Lanes 6 and 8 were digested (wild type or the sensitive genes).

Fig. 3.

Fig. 3

Electrophoregram of Pfmdr1 (N86Y) geneApo1 digest products resolved on 2% Agarose gel. NB: Lanes 2–5, 7 & 9 = Undigested mutants (86Y) Lanes 6 & 8 = Digested wild type. Lanes 1 & 10 = 100 base pair DNA Ladder

The image in Fig. 4 showed the electropherogram of PfKelch13 propeller gene nest 2 PCR amplicons resolved on 1.0% Agarose gel. Lane 1 showed the 1.3 kB DNA ladder while lanes 2–7 showed the undigested PfKelch 13 amplicons (mutant genes).

Fig. 4.

Fig. 4

Electrophoregram of P. falciparum K-13 propeller gene nest 2 PCR amplicons resolved on 1.0% Agarose gel. NB: Lane 1 = 1.3 kb DNA ladder Lanes 2–7 = K-13 amplicons

Discussion

In the current study, the prevalence of the Pfmdr1 mutant gene among the neonates in Akure were 37.9% for neonates, 37% for infants and 40.5% for children 12 months to 5 years. These values are comparable to the reports of Muhammad et al. (2017) from some states in the northern parts of Nigeria, the authors reported prevalence of Pfmdr1 mutant gene to be 32.6% in Jigawa State, 31.1% in Kebbi State and 33.0% in Katsina State. The prevalence of Pfmdr1 mutant gene is however, higher than the prevalence of 18.9% reported in Kaduna and 11.3% in Kano (Muhammad et al. 2017). The authors also reported that prevalent across the various age groups had no clear demarcation except in age 1–5 years where highest prevalence of 31.1% was reported. Factors such as farmland activities, especially irrigation farming and late-night farming have been suggested by the author (Muhammad et al. 2017) to have contributed to increased transmission of malaria and the higher prevalence of resistance alleles obtained in Jigawa and Katsina States but the current study center is with less farming activity and more commercial activities. However, relatively round the year malaria transmission is notable in the area. The prevalence of the mutant genes in the current study is higher than the prevalence of 15.0% reported by Bui et al. (2019) in the Vietnam. Higher prevalence of mutations in Pfmdr1 confers resistance to chloroquine, artemether, mefloquine, artemisinin, ACT and non-ACT, lumefantrine, primaquine, tafenoquine, piperaquine, and mefloquine (Dokunmu et al. 2019) and this was also previously reported by other authors in Nigeria by Olasehinde et al. (2014); Oladipupo et al. 2015).

The Pfmdr1 prevalence of 38.3% observed among the males and 39.2% among the females in the current study is higher than the reports from the northern parts of Nigeria where prevalence of 32.1% and 25.7% were observed in males and females respectively. The resistant genes were common among the males in the north but there is no significant difference in the resistant genes observed between the male and female in the current study.

The nested PCR reaction showed that there was a point mutation in the codon position 557 where the amino acid Alanine was replaced by Serine in the PfK13 detected in some of the blood samples of the participants in the current study. The sequencing also revealed that there were point mutations in some of the amino sequence in some of the codon positions, the amino acid Proline had replaced Alanine in the DNA sequence of the PfK13_6 species and the electrophoresis showed the undigested PfKelch13 amplicons bands. This result is similar to findings in some African countries where K13 non synonymous polymorphisms have been reported at low frequencies in isolates in some African countries such as Cameroon, Central African Republic, Democratic Republic of the Congo, Gabon, Gambia, Kenya, Madagascar, Malawi, Mali, Rwanda, Togo, Uganda, Zambia and Equatorial Guinea (World Health Organization 2015; Isozumi et al. 2015; Gupta et al. 2018). On the other hand, K13 mutant falciparum isolates were highly prevalent in Binh Phuoc and Dak Nong provinces of Vietnam and in these 2 provinces, only the C580Y mutant was detected. In Ninh Thuan province, however, the majority of isolates had wild-type K13 and only 1 isolate with both K13 (C580Y) was reported (Bui et al. 2019). The current study is also different from the report from Mozambique where all the three hundred and fifty-one P. falciparum isolates all carried K13 wild-type alleles (3D7-like) (Gupta et al. 2018).

Conclusions

The study has been able to reveal that both PfK13 and Pfmdr 1 mutant genes were identifiable in children aged 5 years and below in Akure, Ondo State, south-west, Nigeria. The genes were identified in both genders, in all age groups, blood groups, and birth orders and these were responsible for development of resistance to so many of the drugs currently in use for the treatment of malaria; more research into the discovery of newer and more efficacious antimalarial drugs aside the ACTs currently in use for the treatment of malaria is therefore advocated.

Limitations of the study

Two hundred samples were selected from the 261 positive samples for the molecular test due to paucity of fund. However, if all the positive samples have been subjected to molecular test more malaria parasite resistant genes might have been observed. The restriction enzymes were not applied and hence the phenotypes and the percentages of the mutated genes could not be determined. Meanwhile, random sampling techniques used in the selection of the sample give a good presentation of the results.

Acknowledgements

The authors acknowledged the contribution of Dr Sola Ajibaye of the Nigerian Institute of Medical Research, Lagos, Nigeria for his technical assistance during the bench work of the molecular analysis. The authors are also grateful to Miss Wumi Aina, the research assistant, who helped in the field work. We appreciate all the health care workers of the Mother and Child Hospital, Akure and especially Dr Onov for their cooperation in collecting the samples.

Abbreviations

ACTs

Artemisinin-based combination therapies

BSA

Bovine serum albumin

Conc

Concentration

dNTPs

Deoxynucleotide triphosphateS

DNA

Deoxyribonucleic nucleic

MgCl

Magnesium chloride

mM

Millimole

ng

Nanogram

NEB Buffer

New England BIOLABS buffer

OPD

Out-patient department

Pfmdr1

Plasmodium falciparum multidrug resistance 1

PCR

Polymerase chain reaction

PfK13

Plasmodium falciparum resistant kelch protein gene on chromosome 13

rpm

Revolution per minute

RNA

Ribonucleic acid

SNPs

Single nucleotide polymorphisms

μL

Micro-litre

Vol

Volume

C

Cysteine

M

Methionine

A

Alanine

G

Glycine

I

Isoleucine

S

Serine

T

Threonine

Authors’ contribution

OJA, ORO and MOO were involved in the study design and the field work. OJA and ORO were involved in the laboratory works. Data analysis was undertaken by the authors OJA and ORO. OJA and ORO were the major contributors in writing the manuscript. All the authors read and approved the final manuscript.

Funding

No funding received.

Declarations

Competing interests

The authors declare that they have no competing interests.

Ethics approval and consent to participate

The ethics and consent concerning the use of primary data from human were observed in carrying this research.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Olajide Joseph Afolabi, Email: ojafolabi@futa.edu.ng.

Olubanke Rosena Oluwafemi, Email: bankyfem@yahoo.com.

Mobolanle Oladipo Oniya, Email: onixous@gmail.com.

References

  1. Ashley EA, Dhorda M, Fairhurst RM, Amaratunga C, Lim P, Suon S, et al. Tracking resistance to artemisinin collaboration (TRAC). spread of artemisinin resistance in Plasmodium falciparum malaria. N Engl J Med. 2014;371:411–423. doi: 10.1056/NEJMoa1314981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Biomedical Research Laboratory (BMRL) (2010) Molecular detection of malaria parasites manual Faculty of Medical Laboratory Sciences, University of Khartoum, BMRL
  3. Bui QP, Huynh QH, Tran DT, Le DT, Nguyen TQ, Truong HV, et al. Pyronaridine-artesunate efficacy and safety in uncomplicated Plasmodium falciparum malaria in areas of artemisinin-resistant falciparum in viet nam. Clin Infect Dis. 2019;70:2187–2195. doi: 10.1093/cid/ciz580. [DOI] [PubMed] [Google Scholar]
  4. Dokunmu TM, Adjekukor CU, Yakubu OF, Bello AO, Adekoya JO, Akinola O, et al. Asymptomatic malaria infections and Pfmdr1 mutations in an endemic area of Nigeria. Malar J. 2019;18:218. doi: 10.1186/s12936-019-2833-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Federal Ministry of Health (2010) A road map for malaria control in Nigeria, abridged version, Abuja. Strategic plan 2009–2013. Yahian, Press Ltd p155
  6. Gupta H, Macete E, Bulo H, Salvador C, Warsame M, Carvalho E, et al. Drug-resistant polymorphisms and copy numbers in Plasmodium falciparum in Mozambique. Emerg Infect Dis. 2018;24(1):40. doi: 10.3201/eid2401.170864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Isozumi R, Uemura H, Kimata I, Ichinose Y, Logedi J, Omar AH, et al. Novel mutations in K13 propeller gene of artemisinin resistant Plasmodium falciparum. Emerg Infect Dis. 2015;21:490–492. doi: 10.3201/eid2103.140898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Jena Bioscience (2015) Data sheet of blood-animal-plant DNA Preparation Kit. Spin column based genomic DNA purification from blood, animal and plant cells. Jena Biosci 213.
  9. Luxemburger CAB, Silamut K, Nosten F, van Vugt M, Gimenez F, Chongsuphajaisiddhi T, et al. Two patients with falciparum malaria and poor in vivo responses to artesunate. Trans Royal Soc Trop Med Hyg. 1998;92:668–669. doi: 10.1016/S0035-9203(98)90807-0. [DOI] [PubMed] [Google Scholar]
  10. Muhammad RH, Nock IH, Ndams IS, George JB, Deeni Y. Distribution of pfmdr1 and pfcrt chloroquine drug resistance alleles in north-western Nigeria. Malar World J. 2017;8:15. [PMC free article] [PubMed] [Google Scholar]
  11. Oladipupo OO, Wellington OA, Sutherland CJ. Persistence of chloroquine resistant haplotypes of Plasmodium falciparum in children with uncomplicated malaria in Lagos, Nigeria, four years after change of chloroquine as first-line antimalarial medicine. Diagn Pathol. 2015;10:41. doi: 10.1186/s13000-015-0276-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Olasehinde GI, Ojurongbe OO, Fagade EO, Ruchi S, Egwari LO, Ajayi AA, et al. Detection of molecular markers of antimalarial drug resistance in Plasmodium falciparum from south-western, Nigeria. Covenant J Phys Life Sci. 2014;1(2):61–75. [Google Scholar]
  13. Simon-Oke IA, Obimakinde T, Afolabi OJ. Prevalence and distribution of malaria, Pfcrt and Pfmdr 1 genes in patients attending FUTA health centre, Akure, Nigeria. Beni-Suef Univ J Basic Appl Sci. 2013;7:98–103. [Google Scholar]
  14. Vathsala PG, Pramanik A, Dhanasekaran S, Devi CU, Pillai CR, Subbarao SK, et al. Widespread occurrence of the Plasmodium falciparum chloroquine resistance transporter (Pfcrt) gene haplotype SVMNT in P. falciparum malaria in India. Am J Trop Med Hyg. 2004;70:256–259. doi: 10.4269/ajtmh.2004.70.256. [DOI] [PubMed] [Google Scholar]
  15. WHO (2010) Global report on antimalarial drug efficacy and drug resistance: 2000–2010. Geneva
  16. WHO (2014) Antimicrobial resistance: global report on surveillance. http://apps.who.int/iris/bitstream/10665/112642/1/9789241564748_eng.pdf
  17. William N, Ogala A, Adeola A, Orogade M, Mokuolu OA. Malaria. In: Azubuike JC, Nkaginieme KOE, Ezechukwu C, Nte AR, Adedoyin OT, editors. Paediatrics and child health in a tropical region. 3. Educational Printing and Publishing; 2016. pp. 525–545. [Google Scholar]
  18. World Health Organization (2015) Status report on artemisinin and ACT resistance. [2 screens] Available at: http://www.who.int/malaria/publications/atoz/status-rep-artemisinin-resistance sept2015.pdf. Accessed January 2020
  19. Yohanna JA, Gau PC, Adejoh VA. Prevalence of malaria parasites in children at vom christian hospital, Jos South, Plateau State Nigeria. Niger J Parasitol. 2019;40:152–157. doi: 10.4314/njpar.v40i2.5. [DOI] [Google Scholar]

Articles from Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology are provided here courtesy of Springer

RESOURCES