Abstract
Lungfish are the most closely related fish to tetrapods. The olfactory organ of lungfish contains lamellae and abundant recesses at the base of lamellae. Based on the ultrastructural and histochemical characteristics, the lamellar olfactory epithelium (OE), covering the surface of lamellae, and the recess epithelium, contained in the recesses, are thought to correspond to the OE of teleosts and the vomeronasal organ (VNO) of tetrapods. With increasing body size, the recesses increase in number and distribution range in the olfactory organ. In tetrapods, the expression of olfactory receptors is different between the OE and VNO; for instance, the type 1 vomeronasal receptor (V1R) is expressed only in the OE in amphibians and mainly in the VNO in mammals. We recently reported that V1R-expressing cells are contained mainly in the lamellar OE but also rarely in the recess epithelium in the olfactory organ of lungfish of approximately 30 cm body length. However, it is unclear whether the distribution of V1R-expressing cells in the olfactory organ varies during development. In this study, we compared the expression of V1Rs in the olfactory organs between juveniles and adults of the African lungfish Protopterus aethiopicus and South American lungfish, Lepidosiren paradoxa. The density of V1R-expressing cells was higher in the lamellae than in the recesses in all specimens evaluated, and this pattern was more pronounced in juveniles than adults. In addition, the juveniles showed a higher density of V1R-expressing cells in the lamellae compared with the adults. Our results imply that differences in lifestyle between juveniles and adults are related to differences in the density of V1R-expressing cells in the lamellae of lungfish.
Supplementary Information
The online version contains supplementary material available at 10.1186/s40851-023-00202-z.
Keywords: Evolution, In situ hybridization, Lungfish, RNA-seq, Vomeronasal organ, Vomeronasal receptors
Background
Most tetrapods, with some exceptions such as birds and humans, possess two anatomically distinct olfactory organs: the olfactory epithelium (OE) and the vomeronasal organ (VNO). The OE and the VNO send axons to the main and accessory olfactory bulbs, respectively [1]. The OE and the VNO of tetrapods were formerly thought to have distinct functions: the OE detects general odorants, and the VNO detects pheromones. However, recent studies suggest that the OE and the VNO have partially overlapping functions and act synergistically [2–4].
There is no VNO in the fish olfactory organ. Ciliated olfactory receptor cells (ORCs) and microvillous ORCs are intermingled in the OE of teleosts [5], whereas the ciliated and microvillous ORCs are distributed separately in the OE and VNO of mammals [6]. It has been suggested that the ciliated and microvillous ORCs were intermingled in the OE of common ancestors, but they have separated during evolution, giving rise to the mammalian OE and VNO containing ciliated and microvillous ORCs, respectively [5, 7]. The African clawed frog Xenopus, an amphibian that spends its entire life under water, has two main olfactory organs: the OE, which contains mainly ciliated ORCs, and the middle chamber epithelium, which contains both ciliated and microvillous ORCs. In addition, Xenopus has a VNO, which contains microvillous ORCs [8, 9]. The ultrastructural features of the Xenopus olfactory organs represent an intermediate step to the separated distribution of ciliated and microvillous ORCs.
Major olfactory receptor families of vertebrates, including odorant receptors (ORs), trace amine-associated receptors (TAARs), and type 1 and type 2 vomeronasal receptors (V1Rs and V2Rs), are G protein-coupled receptors; ORs and TAARs are coupled with Golf, V1Rs with Gi2, and V2Rs with Go [10, 11]. The signal transduction of ORs and TAARs involves cyclic nucleotide-gated channel alpha 2 [11, 12], whereas that of both V1Rs and V2Rs involves transient receptor potential channel 2 (TRPC2) [13]. From teleosts to mammals, ORs and TAARs are generally expressed by ciliated ORCs, and the V1Rs and V2Rs are expressed by microvillous ORCs [3, 5, 6, 11, 14]. In teleosts, all of the olfactory receptor families are expressed in the OE containing both ciliated and microvillous ORCs. In tetrapods, the olfactory receptor expression is segregated between the OE and VNO. In mammals, the ORs and TAARs are expressed in the OE containing ciliated ORCs, whereas the V1Rs and V2Rs are expressed in the VNO containing microvillous ORCs [15]. In addition, in amphibians, V1Rs are expressed in the OE and middle chamber epithelium, but not in the VNO [16].
The OE and VNO are classified as the main and accessory olfactory organs, respectively. Other than tetrapods, sea lamprey (Cyclostomata) and Polypterus (basal actinopterygians) have accessory olfactory organs [17–20]. However, in terms of the fine structure of ORCs and the expression of olfactory receptors, the accessory olfactory organs of sea lamprey and Polypterus are identical to the main olfactory organ (OE), although they are anatomically separated from the OE.
Lungfish are members of the Sarcopterygii and most closely related to tetrapods. They have two types of sensory epithelia in the olfactory organ: the lamellar OE covering the lamellar surface and the recess epithelium (RecE) contained in recesses at the base of lamellae. The lamellar OE and RecE are considered to correspond to the teleost OE and tetrapod VNO, respectively, based on the fine structure of ORCs, G-protein expression, and axonal projections to the olfactory bulbs [21–26]. In addition, the number and distribution of recesses vary among differently sized individuals of the African and South American lungfish [25, 27]. Also, in two species of the African lungfish, Protopterus annectens and P. amphibius, V1R-expressing cells are distributed mainly in the lamellar OE and slightly in the RecE [28]. However, it is unclear whether the distribution of V1R-expressing cells varies among individuals of different body sizes. In this study, we compared V1R expression in the lungfish olfactory organ among individuals of different body sizes to determine whether the distribution of V1R-expressing cells changes with growth stage.
Materials and methods
Animals
All procedures were approved by the local Animal Ethics Committee of Iwate University. The African lungfish P. aethiopicus and South American lungfish, L. paradoxa, were purchased from commercial suppliers. The fishes were anesthetized with tricaine methanesulfonate and euthanized by decapitation. Information pertaining to the animals is shown in Table 1. Juvenile and adult individuals of each lungfish were used. According to Mlewa and Green (2004) [29] and Jorgensen and Joss (2010) [30], P. aethiopicus individuals over 43 cm in body length (BL) reach sexual maturity. Thus, P. aethiopicus #1 (BL 50 cm) and L. paradoxa #1 (BL 65 cm) were regarded as adults, whereas P. aethiopicus #2–4 and L. paradoxa #3 (BL 35 cm or less) were regarded as juveniles [29, 30]. Also, we confirmed during dissection whether they had functional genital organs or not.
Table 1.
Animals
| Animal No | Total body length (cm) | Body weight (g) | Sex | Application | |
|---|---|---|---|---|---|
| P. aethiopicus | 1 | 50.0 | 349.0 | F | ISH (left)/RNA extraction (right) |
| 2 | 35.0 | 150.6 | M | Dice CT | |
| 3 | 31.5 | 100.0 | unknown | ISH | |
| 4 | 34.0 | 118.3 | F | SEM | |
| L. paradoxa | 1 | 65.0 | 994.5 | F | RNA extraction (left)/ISH (right) |
| 3 | 18.5 | 18.6 | M | ISH |
ISH in situ hybridization; Dice CT Diffusible iodine-based contrast-enhanced computed tomography; SEM Scanning Electron Microscopy
For histological examination, olfactory organs were dissected from the heads and fixed in 4% paraformaldehyde in 0.1 M phosphate buffer (PB, pH 7.4). The specimens were cryoprotected in a sucrose gradient (10%, 20%, and 30% in 0.1 M PB), embedded in O.C.T. compound (Sakura Finetek, Tokyo, Japan), and sectioned sagittally using a cryostat. Sections (20 µm in thickness) were thaw mounted on MAS-coated slides (Matsunami, Osaka, Japan), air-dried, and processed for hematoxylin–eosin staining, immunohistochemistry, and in situ hybridization.
Diffusible iodine-based contrast-enhanced computed tomography (diceCT)
The diffusible iodine-based contrast-enhanced computed tomography (diceCT) procedure followed a previous study [31]. The olfactory organ was fixed in 4% paraformaldehyde in 0.1 M PB (pH 7.4) and stained with an aqueous solution of Lugol’s iodine (I2KI), 1% I2 and 2% KI in deionized water, for several days at room temperature (RT). Specimens were scanned using a microfocus X-ray CT system, inspeXio SMX-90CT (Shimadzu Corporation, Kyoto, Japan). The diceCT data were analyzed and visualized using VGStudio MAX software (System Create, Osaka, Japan).
Scanning Electron Microscopy (SEM)
For Scanning Electron Microscopy (SEM), the olfactory organ was fixed in 2.5% glutaraldehyde in 0.1 M PB (pH 7.4) and postfixed in 1% osmium tetroxide. The dehydrated specimens were dried with t-butyl alcohol using a freeze dryer, ES2030 (Hitachi, Tokyo, Japan). The specimens were coated with osmium and examined by SEM (JSM7001F; JEOL, Tokyo, Japan).
Immunohistochemistry
Immunohistochemistry using a rabbit anti-neural cell adhesion molecule (NCAM) antibody (AB5032, Millipore, Burlington, MA) and rabbit anti-Gαo antibody (551, MBL, Tokyo, Japan) was performed using olfactory organ sections from lungfish as described previously [23, 28]. Sections were incubated with each primary antibody overnight at 4°C, washed, and then incubated with a secondary antibody, Alexa Fluor 488-donkey anti-rabbit IgG (A21208, Thermo Fisher Scientific, Waltham, MA) for 2 h at RT. The sections were mounted in VectaShield mounting medium with DAPI (H-1200, Vector Laboratories, Burlingame, CA).
Identification of lungfish V1R genes
Total RNA extracted from the olfactory organs using the ISOGEN reagent (Nippon Gene, Tokyo, Japan) was analyzed by RNA sequencing as described previously [28]. Briefly, the NovaSeq 6000 instrument was used (Illumina, San Diego, CA, USA), and reads were deposited in the DDBJ Sequence Read Archive (accession No. DRA015344 for P. aethiopicus and DRA015345 for L. paradoxa). De novo transcriptome assembly was performed using Bridger software [32]. We then used FATE (https://github.com/Hikoyu/FATE/commits/master) to search the V1R genes for assembled contig sequences. The V1R amino-acid sequences of two lungfish obtained in this study were aligned using MAFFT (ver. 7.475) [33] to those of a previous study [28]. Phylogenetic trees were constructed using the maximum likelihood method employing the best-fitting model of RAxML (ver. 8.2.12) [34], as estimated using the modeltest function of MEGA X [35]. Rapid bootstrap analyses were performed using 1,000 replicates to assess node reliability. The phylogenetic tree was visualized with FigTree (ver. 1.4.4; http://tree.bio.ed.ac.uk/software/figtree/).
Reverse transcription PCR and gene cloning
The nucleotide sequences of primers specific to the V1R genes of P. aethiopicus and L. paradoxa are shown in Table 2. cDNA was synthesized from total RNA derived from the olfactory organs using oligo dT primers and ReverTra Ace (Toyobo, Osaka, Japan) according to the manufacturer’s protocol. PCR was performed using the cDNA as the template together with Ex Taq (Takara, Shiga, Japan). The PCR products were analyzed by 1.5% agarose gel electrophoresis.
Table 2.
Primers for V1Rs
| Probe name | Target V1R gene | Product size (bp) | Forward primer (5 > 3) | Reverse primer (5 > 3) |
|---|---|---|---|---|
| Paeth01 | P. aethiopicus V1R23 (ancV1R) | 597 | CCCACAGTTAGCTGGCGTAA | GGTTTTGGCATGCCTCATGG |
| Paeth02 | P. aethiopicus V1R52 | 403 | CATTGGTTTGACCTGCCTGC | CTCTGCTCCAGCTTCCTGAC |
| Paeth03 | P. aethiopicus V1R53 | 566 | AGCCTAGCATGCTCAAACCT | ACCACCATCTTGGATGCCTG |
| Paeth04 | P. aethiopicusV1R55 | 551 | TGCTGTTGGCCTTGCAAGTA | TTGCCACAGCCATAAGGACT |
| Paeth05 | P. aethiopicusV1R69 | 599 | TGCTAAGCTGCTTCCAGTGT | AGAGTGGCAAGTCACTGCAT |
| Paeth06 | P. aethiopicusV1R71 | 658 | CTTCTGACTGGGGGTGTTCC | CCAAGGACAGAAAATGCCGC |
| Paeth07 | P. aethiopicusV1R83 | 596 | ACTTGCCAACCCACCAAGAA | GAAATGCAACGTCACGAGCA |
| Paeth08 | P. aethiopicusV1R94 | 563 | CGTGTTTGTCGAGCGATGTC | GCAAAGAAGACACGGGCATC |
| Paeth09 | P. aethiopicusV1R103 | 545 | CTTTTCACGCTGGGACTTCC | GTGACAACAGTCTTGGCAGC |
| Paeth10 | P. aethiopicusV1R111 | 543 | GGGGCAAACCTGTTACTCCT | TGCTTGTAGCTCTGCTGTGG |
| Paeth11 | P. aethiopicusV1R116 | 523 | CGAGAGGCATTCCTGAACCA | TTAGCTGCCTGACCTTCTGC |
| Paeth12 | P. aethiopicusV1R119 | 402 | GACAAGTACTGGTGTTCTGGGT | TAAAGGAGCAGGCCACAACA |
| Paeth13 | P. aethiopicusV1R136 | 477 | TGATCCTTTGCAACCTGGGA | ACAAAATGTTGCTGCTGGCC |
| Paeth14 | P. aethiopicusV1R140 | 589 | CCGTGTTTTTCGAGCGATGT | AGGACTGACAGCAGCATACA |
| Paeth15 | P. aethiopicusV1R141 | 513 | CCAGAGGAATGCCACAGACA | CCCTGGCTTCAGCTGAAACA |
| Paeth16 | P. aethiopicusV1R144 | 432 | CACTGAACTGGCAGGGACAA | ATCAGGTCACGGGCAAAACT |
| Paeth17 | P. aethiopicusV1R148 | 645 | TCAGAGCTGTCAGTGGCAAA | CCGTGACACTGATGCCTGAT |
| Paeth18 | P. aethiopicusV1R159 | 393 | CAAGTACTGGAGTCTTGGGCA | GCAGGCCACAATGCATAACC |
| Paeth19 | P. aethiopicusV1R160 | 695 | TGGAAACATCACATCCGGCA | TGCTTGCTTCTCTGCTGTGA |
| Paeth20 | P. aethiopicusV1R166 | 525 | TACCCGAGGTCTTCCAGCAA | GCTGCTTTCACCTCTACAGC |
| Paeth21 | P. aethiopicusV1R198 | 410 | GTAGTAAGCGGCATCCCTGG | ACAGTGTACATTGGTGGGCT |
| Paeth22 | P. aethiopicusV1R208 | 527 | GGTTGTGCTGACAGTAGGCA | CTTGGGCTTCTGCACTGTTC |
| Paeth23 | P. aethiopicusV1R213 | 549 | ATGGTTGCTTTGCTGTCACG | TACAACCGACTTTGCAGCCT |
| Paeth24 | P. aethiopicusV1R218 | 539 | AGCTTCACAAAAGGGGCCAT | GCAAAGCCGTTCACCTGAAA |
| Paeth25 | P. aethiopicusV1R227 | 520 | CAAGAGGGGTTCCAGACTGT | GCTGCTCTGTTCTCTGCTGT |
| Paeth26 | P. aethiopicusV1R257 | 305 | CTCTGTGTGCTTGCTATGGC | ACTGTTTTTGCTGCTTGGCC |
| LP01 | L. paradoxa V1R20 (ancV1R) | 599 | TACTGTTAGCTGGCGCAACA | TCTGCGTTTGGGGATTCCTC |
| LP02 | L. paradoxa V1R59/L. paradoxa V1R60 | 620 | AATGAGCTGCCCCAAACTGA | AGGTGACAACAGTTCGCGTA |
| LP03 | L. paradoxa V1R64 | 640 | ACAGTTACTGGAGCTGTGGG | TCTCTGCACTGTTCTCCAGC |
| LP04 | L. paradoxa V1R65 | 543 | ACCTGTCAACAGCAAACCTGA | TTGCTGCTTGACTCTCTGCA |
| LP05 | L. paradoxa V1R70 | 525 | TGCAAGAGGAGTGCCACAAA | GATTTTGCTGCCCTGGCTTC |
| LP06 | L. paradoxa V1R80 | 552 | ACCAGCAAACCTCACCATCA | ATGTAGCTGCTGGCAAGTGT |
| LP07 | L. paradoxa V1R89 | 554 | TTGCTGTCCGGAGTAAACCT | GCTGCTTGGCTTTCTGCATT |
| LP08 | L. paradoxa V1R92/L. paradoxa V1R93 | 490 | GGATCAGTGTCCTGGACAGC | TGAGGTCACGGCCAAAAAGA |
| LP09 | L. paradoxa V1R99 | 652 | CAGGTCTCTCTGGGGACTGA | AGGCAAAGTGTTGAGGCAGT |
| LP10 | L. paradoxa V1R103/L. paradoxa V1R104 | 510 | ACTTGGCCATCACTGGATCC | CCACCATGAGATCTCGGCTG |
| LP11 | L. paradoxa V1R120/L. paradoxa V1R121 | 439 | TCACATCCCACCTTGCTTTT | ATTACAGCATCACGCCCTGT |
| LP12 | L. paradoxa V1R127 | 707 | CTGCCCATGGTCTTCTCCAA | AATGGGGTCTCACCTGTTGC |
| LP13 | L. paradoxa V1R130 | 556 | TCCTGCCAACATTGCCATCT | AAAAAGGATTGCTGCGCTGG |
| LP14 | L. paradoxa V1R139 | 412 | TATCACGCGGCATGGCTATT | GACTCGGTGCGATCCTTCAT |
| LP15 | L. paradoxa V1R142 | 524 | AGTGTGTGAGTGTCAGTGCA | TGCAGCATAGCACATCGAGA |
| LP16 | L. paradoxa V1R172 | 540 | GAGCTGCTTCCAGTATGCCA | ACTGAAGCATAGCACGTGGA |
For RNA probe synthesis, each PCR product was subcloned into the pCRII-TOPO vector using the TOPO TA Cloning Kit Dual promotor (Thermo Fisher Scientific). Next, the sequence of each clone was verified. Closely related V1R genes cannot be distinguished due to their high sequence identity, so some probes (LP02, LP08, LP10, and LP11) were expected to detect multiple V1R genes (Table 2).
In situ hybridization
Digoxigenin (DIG)-labeled sense and antisense RNA probes were synthesized from plasmids linearized with restriction enzymes using the DIG RNA Labelling Kit (SP6/T7) (Sigma-Aldrich, St. Louis, MO). After being treated with DNase and EDTA, probes were precipitated with ethanol, dissolved in water, aliquoted, and stored at − 80°C until use. Sections were fixed in 4% (w/v) paraformaldehyde in 0.1 M PB for 10 min at RT, treated with 40 µg/mL proteinase K for 15 min at 37°C, and immersed in 0.1% (v/v) acetic anhydrate in the acetylation buffer for 15 min at RT. Hybridization was performed in the hybridization buffer ISHR7 (Nippon Gene) overnight at 55°C. Post-hybridization washing was performed in formamide/2 × saline-sodium citrate (SSC) for 1 h and 0.1 × SSC for 2 h at 55°C. The sections were incubated with anti-DIG antibody coupled to alkaline phosphatase (Roche Diagnostics, Basel, Switzerland) for 2 h at RT, and color was developed using NBT/BCIP stock solution (Roche) for signal detection.
V1R-expressing cell density
In sections subjected to in situ hybridization using each V1R probe, labeled cells in the lamellae and recesses were counted, and their areas were measured using ImageJ software (https://imagej.nih.gov/ij/) as described previously [28]. The number of labeled cells in the lamellae or recesses was divided by the respective area to calculate the density of labeled cells for each probe (number of labeled cells per 1 mm2).
Results
In the olfactory organ of lungfish, lamellae were arranged on the medial and lateral sides of the midline raphe, and recesses were abundant at the base of lamellae (Fig. 1). The surface of lamellae was covered with lamellar OE and non-sensory epithelium (Fig. 2a). The recesses consisted of RecE and glandular epithelium (GE) (Figs. 2b, 3a1, a3). The overall histological and histochemical features of the olfactory organ were shared by P. aethiopicus (Fig. 3a1–a7) and L. paradoxa (Fig. 3b1,b2): In the lamellar OE, nuclei of the ORCs were located in the basal to middle layer, and those of supporting cells were located in the superficial layer (Fig. 3a2). The lamellar OE and RecE were immunopositive for the neuronal marker NCAM and thus distinguished from the non-sensory epithelium immunonegative for NCAM (Fig. 3a4, a5). The ORCs located in the basal layer of the lamellar OE and the majority of ORCs in the RecE were immunopositive for Gαo, an α subunit of the G protein coupled to V2Rs (Fig. 3a6, a7, b1, b2). In P. aethiopicus and L. paradoxa, Gαo-expressing ORCs were distributed in the RecE and basal layer of the lamellar OE: these histological and histochemical characteristics were shared between adults and juveniles, and were consistent with those reported in the olfactory organs of P. annectens and P. dolloi [21, 22].
Fig. 1.
Diffusible iodine-based contrast-enhanced computed tomography images of the olfactory organ in P. aethiopicus. The right olfactory organ viewed from the ventral (a), dorsal (b) and medial (c) aspects. Higher magnification view of (c) is shown in (c’). Lamellae were arranged on the medial and lateral sides of the midline raphe (arrowheads). Recesses were abundantly present at the base of lamellae. The recesses are highlighted by red-shaded circles in (c’)
Fig. 2.

Scanning electron microscopy of a lamella cut out from the olfactory organ of P. aethiopicus. (a) Surface of the lamella covered with the non-sensory epithelium (asterisks) and lamellar OE (LOE). (b) Higher magnification view of a recess at the base of lamella consisting the recess epithelium (RecE) and glandular epithelium (GE). Scale bars: 100 µm
Fig. 3.

Structure of the olfactory organ of P. aethiopicus (a1-a7) and L. paradoxa (b1-b2). (a1) A sagittal section of the olfactory organ stained with hematoxylin–eosin, showing lamellae suspending from the dorsal wall. Dorsal is top, rostral is left. Recesses are found at the base of lamellae (arrows). (a2) The lamellar OE stained with hematoxylin–eosin showing round nuclei of the olfactory receptor cells (ORC) in the basal to middle layer, and oval nuclei of the supporting cells (Sp) in the upper layer. The lamellar OE and non-sensory epithelium (asterisks) are arranged alternately. (a3) A recess stained with hematoxylin–eosin consisting of the recess epithelium (RecE) which contains several layers of cells with round nuclei, and the glandular epithelium (GE) which contains eosinophilic cytoplasm and basally located round nuclei. (a4) The layer of ORCs immunopositive for NCAM and the non-sensory epithelium (asterisks) immunonegative for NCAM. (a5) The RecE immunopositive for NCAM and the GE immunonegative for NCAM. (a6 and b1) The basal layer of lamellar OE is immunopositive for Gαo. (a7 and b2) Most ORCs in the RecE are immunopositive for Gαo. GE is immunonegative for Gαo. Scale bars: 500 µm in (a1), 50 µm in (a2–a7, b1, b2)
V1R genes expressed in the olfactory organs of two species of lungfish were identified by RNA-seq analysis. We found 26 V1R genes in P. aethiopicus and 20 in L. paradoxa, of which the nucleotide sequences are shown in Supplementary Data S1 and S2. The phylogenetic tree of four lungfish and six representative vertebrates suggested that the V1Rs can be divided into two major groups, fish-type and tetrapod-type (Fig. 4), which is consistent with previous studies [28, 36]. Except for ancV1R, all of the four lungfish V1Rs were of the tetrapod-type, and monophyly was supported by the near-maximum bootstrap probability (Fig. 4). Notably, the lungfish V1Rs tend to form clusters in each species, suggesting an increase via species-specific gene duplications.
Fig. 4.
Phylogenetic tree of V1R genes of four lungfish. The names of the sequences are as follows: Pae, P. aethiopicus; Lpa, L. paradoxa; Pan, P. annectens; Pam, P. amphibius; Ola, medaka; Gac, stickleback; Dre, zebrafish; Lch, coelacanth; Xtr, tropical clawed frog; and Bta, cow. Newly identified lungfish V1Rs are indicated in blue (P. aethiopicus) and orange (L. paradoxa). Scale bars indicate the number of amino acid substitutions per site. T2Rs (bitter-taste receptors) were used as the outgroup. Bootstrap values higher than 80 were shown only for major nodes of the phylogenetic tree. Tetrapod-type and fish-type V1Rs are indicated by dotted and double lines, respectively
Reverse-transcription PCR of the adult olfactory organs using the primers shown in Table 2 resulted in DNA fragments of the expected size for all V1R genes, indicating that these V1Rs are expressed in the lungfish olfactory organ (Fig. 5). Next, using probes prepared from these PCR products, in situ hybridization was conducted to visualize V1R expression in the lungfish olfactory organ.
Fig. 5.

RT-PCR analysis for the expression of V1Rs in the olfactory organ of P. aethiopicus (a) and L. paradoxa (b). All V1Rs analyzed in this study are expressed in the olfactory organ. Lane M: FastGene100bp DNA ladder
V1R expression in the olfactory organ of adult L. paradoxa and P. aethiopicus is shown in Fig. 6 and Supplementary Fig. S1, respectively. In both lungfishes, ancV1Rs (Paeth1, LP1) were expressed in RecE and the basal layer of lamellar OE (Fig. 6, Supplementary Fig. S1). This is consistent with the expression pattern of ancV1R in the P. annectens olfactory organ [20]. Aside from ancV1R, signals for all V1Rs were detected in the lamellar OE in adult L. paradoxa (Fig. 6, Table 3). In adult P. aethiopicus, signals for all probes except Paeth24 were detected in the lamellar OE (Supplementary Fig. S1, Table 4). By contrast, no signal was detected for any probe except LP8 in the recesses of L. paradoxa (Fig. 6), and no signal was detected for any probe in the recesses of P. aethiopicus (not shown). The lack of signals in the recesses by single probe in situ hybridization suggests the presence of very few or no V1R-expressing cells in the recesses. To address this issue, in situ hybridization was conducted using a mixture of all V1R probes except ancV1R to examine the number and distribution of V1R-expressing cells. In P. aethiopicus (Supplementary Figs. S2, S3) and L. paradoxa (Supplementary Figs. S4, S5), signals were distributed mainly in the lamellar OE, but slightly in the recesses, in both juveniles and adults (Table 5). In P. aethiopicus, the densities of V1R-expressing cells in the lamellae and recesses were 36 and 0.75 cells/mm2 in the adult vs. 61 and 0.09 cells/mm2 in the juvenile, respectively. Thus, the density of V1R-expressing cells was approximately 48-fold higher and 670-fold higher in the lamellae than in the recesses in the adult and the juvenile, respectively (Table 5). In L. paradoxa, the densities of V1R-expressing cells in the lamellae and recesses were 15 and 0.33 cells/mm2 in the adult vs. 28 and 0.12 cells/mm2 in the juvenile, respectively. Thus, the density of V1R-expressing cells was approximately 45-fold higher and 230-fold higher in the lamellae than in the recesses in the adult and the juvenile, respectively (Table 5).
Fig. 6.
V1R expression in the lamellar OE (a) and recess (b) of L. paradoxa. a Signals for ancV1R in the basal to middle layer of the lamellar OE (double-headed arrow in LP01) and punctate signals for the other V1Rs (LP02–LP16) in the basal to middle layer of the lamellar OE. Black spots around the epithelium (for example, arrowhead in LP14) are melanophore aggregations. b Signals for ancV1R in most ORCs of the RecE and a signal for LP08 in the RecE. Scale bars: 100 µm
Table 3.
Density of cells labeled by single probes for V1Rs in the lamellae of L. paradoxa
| L. paradoxa #1 | ||||
|---|---|---|---|---|
| Probes | Target V1R gene(s) | Number of labeled cells | Area of lamellae (mm2) | Density (cells/mm2) |
| LP02 | L. paradoxa V1R59/L. paradoxa V1R60 | 36 | 10.78 | 3.34 |
| LP03 | L. paradoxa V1R64 | 26 | 11.17 | 2.33 |
| LP04 | L. paradoxa V1R65 | 16 | 10.32 | 1.55 |
| LP05 | L. paradoxa V1R70 | 13 | 10.86 | 1.20 |
| LP06 | L. paradoxa V1R80 | 9 | 10.45 | 0.86 |
| LP07 | L. paradoxa V1R89 | 3 | 10.51 | 0.29 |
| LP08 | L. paradoxa V1R92/L. paradoxa V1R93 | 25 | 10.66 | 2.35 |
| LP09 | L. paradoxa V1R99 | 20 | 10.95 | 1.83 |
| LP10 | L. paradoxa V1R103/L. paradoxa V1R104 | 8 | 10.79 | 0.74 |
| LP11 | L. paradoxa V1R120/L. paradoxa V1R121 | 7 | 9.07 | 0.77 |
| LP12 | L. paradoxa V1R127 | 29 | 10.63 | 2.73 |
| LP13 | L. paradoxa V1R130 | 7 | 30.15 | 0.23 |
| LP14 | L. paradoxa V1R139 | 3 | 9.27 | 0.32 |
| LP15 | L. paradoxa V1R142 | 8 | 9.57 | 0.84 |
| LP16 | L. paradoxa V1R172 | 7 | 9.39 | 0.75 |
| Total | 20.11 | |||
Table 4.
Density of cells labeled by single probes for V1Rs in the lamellae of P. aethiopicus
| P. aethiopicus#1 | ||||
|---|---|---|---|---|
| Probes | Target V1R gene | Number of labeled cells | Area of lamellae (mm2) | Density (cells/mm2) |
| Paeth02 | P. aethiopicusV1R52 | 18 | 5.97 | 3.02 |
| Paeth03 | P. aethiopicusV1R53 | 31 | 5.97 | 5.19 |
| Paeth04 | P. aethiopicusV1R55 | 25 | 5.82 | 4.30 |
| Paeth05 | P. aethiopicusV1R69 | 16 | 5.90 | 2.71 |
| Paeth06 | P. aethiopicusV1R71 | 6 | 6.29 | 0.95 |
| Paeth07 | P. aethiopicusV1R83 | 20 | 6.04 | 3.31 |
| Paeth08 | P. aethiopicusV1R94 | 3 | 6.05 | 0.50 |
| Paeth09 | P. aethiopicusV1R103 | 8 | 5.95 | 1.34 |
| Paeth10 | P. aethiopicusV1R111 | 4 | 5.82 | 0.69 |
| Paeth11 | P. aethiopicusV1R116 | 6 | 5.76 | 1.04 |
| Paeth12 | P. aethiopicusV1R119 | 5 | 5.95 | 0.84 |
| Paeth13 | P. aethiopicusV1R136 | 1 | 6.04 | 0.17 |
| Paeth14 | P. aethiopicusV1R140 | 3 | 5.90 | 0.51 |
| Paeth15 | P. aethiopicusV1R141 | 11 | 4.88 | 2.25 |
| Paeth16 | P. aethiopicusV1R144 | 8 | 5.55 | 1.44 |
| Paeth17 | P. aethiopicusV1R148 | 10 | 5.96 | 1.68 |
| Paeth18 | P. aethiopicusV1R159 | 12 | 6.22 | 1.93 |
| Paeth19 | P. aethiopicusV1R160 | 7 | 6.55 | 1.07 |
| Paeth20 | P. aethiopicusV1R166 | 5 | 6.56 | 0.76 |
| Paeth21 | P. aethiopicusV1R198 | 2 | 6.31 | 0.32 |
| Paeth22 | P. aethiopicusV1R208 | 9 | 6.21 | 1.45 |
| Paeth23 | P. aethiopicusV1R213 | 8 | 5.84 | 1.37 |
| Paeth24 | P. aethiopicusV1R218 | 0 | 5.39 | 0.00 |
| Paeth25 | P. aethiopicusV1R227 | 3 | 5.53 | 0.54 |
| Paeth26 | P. aethiopicusV1R257 | 1 | 5.15 | 0.19 |
| Total | 37.57 | |||
Table 5.
Density of cells labeled by mixed probes for V1Rs
| Number of labeled cells | Area (mm2) | Density (cells/mm2) | Lamella/Resess ratio of V1R density | ||
|---|---|---|---|---|---|
| P. aethiopicus #1 | Lamellae | 1168 | 32.76 | 35.65 | 47.66 |
| Recesses | 9 | 12.03 | 0.75 | ||
| P. aethiopicus #3 | Lamellae | 874 | 14.40 | 60.71 | 670.93 |
| Recesses | 1 | 11.05 | 0.09 | ||
| L. paradoxa #1 | Lamellae | 764 | 51.13 | 14.94 | 45.27 |
| Recesses | 6 | 18.16 | 0.33 | ||
| L. paradoxa #3 | Lamellae | 1352 | 49.06 | 27.56 | 229.67 |
| Recesses | 1 | 8.49 | 0.12 | ||
In addition, the density of V1R-expressing cells was higher in juvenile than adult lamellae (36 vs. 61 cells/mm2 in P. aethiopicus and 15 vs. 28 cells/mm2 in L. paradoxa) (Table 6, Fig. 7).
Table 6.
Comparison of V1R-expressing cell density in the lamellae between adult and juvenile
| Total body length (cm) | Number of sections analyzed | Area (mm2)a | Number of cells expressing V1Rsa | V1R density in lamellae (cells/mm2)a | ||
|---|---|---|---|---|---|---|
| P. aethiopicus #1 | adult | 50.0 | 5 | 6.55 ± 0.25 | 233.60 ± 23.27 | 35.6 ± 2.45 |
| P. aethiopicus #3 | juvenile | 31.5 | 5 | 2.88 ± 0.10 | 174.8 ± 14.97 | 60.9 ± 7.22 |
| L. paradoxa #1 | adult | 65.0 | 6 | 8.52 ± 0.54 | 127.33 ± 25.50 | 14.98 ± 3.04 |
| L. paradoxa #3 | juvenile | 18.5 | 33 | 1.49 ± 0.44 | 40.97 ± 13.29 | 28.13 ± 6.72 |
aValues represent mean ± SD
Fig. 7.

Comparison of V1R-expressing cell density in the lamellae between adult (#1) and juvenile (#3) of P. aethiopicus (a) and L. paradoxa (b). Data are shown as mean ± SD (n = 5–33, see Table 6). In both lungfish, the density of V1R-expressing cells was higher in the juvenile than adult lamellae
Discussion
By examining V1R expression in the olfactory organ of two species of African lungfish, P. annectens and P. amphibius, we recently reported that the density of V1R-expressing cells was higher in the lamellae than recesses [28]. However, it was unclear whether these characteristics are shared by other species of lungfish. In addition, all individuals analyzed in our previous study had a body length of approximately 30 cm; therefore, we could not determine the relationship between V1R-expressing cell density and individual growth stage. In the current study, we investigated the density of V1R-expressing cells in the olfactory organ of juvenile and adult African lungfish P. aethiopicus and South American lungfish L. paradoxa. The results indicate that the density of V1R-expressing cells is higher in the lamellae than recesses in P. aethiopicus and L. paradoxa, as in the two species of African lungfish in our previous study (P. annectens and P. amphibius), and that this tendency was more remarkable in juveniles than in adults. However, the sexes of juveniles and adults were not matched in the present study. The effect of sex on V1R expression may need to be considered. In our previous study, we found no difference in V1R-expressing cell density in the lamellae and recesses between male and female P. amphibius [28], suggesting that a sex difference did not affect V1R expression at least in P. amphibius. The relationship between sex and V1R expression in other lungfish species remains unknown. It is necessary to compare the V1R expression levels in the lamellae and the recesses between juveniles and adults of the same sex, and between males and females of the same size.
Our intraspecific analysis revealed differences in the density of V1R-expressing cells in the lamellae between adults and juveniles. This evidence suggests that the density of V1R-expressing cells in the lamellae decreases as the individual grows. Unlike what was seen in lamellae, the density of V1R-expressing cells in the recesses was higher in adults than in juveniles (0.75 vs. 0.09 cells/mm2 in P. aethiopicus and 0.33 vs. 0.12 cells/mm2 in L. paradoxa, Table 5). This evidence suggests that the density of V1R-expressing cells in the recesses increases as the individual grows. Thus, adult lungfish showed a lower and higher density of V1R-expressing cells in the lamellae and recesses, respectively, compared with juveniles, and thus the abundance of V1R-expressing cells in the lamellae relative to that in the recesses was more than fivefold greater in juveniles than adults (48:1 and 670:1 in P. aethiopicus and 45:1 and 230:1 in L. paradoxa).
In our previous study, we found a difference between P. annectens and P. amphibius in the density of V1R-expressing cells in the recesses (2.4 vs. 0.1 cells/mm2) [28]. However, as shown in the present study, it may be necessary to take into account the individual growth stage to evaluate the density of V1R-expressing cells. Therefore, in the future, V1R expression should be analyzed in the juveniles and adults of P. annectens and P. amphibius.
Because of the small percentage of V1R-expressing cells in the ORCs in the recesses, the involvement of V1Rs in the overall function of recesses may be negligible. On the other hand, Gαo expression indicated that the RecE consists largely of V2R-expressing cells except for a few V1R-expressing cells, suggesting that V2Rs are primarily relevant to the olfactory functions of recesses in both juveniles and adults. A future study on V2R expression is needed to clarify the functions of recesses.
By contrast, the density of V1R-expressing cells was 50–700-fold higher in the lamellae than recesses. Most V1R genes of lungfish are classified as the tetrapod type [28, 36]. In general, tetrapod V1Rs detect volatile molecules [10]. The lamellar OE is supposed to contact the air when a lungfish moves its snout out of water for air-breathing. Thus, it is highly likely that lungfish detect volatile molecules (airborne odorants) via V1Rs.
Olfaction plays an important role in obtaining external information related to predators, feeding, reproduction, and other processes [14, 37]. The higher density of V1R-expressing cells in the lamellae of juveniles than adults demonstrated here suggests that juveniles are highly dependent on the V1R-mediated olfactory pathway in lamellae compared with adults. Juvenile L. paradoxa breathe more frequently than adults; i.e., the interval between breaths is more than twice as long in adults than juveniles [30]. Thus, the lamellar OE likely comes in contact with air more often in juveniles than adults. Juvenile P. aethiopicus are more threatened by terrestrial predators than are adults because juveniles live in shallow water close to shore, whereas adults live in deep water [30]. Juveniles have a wider range of feeding habits than do adults [30]. Our present results imply that differences in lifestyle, including habitats, feeding, and reproductive status are related to the differences in V1R-expressing cell densities between juvenile and adult lungfish.
We report changes in the density of V1R-expressing cells in the lamellar OE with individual growth stage. The expression of signal transduction molecules suggests that the lamellar OE contains V2R-, OR-, and TAAR-expressing cells, in addition to V1R-expressing cells [28]. Therefore, it is necessary to clarify the expression of V2Rs, ORs, and TAARs in addition to V1Rs to understand the functions of lamellar OE. Changes in olfactory function during growth would be revealed by comparing the expression of each olfactory receptor between juveniles and adults.
Conclusion
We compared the expression of V1Rs in olfactory organs between juvenile and adult African lungfish Protopterus aethiopicus and South American lungfish Lepidosiren paradoxa. The density of V1R-expressing cells was higher in the lamellae than in the recesses in all specimens evaluated, as in the other two species of African lungfish (P. annectens and P. amphibius). This tendency was more pronounced in juveniles than adults. In addition, the juveniles had a higher density of V1R-expressing cells in the lamellae than adults. These results imply that differences in lifestyle factors, including habitat, feeding, and reproductive status are related to differences in V1R-expressing cell density between juvenile and adult lungfish.
Supplementary Information
Additional file 1: Supplementary Fig. S1-S5. V1R expression in the olfactory organs of P. aethiopicus (Figs. S1-S3) and L. paradoxa (Figs. S4-S5).
Additional file 2: Supplementary Data S1. Nucleotide sequences of P. aethiopicus V1Rs.
Additional file 3: Supplementary Data S2. Nucleotide sequences of L. paradoxa V1Rs.
Abbreviations
- OE
Olfactory epithelium
- VNO
Vomeronasal organ
- ORC
Olfactory receptor cell
- OR
Odorant receptor
- TAAR
Trace amine-associated receptor
- V1R
Type 1 vomeronasal receptor
- V2R
Type 2 vomeronasal receptor
- RecE
Recess epithelium
- BL
Body length
- PB
Phosphate buffer
- ISH
In situ hybridization
- diceCT
Diffusible iodine-based contrast-enhanced computed tomography
- SEM
Scanning electron microscopy
- RT
Room temperature
- NCAM
Neural cell adhesion molecules
- DIG
Digoxigenin
- SSC
Saline-sodium citrate
- GE
Glandular epithelium
Authors contributions
N.N. supervised the project. S.N. conducted animal experiments and data analysis and wrote the paper. Y.Y., M.M., M.N., and N.N. conducted manuscript editing. A.S. conducted data analysis. M.N. and N.N conducted experimental design. All authors read and approved the final manuscript.
Funding
This work was supported by JSPS KAKENHI Grant Number JP20K06399.
Availability of data and materials
All data generated or analyzed during this study are included in this published article and its supplementary information files.
Declarations
Ethics approval and consent to participate
All animal procedures were approved by the local Animal Ethics Committee of Iwate University.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no conflicts of interest.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Buck LB. The molecular architecture of odor and pheromone sensing in mammals. Cell. 2000;100(6):611–618. doi: 10.1016/s0092-8674(00)80698-4. [DOI] [PubMed] [Google Scholar]
- 2.Baum MJ. Contribution of pheromones processed by the main olfactory system to mate recognition in female mammals. Front Neuroanat. 2012;6:20. doi: 10.3389/fnana.2012.00020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Suárez R, García-González D, de Castro F. Mutual influences between the main olfactory and vomeronasal systems in development and evolution. Front Neuroanat. 2012;6:50. doi: 10.3389/fnana.2012.00050. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Vargas-Barroso V, Peña-Ortega F, Larriva-Sahd JA. Olfaction and pheromones: Uncanonical sensory influences and bulbar interactions. Front Neuroanat. 2017;11:108. doi: 10.3389/fnana.2017.00108. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Hansen A, Anderson KT, Finger TE. Differential distribution of olfactory receptor neurons in goldfish: structural and molecular correlates. J Comp Neurol. 2004;477(4):347–359. doi: 10.1002/cne.20202. [DOI] [PubMed] [Google Scholar]
- 6.Menco BP. Ultrastructural aspects of olfactory signaling. Chem Senses. 1997;22(3):295–311. doi: 10.1093/chemse/22.3.295. [DOI] [PubMed] [Google Scholar]
- 7.Taniguchi K, Taniguchi K. Phylogenic studies on the olfactory system in vertebrates. J Vet Med Sci. 2014;76(6):781–788. doi: 10.1292/jvms.13-0650. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Hansen A, Reiss JO, Gentry CL, Burd GD. Ultrastructure of the olfactory organ in the clawed frog, Xenopus laevis, during larval development and metamorphosis. J Comp Neurol. 1998;398(2):273–288. doi: 10.1002/(sici)1096-9861(19980824)398:2<273::aid-cne8>3.0.co;2-y. [DOI] [PubMed] [Google Scholar]
- 9.Oikawa T, Suzuki K, Saito TR, Takahashi KW, Taniguchi K. Fine structure of three types of olfactory organs in Xenopus laevis. Anat Rec. 1998;252(2):301–310. doi: 10.1002/(SICI)1097-0185(199810)252:2<301::AID-AR16>3.0.CO;2-R. [DOI] [PubMed] [Google Scholar]
- 10.Silva L, Antunes A. Vomeronasal receptors in vertebrates and the evolution of pheromone detection. Annu Rev Anim Biosci. 2017;5:353–370. doi: 10.1146/annurev-animal-022516-022801. [DOI] [PubMed] [Google Scholar]
- 11.Dewan A. Olfactory signaling via trace amine-associated receptors. Cell Tissue Res. 2021;383(1):395–407. doi: 10.1007/s00441-020-03331-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Brunet LJ, Gold GH, Ngai J. General anosmia caused by a targeted disruption of the mouse olfactory cyclic nucleotide-gated cation channel. Neuron. 1996;17(4):681–693. doi: 10.1016/s0896-6273(00)80200-7. [DOI] [PubMed] [Google Scholar]
- 13.Liman ER, Corey DP, Dulac C. TRP2: a candidate transduction channel for mammalian pheromone sensory signaling. Proc Natl Acad Sci USA. 1999;96(10):5791–5796. doi: 10.1073/pnas.96.10.5791. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Korsching SI. Taste and smell in zebrafish. In: Fritzsch B, Meyerhof W, editors. The senses: a comprehensive reference. Cambridge: Elsevier Academic Press; 2020. pp. 466–492. [Google Scholar]
- 15.Poncelet G, Shimeld SM. The evolutionary origins of the vertebrate olfactory system. Open Biol. 2020;10(12):200330. doi: 10.1098/rsob.200330. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Date-Ito A, Ohara H, Ichikawa M, Mori Y, Hagino-Yamagishi K. Xenopus V1R vomeronasal receptor family is expressed in the main olfactory system. Chem Senses. 2008;33(4):339–346. doi: 10.1093/chemse/bjm090. [DOI] [PubMed] [Google Scholar]
- 17.Ren X, Chang S, Laframboise A, Green W, Dubuc R, Zielinski B. Projections from the accessory olfactory organ into the medial region of the olfactory bulb in the sea lamprey (Petromyzon marinus): a novel vertebrate sensory structure? J Comp Neurol. 2009;516(2):105–116. doi: 10.1002/cne.22100. [DOI] [PubMed] [Google Scholar]
- 18.Green WW, Basilious A, Dubuc R, Zielinski BS. Neuroanatomical organization of projection neurons associated with different olfactory bulb pathways in the sea lamprey, Petromyzon marinus. PLoS ONE. 2013;8(7):e69525. doi: 10.1371/journal.pone.0069525. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Chang S, Chung-Davidson YW, Libants SV, Nanlohy KG, Kiupel M, Brown CT, Li W. The sea lamprey has a primordial accessory olfactory system. BMC Evol Biol. 2013;13:172. doi: 10.1186/1471-2148-13-172. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Sakuma A, Zhang Z, Suzuki E, Nagasawa T, Nikaido M. A transcriptomic reevaluation of the accessory olfactory organ in Bichir (Polypterus senegalus) Zoolog Lett. 2022;8(1):5. doi: 10.1186/s40851-022-00189-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.González A, Morona R, López JM, Moreno N, Northcutt RG. Lungfishes, like tetrapods, possess a vomeronasal system. Front Neuroanat. 2010;4:130. doi: 10.3389/fnana.2010.00130. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Nakamuta N, Nakamuta S, Taniguchi K, Taniguchi K. Analysis of glycoproteins produced by the associated gland in the olfactory organ of lungfish. J Vet Med Sci. 2013;75(7):887–893. doi: 10.1292/jvms.12-0547. [DOI] [PubMed] [Google Scholar]
- 23.Nakamuta S, Nakamuta N, Taniguchi K, Taniguchi K. Histological and ultrastructural characteristics of the primordial vomeronasal organ in lungfish. Anat Rec (Hoboken) 2012;295(3):481–491. doi: 10.1002/ar.22415. [DOI] [PubMed] [Google Scholar]
- 24.Nakamuta S, Nakamuta N, Taniguchi K, Taniguchi K. Localization of the primordial vomeronasal organ and its relationship to the associated gland in lungfish. J Anat. 2013;222(4):481–485. doi: 10.1111/joa.12025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Wittmer C, Nowack C. Epithelial crypts: A complex and enigmatic olfactory organ in African and South American lungfish (Lepidosireniformes, Dipnoi) J Morphol. 2017;278(6):791–800. doi: 10.1002/jmor.20673. [DOI] [PubMed] [Google Scholar]
- 26.Kim HT, Park JY. Morphology and histology of the olfactory organ of two African lungfishes, Protopterus amphibius and P. dolloi (Lepidosirenidae, Dipnoi) Appl Microsc. 2021;51(1):5. doi: 10.1186/s42649-021-00054-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Nakamuta S, Yamamoto Y, Nakamuta N. Distribution of recesses in the olfactory organ of African lungfish Protopterus aethiopicus. J Vet Med Sci. 2022;84(7):885–889. doi: 10.1292/jvms.22-0173. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Nakamuta S, Yamamoto Y, Miyazaki M, Sakuma A, Nikaido M, Nakamuta N. Type 1 vomeronasal receptors expressed in the olfactory organs of two African lungfish, Protopterus annectens and P. amphibius. J Comp Neurol. 2023;531(1):116–31. doi: 10.1002/cne.25416. [DOI] [PubMed] [Google Scholar]
- 29.Mlewa CM, Green JM. Biology of the African lungfish, Protopterus aethiopicus Heckel in Lake Baringo. Kenya Afr J Ecol. 2004;42(4):338–346. doi: 10.1111/j.1365-2028.2004.00536.x. [DOI] [Google Scholar]
- 30.Jorgensen JM, Joss J. The Biology of Lungfishes. 1. Boca Raton: CRC Press; 2010. [Google Scholar]
- 31.Camilieri-Asch V, Shaw JA, Mehnert A, Yopak KE, Partridge JC, Collin SP. diceCT: A valuable technique to study the nervous system of fish. eNeuro. 2020;7(4):ENEURO.0076–20.2020. doi: 10.1523/ENEURO.0076-20.2020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Chang Z, Li G, Liu J, Zhang Y, Ashby C, Liu D, et al. a new framework for de novo transcriptome assembly using RNA-seq data. Genome Biol. 2015;16(1):30. doi: 10.1186/s13059-015-0596-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Katoh K, Standley DM. MAFFT: iterative refinement and additional methods. Methods Mol Biol. 2014;1079:131–146. doi: 10.1007/978-1-62703-646-7_8. [DOI] [PubMed] [Google Scholar]
- 34.Stamatakis A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 2014;30(9):1312–1313. doi: 10.1093/bioinformatics/btu033. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol Biol Evol. 2018;35(6):1547–1549. doi: 10.1093/molbev/msy096. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Nikaido M. Evolution of V1R pheromone receptor genes in vertebrates: diversity and commonality. Genes Genet Syst. 2019;94(4):141–149. doi: 10.1266/ggs.19-00009. [DOI] [PubMed] [Google Scholar]
- 37.Weiss L, Manzini I, Hassenklöver T. Olfaction across the water-air interface in anuran amphibians. Cell Tissue Res. 2021;383(1):301–325. doi: 10.1007/s00441-020-03377-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Additional file 1: Supplementary Fig. S1-S5. V1R expression in the olfactory organs of P. aethiopicus (Figs. S1-S3) and L. paradoxa (Figs. S4-S5).
Additional file 2: Supplementary Data S1. Nucleotide sequences of P. aethiopicus V1Rs.
Additional file 3: Supplementary Data S2. Nucleotide sequences of L. paradoxa V1Rs.
Data Availability Statement
All data generated or analyzed during this study are included in this published article and its supplementary information files.



