Abstract
Most of the circulating tumor cells (CTCs) are detected as single cells, whereas a small proportion of CTCs in multicellular clusters with stemness properties possess 20–100 times higher metastatic propensity than the singles. Here we report that CTC dynamics in both singles and clusters in response to therapies predict overall survival for breast cancer. Chemotherapy-evasive CTC clusters are relatively quiescent with a specific loss of ST6GAL1-catalyzed α2,6-sialylation in glycoproteins. Dynamic hyposialylation in CTCs or deficiency of ST6GAL1 promotes cluster formation for metastatic seeding and enables cellular quiescence to evade paclitaxel treatment in breast cancer. Glycoproteomic analysis reveals newly identified protein substrates of ST6GAL1, such as adhesion or stemness markers PODXL, ICAM1, ECE1, ALCAM1, CD97, and CD44, contributing to CTC clustering (aggregation) and metastatic seeding. As proof-of-concept, neutralizing antibodies against one newly identified contributor, PODXL, inhibit CTC cluster formation and lung metastasis associated with paclitaxel treatment for triple-negative breast cancer.
Statement of significance
This study discovers that dynamic loss of terminal sialylation in glycoproteins of CTC clusters contributes to the fate of cellular dormancy, advantageous evasion to chemotherapy, and enhanced metastatic seeding. It identifies PODXL as a glycoprotein substrate of ST6GAL1 and a candidate target to counter chemoevasion-associated metastasis of quiescent tumor cells.
Introduction
Distant metastasis is often coupled with therapy evasion and a poor outcome for patients with cancer. Identifying the cellular mechanisms and molecular targets responsible for metastasis remains one of the most challenging frontiers in cancer medicine. Metastasis is seeded at an extremely low efficiency by single circulating tumor cells (CTCs), but at a 20–100 fold higher efficiency by multicellular CTC clusters with stemness advantages, due in part to the plastic reprogramming, regenerative properties, and advantageous survival of clusters compared to single CTCs (1–5).
Triple negative breast cancer (TNBC) has a median overall survival of approximately 18 months (6), and is highly metastatic to viscera, such as the lungs (40%) (7) which has been recapitulated in our established patient-derived xenograft (PDX) models (8). While chemotherapy has been one of the first-line treatments for TNBC to shrink the primary tumor (9), the benefit of adjuvant chemotherapy might be limited and context-dependent (10–12). In phase III clinical trials for advanced or metastatic TNBC, about 55% of the patients might respond to chemotherapy such as paclitaxel or Nab-paclitaxel (PAX) (13) with a median progression-free survival (PFS) of 3–5 months (13,14). In other large breast cancer trials, the addition of paclitaxel or taxol into a primary systemic or adjuvant therapy did not improve the distant disease-free survival (DFS) or overall survival (OS) even after improving the response of the local disease to treatment (11,12). In this study, we found that chemotherapy evasion (chemo-evasion) is associated with enriched quiescent CTC clusters and possibly decreased survival for patients with breast cancer. Since the microtubule inhibitor paclitaxel is used to treat metastatic breast cancer, we focused on determining its effects on CTCs.
While collective migration and cohesive shedding could contribute to CTC cluster formation (1,3), tumor cell aggregation (4,15) provides an alternative mechanism to initiate and enhance tumor cluster formation (16). We previously demonstrated that cell adhesion and stemness glycoproteins on breast tumor-initiating cells (BTICs), such as CD44, CD81, and ICAM1 drive CTC aggregation and homotypic cluster formation in metastatic TNBC (4,15,17). However, the role of glycosylation in CTC aggregation and cluster formation has yet to be fully elucidated.
Catalyzed by glycosyltransferases, glycosylation is one of the most common post-translational protein modifications that add hierarchical sugar residues (monosaccharides or polysaccharide glycan chains) onto more than 50% of proteins (18,19). To compare the glycan profiles between single and clustered CTCs in patients, we utilized a spectrum of fluorophore-bound lectins with specific sugar residue-recognizing preferences for quantitative detection of sialic acids (SA), polylactosamine, galactose, complex type N glycans, mannose, and fucose via flow cytometry and FDA-approved CellSearch platform.
In this report, we found that terminal sugar residue α2,6-sialic acid (α2,6-SA) mediated glycoprotein sialylation, which is mainly catalyzed by β-galactoside α2,6-sialyltransferase (ST6GAL1) in human cells, specifically decreased in the CTC clusters surviving therapies. ST6GAL1 is a type II transmembrane protein that catalyzes the addition of α2,6-SA onto terminal glycans of glycoproteins (20). ST6GAL1 is known to regulate multiple hallmarks of cancer, such as promoting cell proliferation (21–24). This work identified a novel function of ST6GAL1 which loss in CTCs promotes chemo-evasion associated cluster formation and metastatic seeding in TNBC. Furthermore, using advanced glycome mass spectrometry we systemically analyzed α2,6-sialylated glycoproteins and identified many new substrates of ST6GAL1 related to cell adhesion or cancer stemness, such as PODXL, ICAM1, and CD44, which contribute to CTC aggregation and lung metastasis of the TNBC. The evidence highlights new targeting strategies to block tumor cluster-mediated metastatic seeding associated with poor outcomes for TNBC.
Results
Chemo-evasive CTC clusters predict an unfavorable survival for breast cancer
To monitor the longitudinal dynamics of CTCs (singles and clusters) in response to therapy such as chemotherapy or paclitaxel, we established multiple complementary approaches in parallel, including (I) the standard CellSearch-based immunofluorescence staining of EpCAM-enriched CD45−cytokerain (CK)+DAPI+ cells from human blood, (II) flow cytometry analysis of blood-derived lineage−CD45−EpCAM+/− CK+/− cells, with singles and clusters gated on size scatter channels, and (III) immunohistochemistry staining of vascular CTCs in tissue sections (Supplementary Fig. S1A–C) (4,15).
After establishing an IRB protocol for longitudinal CTC analyses of patients with stage III-IV breast cancer at Northwestern University, we enrolled a cohort of 162 patients for blood collections at the baseline prior to a new line of treatment (Supplementary Tables S1A–B). Around half of the patients were followed up after 3 months of treatment for a second draw of blood and analysis of CTCs (singles and clusters) at the first radiological evaluation (Evaluation 1, E1). Blood was collected and analyzed for CTC counts (singles and clusters) on CellSearch (Supplementary Fig. S1B, Supplementary Excel S1). Consistent with the literature (3,25) and our previous findings (4,15), the detection of CTC clusters at the baseline is associated with an unfavorable overall survival (OS) (N=162, P=0.0003, Supplementary Fig. 1D, Supplementary Table S1A). Among those with follow-up CTC monitoring and survival analysis (N=65), the patients with decreased CTCs (single or clusters) at E1 show the best OS compared to a moderate survival for those with stably low or negative counts of single CTCs/CTC clusters, and the worst survival for those with increased (or stably high counts) single CTCs/clusters at E1 post therapy (Fig. 1A, Supplementary Fig. S1E). Using a multivariable Cox regression model, we found that CTC clusters at E1 is an independent factor predicting an unfavorable OS for patients with breast cancer (Supplementary Table S1B).
Figure 1. Chemotherapy correlates with CTC cluster formation and loss of α2,6-SA / ST6GAL1.
A. The probability of overall survival (OS) by Kaplan-Meier estimates in the patients with advanced-stage breast cancer, stratified by three alteration patterns of single CTCs (left panel) or CTC clusters (middle panel) between the baseline (prior to treatment) and the first radiological evaluation (E1) after 3-month treatment, including (1) decreased CTCs; (2) stably low or negative CTCs; and (3) increased or stably high CTCs (singles or clusters). Wilcoxon signed rank test P<0.0001. CTCs were detected via CellSearch. Right panel: representative CellSearch images of a single CTC (CK+DAPI+CD45−) at the baseline (top row) and a 2-cell CTC cluster at E1 (bottom row) from a chemo-treated patient (Scale bar = 10 μm).
B. Dynamic counts of CellSearch-detected CTCs (# events), singles and CTC clusters, at the baseline and E1 for each breast cancer patient treated with chemotherapy (blue lines) and non-chemotherapy (purple lines). Wilcoxon signed rank test for CTC cluster alterations P = 0.0158 with chemo (N=47) and P = 0.6447 without chemo (N=35); for single CTC alterations P=0.5461 with chemo and P= 0.5028 without chemo.
C. The probability of OS by Kaplan-Meier estimates in advanced-stage breast cancer patients with or without chemotherapy (chemo +/−, left and right panels), stratified by the CTC alteration patterns of decreased, negative or stable low, and increased CTC cluster events at E1 compared to the baseline (log-rank test P=0.0071 and P<0.0001). CTCs were measured by CellSearch.
D. Representative images (left panel) and quantification (right panel) of SNA-bound α2,6-SA signals in individual CTCs, both singles (S, n=120 cells) and from clusters (C, n=44 tumor cells in the clusters (homotypic and heterotypic clusters of CTCs and CD45+ cells) of breast cancer patients (N=6 patients), analyzed by CellSearch. (Scale bar = 10 μm)
E. The bar graphs of SNA-high populations within singles (S) and clusters (C) in non-chemo treated patients (left: - chemo), chemo-treated patients (middle: + chemo, N=46, P=0.002) and paclitaxel treated patients (right: PAX, N=6, P=0.038).
F. Schematic of the PAX treatment for PDX-M1 tumors and subsequent analyses of CTCs and lung metastases. One week after orthotopic implantation (O.I.) of PDX-M1 tumor cells into mouse mammary fat pads, mice were treated with PBS or nano-albumin paclitaxel (PAX, 13.5 mg/kg) once every three days via tail vein for 10 times. 3 days after the last treatment, mice were sacrificed with collections of blood, breast tumors and lungs for analyses of CTCs, tumors, and metastasis burdens, respectively.
G-N. After PBS/PAX treatments shown in F, representative photos of PDX tumors (G, scale bar = 1 cm) and quantification of the tumor weight (H), bioluminescence images of dissected lungs ex-vivo (I) and quantified lung metastases in total flux (J), counts of single CTCs (K) and CTC clusters (L) in PBS and PAX treated mice, and the percentage of SNA-high CTCs in singles versus clusters in PBS (M) and PAX (N) treated mice. CTCs were analyzed via flow cytometry.
P values are calculated by Graphpad (Student’s t-test) unless otherwise indicated. Data are represented as mean values of +/− SD.
About half of the patients analyzed at E1 had received chemotherapy and the rest non-chemotherapy (Supplementary Table S2). We compared the dynamic patterns of CTCs (singles and clusters) between the baseline and E1 among chemotherapy and non-chemotherapy groups. The number of CTC clusters, but not single CTCs, increased significantly at E1 in the patients post chemotherapy (N=47, Wilcoxon signed rank test P = 0.0158) whereas mixed fluctuations (without statistical significance) in CTCs (singles or clusters) were observed in the patients who did not receive new chemotherapy (N=35) (Fig. 1B, Supplementary Table S2). About 20% of the chemo-treated patients (8 out of 40) and ~10% of non-chemo-treated patients (3 out of 31) show increased CTC clusters (or stable high) and worse survival, in comparison to those with stably low (negative changes) or decreased CTC clusters (Fig. 1C). Decreased CTC clusters were only found in the patients treated with non-chemo approaches (Fig. 1C, right panel) but not observed in chemo-treated group (Fig. 1C, left panel). These data suggest that CTC clusters may confer therapy-resistant or chemo-evasive features to be fully elucidated.
Loss of α2,6-sialylation in clustered CTCs and associated with PAX treatment.
To investigate whether cell surface glycosylation impacts CTC cluster formation, we first optimized the flow cytometry approach to analyze the glycosylation profiles in EpCAM+/−CK+/−CD45− CTCs (clusters and singles), using lectin-based recognition of various carbohydrate residues. These include the terminal sialylation residues α2,3-SA and α2,6-SA (recognized by lectins MAL-II and SNA respectively), polylacto-samine (LEL), galactose (RCA), tri- and tetra-antennary complex type N glycans (PHA-L), mannose (ConA), and fucose (LTL) (Supplementary Fig. S2A). Among all tested glycans, the levels of SNA-bound α2,6-SA had the most dramatic reduction in clustered CTCs along with a moderate decrease of α2,3-SA and fucose levels compared to single CTCs from breast cancer patients (N=60, P<0.0001), whereas the single and clustered white blood cells (CD45+) had comparable levels for tested glycans (Supplementary Fig. S2B–E, Supplementary Excel S2). Consistently, when analyzed on the CellSearch platform, CK+DAPI+CD45−CTCs in the clusters displayed lower α2,6-SA levels (SNA binding) per cell than the singles (Fig. 1D), confirming the flow analysis data. Moreover, in comparison with single CTCs, α2,6-SA levels specifically decreased in the CTC clusters of chemo-treated and paclitaxel (PAX) treated patient’s group, but not in non-chemo-treated group (Fig. 1E), implicating an association of hypo-sialylation with chemotherapy or PAX treatment.
As proof-of-concept, we treated mice with PAX following orthotopic implantation of luciferase 2-eGFP (L2G) or luciferase 2-tdTomato (L2T) labeled TNBC PDX cells(8) into 4th mammary fat pads (Fig. 1F). The tumor sizes were slightly reduced in response to PAX treatment (Fig. 1G–H); however, the spontaneous metastases to the lungs were significantly higher in the PAX treated group than control-PBS treated group (Fig. 1I–J). Blood analysis of L2G+ or L2T+ CTC via flow cytometry did not identify significant changes in the total number of single CTCs between two groups of the mice (Fig. 1K), whereas the events of CTC clusters were significantly higher in the PAX-treated group than the PBS control (Fig. 1L). CTC clusters displayed lower levels of α2,6-SA sialylation (SNA signals) than single CTCs in both groups (Fig. 1M–N). These findings suggest that chemo-evasive CTC clusters are associated with PAX treatment, enhanced lung metastasis, and loss of α2,6-sialylation.
Loss of α2,6-SA or ST6GAL1 promotes CTC cluster formation, leading to the evasion of PAX treatment
To determine whether α2,6-SA levels and ST6GAL1 influence tumor cell clustering, we first sorted the SNA high and low subpopulations from the metastatic MDA-MB-231 cells (Fig. 2A, Supplementary Video S1–2). When seeded onto poly-HEMA-treated plates for cell suspension and cluster formation assessment, the SNAlow cells aggregated into bigger clusters than SNAhigh cells (Fig. 2A, right panels). Moreover, neuraminidase (NA) -mediated cleavage of SA (α2,6-SA, α2,3-SA and α2,8-SA) from the cell surface also drastically promoted tumor cluster formation (Supplementary Fig. S3A–B). Since CD44 was one of the main adhesion molecules and breast tumor initiation markers mediating CTC cluster formation (4), we compared the glycan profiles in CD44WT and CD44KO cells. CD44KO cells with compromised clustering capabilities increased α−2,6-SA levels and ST6GAL1 expression without altering other tested glycan residues (Supplementary Fig. S3C–F). CD44 overexpression inhibited ST6GAL1 expression in CD44KO cells and siST6GAL1 knockdown partially rescued the tumor cell formation of CD44KO cells (Supplementary Fig. S3G–H).
Figure 2. α2,6-SA and ST6GAL1 inhibit cluster formation and confer sensitivity to PAX.
A. Left panel: flow profile of MDA-MB-231 cells with α2,6-SA low and high populations. Right panels: representative images of sorted α−2,6-SA low and high cells at 4 h clustering (top panels) and cluster formation curves (cluster size by area) of sorted cells (bottom panel). Scale bar = 60 μm. Cluster videos are attached as Suppl. Video 1–2.
B. Flow histograms of SNA-binding signals (left panels), representative cluster images (middle panels), and cluster formation curves (right panel) of MDA-MB-231 cells: ST6WT and ST6KO cells transfected with control vectors (-Con), and ST6KO cells transfected with ST6GAL1 overexpression vector (-OE). Scale bar = 100 μm. Cluster videos are attached as Suppl. Video 3–5.
C. Left panel: cell death (%) of CTC-092 PDX tumor cells ex vivo at 24 h after paclitaxel (PAX) treatments at 0, 25, 50, and 250 μg/mL, measured as DAPI positivity of live cells via flow cytometry (ns=not significant). Right panel: representative flow profile of DAPI and SNA signals in PAX-treated cells at the high dose of 250 μg/mL.
D Representative flow histograms (left panels) and SNA-high population (%) within alive CTC-092 cells (right panel) after 24 h PAX treatment at indicated doses (0–250 μg/mL).
E. Representative images of CTC clusters formed at 24 h (left panels) and the time-course cluster formation curves (right panel, cluster size) of CTC-092 PDX cells ex vivo upon treatment of PBS and PAX-Nab at 25 μg/mL (Scale bar=50 μm). Cluster videos are attached as Suppl. Video 6–7.
F. Representative flow plots (left panels) and quantified viability (DAPI exclusion %) (right graph) of flow sorting-enriched SNA-high and SNA-low MDA-MB-231 cells (as shown in A) after overnight treatment with PAX at 0 and 25 μg/ml.
G. Immunoblots of ST6GAL1, ST3GAL1, FUT3, CD44, and β-actin (loading control) of ST6WT and ST6KO cells at indicated time points (0, 24, and 48 h) after PAX (25 μg/ml) treatment. Data are representative images of 2 biological replicates.
H. Bright field images of ST6WT and ST6KO cells (left panels) and their cell viability (%) after treatment with PAX at indicated doses (0–200 μg/ml) (right panel).
I. Cell viability of ST6WT and ST6KO cells after indicated time of paclitaxel (PAX) treatment at 25 μg/mL
P values are calculated with Student’s t-test in Graphpad unless otherwise indicated. Data are represented as mean with ±SD of 3–5 experimental replicates.
We continued to determine the regulatory effects of ST6GAL1 gene modulation (depletion and overexpression) on human and mouse tumor cell clustering. Both human ST6GAL1 KO (ST6KO) tumor cells (MDA-MB-231 and PDXs) and mouse St6gal1 KO (St6KO) tumor cells (4T1) were generated via CRISPR-Cas9 and specific gRNAs. Using glycoproteomic mass spectrometry, we observed a complete depletion of the peaks of α2,6-SA on glycoproteins whereas α2,3-SA peaks remained in ST6KO MDA-MB-231 cells in comparison with the WT cells (Supplementary Fig. S4A–B), in consistency with the loss of sialic acid peaks in the LC-MS/MS spectra of tryptic digest for extracted ion HexNAc and SA monosaccharide profiles as well as loss of SNA-binding to these cells in flow cytometry profiling (Fig. 2B left panels, Supplementary Fig. S4C), suggesting a dominant role of ST6GAL1 in α2,6-SA of breast tumor cells.
Consistently, both ST6KO in human tumor cells and St6KO in mouse 4T1 tumor cells promoted the cluster formation of tumor cells in suspension compared their WT controls (Fig. 2B, Supplementary Fig. S5A). When ST6GAL1 was overexpressed (OE) in the ST6KO cells, the α2,6-SA levels were rescued with inhibited cluster formation (Fig. 2B, Supplementary Video S3–5). Similarly, the ST6GAL1 depletion-enhanced cluster formation was repeatedly observed in multiple ST6KO clones of MDA-MB-231 cells as well as the cells with siRNA-mediated knockdown of ST6GAL1 (Supplementary Fig. S5B–E). These results suggest that CTC aggregation-based cluster formation is negatively associated with and inhibited by cell surface α2,6-SA levels as well as ST6GAL1.
We then investigated the effects of chemotherapy such as PAX on the levels of surface α2,6-SA and cluster formation of patient CTC-092 derived xenograft tumor cells (PDX) (26) and MDA-MB-231 cells. Clinically used PAX in nano-albumin bound version (PAX-NAB) at 25–50 μg/mL induced minimal cell death in CTC-092 cells ex vivo with a small subset of SNA-high cells showing a selective vulnerability (<5%) to the high dose treatment at 250 μg/mL (Fig. 2C, Supplementary Fig. S5F). As a result, PAX treatment decreased α2,6-SA levels (SNA-binding) in a dose-dependent manner (Fig. 2D) and promoted cluster formation of chemo-resistant CTC-092 cells at a low dose of 25 μg/mL (Fig. 2E, Supplementary Video S6–7). Next, we treated sorted SNA-high and SNA-low cells for PAX treatment and assessed the cell viability. While 35% of the cells in SNA-high populations died in response to PAX treatment, minimal cell death was observed in SNA-low populations (Fig. 2F), suggesting that α2,6-SA deficiency is associated with resistance and/or evasion to PAX treatment. Notably, PAX treatment selectively decreased ST6GAL1 protein expression over time without altering ST3GAL1 levels (Fig. 2G), although transient knockdown of ST3GAL1 (which catalyzes the transfer of α2,3-SA) via siRNAs had similar cluster-promoting effects as siST6GAL1 (Supplementary Fig. S5E), suggesting a distinct regulatory mechanism and chemo-selective pressure on ST6GAL1.
We further determined the effects of ST6GAL1 depletion on cancer cell sensitivity to therapeutic agents, including chemotherapeutics PAX and doxorubicin as well as the CDK inhibitor palbociclib. Compared to ST6WT cells, ST6KO in MDA-MB-231 tumor cells enabled a specific resistance to PAX treatments (25–200 μg/mL) (Fig. 2G–I), but with a similar sensitivity to palbociclib and a moderately increased sensitivity to doxorubicin (Supplementary Fig. S6A–D). When SNA high (WT) and low (ST6KO) cells are mixed at 1:1 ratio prior to treatment, an increased dominance of α2,6-SA low (ST6KO) population of MDA-MB-231 cells emerged 24 hours after PAX treatment (25 μg/mL) (Supplementary Fig. S6E), similar to the profiles of CTC-092 cells in response to PAX treatment (Fig. 2D).
Loss of ST6GAL1 induces quiescence in CTC clusters for chemo-evasion
Next, we investigated if chemo-evasion of the CTC clusters is associated with distinct proliferative status, as previous studies demonstrated that ST6GAL1 and α2,6-SA are associated with cellular proliferation in various cancers (27–29). We first added customized Ki67 staining to the patient CTC panel analyses via CellSearch. Through binary assessment and intensity comparison, decreased Ki67 positivity was observed in clustered CTCs in comparison to single CTCs from patients with breast cancer (Fig. 3A–B, P=0.0005 and 0.008). The heterogeneous levels of Ki67 signal intensity per cell in singles and clusters positively correlate with the DAPI signal intensity (DNA content) in each CTC (Fig. 3C). The cell cycle analyses based on DAPI intensity revealed that the population of G1/G0 phase increased in clusters post chemotherapy (73%) than that of single CTCs (59%), while single and clusters at the baseline prior to therapy were 64% and 67%, respectively (Fig. 3D). Moreover, the intensity of DNA content (DAPI intensity) is in positive correlation with SNA signals (α2,6-SA levels) per human CTC (Fig. 3E). We then continued to measure the α2,6-SA levels and Ki67 positivity of CTCs in TNBC PDX models that develop spontaneous lung metastases (4). Flow cytometry analyses revealed that the SNA-high levels (%) of L2T+/L2G+ CTCs from the PDX-M1 tumor bearing mice also correlated with high Ki67 positivity (Fig. 3F). Furthermore, in PAX-treated mice, the Ki67-positivity (%) within CTC clusters was significantly lower than single CTCs (Fig. 3G), indicating an association of CTC clusters with low α2,6-SA levels and relative quiescence under the pressure of PAX treatment.
Figure 3. Lack of α2,6-SA and ST6GAL1 is associated with quiescence in CTC clusters.
A. Representative CellSearch CTC (CK+DAPI+CD45−) images of two singles and one 5-cell cluster with channels of CK/DAPI merged, DAPI, CD45, and Ki67 signals, collected from the blood of breast cancer patients. One single CTC and one CTC within the cluster stained Ki67 positive. Scale bar = 10 μm.
B. Ki67 signal intensity per cell in single CTCs (n=83 cells) and clustered CTCs (n=102 cells, P=0.0005) as well as binary assessment of Ki67 positive cells (positive threshold at the intensity mean >75) between single CTCs and CTC clusters (P=0.008), as measured on ImageJ.
C. Plots of individual CTCs showing a positive association between quantified Ki67 (proliferative index) and DAPI (DNA content) signal intensities per CTC (n=141, R=0.8618, P<0.00001 calculated using www.socscistatistics.com), as measured on ImageJ.
D. Proportion of single and clustered CTC distributions within the cell cycle phases (G0/G1, S, G2/M) at the baseline and E1 after treatment, based on the DAPI (DNA) intensity of each CTC on ImageJ using CellSearch images. The ranges of DAPI mean intensity/cell: G1/G0<100, S=100–140, G2/M>140 (n=1,684 CTCs from 15 patients with breast cancer), P=0.052 (baseline singles versus baseline clusters), P=8.8E-26 (E1 singles versus E1 clusters), P=0.935 (baseline singles versus E1 singles), and P=5.2E-07 (baseline clusters versus E1 clusters).
E. Dot plots of individual CTCs with a positive correlation between SNA signals (α2,6-SA) and DAPI intensity (DNA content) per CTC (n=164 cells, R=0.4052, P<0.00001).
F-G. The Pearson’s correlation of the percentage (%) of SNA high cells and % of Ki67+ CTCs in M1-PDX tumor bearing mice (N=20 mice, R=0.6278, P<0.00304 calculated using www.socscistatistics.com) (F) and the % of Ki67+ CTCs in singles versus clusters (G) in PBS/PAX-treated PDX-M1 model shown in Fig.1 F-N.
H-J. Gene set enrichment analysis of RNA sequencing of ST6WT versus ST6KO MDA-MB-231 cells. The most down-regulated pathways are purple and up-regulated pathways are blue (H). The enrichment plots for down-regulated pathways include E2F targets, G2M checkpoint, and Myc targets (V1 and V2) (I). The upregulated pathways include interferon response sets, EMT, and inflammatory response genes (J).
K. Cell confluency curves of two clones of ST6WT (1 and 2, purple) versus two clones of ST6KO (1 and 2, blue) cells over 120 hours Data are represented as mean +/− SD of 12 experimental replicates.
L. The relative proportion (%) of α−2,6-SA-low and -high populations in each of the cell cycle phases of ST6WT cells.
M-N. Representative flow profiles (M) and quantification of cell cycle phases (N) of ST6WT versus ST6KO cells. Cellular DNA content is measured with Hoechst-33342 and RNA content is measured with Pyronin Y. Quiescent cells (G0) are distinguished from G1 phase by low level of RNA content with same amount of DNA content.
P values are calculated with Student’s t-test in Excel or GraphPad unless otherwise indicated. Data are represented as mean with ±SD of 3–5 experimental replicates.
To further elucidate the transcriptome programs related to low α2,6-SA levels (ST6GAL1 depletion) and quiescence, we conducted RNA-sequencing analysis of the WT and ST6KO bulk tumor cells. Hallmark pathway analysis and gene set enrichment analysis (GSEA) identified differential regulatory pathways in ST6KO tumor cells, including suppressed cell cycling, such as E2F targets, G2M checkpoints, and Myc targets, as well as upregulated interferon responses, cell adhesion, epithelial-to-mesenchymal transition, and inflammatory responses (Fig. 3H–J, Supplementary Fig. S7A–C, Supplementary Excel S3). As the RB-E2F signaling pathway controls proliferation and quiescence in cancer cells (30–32), we analyzed cell growth and cell cycle phases of the tumor cells using multiple approaches. ST6KO cells showed a delayed growth rate for confluency compared to the WT cells (Fig. 3K). Using Hoechst and pyronin Y-based DNA and RNA (respectively) double staining, we found that α2,6-SA low (SNA-low) WT cells dominated the quiescent pyronin Y− (G0) phase but only contributed to a small subset of active cycling phases G1, S, and G2/M (Fig. 3L). Furthermore, compared to ST6WT cells, ST6KO increased the proportion of tumor cells in quiescent/G0 phase and decreased in active cell cycles such as G1 and G2/M (Fig. 3M–N), with a consistent pattern of delayed and halted cell division with relatively undiluted dye of carboxyfluorescein succinimidyl ester (CFSE) in the KO cells (Supplementary Fig. S8A). Furthermore, ST6KO cells formed significantly smaller colonies than ST6WT cells (Supplementary Fig. S8B). When ST6WT and KO cells were mixed in two distinct colors for competitive proliferation assays in culture (Supplementary Fig. S8C), the counts of ST6KO cells were overtaken by ST6WT cells over time (Supplementary Fig. S8D–G). However, the dominance was converted to ST6KO cells under PAX treatment at an even lower dose of 25 μg/mL (Supplementary Fig. S6E). These results suggest that lack of ST6GAL1 induces cellular quiescence at G0 and provides advantages to chemo-evasion.
Since chemo-resistance is often associated with local relapse and distant metastasis, we continued to investigate the clinical relevance of α2,6-SA and ST6GAL1 levels in CTCs or tumor cells with breast cancer outcomes. Clinically, we observed an unfavorable distant metastasis-free survival (since the diagnosis) of the patients with breast cancer and detectable SNA-low CTCs (Supplementary Fig. S8H). Furthermore, using the online KM-plotter analysis (33), we found that high expression of ST6GAL1 mRNAs are associated with a favorable relapse-free survival (RFS) in TNBC (N=265, P=0.019) and higher protein levels of ST6GAL1 in breast cancer predict a dramatically better OS than those with lower protein levels (N=65, P=0.0096) (Supplementary Fig. S8I–J). These data intrigued us to investigate the alteration patterns and molecular mechanisms associated with the impact of ST6GAL1 in metastasis.
Dynamic changes of α2,6-SA and ST6GAL1 levels in CTCs and DTCs during seeding
To determine the patterns of α2,6 sialylation in CTCs and disseminated tumor cells (DTCs) during metastasis, we compared their ST6GAL1 expression profiles and α2,6-SA levels using immunohistochemistry (IHC) staining and flow cytometry, respectively. In PDX-M1 orthotopic tumor models, the lung tissue sections with spontaneous metastases were stained with anti-human ST6GAL1, showing a significant higher ST6GAL1 positivity (%) in single CTCs and disseminated tumor cells (DTCs) than CTC clusters (Supplementary Fig. S9A–B). Analyses of SNA binding to eGFP+ (L2G+) or tdTomato+ (L2T+) primary tumor cells, CTCs, and lung metastases from TNBC PDX-M1 also revealed lower α2,6-SA levels in CTCs than both primary tumor cells and lung metastases which regained higher levels of α2,6 sialylation after seeding (Supplementary Fig. S9C). Single-cell RNA seq of primary tumor cells, CTCs, and lung metastasis from our PDXs and MDA-MB-231 tumors (4) also revealed low expression of ST6GAL1 in CTCs (Supplementary Fig. S9D), suggesting possible plasticity and dynamic α2,6 sialylation patterns in CTCs during metastatic seeding. Then, we sorted SNA-high and -low cells of MDA-MB-231 cells for tail vein injection into mice and the lungs were dissected and dissociated for flow cytometry analyses of L2G+/L2T+ tumor cells. Surprisingly, the SNA-low tumor cells (sorted as 100% SNA-low) shifted to nearly all SNA-high (>90% high) DTCs in the lungs as detected at 24 hours and 9 days after intravenous injection (Supplementary Fig. S9E–F), suggesting a transient loss of α2,6-SA in CTCs and a dynamic gaining of sialylation in DTCs after seeding. This finding led us to determine the regulatory roles of ST6GAL1 in metastasis in TNBC.
Depletion of ST6GAL1 promotes metastatic seeding of TNBC
Based on the glycan profiles of multiple TNBC PDX tumors (8), we identified SNA-high M1 and M3 PDXs (>95% SNA+) and SNA-low M2 PDXs (~45% SNA+) (Fig. 4A), which were labeled by dual optical reporters L2G or L2T(8) for bioluminescence and fluorescence imaging(4). When placed on collagen-coated plates ex vivo for aggregation-based clustering(4), dissociated SNA-low M2 tumor cells formed 5-fold larger clusters than the SNA-high M1 tumor cells (Fig. 4B). To compensate for potential disadvantages of smaller tumors for metastasis, we designed a series of tumor implantation experiments for slow-growing ST6-deficient tumor cells to reach tumor volumes relatively close to ST6WT or SNA-high tumors for assessment of metastatic seeding and lung colonization. To determine the regulatory roles of ST6GAL1 in tumor growth, CTC clustering, metastatic seeding, and colonization in mice, we combined all data into one table using multiple TNBC PDX models and tumor cell lines, various or same numbers of cells for implantation, and harvesting tumors at various or same times for phenotype comparisons (Supplementary Fig. S10A).
Figure 4. ST6GAL1 inhibits cluster formation and blocks metastatic seeding in PDX models.
A. Flow cytometry profiles of α−2,6-SA (SNA) of indicated PDX models (M1, M2, and M3).
B. Representative images (left) and quantification (right) of cluster size (area) of PDX-M1 (M1) versus PDX-M2 (M2) tumor cells at 24 h (scale bars = 300 μm). Data are represented as mean +/− SD of 6 experimental replicates.
C. Schematic design to analyze spontaneous metastases of M1 (−5 weeks) and M2 (−8 weeks) PDX tumor models: 5×104 cells were orthotopically injected into the 4th mouse mammary fat pads. Five to eight weeks after implantation, breast tumor weight and lung metastasis (lung mets) were measured.
D. Top panels: images of dissected tumors (scale bar = 1cm) and lung metastases (bioluminescence) of PDX-M1 and -M2 models. Bottom panels: quantified tumor weight (g) and lung metastasis (BLI total flux).
E. Flow cytometry profiles of α−2,6-SA levels in ST6WT and ST6KO PDX-M1/M2 models.
F. Flow cytometry profile of α−2,6-SA levels (left panel) and cluster formation curves (right panel) in ST6WT and ST6OE cells derived from M2 PDXs. Curve data are represented as mean +/− SD of 12 experimental replicates.
G. Experimental illustration of tail vein injection of ST6KO (KO) with appropriate ST6WT (WT) controls of PDX-M1 and -M2 models; 1×105 cells/mouse were injected via tail vein and lung localization signals were measured at 24 h and/or 5 weeks after injection.
H. Representative images (left panels) and quantification (right panels) of lung metastatic seedings of ST6WT versus ST6KO M1 and M2 models at 24 h post injection. Lung total flux of cellular bioluminescence signals were imaged prior to and after injections.
I. Lung BLI images (left panel) and quantified lung mets (photons/s) (right panel) at 5 weeks post tail vein injection of ST6WT and ST6KO cells.
J. Schematic illustration of orthotopic implantations of ST6WT and KO PDX-M1 into the 4th mouse mammary fat pads. Two batches of ST6WT (1.2×103 cells/injection) and ST6KO (5×103 cells/injection) cells were injected, and tumors were harvested when reaching ~0.5 g or 1.0 g.
K. Quantified tumor weight for both ST6WT and ST6KO M1 tumor collected at various time points.
L. Representative bioluminescence images (left panels) and quantified lung metastasis (right panels) of ST6WT and ST6KO PDX M1 models at 0.5 g and 1.0 g, respectively. Data are represented as mean +/− SD of 8 experimental replicates.
M. Schematic of orthotopic implantations of ST6WT (6×104 cells) and ST6OE (2×104 cells) PDX-M2 cells per mammary fat pad, photo of primary breast tumors, and tumor weight comparison between two groups. to assess the lung metastases of.
N. Representative bioluminescence images of dissected lungs (left panels) and the relative lung metastases, presented as total flux of the lung bioluminescence, at 2 months of implantation.
P values are calculated with Student’s t-test using GraphPad and data are represented as mean +/− SD of 3–5 experimental replicates unless otherwise indicated.
We first compared the lung metastases developed by SNA-high M1 and SNA-low M2 PDX models (Fig. 4C). Following orthotopic implantations of equal numbers of tumor cells into mouse mammary fat pads but at different timing, we observed a slower growth rate of the SNA-low M2 PDXs which within even extended time window grew about half weight of the SNA-high M1 tumors; however, these smaller M2 tumors developed spontaneous lung metastases with bioluminescence signals in 108-fold higher intensity than that of M1 PDXs (Fig. 4D), suggesting that low α2,6-SA levels are associated with an elevated metastatic potential in PDX models. To determine if genetic modulations of ST6GAL1 and α2,6-SA levels impact lung metastasis, we first generated ST6KO with depleted α2,6-SA levels in M1 and M2 PDXs (Fig. 4E), but also overexpressed ST6GAL1 (ST6OE) in SNA-low M2 PDX cells in which elevated α2,6-SA levels inhibited tumor cell cluster formation (Fig. 4F).
After tail vein injections of equal numbers of tumor cells, ST6KO M1 and ST6KO M2 cells seeded 2.5-fold and 5-fold experimental metastases to the lungs within 24 hours compared to their respective ST6WT tumor cell controls (Fig. 4G–H). The elevated seeding of ST6KO tumor cells sustained in colonizing the lungs more effectively than the WT control cells as detected 5 weeks after injections (Fig. 4I).
After orthotopic implantations of ST6WT and ST6KO tumor cells in identical numbers, we observed a significant delay of tumor initiation and slower growth in ST6KO PDX tumors (both M1 and M2) in comparison to the WT controls (Supplementary Fig. S10A–C). When ST6WT M1 tumors reached ~1.0 g with significant dissemination, ST6KO M1 tumors at 0.2 g almost had undetectable metastases (Supplementary Fig. S10B), suggesting a minimal requirement of primary tumor volume for suitable evaluation of metastatic potential. Instead, ST6KO M2 tumors at 0.5 g seeded more spontaneous lung metastases relative to the tumor burden than the WT M2 tumors at the size of ~1.0 g (Supplementary Fig. S10B–C).
Furthermore, the ST6WT and ST6KO tumor cells in the PDX-M1 model were implanted at various ratios of cells or within extended time to reach relatively comparable tumor volumes (Fig. 4J–K). With matched tumor weight of 0.5 g or 1.0 g, α2,6-SA-deficient ST6KO M1 tumors developed >20-fold more spontaneous lung metastases than that of ST6WT M1 tumors (Fig. 4L–N). A higher number of CTCs and especially CTC clusters were detected in ST6KO M1 tumor-bearing mice than the WT control via flow cytometry (Supplementary Fig. S10D–F).
Loss of ST6GAL1 promotes trans-endothelial migration for metastatic seeding
To further assess the extravasation and metastatic seeding of SNA-low CTCs into the lungs, we performed endothelial CD31 staining with the lung tissue sections of PDX tumor-bearing mice to distinguish the vascular CTCs in situ and extravascular DTCs (Supplementary Fig. S10G). In PDX-M1 tumor models, orthotopically implanted ST6KO tumors disseminated more DTCs to the lungs with a higher number of vascular CTC clusters than the ST6WT tumors but with relatively comparable single CTCs, detected via IHC staining of mouse lung sections (Supplementary Fig. S10G–H). In addition, ST6KO tumors disseminated more DTCs but showed a lower Ki67 positivity than ST6WT cells (Supplementary Fig. S10I–J).
On the other hand, the metastatic potential of PDX-M2 models were assessed with ST6WT and ST6OE tumor cells implanted at 3:1 ratio into separate mice (Fig. 4M). ST6OE M2 tumors with an up-regulation of α2,6-SA levels grew into >2-fold higher tumor weight than the WT control tumors, but relatively impaired spontaneous lung metastasis, measured via bioluminescence imaging (Fig. 4N). IHC analyses further revealed that ST6OE decreased lesions and numbers of DTCs to the lungs, even though with a relatively higher rate of Ki67+ DTCs than those of the ST6WT control tumors (Supplementary Fig. S11A–D).
We further evaluated the function of ST6GAL1 in trans-endothelial migration during metastatic seeding, using our established trans-endothelial migration assay(34,35) with tumor cells seeded onto human umbilical vein endothelial cells (HUVECs) 33,34. Consistently, ST6KO MDA-MB-231 tumor cells with depleted α2,6-SA interacted with and transmigrated through HUVECs at a much higher efficiency than the ST6WT cells (Supplementary Fig. S12A). Similarly, within 24 hours following tail vein injections, ST6KO (GFP) cells seeded in the lungs with dramatically increased number of clusters than ST6WT (tdTomato) cells, in either separately injected or mixed injected (tdTomato labeled ST6WT with eGFP labeled ST6KO MDA-MB-231 cells) (Supplementary Fig. S12B–F). In addition, following separate orthotopic implantations or mixed implantations into NSG mammary fat pads, ST6KO tumor cells seeded more colonies (total foci) into the lungs but developed into smaller lung colonies compared to ST6WT tumor cells (Supplementary Fig. S12G–L), due to a relatively quiescent phenotype of ST6KO tumor cells (Fig. 3–4, Supplementary Fig. S10–11).
Together, these results demonstrate double-edge regulatory effects of ST6GAL1 which deficiency slows down tumor growth but improves CTC clustering and subsequent seeding into the lungs, whereas ST6GAL1 upregulation enhances tumor growth with a compromised dissemination and metastasis. However, the dynamics of ST6GAL1 alteration with its transient deficiency in CTCs enables clustering and seeding as rate-limiting steps whereas restored expression in DTCs empowers secondary regeneration rates in mice.
Glycoproteomic analyses reveal novel α2,6-sialylation substrates of ST6GAL1
To identify the glycoprotein targets of ST6GAL1 that impact tumor cell cluster formation and metastatic seeding, we performed global glycoproteomic analysis of SNA-precipitated proteins from the membrane fractions or whole cell lysates of ST6WT and ST6KO cells (MDA-MB-231) (Fig. 5A). A total of 217 SNA-bound glycoproteins were specifically identified from the membrane fractions of ST6WT cells in comparison to the negative control of ST6KO cells, including previously known proteins that facilitate CTC cluster formation such as CD44 (4) , EGFR (36), ICAM1 (15), and DSG2 (Desmoglein 2) (37) (Supplementary Excel S4, Supplementary Fig. S13A). Among these glycoprotein targets of ST6GAL1, 68 peptides with characterized N-linked glycans belong to 14 glycoproteins, including known targets of ST6GAL1 (integrin β1) and many newly identified targets such as adhesion molecules PODXL, CD97, ECE1, ALCAM1, and ICAM1, immune regulator HLA-A2, and exosomal proteins CD63, LAMP1 and LAMP2 (Fig. 5B, Supplementary Excel S5). Immunoblotting of the SNA-precipitates further confirmed that PODXL, CD97, ECE1, ALCAM1, ICAM1, and CD44 were enriched in the membrane fractions and specifically pulled down by SNA from WT cells only (Fig. 5C, Supplementary Fig. S13B).
Figure 5. Glycoproteomic analyses reveal novel α2,6-sialylation targets of ST6GAL1.
A. Experimental design of glycoproteome profiles of SNA-bound α2,6-SA+ membrane proteins isolated from ST6WT and KO cells. The membrane fractions were isolated and α2,6-SA-linked proteins were co-immunoprecipitated with SNA-conjugated agarose beads. Purified proteins were loaded to glycoproteomics analysis.
B. The list of top ST6GAL1 target glycoproteins including their α2,6-sialylation sites on the peptide.
C. Immunoblots of the ST6GAL substrates PODXL, ECE1, CD97, ALCAM1 and ICAM1 with the pulldowns by SNA (α−2,6-SA+ proteins) or agarose controls, and input controls of the membrane fraction (Mem) or whole cell lysate (WCL) from ST6WT (+) and ST6KO (–) MDA-MB-231 cells.
D. Immunoblots of ST6GAL1 target proteins and the loading control β-actin from the lysates of ST6KO MDA-MB-231 cells transfected with the scramble control (scr) and siRNAs for PODXL, ECE1, CD97, ALCAM1, and ICAM1.
E-F. Representative images of clusters at 2 hours (E) and cluster formation curves over the time (0–16 h) of ST6KO (F) MDA-MB-231 cells after down-regulation of indicated genes. Scr = scrambled control siRNA. P scrST6KO vs WT<0.0001, P scrST6KO vs siPODXL=0.0001, P scrST6KO vs siECE1=0.0175, P scrST6KO vs siALCAM1=0.0260, P scrST6KO vs siCD97=0.0043, P scrST6KO vs siICAM1=0.0003, scale bar = 100 μm. P values are calculated with T-TEST using GraphPad. Data are represented as mean +/− SD of 12 experimental replicates. Cluster videos are attached as Suppl. Video 8–14.
G. Representative images of PODXL staining on patient CTCs (CD45-CK+DAPI+) via CellSearch (left panel) and flow cytometry-based quantification (right panel) of PODXL expression.
H. Schematic (left panel) and quantification (right panel) of cell binding analyses (ST6WT/ST6KO) with PODXL (P) and α2,6-desialylated PODXL (dP), isolated from ST6WT and ST6KO cells, respectively.
P values are calculated with Student’s t-test using GraphPad and data are represented as mean +/− SD of 3–5 experimental replicates unless otherwise indicated.
We hypothesized that these adhesion glycoproteins contribute to tumor cell cluster formation and metastatic seeding; and their levels and/or activity are subject to and regulated by ST6GAL1-mediated sialylation. To examine the importance of unknown adhesion glycoproteins in cluster formation, we transfected both ST6WT and KO cells with siRNAs to deplete individual target proteins. Using ICAM1 and DSG2 knockdown as positive controls, down-regulation of PODXL, CD97, ECE1, and ALCAM1 also significantly inhibited cluster formation of ST6KO cancer cells, in which PODXL knockdown particularly reversed the clustering level equivalent to the ST6WT cells (Fig. 5D–F, Supplementary Videos S8–14). Moreover, knockdown of PODXL and other adhesion molecules in ST6WT cells also slightly suppressed the tumor cell cluster formation except for ALCAM1 and DSG2 which had minimal effects (Supplementary Fig. S14A–C, Supplementary Videos S15–20). These data demonstrate that targeting of the downstream adhesion molecules of ST6GAL1 provides possible strategies to partially or completely reverse the tumor cell clustering promoted by loss of α2,6-SA or ST6GAL1.
We continued to analyze the expression of adhesion molecules in the CTCs of patients with breast cancer using CellSearch and flow cytometry. PODXL expression was significantly enriched in the CTC clusters in comparison to single CTCs isolated from the blood of breast cancer patients (Fig. 5G). An increased protein expression level of PODXL was also observed in ST6KO cells without an alteration of mRNA expression (Supplementary Fig. S14D–E), implicating potential post-translational advantageous of desialylated PODXL. Furthermore, we isolated sialylated and desialylated PODXL protein from respective ST6WT and ST6KO cell membrane fractions for cellular binding. The dP-KO binding between desialylated PODXL (dP) and ST6KO cells was stronger than other pairs of bindings, such as dP-WT (dP binding with ST6WT cells) and P-KO (sialylated PODXL binding with ST6KO cells) (Fig. 5H). Consistently, after neuraminidase treatment, desialylated CD44 increased binding affinity for its homophilic interactions on solid phase (Supplementary Fig. S14F). This suggests that ST6GAL1-mediated α2,6-sialylation of PODXL may negatively regulate protein stability and/or inhibit their binding activity necessary for tumor cluster formation. The molecular mechanism of ST6GAL1 mediated stability of PODXL remains in our future investigation.
Targeting PODXL blocks lung metastasis promoted by ST6GAL1 deficiency and chemo-evasion
To demonstrate whether PODXL and other adhesion molecules contribute to ST6GAL1 deficiency-promoted metastatic seeding in vivo, we knocked down these genes in ST6KO and ST6WT cells prior to cell inoculation into mice. Reduced expression levels of PODXL, CD97, ECE1, ALCAM1 and ICAM1 in these tumor cells were verified via immunoblotting (Fig. 5D, Supplementary Fig. S14A). At 24 hours post tail vein injection, PODXL knockdown effectively blocked 80–90% of metastatic seeding and tumor cluster formation in both ST6KO and ST6WT cells (Fig. 6A–C), similar to the inhibitory effects of ICAM1 knockdown (4,15), whereas knockdown of ECE1, CD97, and ALCAM1 displayed relatively weaker inhibitory effects (Supplementary Fig. S15A–F). PODXL knockdown had minimal effects on the proliferation nor the viability of transfected cells (Supplementary Fig. S15G–H). Similarly, cell viability was not affected by CD97 knockdown and slightly improved by knockdowns of ECE1 or ALCAM1 except for a small decrease by ICAM1 down-regulation (Supplementary Fig. S15H).
Figure 6. Targeting PODXL blocks ST6KO- and chemo-associated metastasis.
A-C. Bioluminescence images (BLI) and lung metastasis quantifications of mouse imaging (A) and dissected lungs ex vivo (B), and fluorescence images and relative metastatic seeding (disseminated colonies) to the lungs (C), at 24 h after tail vein injections of ST6WT (in purple) and ST6KO (in blue) cells transfected twice with a scrambled control (scr) and siPODXL (siP) for gene knockdown. Scale bars = 100 μm.
D-F. Experimental design (D), representative images and quantification of mouse BLI (E) and lung ex-vivo BLI (F) to determine the lung metastases after administration of IgG and anti-PODXL (αP) neutralizing antibody to ST6WT MDA-MB-231 cells. 6.5×104 cells/mice were pre-incubated with αP antibody (7 μg/mice) or isotope control IgG (7 μg/mice) for 1 h. Cells were then injected via tail vein and BLI was measured after 24 h of injection (E). Then mice were sacrificed and ex-vivo images of the lungs were measured (F).
G-I. Schematic view of experiment for co-treatment of PAX and αP antibody (G). PDX-M1 tumor cells were pretreated with PAX (NAB) (50 μg/ml) or PBS with αP (20 μg/ml) or IgG control (20 μg/ml) and incubated for 12 h at 37°C. Meanwhile, mice were treated with the same combination of drugs (PAX-NAB, 27 mg/kg or PBS, αP or IgG control, 30 μg/mouse) via tail vein 3 h prior to cell inoculation. 20 h and 3 weeks (3 w) after IV injection of the cells, lungs were dissected for ex-vivo BLI (H, left panel, 20h) and disseminated lung metastasis quantified as total flux in H (right panel, 20h) and I (3 w).
J-N. Experimental design of co-treatment of mice bearing orthotropic PDX-M1 tumors. First, ST6KO M1-PDX cells were injected into mammary fat pad. Mice were co-treated with PAX (NAB) (13.5mg/kg) or PBS and αP or IgG control (20 μg/mouse) once in every 3 days. After 11 times treatment, mice were sacrificed for further analysis. Tumors weight (K), representative images of lung BLI (L) with normalized quantification of lung total flux with tumor weight (M), and the count of CTC clusters (N, left panel) and single CTC (right panel) are shown.
P values are calculated with Student’s t-test using GraphPad. Data are represented as mean +/− SD of 3–4 biological replicates.
As proof-of-concept, we investigated the possibility of targeting PODXL therapeutically using a neutralizing antibody in multiple tumor models. Administration with the anti-PODXL antibody (5–20 μg/mL) significantly blocked tumor cell cluster formation of ST6KO and ST6WT tumor cells (MDA-MB-231) as well as the M2 PDX cells ex vivo (Supplementary Fig. S16A–C). Knockdown of PODXL diminished the binding of anti-PODXL to these cells suggesting minimal off-target binding of this antibody to PODXL-negative cells (Supplementary Fig. S16D). When anti-PODXL antibody was administered intravenously once (7 μg/mouse) at 1 hour prior to tumor cell inoculation, it efficiently blocked near half of the metastatic seeding from both ST6WT and ST6KO MDA-MB-231 tumor cells as measured at 24 hours after tail vein-inoculation (Fig. 6D–F, Supplementary Fig. S16E–F).
We then tested the efficacy of anti-PODXL in preventing and treating the metastatic PDX models (M1 and CTC-092) which resist PAX chemotherapy. In an experimental metastasis study, the dissociated ST6WT PDX tumor cells were pretreated with PAX (50 μg/mL) ex vivo for 12 hours and then inoculated via tail-vein into the mice. Mice were pre-treated with PAX (27 mg/kg) 3 hours prior to cell inoculation (Fig. 6G). Revealed by the analyses at 20 hours and 3 weeks, PAX-promoted metastatic seeding of these tumor cells to the lungs were almost completely inhibited by a concurrent treatment with anti-PODXL (20 μg/mL ex vivo and 30 μg/mouse via intravenous injection) in M1 PDX models (Fig. 6G–I). In CTC-092 PDX models, anti-PODXL administration also reduced lung colonization in both PBS and PAX treatment groups (Supplementary Fig. S17A).
We further investigated the therapeutic effects of anti-PODXL on spontaneous metastasis which is elevated by ST6KO and PAX treatment in PDX tumor cells (Fig. 6I). Following orthotopic tumor implantations, the PAX administration (13.5 mg/kg, i.p., every 3 days for 11 cycles, started from second week) failed to shrink the primary tumor but increased spontaneous lung metastases along with elevated CTC clusters (Fig. 6J–N). Intravenous anti-PODXL treatment at the dosage of 20 μg/mouse concurrent to PAX treatment (every 3 days for 11 cycles) effectively blocked spontaneous metastases along with a dramatic reduction in CTC clusters (Fig. 6N, Supplementary Fig. S17B–E).
In a summary, our work reports PODXL as a promising new target of ST6GAL1 contributing to increased formation of quiescent CTC clusters and breast cancer metastasis in response to PAX therapy.
Discussion
Collectively, our study demonstrates that PAX-induced loss of ST6GAL1 and α2,6-sialylation promotes adhesion molecule-mediated CTC cluster formation and metastatic seeding of TNBC. During chemotherapeutic treatment, the prognosis of TNBC is not only determined by treatment response in primary tumor, but also by the metastatic outgrowth. Chemo-evasion is one of the most challenging problems compromising patient survival. PAX has previously been shown to delay tumor growth but increase metastasis with unknown mechanisms (38). Our study unveils unexpected effects of chemo-evasion and ST6GAL1 deficiency on promoting CTC cluster formation linked to an expected quiescence phenotype. A number of studies have also shown that PAX induces drug resistance through NF-κB activation and tumor cell dissemination by activating inflammation that promote angiogenesis (39). PAX may also induce breast cancer cell intravasation and dissemination by promoting formation of micro-anatomical structure called tumor microenvironment of metastasis (known as TMEM) (38). Interestingly, our signaling pathway analysis also reports that loss of ST6GAL1 results in activation of tumor-intrinsic inflammatory pathways that may also relate to chemo-evasion and the responses in PAX-treated cells.
Targeting quiescent metastatic stem cells and/or CTC clusters is a demanding task to counter chemo-evasion and block metastasis. The comprehensive glycoproteomic analyses of α2,6-sialylated proteins provides a robust platform by which we have further identified new adhesion protein substrates of ST6GAL1, such as PODXL, as innovative therapeutic targets. In addition to promoting homotypic CTC-CTC cluster formation, ST6GAL1 deficiency also promotes heterotypic tumor cell-endothelial cell interactions, thereby facilitating trans-endothelial migration, which is a gatekeeping step during metastatic seeding. Antibody-mediated blockade of PODXL interaction with neighboring cells further suggests a proof-of-concept therapeutic approach for inhibiting CTC cluster formation and blocking lung metastasis of TNBC.
While PODXL is one of the top substrates responsible for ST6GAL1-mediated regulation in metastatic seeding, many others may be required for optimal tumor stem cell cluster formation, such as ICAM1(15), CD44 (4), and EGFR (36) as demonstrated in our previous studies. Moreover, large CTC clusters may also be possibly trapped in capillaries or enabling closure of such vasculatures for initiation of colonization (16). Seeking combinational targeting approaches to prevent and treat metastasis remains urgent and to be further advanced.
Glycosylation of cell surface proteins is constantly and dynamically changing and is associated with cancer development (18) in a context-dependent manner in various cancers including breast (40), prostate (41), ovarian (42), and colorectal cancers (43,44). Glycosylation patterns modulate cell surface polarity and protein binding affinity to finely tune cell-cell and protein-protein interactions (18). Altered glycosyltransferases and glycosylation are often associated with oncogenic transformation in various cancers including breast cancer. The most frequent altered glycosylations are sialylation, fucosylation, and O-glycan truncation (18,19). N-glycan sialylation refers to the covalent addition of negatively-charged SAs via α2,3-, α2,6-, or α2,8-bonds to the terminal end of oligosaccharides that are linked to the asparagine (N) residue of glycoproteins (20).
While sialylation may increase intercellular communication via lectin ligand-binding activities of glycoproteins (18,19), loss of α2,6-sialylation promotes CTC cluster formation and metastatic seeding, likely through enhanced binding of ST6GAL1 substrate adhesion molecules. In addition to a possible negative association between CD44 and ST6GAL1, future studies will be pursued to elucidate the biochemical properties and regulatory mechanisms underlying transient and dynamic loss of α2,6-sialylation in CTCs during metastasis and in response to chemotherapy. We speculate that the negative charges α2,6-SA brings to glycoproteins on cell surfaces may cause cell repulsion and shedding of migratory tumor cells at the early steps of metastasis, and removal of α2,6-SA in CTCs may expose strong binding sites among cell adhesion molecule and their ligands to facilitate clustering and seeding with advantageous quiescence to evade chemotherapy. In mammals, α2,6-sialylation is catalyzed by two different sialyltransferases, ST6GAL1 and ST6GAL2 (40). While ST6GAL1 is ubiquitously expressed in human tissues and implicated in various tumors including breast cancer, ST6GAL2 expression is limited to the brain cortex and embryos (40). It might be interesting to examine if chemotherapy or PAX impacts ST6GAL2 and cellular functions in those tissues such as neuropathy.
Methods
Human specimen analyses.
All human specimen collection and blood sample analyses were performed according to Northwestern University’s Institutional Review Board-approved protocol (IRB STU00203283) and following NIH guidelines for human subject studies. Written informed consent was provided by the patients whose blood and/or tissue specimens were analyzed for the study.
Overall Survival analysis.
The cohort consisted of 157 patients with metastatic breast cancer (MBC) longitudinally characterized for CTCs and CTC clusters at the Robert H. Lurie Comprehensive Cancer Center at Northwestern University (Chicago, IL). Patients were enrolled under the Investigator Initiated Trial NU16B06 (IRB STU00203283) at the time of initial metastasis or disease progression, independent of line of therapy. Imaging was performed according to the investigators’ choice. Clusters enumeration was performed before treatment start (baseline) and at the first clinical evaluation one (E1) within a median of 3 months after the baseline time-point. OS was defined as the time from baseline until from any cause. Patients without an end point event at the last follow-up visit were censored. Differences were analyzed by logrank test and presented by Kaplan-Meier estimator plot.
Animal studies.
PDX mouse models were kept in specific pathogen-free facilities in the Animal Resources Center at Northwestern University. All animal procedures complied with the NIH Guidelines for the Care and Use of Laboratory Animals and were approved by the Northwestern University Institutional Animal Care and Use Committee (IACUC protocol IS00016125). Animals were randomized by age. Sample sizes were specified based on the results of preliminary experiments. Immunodeficient NSG (NOD Scid Gamma) mice (8–10 weeks old) were utilized for orthotopic implantation and tail vein injection of multiple TNBC PDX models and MDA-MB-231 breast cancer cell lines. The PDX models were established as described previously(8).
Circulating tumor cell (CTC) analyses by CellSearch and flow cytometry.
Two complementary methods were previously established in the laboratory for CTC analyses in parallel using distinct blood sample tubes (4,45). One is FDA-approved CellSearch platform with blood drawn directly into CellSave Preservative Tubes (Menarini Silicon Biosystems) which contains cell preservatives to keep CTCs intact under storage at room temperature. Another is flow cytometry of live CTCs (blood cell lineage-negative) with blood drawn into EDTA Vacutainer tubes (Becton Dickinson).
(1). CellSearch:
The CellSearch System (Menarini Silicon Biosystems) is semiautomated for blood sample processing, enrichment of EpCAM+ epithelial CTCs using Epithelial Cell Kit (EpCAM-coated magnetic beads), and subsequent four-channel immunofluorescence staining as described in Cristofanilli et al. (45). Normally, CTCs are specified by combining three routine channels of DAPI positivity, negative for white blood cell marker CD45, and positive for epithelial marker cytokeratin (8, 18, and 19), with the fourth and the only channel open for analysis of one customized candidate marker, such as glycans and proteins. Fluorophore-labeled lectins were used for glycan recognition, such as Flourescein labeled Sambucus Nigra Lectin (SNA, EBL) (Vector lab, FL-1301) for α2,6-SA analysis. Fluorophore-conjugated antibodies were chosen for optimized detection of proteins, such as anti-PODXL (Santa Cruz Biotechnology, 3D3, sc-23904 PE) and anti-Ki67 (Abcam, SP6, ab282173). For the PODXL staining, blood samples were prestained with antibody for 30 min at 37°C and then proceeded for semiautomated processing on CellSearch as described (45,46).
(2). Flow Cytometry:
The protocol of Flow Cytometry for CTC analysis was previously established (4) and optimized for comprehensive analysis of glycans and other protein markers. The blood samples were collected into EDTA Vacutainer tubes (Becton Dickinson) from breast cancer patients and stored on ice or 4°C temporarily prior to manual blood processing within 24 hours (h). After multiple rounds (two to four rounds) of red blood cell lysis (lysis buffer, Sigma, R7757), white blood cells (mainly peripheral blood mononuclear cells) were washed twice with PBS. Cells were fixed with 3% paraformaldehyde for 30 minutes for glycan and protein profiling analyses. Cells were blocked with carbo-free blocking solution (Vector laboratories, SP-5040) and stained with antibodies for proteins (CD45, epithelial marker EpCAM and other blood cell lineage markers) and lectins for glycans, such as SNA-FITC, MALII-FITC, PHA-L-PE, LTL-FITC, RCA-Rho, LEL-APC, ConA-PE (Vector labs) and MALII-FITC (GlycoMATRIX). CTCs were gated based on cell size (forward-scatter and side-scatter channels), CD45 negativity, and EpCAM+/− Cytokeratin +/−.
Cell lines and transfections.
Human MDA-MB-231 cells and mouse breast cancer cell line 4T1 were purchased commercially from ATCC, and periodically verified to be mycoplasma-negative using MycoAlert Mycoplasma Detection Kit (Lonza, LT07–218). Cell morphology, growth characteristics, and microarray gene expression analyses were compared to published information to ensure their authenticity. Early passage of cells (<15 passages) was maintained in Dulbecco’s modified Eagle medium with 10% fetal bovine serum (FBS) + 1% penicillin-streptomycin (P/S). Primary tumor cells were cultured in HuMEC-ready medium (Life Technologies) plus 5% FBS and 0.5% P/S in collagen type I (BD Biosciences) coated plates. ON-TARGETplus siRNAs for ST6GAL1, PODXL, ALCAM1, ECE1, CD97, and ICAM1 and non-targeting control siRNA were purchased from Dharmacon and transfected using Dharmafect (Dharmacon) at 50 nM, and for the double knockdown, cells were transfected again after 24–48 h. Transfection efficiency was evaluated by flow cytometry analysis and western blotting.
Tumor dissociation and orthotopic injection.
L2T- or L2G-labeled PDX tumors or MDA-MB-231 cell tumors were dissociated with liberase TH lysis buffer (Sigma-Aldrich) according to the supplied protocol, and after dissociation, cells were filtered with 70 μm and 40 μm strainers. Red blood cells were lysed with red blood cell lysing buffer (Sigma) for 1 min on ice and washed with PBS. Next, 100–1,000 cells were resuspended in Matrigel: phosphate-buffered saline (PBS) (50 : 50 μl) and injected under the mammary fad pad. Tumor growth was monitored weekly under in vivo bioluminescence imaging (see below). After euthanizing mice, tumors were dissected and weighed and dissociated for clustering assays, western blotting, and flow cytometry analysis. Lung metastases were imaged by fluorescence microscopy and bioluminescence imaging and fixed with 4% paraformaldehyde for immunofluorescence staining and 4% formalin for immunohistochemistry. Lungs were dissociated using the same techniques as tumors for flow cytometry analysis to quantify lung metastasized cells.
Tail vein injection.
After dissociation of the tumors, L2G- or L2T-labeled PDX cells (0.5 × 105 – 2 ×105/mouse) or MDA-MB231 cells (1 × 105/mouse) were resuspended in PBS (200 μl/mouse) and reinjected via the tail vein. Because the bioluminescence signal is dependent on cellular metabolic energy and modulation of ST6GAL1 gene effects cellular activity, the same number of cells per mouse were imaged by bioluminescence before injection to estimate lung localization of the cells. Mice were imaged right after tail vein injection and 24 h post-injection. After that, mice were euthanized, and lung metastasis was measured by bioluminescence imaging (BLI) and fluorescence microscopy. Lungs were dissociated for flow cytometry analysis and fixed for IFC and immunohistochemistry analysis.
PAX treatment of M1-PDX model after orthotopic inoculation.
ST6WT cells (1 × 106) were injected into mammary fad pad. After one week of tumor-growth, mice were treated with PAX (NAB) (13.5 mg/kg) or PBS control (in every 3 days, 10 times). Mice were sacrificed and blood were collected from the heart individually. Red Blood cells were lysed by using RBC buffer (0.15 M ammonium chloride, 1 mM potasium bicarbonate, 0.1 mM EDTA, pH 7.2 – 7.4). tdTomato labeled PDX-M1 CTCs in blood and the percentage of SNA-high and Ki67 staining in single CTCs and CTC clusters are quantified using flow cytometry. The gating strategy of CTCs is shown in Suppl.Fig.S17. After collecting blood tumor and lungs were dissected and lung ex-vivo BLI were measured as explained above.
Anti-PODXL antibody treatment of MDA-MB-231 tumor cells via tail vein injection.
ST6WT and ST6KO cells (6.5×104) were pre-treated with 7 μg/mice concentration of antibody or isotope IgG control for 2 hours at 37°C. Cells in 200 μL were then inoculated directly to the mice via tail vein. Since BLI of the ST6WT and ST6KO cells were different due to cell activity, we first performed BLI of the same number of the cells for further analyses. After cell inoculation, BLI of the mice were imaged after 1 hour and 24 hours and sacrificed. Lung ex vivo images were taken right after sacrifice. The quantifications of the total fluxes were normalized with the total flux of the cells that were imaged before cell tail vein injection.
Anti-PODXL and PAX (NAB) treatment of M1-PDX/CTC-092-PDX via tail vein injection.
Luc2-tdTomato labeled PDX-M1 or CTC-092-PDX cells were dissociated and pre-treated with PAX (NAB) (50 μg/mL) and/or anti-PODXL antibody or isotope control IgG (20 μg/mL) for 12 hours. After washing and centrifugation, 5 × 105 cells were inoculated into the tail vein of the mice pretreated with PAX (27 mg/kg) and anti-PODXL or IgG (~30 μg/mouse) at 3 hours prior to cell inoculation. 20 hours or 3 weeks after tumor cell injections, bioluminescence signals of the mice and dissected lungs were imaged using SII LAGO (excitation wavelength was 465 nm and emission filter wavelength was 510 nm).
Co-treatment of Anti-PODXL and PAX in M1-PDX after orthotopic inoculation.
ST6KO cells (1 × 106) were injected into mammary fad pad. After one week tumor-growth, mice were treated with PAX (NAB) (13.5 mg/kg) and/or anti-PODXL antibody or isotope control IgG (10 μg/mouse, in every 3 days, 12 times). Mice were sacrificed and blood were collected from the heart individually. Red Blood cells were lysed by using RBC buffer (0.15 M ammonium chloride, 1 mM potasium bicarbonate, 0.1 mmol/L EDTA, pH 7.2 – 7.4). tdTomato labeled PDX-M1 CTCs in blood were quantified using flow cytometry. The gating strategy is shown in Suppl.Fig.14. After collecting blood tumor and lungs were dissected and lung ex-vivo BLI were measured as explained above. The total flux of lungs was normalized with tumor weight.
Bioluminescence imaging.
After intraperitoneal injections with 100 μl of D-luciferin (30 mg/ml, Gold Biotechnology, 115144-35-9), mice were anesthetized with isoflurane. Bioluminescence images were acquired using a Spectral Lago system from Spectral Instruments Imaging, and the signals are presented as total flux (photons/second, p/s) and fold changes of the total flux signals (Aura, version 2.2.1.1). Acquisition times ranged from 5 s to 5 min.
Flow cytometry and cell sorting.
L2T- or L2G-labeled PDX tumor cells or MDA-MB-231 cells were washed twice with PBS and blocked with carbo-free blocking solution (Vector labs, SP-5040) for 20 min on ice (1 × 106 cells in 0.2 mL). Then cells were incubated with the appropriate lectins (1 μl/1×106 cells) including biotinylated SNA, MAL-II, LTL, or PHA-L (Vector labs). Streptavidin-labeled APC antibodies were used as secondary antibodies at the beginning of the experiments, and later SNA-FITC and SNA-APC (Vector labs) were used at the same concentrations. CD44 antibody with PE, APC, FITC, or Pe-Cy7 labels (R&D systems) were co-incubated with lectins at the concentrations suggested by the manufacturers. Cells were analyzed with a BD-LSR II flow cytometer (BD Bioscience) or BDAria cell sorter (BD Bioscience). DAPI was used for cell viability control.
Western blotting and immunoprecipitation.
Cultured cells were scraped and washed twice with PBS before lysing with RIPA buffer (Thermo Fisher) with protease inhibitor cocktail (1:100 dilution, Thermo Fisher). Lysis was completed for 30 min on ice, and the mixture was centrifuged for 10 min at 4 °C and 14,000 rpm. For western blotting, 2–10 μg of protein were denatured at 100 °C for 5 min and subjected to SDS-PAGE, then transferred to PVDF membranes. For immunoprecipitation, 100–1,000 μg of protein were first preincubated with agarose beads (Vector labs) for 1 h. Then SNA-tagged agarose beads (Vector labs, Al-1303) were added to the lysates and incubated overnight at 4 °C on a rotator. SNA-bound proteins were eluted with SDS buffer (BioRad) and subjected to SDS-PAGE. Antibodies against ST6GAL1 (R&D systems, AF5924), ST3GAL1 (R&D System, AF6905-SP), FUT3 (I) (anti-CD174, Biolegend 392602), FUT3 (II) (Abcam, ab110082), CERCAM (Santa Cruz, D-4, sc-514083), Serpine-1 (Proteintech, 13801–1-AP), L1CAM (Thermo Fisher, 1.G11B1, MA526429), CD44 (Thermo Fisher, 8E2F3, MA515462), PODXL (Santa Cruz, 3D3, sc-23904), ICAM1 (Sigma, HPA004877), ECE1 (Santa Cruz, A-6, sc-376017), ALCAM1 (Proteintech, 21972–1-AP), CD97 (Santa Cruz, G-8, sc-166852), Na+/K+ ATPase aptha1 (Santa Cruz, C464.6) and β-actin (Sigma, A5441) were used as primary antibodies, and horseradish peroxidase-conjugated secondary antibodies were from Promega (Rabbit W401B and Mouse W402B). The substrate ECL was detected by Pierce ECL2 solution (Thermo Fisher Scientific, 1896433A).
Release of N-linked glycans from cells.
About 20 × 106 cells were lysed in a high salt buffer (2M NaCl, 5 mM EDTA in 100 mM Tris.HCl pH 7.5), centrifuged at 15000 rcf for 5 min and collected the pellet. The protein pellet is subsequently dissolved in a urea lysis buffer (8 mol/L urea, 4 % CHAPS, 100 mmol/L DTT, 5 mM EDTA in 100 mmol/L Tris.HCl, pH 8) and heated at 60 °C for 45 min for protein reduction. Further, 300 mM iodoacetamide was added to the protein sample and incubated in the dark at room temperature for 45 min. The samples were dialyzed, and to make 500 μL of sample, 50 μL of 10 × New England Biolabs (NEB) glycobuffer 2 buffer was added to prepare a 1 × solution. The samples were then treated with 5 μL of PNGase F (NEB), and the mixture was incubated at 37 °C for 16 h to release the N-linked glycans. The N-glycans were recovered by passing the mixture through a C18 cartridge, eluting the N-glycans with 5 % acetic acid, and lyophilization. The N-glycans were permethylated by methyl iodide in the presence of sodium hydroxide-dimethyl sulfoxide (NaOH-DMSO) and further analyzed by ESI-MSn (47).
ESI-MSn analysis of glycans.
About 2 μL of permethylated glycans were dissolved in 98 μL of ESI-MS infusion buffer (1:1:1 - Methanol, 0.1 % formic acid in water and acetonitrile) and infused into Orbitrap Fusion Tribrid mass spectrometer. A precursor scan was acquired at 120,000 resolution and subsequent CID MSn was acquired for the detailed structural characterization of glycans. For the determination of sialic acid linkages, the glycans were infused with lithium salts for increased cross ring fragmentation of glycans. The cross-ring fragments of the partially methylated galactose to which the sialic acids are either 2,3- or 2,6-linked are different and allow the identification of sialic acid linkages (47).
Glycoproteomics.
The glycoproteins were enriched by SNA lectin from membrane fractions as described in western blotting and immunoprecipitation section. Glycoproteins were eluted by boiling in SDS buffer. The control and knockout samples were run on SDS gel, stained with Coomassie Blue, the gel bands were excised, de-stained, reduced, alkylated and proteins were digested by trypsinization at 37 °C for 24 h. Further, the digested peptides were extracted from the gel pieces, filtered, and evaporated to dryness. The peptides were re-dissolved in 0.1 % formic acid and injected into Orbitrap Fusion Tribrid mass spectrometer coupled with Dionex LC system for glycoproteomics analysis. Acclaim PepMap® nano-LC column (Thermo Scientific; Cat No. 164568) of 150 mm length with 75 μm internal diameter (id), filled with 3 μm, 100 Å C18 material (reverse phase) were used for chromatographic separation of peptides. The mass spectrometer method was set up in data dependent acquisition mode with an MS1 automatic gain control (AGC) target value of 5 × 105. After the precursor ion scan at 120,000 resolutions in Orbitrap analyzer, intense precursors were selected for subsequent fragmentation using HCD or CID (product-triggered based on the presence of glycan oxonium ions in the HCD) within 3 sec at a normalized collision energy of 28 and 35, respectively. For internal mass calibration 445.120025 ion was used as lock mass with a target lock mass abundance of 0 %. Charge state screening was enabled, and precursors with unknown charge state or a charge state of +1 were excluded. Dynamic exclusion was enabled (exclusion size list 100, exclusion duration 30 s). The fragment ions were analyzed in the Orbitrap at 15,000 resolution. The LC-MS/MS chromatogram of control and knockout were analyzed by searching against human protein database using Byonic 2.3.5 software with variable modifications such as carbamidomethylation of cysteine and oxidation of methionine. Trypsin was chosen as the digestion enzyme and human N-glycan database was used for the glycopeptide search. Only glycopeptides with higher scores and good MS/MS fragment ion presence are considered while annotating the proteins. Glycoproteomic data are deposited in glycopost.glycosmos.org with the accession number GPST000273.0 (PIN CODE: 1613).
Cell clustering assay.
Dissociated PDX primary tumor cells in single cell suspension were seeded in 96-well plates coated with collagen type I. MDA-MB-231-derived cells were detached with EDTA buffer (0.05 mM) and single cells were seeded in suspension in 96-well plates pretreated with poly-hydroxyethyl methacrylate (Poly-HEMA, Sigma-Aldrich). For the neuraminidase treatment, the same number of cells were treated with neuraminidase at 0, 10, 50, and 100 mU/ml concentrations. The cells were then incubated and monitored by the IncuCyte live cell imaging system (Essen BioScience), and images were acquired every 2 h. Cluster size was analyzed over time by the IncuCyte ZOOM software. In addition, MDA-MB-231 tumor cells were incubated with anti-PODXL antibody for 30 min on ice and imaged using the same experimental method.
Cell growth competition assay.
Equal numbers of L2T-ST6WT and L2G-ST6KO or L2G-ST6WT and L2T-ST6KO cells were cultured on the same plate. Cells were counted with flow cytometry on days 0, 6, 18, 25, and 31. Before detaching cells, cells were imaged under a fluorescence microscope. Cells were passaged when they reached 70–80% confluence.
Colony formation assay.
ST6WT and ST6KO cells were cultured in 4-well chambers or 6-well plates (2 × 103 cells) and incubated for a week. Cell cultures were washed gently with PBS and fixed with methanol (25 min, 4 °C). Next, cells were stained with crystal violet: methanol at the ratio of 1:1 (Sigma Aldrich and Sigma, respectively). The number and size of the colonies were determined using ImageJ.
Quiescence assay.
ST6WT or ST6KO cells were washed twice with PBS. Cells were stained with pyronin Y (Sigma-Aldrich) according to the manufacturer’s protocol. Briefly, 1 × 106 cells were resuspended in 1 ml of PBS containing 2% FBS and added 1 μl of pyronin Y solution. Cells were then incubated at 37 °C for an hour. Then, Hoechst 33342 was added and incubated for an additional hour. Cells were washed twice with pyronin Y and Hoecsht containing PBS and stained with lectins or antibodies if necessary or directly loaded onto the flow cytometer.
Cell viability and proliferation assay.
To track cell proliferation, a CellTrace CFSE cell proliferation kit (Thermo Fisher) was used. Briefly, equal numbers of ST6WT and ST6KO cells were resuspended in CellTrace CFSE solution (1:1000 dilution) and incubated for 20 min at 37 °C in the dark. Complete medium was added to a total volume of 10 ml and further incubated for 5 min. Cell suspensions were pelleted and re-plated on 10 cm plates, and proliferation was analyzed after 24 h by flow cytometry. For the cell viability assay, since ST6WT and ST6KO cells’ proliferation rates are different, ST6WT and ST6KO cells were seeded at a ratio of 1:4 in 10 cm plates and grown to a similar confluency on the treatment day. When cells reached 80% confluency, cells were treated with paclitaxel (Sigma) at 0, 10, 25, 50, 100 and 250 μg/ml concentration. Cell viability was measured 24 h after treatment with DAPI by flow cytometry analysis. To observe time-dependent resistance to paclitaxel, cells were treated with 25 μg/ml paclitaxel and harvested at 0, 8, and 24 h post-treatment. For the treatment of CTC-PDX-092 model, cells were treated with PAX (NAB) at 0, 25, 50, 100 and 250 μg/ml concentrations and cell death in response to PAX (NAB) were measured using DAPI staining by flow cytometry. After SNA-sorted (-high and -low), cells were treated with PAX (25 μg/mL) or left untreated and 24 h post treatment, cellular viability were measured as mentioned above.
Gene modulation.
Luciferase-2-eGFP (L2G) and luciferase-2-tdTomato (L2T) dual-optical reporter labeled MDA-MD-231 cells, 4T1 cells, and PDX models were generated as described in previous publications. The CRISPR/Cas9 technique was used to generate ST6GAL1 KO cells. The gRNA and Cas9 co-expressing lentiviral plasmid targeting human ST6GAL1 (gRNA-1 5’ CACCGTCCTACAAGGGGCCGGGACC and gRNA-2 5’ CACCGCATTCACGTGGTCTCGAAGG) and control non-target gRNA were generated by Dr. Derek Abbott (request contact dwa4@case.edu) and kindly gifted by Dr. Brian Cobb, Case Western Reserve University. Mouse ST6GAL1-targeting gRNAs, control non-targeting gRNA, and Cas9 expressing plasmids were purchased from Sigma. L2G- or L2T-labeled MDA-MB-231 cells, 4T1 cells, or PDX models were co-infected with appropriate lentiviruses (3 Particle Forming Unit (PFU)/cell). After 48 h of infection, cells were selected with puromycin (3 μg/mL). Then cells were sorted for SNA-negative cells. MDA-MB-231 and 4T1 cells were sorted into single cells and plated on 96-well plates to grow single cell-derived clones. For the ST6GAL1 overexpressing cells (ST6OE), full length ST6GAL1 was inserted into a pEZ-Lv122 vector purchased from GeneCopoeia (EX-M03510Lv122). Virus infection and selection of the cells was performed as described above.
RNA sequencing.
Total RNA was isolated from ST6WT and ST6KO MDA-MB-231 cells using TRIzol (Thermo Fisher Scientific) according to the manufacturer’s protocol. RNA sequencing was performed at the Center for Genetic Medicine Sequencing Core Facility, Northwestern University. RNA sequencing was performed on a HiSeq 4000, and a library was made using a TruSeq Total RNA-Seq Library Prep kit. Data were processed and quantified using STAR(48), DESeq2(49), and HTSeq (50). Differentially expressed genes were defined by cutoffs of false discovery rate < 0.05 and log2 (fold change) > 0.48 or < −0.48. Finally, the pathway analysis of significantly differentially expressed genes was obtained using Metascape (http://metascape.org) (51). The data are accessible at GEO with accession number GSE174080 (release date: Dec 1, 2022).
Cell binding assay.
MDA-MB-231 cells (ST6WT and ST6KO) were plated in 96 wells/plate (2×104 cells/well) and cultured overnight and next day after cells were attached completely, cells were washed with PBS twice. On the other side, membranes of the ST6WT and ST6KO cells were fractionated according to the protocol indicated above. Endogenous PODXL were pulled down using anti-PODXL antibody (Santa Cruz, 3D3, sc-23904). 0.1 mol/L Glycine (pH 2.5) was utilized for antibody/antigen (anti-PODXL/PODXL) release from agarose beads. Acidic condition was neutralized immediately by adding Tris-HCl 1 mol/L, pH 8.8). Purified complexes were then labeled with horse radish peroxidase (HRP) (EZ-Link plus activated peroxidase kit, Thermo Fisher, 31489) according to the provided protocol. HRP lebaled purified PODXL from ST6WT and ST6KO cells were added onto the cells and incubated for 1–2 h at 37°C. Cell-protein complexes were then washed with PBS 5 times. TMD Substrate solution (Thermo Scienctific, N301) and stop solution (Thermo Scientific, N600) were used to visualize the protein binding to the cells (absorbance were measured at 450 nm).
Trans-Endothelial cell Migration (TEM).
TEM of cancer cells through HUVECs were quantified as described previously (52,53). Briefly, HUVEC cells were grown on hydrated collagen gels until confluent. ST6WT and ST6KO MDA-MB-231 cells were added to the medium. The cells were allowed to transmigrate for 3 h at 37°C. Then the suspending cells were washed with PBS and plates were fixed with 10% neutral buffered formalin. Cells on the top of the HUVEC and the cells that migrated through HUVEC were counted.
The quantification of total intensity of CellSearch images.
The images of the individual cells collected by CellSearch analysis were analyzed using ImageJ software manually. The mean intensity was multiplied by total area to find total intensity of DAPI. The cutoff value of binary assessment of Ki67 negative cells was <75. Cell cycle determination using DAPI intensity was: G1/G0 ≤100.000, G2M 100.001–139.999, and S phase is ≥140.000. The correlation of DAPI versus Ki67 / SNA were calculated using www.socscistatistics.com.
Statistical analysis.
Categorical variables were reposted as frequency distributions, while continuous variables were described through median and interquartile ranges (IQRs). Matched pairs variations of cluster enumerations were tested across baseline and EV1 through Wilcoxon signed rank test. Patient-data analysis was conducted using StataCorp 2019 Stata Statistical Softwares (Release 16.1 (College Station, TX), R (version 4.1.0, The R foundation for Statistical Computing, Vienna, Austria) and JMP (version 16, SAS Institute, Cary, NC). Microsoft Excel and Graph Pad Prism were used to perform Student’s t test and calculate P values for all in vitro assays and analyses unless specified otherwise. P ≤ 0.05 was considered statistically significant and is represented with one asterisk (*) for P ≤ 0.05, two asterisks (**) for P ≤ 0.01, three asterisks (***) for P ≤ 0.001, and four (****) for P ≤ 0.0001. Data are presented as mean ± standard deviation (SD) unless specified otherwise.
Supplementary Material
Acknowledgement
We are grateful to Dr. Susan L. Bellis at the University of Alabama at Birmingham for her insightful feedback and suggestions to this project. We thank Dr. Derek W. Abott at Case Western Reserve University for generating and providing gRNAs for CRISPR-Cas9 mediated KO of ST6GAL1 (R21 DE025825 to D. Abbott and B. Cobb). We acknowledge the tremendous support from the Northwestern Core facilities of CTC Core, the Center for Comparative Medicine, Small Animal Imaging, Microscopy Imaging, Lurie Cancer Center Flow Core, NUseq Core, and Bioinformatics Center, Mouse Histology & Phenotyping Laboratory, and Pathology Core, as well as the Glycomic Mass Spectrometry Facilities at Complex Carbohydrate Research Center, the University of Georgia. This work was partially funded by the Department of Defense (BC150596 and BC190982; H.L), the National Institute of Health (R01CA245699 to H.L.; R01 GM115234 to B.A.C.; and S10OD018530 and R24GM137782 to P.A.); American Cancer Society ACS127951-RSG-15-025-01-CSM, Komen Foundation CCR15332826, H Foundation, Lynn Sage Breast Cancer Foundation (H. Liu and N. Dashzeveg) and Northwestern University start-up grant (H.L.).
Footnotes
Conflict of interest: Huiping Liu and Andrew D. Hoffmann are scientific co-founders of Exomira Medicine Inc.
Data availability
All of the data included in the manuscript are available to be shared upon request. The data generate in this study are publicly available in glycopost.glycosmos.org at GPST000273.0 (PIN CODE: 1613) and in Gene Expression Omnibus (GEO) at GSE174080. RRID numbers and more detailed information of commercially available antibodies and reagents are included in Supplementary Excel S6.
References
- 1.Cheung KJ, Padmanaban V, Silvestri V, Schipper K, Cohen JD, Fairchild AN, et al. Polyclonal breast cancer metastases arise from collective dissemination of keratin 14-expressing tumor cell clusters. Proc Natl Acad Sci U S A 2016;113(7):E854–63 doi 10.1073/pnas.1508541113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Mu Z, Wang C, Ye Z, Austin L, Civan J, Hyslop T, et al. Prospective assessment of the prognostic value of circulating tumor cells and their clusters in patients with advanced-stage breast cancer. Breast Cancer Res Treat 2015;154(3):563–71 doi 10.1007/s10549-015-3636-4. [DOI] [PubMed] [Google Scholar]
- 3.Aceto N, Bardia A, Miyamoto DT, Donaldson MC, Wittner BS, Spencer JA, et al. Circulating tumor cell clusters are oligoclonal precursors of breast cancer metastasis. Cell 2014;158(5):1110–22 doi 10.1016/j.cell.2014.07.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Liu X, Taftaf R, Kawaguchi M, Chang YF, Chen W, Entenberg D, et al. Homophilic CD44 Interactions Mediate Tumor Cell Aggregation and Polyclonal Metastasis in Patient-Derived Breast Cancer Models. Cancer Discov 2019;9(1):96–113 doi 10.1158/2159-8290.CD-18-0065. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Zoller M CD44: can a cancer-initiating cell profit from an abundantly expressed molecule? Nat Rev Cancer 2011;11(4):254–67 doi nrc3023 [pii] 10.1038/nrc3023. [DOI] [PubMed] [Google Scholar]
- 6.Vagia E, Mahalingam D, Cristofanilli M. The Landscape of Targeted Therapies in TNBC. Cancers (Basel) 2020;12(4) doi 10.3390/cancers12040916. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Foulkes WD, Smith IE, Reis-Filho JS. Triple-negative breast cancer. N Engl J Med 2010;363(20):1938–48 doi 10.1056/NEJMra1001389. [DOI] [PubMed] [Google Scholar]
- 8.Liu H, Patel MR, Prescher JA, Patsialou A, Qian D, Lin J, et al. Cancer stem cells from human breast tumors are involved in spontaneous metastases in orthotopic mouse models. Proc Natl Acad Sci U S A 2010;107(42):18115–20 doi 1006732107 [pii] 10.1073/pnas.1006732107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Gianni L, Baselga J, Eiermann W, Guillem Porta V, Semiglazov V, Lluch A, et al. Feasibility and tolerability of sequential doxorubicin/paclitaxel followed by cyclophosphamide, methotrexate, and fluorouracil and its effects on tumor response as preoperative therapy. Clin Cancer Res 2005;11(24 Pt 1):8715–21 doi 10.1158/1078-0432.CCR-05-0539. [DOI] [PubMed] [Google Scholar]
- 10.Kalinsky K, Barlow WE, Gralow JR, Meric-Bernstam F, Albain KS, Hayes DF, et al. 21-Gene Assay to Inform Chemotherapy Benefit in Node-Positive Breast Cancer. N Engl J Med 2021;385(25):2336–47 doi 10.1056/NEJMoa2108873. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Gianni L, Baselga J, Eiermann W, Porta VG, Semiglazov V, Lluch A, et al. Phase III trial evaluating the addition of paclitaxel to doxorubicin followed by cyclophosphamide, methotrexate, and fluorouracil, as adjuvant or primary systemic therapy: European Cooperative Trial in Operable Breast Cancer. J Clin Oncol 2009;27(15):2474–81 doi 10.1200/JCO.2008.19.2567. [DOI] [PubMed] [Google Scholar]
- 12.Rastogi P, Anderson SJ, Bear HD, Geyer CE, Kahlenberg MS, Robidoux A, et al. Preoperative chemotherapy: updates of National Surgical Adjuvant Breast and Bowel Project Protocols B-18 and B-27. J Clin Oncol 2008;26(5):778–85 doi 10.1200/JCO.2007.15.0235. [DOI] [PubMed] [Google Scholar]
- 13.Miles D, Gligorov J, Andre F, Cameron D, Schneeweiss A, Barrios C, et al. Primary results from IMpassion131, a double-blind, placebo-controlled, randomised phase III trial of first-line paclitaxel with or without atezolizumab for unresectable locally advanced/metastatic triple-negative breast cancer. Ann Oncol 2021;32(8):994–1004 doi 10.1016/j.annonc.2021.05.801. [DOI] [PubMed] [Google Scholar]
- 14.Cortes J, Cescon DW, Rugo HS, Nowecki Z, Im SA, Yusof MM, et al. Pembrolizumab plus chemotherapy versus placebo plus chemotherapy for previously untreated locally recurrent inoperable or metastatic triple-negative breast cancer (KEYNOTE-355): a randomised, placebo-controlled, double-blind, phase 3 clinical trial. Lancet 2020;396(10265):1817–28 doi 10.1016/S0140-6736(20)32531-9. [DOI] [PubMed] [Google Scholar]
- 15.Taftaf R, Liu X, Singh S, Jia Y, Dashzeveg NK, Hoffmann AD, et al. ICAM1 initiates CTC cluster formation and trans-endothelial migration in lung metastasis of breast cancer. Nat Commun 2021;12(1):4867 doi 10.1038/s41467-021-25189-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Schuster E, Taftaf R, Reduzzi C, Albert MK, Romero-Calvo I, Liu H. Better together: circulating tumor cell clustering in metastatic cancer. Trends Cancer 2021;7(11):1020–32 doi 10.1016/j.trecan.2021.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Ramos EK, Tsai CF, Jia Y, Cao Y, Manu M, Taftaf R, et al. Machine learning-assisted elucidation of CD81-CD44 interactions in promoting cancer stemness and extracellular vesicle integrity. Elife 2022;11 doi 10.7554/eLife.82669. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Pinho SS, Reis CA. Glycosylation in cancer: mechanisms and clinical implications. Nature reviews Cancer 2015;15(9):540–55 doi 10.1038/nrc3982. [DOI] [PubMed] [Google Scholar]
- 19.Reily C, Stewart TJ, Renfrow MB, Novak J. Glycosylation in health and disease. Nature reviews Nephrology 2019;15(6):346–66 doi 10.1038/s41581-019-0129-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Li F, Ding J. Sialylation is involved in cell fate decision during development, reprogramming and cancer progression. Protein & cell 2019;10(8):550–65 doi 10.1007/s13238-018-0597-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Garnham R, Scott E, Livermore KE, Munkley J. ST6GAL1: A key player in cancer. Oncology Letters 2019;18(2):983–9 doi 10.3892/ol.2019.10458. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Jones RB, Dorsett KA, Hjelmeland AB, Bellis SL. The ST6Gal-I sialyltransferase protects tumor cells against hypoxia by enhancing HIF-1alpha signaling. J Biol Chem 2018;293(15):5659–67 doi 10.1074/jbc.RA117.001194. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Swindall AF, Bellis SL. Sialylation of the Fas death receptor by ST6Gal-I provides protection against Fas-mediated apoptosis in colon carcinoma cells. J Biol Chem 2011;286(26):22982–90 doi 10.1074/jbc.M110.211375. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Britain CM, Holdbrooks AT, Anderson JC, Willey CD, Bellis SL. Sialylation of EGFR by the ST6Gal-I sialyltransferase promotes EGFR activation and resistance to gefitinib-mediated cell death. J Ovarian Res 2018;11(1):12 doi 10.1186/s13048-018-0385-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Smerage JB, Barlow WE, Hortobagyi GN, Winer EP, Leyland-Jones B, Srkalovic G, et al. Circulating tumor cells and response to chemotherapy in metastatic breast cancer: SWOG S0500. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 2014;32(31):3483–9 doi 10.1200/jco.2014.56.2561. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Tsai C-F, Zhang P, Scholten D, Martin K, Wang Y-T, Zhao R, et al. Surfactant-assisted one-pot sample preparation for label-free single-cell proteomics. Communications Biology 2021;4(1):265 doi 10.1038/s42003-021-01797-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Dorsett KA, Jones RB, Ankenbauer KE, Hjelmeland AB, Bellis SL. Sox2 promotes expression of the ST6Gal-I glycosyltransferase in ovarian cancer cells. J Ovarian Res 2019;12(1):93 doi 10.1186/s13048-019-0574-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Schultz MJ, Holdbrooks AT, Chakraborty A, Grizzle WE, Landen CN, Buchsbaum DJ, et al. The Tumor-Associated Glycosyltransferase ST6Gal-I Regulates Stem Cell Transcription Factors and Confers a Cancer Stem Cell Phenotype. Cancer Res 2016;76(13):3978–88 doi 10.1158/0008-5472.CAN-15-2834. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Swindall AF, Londono-Joshi AI, Schultz MJ, Fineberg N, Buchsbaum DJ, Bellis SL. ST6Gal-I protein expression is upregulated in human epithelial tumors and correlates with stem cell markers in normal tissues and colon cancer cell lines. Cancer Res 2013;73(7):2368–78 doi 10.1158/0008-5472.CAN-12-3424. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Johnson DG, Schwarz JK, Cress WD, Nevins JR. Expression of transcription factor E2F1 induces quiescent cells to enter S phase. Nature 1993;365(6444):349–52 doi 10.1038/365349a0. [DOI] [PubMed] [Google Scholar]
- 31.Kwon JS, Everetts NJ, Wang X, Wang W, Della Croce K, Xing J, et al. Controlling Depth of Cellular Quiescence by an Rb-E2F Network Switch. Cell Rep 2017;20(13):3223–35 doi 10.1016/j.celrep.2017.09.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Poppy Roworth A, Ghari F, La Thangue NB. To live or let die - complexity within the E2F1 pathway. Molecular & cellular oncology 2015;2(1):e970480 doi 10.4161/23723548.2014.970480. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Nagy A, Lanczky A, Menyhart O, Gyorffy B. Validation of miRNA prognostic power in hepatocellular carcinoma using expression data of independent datasets. Sci Rep 2018;8(1):9227 doi 10.1038/s41598-018-27521-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Weber EW, Han F, Tauseef M, Birnbaumer L, Mehta D, Muller WA. TRPC6 is the endothelial calcium channel that regulates leukocyte transendothelial migration during the inflammatory response. J Exp Med 2015;212(11):1883–99 doi 10.1084/jem.20150353. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Muller WA, Weigl SA, Deng X, Phillips DM. PECAM-1 is required for transendothelial migration of leukocytes. J Exp Med 1993;178(2):449–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Liu X, Adorno-Cruz V, Chang YF, Jia Y, Kawaguchi M, Dashzeveg NK, et al. EGFR inhibition blocks cancer stem cell clustering and lung metastasis of triple negative breast cancer. Theranostics 2021;11(13):6632–43 doi 10.7150/thno.57706. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Cherian S, Potdar V, Jadhav S, Yadav P, Gupta N, Das M, et al. SARS-CoV-2 Spike Mutations, L452R, T478K, E484Q and P681R, in the Second Wave of COVID-19 in Maharashtra, India. Microorganisms 2021;9(7) doi 10.3390/microorganisms9071542. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Karagiannis GS, Pastoriza JM, Wang Y, Harney AS, Entenberg D, Pignatelli J, et al. Neoadjuvant chemotherapy induces breast cancer metastasis through a TMEM-mediated mechanism. Sci Transl Med 2017;9(397) doi 10.1126/scitranslmed.aan0026. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Dong QG, Sclabas GM, Fujioka S, Schmidt C, Peng B, Wu T, et al. The function of multiple IkappaB : NF-kappaB complexes in the resistance of cancer cells to Taxol-induced apoptosis. Oncogene 2002;21(42):6510–9 doi 10.1038/sj.onc.1205848. [DOI] [PubMed] [Google Scholar]
- 40.Garnham R, Scott E, Livermore KE, Munkley J. ST6GAL1: A key player in cancer. Oncology letters 2019;18(2):983–9 doi 10.3892/ol.2019.10458. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Wei A, Fan B, Zhao Y, Zhang H, Wang L, Yu X, et al. ST6Gal-I overexpression facilitates prostate cancer progression via the PI3K/Akt/GSK-3beta/beta-catenin signaling pathway. Oncotarget 2016;7(40):65374–88 doi 10.18632/oncotarget.11699. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Christie DR, Shaikh FM, Lucas JAt, Lucas JA 3rd, Bellis SL. ST6Gal-I expression in ovarian cancer cells promotes an invasive phenotype by altering integrin glycosylation and function. J Ovarian Res 2008;1(1):3 doi 10.1186/1757-2215-1-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Jung YR, Park JJ, Jin YB, Cao YJ, Park MJ, Kim EJ, et al. Silencing of ST6Gal I enhances colorectal cancer metastasis by down-regulating KAI1 via exosome-mediated exportation and thereby rescues integrin signaling. Carcinogenesis 2016;37(11):1089–97 doi 10.1093/carcin/bgw091. [DOI] [PubMed] [Google Scholar]
- 44.Zhang S, Lu J, Xu Z, Zou X, Sun X, Xu Y, et al. Differential expression of ST6GAL1 in the tumor progression of colorectal cancer. Biochem Biophys Res Commun 2017;486(4):1090–6 doi 10.1016/j.bbrc.2017.03.167. [DOI] [PubMed] [Google Scholar]
- 45.Cristofanilli M, Budd GT, Ellis MJ, Stopeck A, Matera J, Miller MC, et al. Circulating Tumor Cells, Disease Progression, and Survival in Metastatic Breast Cancer. New England Journal of Medicine 2004;351(8):781–91 doi 10.1056/NEJMoa040766. [DOI] [PubMed] [Google Scholar]
- 46.Allard WJ, Matera J, Miller MC, Repollet M, Connelly MC, Rao C, et al. Tumor Cells Circulate in the Peripheral Blood of All Major Carcinomas but not in Healthy Subjects or Patients With Nonmalignant Diseases. Clinical Cancer Research 2004;10(20):6897–904 doi 10.1158/1078-0432.ccr-04-0378. [DOI] [PubMed] [Google Scholar]
- 47.Shajahan A, Supekar NT, Chapla D, Heiss C, Moremen KW, Azadi P. Simplifying Glycan Profiling through a High-Throughput Micropermethylation Strategy. SLAS technology 2020;25(4):367–79 doi 10.1177/2472630320912929. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 2013;29(1):15–21 doi 10.1093/bioinformatics/bts635. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 2014;15(12):550- doi 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Anders S, Pyl PT, Huber W. HTSeq--a Python framework to work with high-throughput sequencing data. Bioinformatics 2015;31(2):166–9 doi 10.1093/bioinformatics/btu638. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Tripathi S, Pohl MO, Zhou Y, Rodriguez-Frandsen A, Wang G, Stein DA, et al. Meta- and Orthogonal Integration of Influenza “OMICs” Data Defines a Role for UBR4 in Virus Budding. Cell Host Microbe 2015;18(6):723–35 doi 10.1016/j.chom.2015.11.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Muller WA, Weigl SA, Deng X, Phillips DM. PECAM-1 is required for transendothelial migration of leukocytes. Journal of Experimental Medicine 1993;178(2):449–60 doi 10.1084/jem.178.2.449. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Muller WA, Luscinskas FW. Assays of transendothelial migration in vitro. Methods Enzymol 2008;443:155–76 doi 10.1016/S0076-6879(08)02009-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All of the data included in the manuscript are available to be shared upon request. The data generate in this study are publicly available in glycopost.glycosmos.org at GPST000273.0 (PIN CODE: 1613) and in Gene Expression Omnibus (GEO) at GSE174080. RRID numbers and more detailed information of commercially available antibodies and reagents are included in Supplementary Excel S6.