Institution: NIH Library Sign In as Member / Individual

This Article Full Text Services Alert me to new issues of the journal Request Copyright Permission

Cell Culture. B95-8 is a marmoset B cell line transformed with the type I Epstein–Barr (EB) virus (EBV) strain B95-8. P3HR1 is Burkitt lymphoma cell line infected with type II EBV. B cell lines were maintained in RPMI medium 1640 supplemented with 10% FCS and L-glutamine. B95-8 cells stably expressing a BZLF1-4-hydroxytamoxifen (4HT)-dependent mutant estrogen receptor fusion protein (ZHT) were constructed by transfection of 10 m g of linearized pCDNA3 ZHT plasmid followed by selection with G418.

Plasmids. The ZHT plasmid was constructed by PCR amplifying the BZLF1 gene with the primers CCTTTGCTAAGATCTACCACCATGATGGACCCAAACTCG and GGCGTGAAGCTCGAGGGGAATTCTTAT GGATCC AAGAAATTTAAGAGATC. This PCR product was cloned as a BglII and XhoI fragment into the BamHI and XhoI sites of pCDNA3 (Invitrogen). The BamHI and EcoRI fragment with the 4HT-responsive mutant estrogen receptor hormone-binding domain from pBSKS+ERTM (a gift from T. Littlewood, Wellcome Trust Sanger Institute, Hinxton, U.K.) (1) was cloned in frame with the 3' codon of the BZLF1 ORF.

Extracellular EB Virion Purification. Lytic replication was induced by adding 200 nM 4HT to the medium of B95-8/ZHT stable cell lines. Lytic replication was evaluated by immunoflourescent staining for gp350 on day 2 by using 72A1 monoclonal antibody. For virus purification, supernatants were harvested on day 5, cleared by two sequential centrifugations at 3,500 rpm for 15 min at 4°C, and virus was pelleted by centrifugation at 11,500 rpm (15,000 ´ g) in a GSA rotor for 2 h. The virus pellet was resuspended in 2 ml 0.5 mM sodium phosphate (SP) buffer, pH 8.0, homogenized with a tight-fitting Dounce, clarified by centrifugation at 2,000 rpm for 10 min, applied to a 35 ml 5–30% dextran T10 in SP gradient, and centrifuged at 76,000 ´ g in an SW28 tube for 1 h at 4°C. The virus band was 40–50% into the gradient and was aspirated, diluted 1:2 in SP, reapplied to a 35-ml 10–30% dextran T10 gradient in an SW28 tube, and spun at 90,000 ´ g for 1 h at 4° C. The resultant virus band, which was 40% into the gradient, was then aspirated from the second gradient, diluted with SP buffer, and spun to a pellet at 90,000 ´ g for 2 h at 4° C

Isotope-Coded Affinity Tag (ICAT) Analysis. For ICAT analysis, purified enveloped virus, Nonidet P-40 (NP-40), and NP-40/deoxycholate (ND)-treated purified virus were spun through a 30% glycerol cushion. Two aliquots of enveloped virus and equal amounts of virions recovered after NP-40 or ND treatment were labeled with cleavable ICAT reagent, after boiling in denaturing buffer (50 mM Tris, pH 8.8/0.1% SDS/1.25 mM tris(2-carboxyethyl)phosphine hydrochloride), as described by the manufacturer (Applied Biosystems). Enveloped virus was labeled with a ¹²C (light) ICAT reagent, whereas NP-40 or ND-treated virus was labeled with ¹³C (heavy) ICAT. After 2-h incubation at 37°C, the two aliquots of light ICAT-labeled enveloped virus were pooled, redivided to ensure a common baseline, and mixed with heavy ICAT-labeled NP-40- or ND-treated virus. Each mixture was boiled in SDS sample buffer, loaded in two separate lanes on an 8% SDS/PAGE, and eletrophoresed 3 cm past the stacking gel. Each lane was cut into 16- × 2-mm slices (one slice extending beyond the dye front). Gel slices were submitted for LC MS/MS sequencing, in-gel trypsin digestion, and ICAT cleavage with 95% trifluroactetic acid. The relative abundance of the heavy and light ICAT-modified peptide peaks was calculated by using the EXPRESS algorithm in BIOWORKS. The heavy-to-light ICAT ratio for each protein was calculated from the geometric mean ratios of constituent peptides. The ratios were normalized to the ICAT ratio of the major capsid protein (BcLF1) in each experiment.

Transmission Electron Microscopy. Virions in SP buffer were absorbed onto carbon-coated grids and visualized after negative stain with 1% uranyl acetate. Sections 80 nm thin were made from virus pellets that were fixed in 2% paraformaldehyde and 2.5% gluteraldehyde, stained with 1% osmium tetroxide and 1.5% potassium ferrocyanide for 1 h followed by 1% uranyl acetate for 30 min, dehydrated with ethanol, treated with propylene oxide, and embedded in a 1:1 mixture of Epon and Araldite. Grids and thin sections were visualized by using a JEOL 1200EX transmission electron microscope.

Deglycosylation, Protein Gel Electrophoresis, Western Blotting, and Immunoflourescence. Purified EBV equivalent to 10 m g of protein was resuspended in 50 mM NaPO₄, pH7.5/0.1%SDS/50 mM b -metcaptoethanol, heated to 100°C for 5 min, cooled, adjusted to 0.75% Triton X-100, incubated at 37°C for 3 hours with 8 units of PNGaseF, 5 microunits of Neuramindase, and 1.3 microunits of O-glycosidase (Sigma). Deglycosylation was confirmed by Western blotting by using EBV-immune human sera.

Proteins were rendered soluble in 10´ sample buffer (20% SDS/10% b -mercaptoethanol/500 mM Tris, pH 6.8/0.025% bromophenol blue), adjusted to 5% glycerol, heated to 95°C for 5 min, and separated on 5–15% polyacrylamide gradient gels. Gels were stained with Coomassie brilliant blue, Sypro-Ruby, or phosphoserine-, phosphothreonine-, and phosphotyrosine-specific Sypro-Diamond. Unstained BenchMark proteins (Invitrogen) were used as size markers .

For Western blotting, gels were transferred to nitrocellulose membrane, blocked with 5% milk, and reacted with EBV-immune human sera. After reacting with appropriate horseradish peroxidase-conjugated secondary antibody, membranes were developed with chemiluminescence reagent (NEN). For immune fluorescence, 10⁶ cells were placed in 90 m l of fluorescence-activated cell sorter (FACS) buffer (PBS/5% FCS/0.1% sodium azide) and incubated with 10 m l of the 72A1 gp350 monoclonal antibody for 20 min, washed in 1 ml FACS buffer, incubated for 20 min with FITC-conjugated anti-mouse antibody diluted 1:200 in FACS buffer, washed with 1 ml FACS buffer, and visualized by immune flourescence microscopy.

In-Gel Digestions. Gel slices were placed into 1.5-ml Axygen centrifuge tubes (Axygen Scientific, Union City, CA), washed three times with 50% methanol and 5% acetic acid and agitated successively for 30-min intervals in 1.5 ml of acetonitrile, 1.5 ml of 100 mM ammonium bicarbonate, and 1.5 ml of acetonitrile. Acetonitrile was removed, and gel slices were dried for 30 min in a speedvac. Gel slices were incubated successively for 1-h intervals with 300 m l of 100 mM ammonium bicarbonate/50 mM DTT and with 300 m l of 75 mM iodoacetamide in 100 mM ammonium bicarbonate. Gel slices were then again agitated for successive 30-min intervals in 1.5 ml of acetonitrile, in 100 mM ammonium bicarbonate, and in acetonitrile. After acetonitrile removal, gel slices were dried for 30 min in a speedvac, cooled on ice, and incubated with 330 ng of Promega sequencing grade trypsin in 25 m l of 50 mM ammonium bicarbonate. After 15 min, another 25 m l of 50 mM ammonium bicarbonate was added, and digestion was continued for 16 h at 37°C. A final 75 m l of 50 mM ammonium bicarbonate was added to each tube, and the samples were incubated for 1 h more at 37°C. All liquid was removed and placed into well of a 48-well plate. Each tube was washed once with 75 m l of ammonium bicarbonate and twice with 75 m l of 50% acetonitrile with 0.1% formic acid. The washes were pooled with the first volume. Samples were frozen to –80°C, lyophilized in a ThermoSavant SC280 speedvac, and redissolved in 24 m l of 5% acetonitrile/0.1% formic acid. Angio Mix peptide standards (Michrom Bioresources, Auburn, CA) were added to the plate at a concentration of 20 nM, which was then sealed and stored at 4°C until ready for MS.

Mass Spectrometry. Samples were run on a LCQ DECA XP plus PROTEOME X workstation (ThermoFinnigan, Cambridge, MA). For each run, 10 m l of each sample (i.e., 42% of the total) was injected with a Famos autosampler and separated on a 75-m m-i.d. ´ 18-cm column packed with C18 media running at a flow rate of 235 nl/min with 0.1% formic acid in a gradient of 5–60% acetonitrile in water over 2.5 h. After every eight runs, Angio mix peptides standards (Michrom BioResources) were loaded as a control. The LCQ was run in a top five configuration, with one MS scan and five MS/MS scans. Dynamic exclusion was set to one with a limit of 30 sec.

Databases Searches. Three sequence databases were independently searched: (i) National Center for Biotechnology Information (NCBI) NR database (October 2003), (ii) a database of all possible reading frames >10 aa from the complete EBV genome (NC_001345) created with the EMBOSS (www.hgmp.mrc.ac.uk/Software/EMBOSS/) utility getorf, and (iii) NCBI Human RefSeq (October 2003), with the addition of manually curated EBV peptide sequences as well as 27 additional sequences (primate sequences that scored well in our NR database searches). A contaminants library was added to each of the above libraries. Databases were indexed by using BIOWORKS BROWSER, Version 3.1 (ThermoFinnigan) with trypsin, allowing for up to three internal cleavage sites, sequence length of 6–100 residues, carbamidomethyl modified cysteine, and oxidized methionine. For phosphopeptide searches, the third database was reindexed to include phosphoserine-, phosphothreonine-, and phosphotyrosine-containing peptides.

Spectra were searched using SEQUEST through BIOWORKS BROWSER 3.1 with default settings, except for the peptide parameter, which was changed to 2.00, and ions, which was changed to 0.25, in the "Tolerance & Limits for Dta Search" dialogue box. Resulting files for each slice were opened with BIOWORKS BROWSER, and areas for each peptide were calculated by using the default setting of the Protein Area/Height Calculation function, exported to EXCEL and saved as a tab-delimited file. Files were manipulated with PERL script and EXCEL. Only peptides exceeding an xcorr of 1.5 for singly charged ions, 2.5 for doubly charged ions, 3.0 for triply charged ions, Delta Cn values ³ 0.1, and an RSp of 1 were considered for further analysis.

Peptide Mapping. A nonredundant protein sequence list was created from the third database by identifying all genes matching any peptide identified. These sequences were clustered with BLASTCLUST (ftp://ftp.ncbi.nlm.nih.gov/blast/executables) by using the settings –S to 70 and –L to 50 (70% sequence identity over 50% of the length). A PERL script was written to map peptides to individual clusters, based on their being together in one or more genes, which were usually related. Within a slice, peptides that matched multiple genes, e.g., b -actin-related genes, were ultimately assigned primarily to a single gene, b -actin, based on best fit of the most frequently detected unique peptides. Rarely detected unique peptides could be indicative of the presence of another b -actin-related gene or may be sites of sequence divergence between marmoset and human proteins. For each gene, the tables report the best fit first with the number of total sequenced constituent peptides detected by MS/MS degradation (total peptides), the number of unique sequenced peptides (unique peptides), the residue fraction accounted for by all peptides assigned to an ORF (coverage), and the sum of the area under the curve for all peptides assigned to an ORF for which the y axis is related to the quantity of a given peptide in MS scans (total area).

1. Littlewood, T. D., Hancock, D. C., Danielian, P. S., Parker, M. G. & Evan, G. I. (1995) Nucleic Acids Res. 23, 1686–1690.