Institution: NIH Library Sign In as Member / Individual

This Article Abstract Full Text Services Alert me to new issues of the journal Request Copyright Permission

Supporting Information

Files in this Data Supplement:

Raw threshold (Ct) cycle values in quantitative reverse transcription PCR assay were normalized (D Ct) by subtracting the corresponding 18S rRNA Ct value from each sample value of GGLO1 and GDEF2. Mean values for each set of Ct and D Ct are shown with their SDs. Relative expression levels (RELs) were calculated by raising each negative D Ct value to a power of 2 and by comparing to Regina for GGLO1 and GDEF2 separately. All D Ct value sets differ from the corresponding Regina control with statistical significance (P < 0.05, one-way ANOVA). Regina, nontransgenic control; Tr13 and Tr15, two transgenic lines showing reduced level of GRCD2 expression.

Fig. 7. Interaction between GRCD2 and other Gerbera MADS-domain proteins in yeast two-hybrid assay. Based on two-hybrid analysis in yeast, GRCD2 is able to form dimers with Gerbera GAGA1 and GAGA2 proteins. GAGA1 and GAGA2 are Gerbera C-function MADS-domain regulators (1). In addition to GRCD2, they form heterodimers in yeast with GRCD1 but do not homodimerize or heterodimerize with each other (2). GRCD2 heterodimerizes also with GGLO1, the Gerbera B-function MADS-domain protein. However, down-regulation of GRCD2 does not lead to phenotypic changes in whorls 2 or 3, where GGLO1 is expressed. On the x axis (samples), the upper row indicates the gene product fused to the activation domain (AD), and the lower row indicates the gene product fused to the binding domain (BD) of vectors pB42AD and pLexA.

1. Kotilainen, M., Elomaa, P., Uimari, A., Albert, V., Yu, D. & Teeri, T. H. (2000) Plant Cell 12, 1893–1902.

2. Yu, D., Kotilainen, M., Pöllänen, E., Mehto, M., Elomaa, P., Helariutta, Y., Albert, V. A. & Teeri, T. H. (1999) Plant J. 17, 51–62.

Yeast Two-Hybrid Analysis. Yeast two-hybrid analysis was performed by using the Matchmaker LexA two-hybrid system (CLONTECH). Full-length coding sequences of Gerbera MADS-box genes were amplified by PCR using cDNA clones as templates. For construction of fusion plasmids, PCR fragments were purified (High Pure PCR-product purification kit, Roche Diagnostics), and restriction enzyme was digested at their ends and subcloned into the plasmids pB42AD and pLexA. Yeast transformation and selections of transformants were done according to the manufacturer’s instructions. We measured b -galactosidase activity as described (1) by using seven or eight individual transformants for each combination.

Quantitative RT-PCR. Transcript levels for the Gerbera B-function MADS-box genes Gerbera Globosa 1 (GGLO1) and Gerbera Deficiens 2 (GDEF2) were estimated from whorl-4 organs of disk flowers for both control and transgenic lines by using quantitative RT-PCR. Reverse transcription was done by using the TaqMan reverse transcription kit (Applied Biosystems). PCR was done by using SYBR green PCR master mix (Applied Biosystems). We used 500 ng of total RNA for two duplicate reverse-transcription reactions and 5 m l of cDNA as template in PCRs. PCR was done in triplicate by using default ABI PRISM 7700 sequence-detection system (Applied Biosystems) cycling conditions with 50 nM primers. The raw threshold cycle (Ct) values were normalized against 18S rRNA standard to obtain normalized D Ct values, which were then used to calculate relative expression levels in the samples (Table 1). The following primer pairs were used to amplify cDNA: GGLO1, 5'-CCTTCCGTGTCCAGCCAAT and 5'- GAAGTTGAAGCCTCGAATGTGA; and GDEF2, 5'- AGTGCCCCACGCATCCT and 5'- GCAGCGGCGTGAAGATTATC. Generic 18S rRNA primers were provided by Applied Biosystems.

1. Kotilainen, M., Elomaa, P., Uimari, A., Albert, V., Yu, D. & Teeri, T. H. (2000) Plant Cell 12, 1893–1902.