Institution: NIH Library Sign In as Member / Individual

This Article Abstract Full Text Services Alert me to new issues of the journal Request Copyright Permission

Supporting Information

Files in this Data Supplement:

Fig. 5. dSir2 mRNA levels are increased in flies that have the tubulin-GAL4 driver and P element in the dSir2 region compared with the wild type. RNA levels were measured by RT-PCR in tubulin-GAL4/dSir2^EP2300 (Top) and tubulin-GAL4/dSir2^EP2384 (Middle) whole male flies in which dSir2 was ubiquitously expressed and in wild-type Canton-S flies (Bottom). Total RNA from 10-day-old flies was isolated by using TRIzol reagent and the standard Chomczynski protocol (1). Oligo(dT) primer was used in the RT reaction. Sir2 primers were Sir2-4, GCTCTCCACCGTTGTCTGAGGGCC, and Sir2-5, GGCGGCAGCTGTGCTGCGATGAG. Ribosomal protein 49 (RP49) was amplified at the same time and used as internal control. Aliquots were taken from the reaction every 2–3 cycles after cycle 18, run on a gel with ethidium bromide, and imaged. Quantification was done by using a LABWORKS (Ultraviolet Products, Upland, CA) gel reader.

1. Rogina, B., Helfand, S. L. & Frankel, S. (2002) Science 298, 1745.

Fig. 6. Survival and log rank analyses for the tubulin-driven dSir2 lines. Flies that died before day 18 were not included in these analyses.

Fig. 7. Age-specific mortality rates, m (x), for tubulin-driven dSir2 lines. The mortality rate, m (x), was approximated by m(x) = –ln p(x). Bin size was 4 days. Intervals with no mortality have been left out. See Magwere et al. (1) for further details.

1. Magwere, T., Chapman, T. & Partridge, L. (2004) J. Gerontol. A Biol. Sci. Med. Sci. 59, 3–9.

Fig. 8. Anti-Sir2 antibody stains the nuclei of neurons and nuclei and cytoplasm of fat body. Adult 10-day-old male flies were fixed in 4% paraformaldehyde and embedded in paraffin, and 8-mm sections were made. Immunostaining of brain (a) and fat body (b) of wild-type Canton-S adult flies using rat anti-Sir2 primary antibody (1:2,000; provided by S. Smolik, Oregon Health & Science University, Portland) and rabbit anti-rat secondary antibody, as described, in the VECTASTAIN Elite ABC kit (Vector Laboratories). Nuclei were counterstained by using methyl green. (Scale bar, 10 m m.) Similar results were observed with the rabbit anti-Sir2 polyclonal antibodies (1:2,000; provided by S. Astrom, Stockholm University, Stockholm).