Preemptive Regulation of Intracellular pH in Hippocampal Neurons by a Dual Mechanism of Depolarization Induced Alkalinization

Abstract

Numerous studies have documented the mechanisms that regulate intracellular pH (pH_i) in hippocampal neurons in response to an acid load. Here, we studied the response of pH_i to depolarization in cultured hippocampal neurons. Elevation of external K⁺ (6–30 mM) elicited an acid transient followed by a large net alkaline shift. Similar responses were observed in acutely dissociated hippocampal neurons. In Ca²⁺ free media, the acid response was curtailed and the alkaline shift enhanced. DIDS blocked the alkaline response and revealed a prolonged underlying acidification that was highly dependent on Ca²⁺ entry. Similar alkaline responses could be elicited by AMPA, indicating that this rise in pH_i was a depolarization-induced alkalinization (DIA). The DIA was found to consist of Cl⁻-dependent and Cl⁻-independent components, each accounting for about half the peak amplitude. The Cl⁻-independent component was postulated to arise from operation of the electrogenic Na⁺-HCO₃⁻ cotransporter NBCe1. QPCR and single cell multiplex RT-PCR demonstrated message for NBCe1 in our hippocampal neurons. In neurons cultured from Slc4a4 knockout (KO) mice, the DIA was reduced by roughly half compared with wild type, suggesting that NBCe1 was responsible for the Cl⁻-independent DIA. In Slc4a4 KO neurons, the remaining DIA was virtually abolished in Cl⁻-free media. These data demonstrate that DIA of hippocampal neurons occurs via NBCe1, and a parallel DIDS-sensitive, Cl⁻-dependent mechanism. Our results indicate that by activating net acid extrusion in response to depolarization, hippocampal neurons can preempt a large, prolonged, Ca2+-dependent acidosis.

Introduction

In hippocampal neurons, and other nerve cells, depolarizing stimuli cause a fall in pH_i, linked to the entry of Ca²⁺. This acid is generated due to Ca²⁺-H⁺ exchange by Ca²⁺-ATPases, located in the plasma membrane and endoplasmic reticulum, and may also arise from the generation of metabolic acids (reviewed by Chesler, 2003). Most cells respond to a fall in pH_i by actively extruding net H⁺ from the cytosol. In hippocampal neurons, this is accomplished primarily by electro-neutral mechanisms that include a Na⁺-H⁺ exchanger (NHE), a Na⁺-driven Cl⁻-HCO₃⁻ exchanger (NDCBE) and one or more additional Na⁺-HCO₃⁻ cotransporters. Following an imposed acidification, these mechanisms allow pH_i to return toward baseline over the course of several minutes (Raley-Susman et al., 1991; Schwiening and Boron, 1994; Baxter and Church, 1996; Bevensee et al., 1996; Cooper et al., 2005).

In addition to these electro-neutral processes, hippocampal neurons also express an electrogenic Na⁺-HCO₃⁻ cotransporter (Bevensee et al., 2000; Schmitt et al., 2000; Rickmann et al., 2007). The role of this carrier (NBCe1; gene name Slc4a4) in neuronal function is unknown. In astrocytes, and some invertebrate glia, this mechanism imports two HCO₃⁻ ions with one Na⁺, and thereby gives rise to a depolarization-induced alkalinization (DIA) (Deitmer and Szatkowski, 1990; Pappas and Ransom, 1994; Brookes and Turner, 1994) that is pronounced and rapid in vivo (Chesler and Kraig, 1987; 1989). The role of NBCe1 in neurons, however, has remained obscure.

In the present report, we identify a DIA of hippocampal neurons, and directly address the involvement of NBCe1, using cells cultured from wild type and Slc4a4 knockout mice. We show that an initial depolarization induced acid transient, dependent on Ca²⁺ entry, is markedly limited by the subsequent onset of a DIA. Using Slc4a4 knockout mice, we demonstrate that a substantial component of this neuronal DIA is attributable to NBCe1. In addition, we describe the presence of a parallel Cl⁻-dependent mechanism that also contributes prominently to the DIA. These results indicate that hippocampal neurons respond to sustained membrane depolarization by activating net acid extrusion in advance of an ensuing Ca²⁺-dependent acid load, and thereby preempt much of the acidosis.

Methods

Hippocampal Neuronal Cultures

All procedures were carried out with approval of the Institutional Animal Care and Use Committee of the NYU School of Medicine. Primary neuronal cultures were prepared from the hippocampi of neonatal (P1) Swiss Webster (Taconic) mice of either gender, by dissociation with trypsin, followed by plating on poly-L-lysine coated cover slips (Svichar et al., 2009). For Slc4a4 knockout mouse primary culture, each hippocampus was individually processed to provide a single neuronal culture, which was subsequently identified by PCR analysis of tail DNA. Genotyping utilized the following primers (Gawenis et al., 2007): a forward primer from the deleted region of intron 9 (5′-TCACAAACCTTTCAGCAAAAGAGTGC-3′) that identified only the wild-type allele; a reverse primer from intron 9 (5′-CAAAGAGCAACAGTCAGACAGC-3′) that identified both wild-type and mutant alleles; and a primer from the neomycin resistance gene (5′-GACAATAGCAGGCATGCTGG-3′) that identified only the mutant allele. Breeding pairs of Slc4a4 heterozygous mice were kindly provided by Dr. Gary Schull, University of Cincinnati College of Medicine. For all neuronal cultures, physiological experiments were performed after 14 – 21 days in vitro.

Acutely-Dissociated Hippocampal Neurons

Hippocampal neurons from area CA1 were dissociated from neonatal animals of either gender (P12-P14) as described previously (Svichar et al., 2009). Cells were plated onto concanavalin A-coated coverslips and left to settle for 1–2 hours before use. Pyramidal neurons were identified morphologically by their large size, pyramidal shape, and distinct basal and apical dendritic arbors (Tse et al., 1992).

Experimental Solutions and Drugs

Standard bicarbonate-buffered saline contained (in mM): 124 NaCl, 26 NaHCO₃, 3.0 KCl, 1.0 NaH₂PO₄, 2.0 CaCl₂, 1.5 MgCl₂, and 10 glucose. Solutions were gassed with 95 percent O₂ and 5 percent CO₂ and had a nominal pH of 7.4. Saline with elevated K⁺ was made by equimolar replacement of NaCl with KCl. In nominally zero Ca²⁺ saline, CaCl₂ was replaced by MgCl₂. EGTA was omitted from zero Ca2+ saline, as neurons did not survive for the duration of the experiments when it was present. In zero Cl⁻ saline, the NaCl, KCl, CaCl₂ and MgCl₂ were substituted with 124 Na⁺-methanesulfonate, K⁺-methanesulfonate, CaSO₄, and MgSO₄, respectively. Following exposure of neurons to zero Cl⁻ saline, it was necessary to lower the pH_i (see below) using a 3–5 min. pre-pulse of 10 mM NH₄⁺ (Boron and De Weer, 1976). For this purpose, 10 mM Na⁺-methanesulfonate was replaced by 10 mM NH₄⁺-methanesulfonate. Experimental solutions were warmed to 32° C and superfused at 2 ml per min., exchanging the chamber volume in 20–30 s. RS-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA), cyclothiazide, and bafilomycin were respectively obtained from Tocris Biosciences (Ellisville, MO.), Research Biochemicals International (Natick, MA) and LC Laboratories (Woburn, MA). HOE-694 and cariporide were the generous gifts of Sanofi-Aventis (Frankfurt, Germany). All other reagents were purchased from Sigma Chemical Co. (St. Louis, MO.).

Recording of Intracellular pH

Coverslips with attached neurons served as the floor of a submersion chamber mounted on the stage of a Zeiss Axiovert inverted microscope equipped for epifluorescence. Neurons were loaded with pH-sensitive fluorophore BCECF by incubation with 2 μM of the acetoxy-methylester (Molecular Probes) for 10 min at room temperature. A 75-watt xenon lamp and a monochromater provided alternate 490- and 440-nm fluorescence excitation. For each excitation wavelength, the respective emissions above 535 nm (F490 and F440, respectively) were collected via a 40X oil immersion objective and an intensified CCD camera. Averaged fluorescence from regions of interest around single neurons was imaged at 15 s intervals using ImageMaster software (Photon Technology International). In each experiment, the F490:F440 ratios were displayed as simultaneous line traces from multiple neurons. Experimental ratios were converted to pH_i using the nigericin single point technique (Boyarsky et al., 1988b), using a HEPES-buffered calibration solution (150 mM K⁺ and 3 μM nigericin, pH 7.0) applied at the end of each experiment. Data were referenced to a calibration curve previously constructed using nigericin-150 mM K⁺ solutions buffered with PIPES or HEPES over the pH range 6.0 – 8.0.

Determination of Intracellular Buffering Capacity

The total intracellular buffering capacity of neurons, β_T, was calculated as the sum of the intrinsic buffering capacity (β_i) and the bicarbonate-derived buffering capacity (β_b) (Roos and Boron, 1981). The β_i was determined by a variation of the method of Bevensee et al. (1996): in bicarbonate-free saline (using 26 mM HEPES, pH 7.4) the pH_i was lowered by transition to Na⁺-free saline and 20, 10, 5 and 2.5 mM NH₄⁺ were then added sequentially to produce stepwise changes in pH_i. Data were pooled for pH_i values over increments of 0.2 pH units and the results fit to straight line that served as a standard calibration for β_i values. The β_b was calculated as 2.3 × [HCO₃⁻]_i based on the Henderson-Hasselbalch equation, with CO₂ concentration assumed to be equal across the cell membrane.

Determination of Net Molar Fluxes

The response to elevation of external K⁺ consisted of an initial acid transient, followed by a net alkaline shift (Results, Figure 1). The net acid flux was defined as the product of the initial acid-directed dpH_i/dt and β_T, with β_T determined at the initial baseline pH_i. The initial net alkaline flux was defined as the product of the initial alkaline-directed dpH_i/dt and β_T, with β_T determined at the onset of the alkaline response where the rate of rise became constant.

Figure 1.

Responses induced by 30 mM K⁺ and intracellular buffering capacity of hippocampal neurons. A. Typical response of a cultured mouse hippocampal neuron consisted of early acid transient, which was followed by a net alkaline shift. B. Peak amplitudes and net molar fluxes for acid and alkaline shifts in cultured hippocampal neurons. C. Typical response of an acutely dissociated CA1 pyramidal neuron from a juvenile mouse. D. Peak amplitudes and net molar fluxes for acid and alkaline shifts in CA1 pyramidal neurons acutely dissociated from juvenile mice. E. Example of repetitive acid-alkaline transients elicited in cultured neurons. F. Relationship of intrinsic (non-bicarbonate) buffering capacity (β_i in mM) and pH_i. Parentheses contain number of cells for each mean value. For the pH_i traces, the acid and alkaline responses during application of high K⁺ are emphasized in black, with baseline pH_i and pH_i recoveries in gray. All data in standard 2 mM Ca²⁺ saline.

Comparisons in Zero Cl⁻ Saline

In hippocampal neurons, replacement of extracellular Cl⁻ produces a large increase in pH_i, owing to the reversal of Cl⁻-HCO₃⁻ exchange (Boyarsky et al., 1988a; Raley-Susman et al., 1993; Baxter and Church, 1996). In order to assess pH_i responses at comparable baselines, we lowered the pH_i following exposure to Cl⁻-free solution. This was accomplished by applying a short pulse of 10 mM NH₄⁺ followed by 100 μM HOE-694 after the resulting peak acidification, thereby blocking the contribution of NHE to recovery of pH_i from the imposed acid shift. In some cases, pH_i could be lowered with application of 100 μM HOE alone. In later experiments, HOE-694 became unavailable, and the congener cariporide was used instead (Weichert et al., 1997; Xue et al., 2008).

Whole-Cell Recording

The somata of neurons were visualized under infrared differential interference contrast microscopy using a Zeiss Axioscop 2 Plus, fixed-stage microscope, fitted with a 40x, water immersion objective (0.75 numerical aperture), and an Olympus Optical 150 video camera. Patch pipettes were pulled from 1.5 mm OD × 1.12 mm ID borosilicate tubing (World Precision Instruments, Sarasota, FL) using a Narishige PP-830 two-stage puller (Japan). The intracellular filling solution contained the following (in mM): 120 K-gluconate, 20 KCl, 2.0 MgCl₂, 25Na-HEPES, and 2.0 Mg²⁺-ATP. After adjusting the pH to 7.3 with KOH the final osmolarity was 280–290 mOsm. Pipettes had resistances of 3–5 mΩ. Data were acquired using an Axopatch 1D amplifier and Digidata board 1320A, controlled by Clampex 8.2, and analyzed using ClampFit (Molecular Devices, Union City, CA).

RNA extraction, Reverse transcription and Polymerase Chain Reaction

Total RNA from neuronal cultures was isolated using RNeasy mini kit (Qiagen) and reverse transcribed into a single-stranded cDNA with a SuperScript II Reverse Transcriptase kit (Invitrogen) as per manufacturer instructions. The resulting first-strand cDNA was then used as a template for SYBR Green real-time PCR. Intron-spanning primers (Table 1A) were designed with Primer 3.0 (Whitehead Institute for Biomedical Research) utilizing sequences obtained from the NCBI GenBank database. The amplification efficiencies for each PCR reaction were calculated from the respective kinetic curves. Initial gene transcript levels (per 1000 transcipts of β-actin; gene Actb) were derived as per Liu and Saint (Liu and Saint, 2002).

Table 1.

Primer sequences.

A. QPCR reactions.
Gene	Accession N	Fragment	Forward primer	Reverse primer
Slc4a4	NM_018760	222–325	TCCGACAAATCTGATGTGGA	TCCTCTCCCAAGATGAATCG
Slc4a8	NM_021530	763–744	CTGGACATGCGTGCAAGTAG	CTTTAACCCTCACGCTGTCG
Slc9a1	NM_016981	1189–1170	ATCCTTGTCTTCGGGGAGTC	TGCCCACAGAGTCATAGCTG
ActB	NM_007393	858–911	GCTCTTTTCCAGCCTTCCTT	AGTTTCATGGATGCCACAGG

B. Multiplex PCR reactions.
Gene	Accession N	Fragment	Forward primer	Reverse primer
Slc4a4	NM_018760	76–697	ATGTGTGTGATGAAGAAGAAGTAGAAG	GACCGAAGGTTGGATTTCTTG
ActB	NM_007393	305–877	TGTTACCAACTGGGACGACA	AAGGAAGGCTGGAAAAGAGC

C. Nested PCR reactions.
Gene	Accession N	Fragment	Forward primer	Reverse primer
Slc4a4	NM_018760	359–577	GGAACTCGATGAGCTTCTGG	ACCAGCTGTGGGAGAGAAGA
ActB	NM_007393	470–696	AGCCATGTACGTAGCCATCC	TCTCAGCTGTGGTGGTGAAG

For single cell multiplex RT-PCR the cytoplasm of a neuron was aspirated into a patch pipette filled with a 5x buffer (Promega) containing RNase inhibitor (Eppendorf; 20 units/ml) and then expelled into a microcentrifuge tube containing a reverse transcription reaction mixture. First strand cDNA was synthesized with ImProm II Reverse Transcriptase (Promega) following manufacturer instructions. After reverse transcription, the cDNAs for Slc4a4 and βactin were amplified in a multiplex PCR with primers listed in Table 1B. The final product was diluted 10-fold and nested PCR carried out using the primers in Table 1C, performed for each gene separately. The products of nested PCR were separated and visualized on an ethidium bromide-stained agarose gel.

Data analysis

Data were presented as means with standard error. Values of n were given as number of cells/number of cover slips. Statistical comparisons were made with a paired or unpaired two-tailed Student’s t-test, or repeated measures ANOVA with a Tukey post-hoc test, as appropriate.

Results

pH_i Shifts of Hippocampal Neurons Elicited by High K⁺

Changes in pH_i of cultured hippocampal neurons were elicited by elevation of bath K⁺ from the baseline of 3 mM to 30 mM. In separate current clamp recordings, this caused a peak depolarization of 39 ± 3.1 mV from a resting potential of −52 ± 3.4 mV (n = 5). From an initial baseline pH_i of 7.07 ± 0.02, the typical response (Figure 1A) consisted of an initial acid transient, followed by a net alkaline shift that persisted for the duration of the K⁺ elevation. Upon return to 3 mM K⁺, the pH_i recovered toward baseline, and was sometimes followed by an undershoot. The size and speed of the responses varied considerably among cultures. In one representative culture, the early acid transient averaged −0.13 ± 0.01 with an initial molar acid flux of −4.04 mM-min.⁻¹ (n = 47/4). This included 9 neurons that did not display an acid transient. In the same data set, the peak alkaline shift averaged 0.14 ± 0.03 unit pH above initial baseline, with an initial molar flux of 10.4 mM-min.⁻¹ This included 8 cells, in which only an acid transient occurred (Figure 1B). Qualitatively similar responses to 30 mM K⁺ were elicited from CA1 pyramidal neurons acutely dissociated from juvenile (Figure 1C, D) and adult mice (n = 17/6). These acid-alkaline responses could be evoked sequentially (Figure 1E) with no significant difference (p> 0.05) in either the first and second acid shifts (−0.03 ± 0.02 vs. −0.03 ± 0.02, respectively) or the first and second alkaline shifts (0.22 ± 0.02 vs. 0.29 ± 0.03, respectively). Among cultured, acutely dissociated juvenile, and acutely dissociated adult neurons, the baseline pH_i did not differ significantly (p > 0.05), and was normal in distribution for each group, with average values of 7.07± 0.02 (n=47/4), 7.09 ± 0.03 (n=15/4), and 7.17 ± 0.07 (n=17/6), respectively.

The intrinsic buffering capacity of the cultured neurons as a function of pH_i is shown in Figure 1F. The values and relationship to pH_i were comparable to those of acutely dissociated hippocampal CA1 neurons obtained by Yao et al. (1999) but were somewhat higher than the values reported by Bevensee et al. (1996). Subsequent experiments were carried out exclusively on cultured hippocampal neurons.

Ca²⁺-Dependence of K⁺-Evoked pH_i Shifts

Numerous studies have shown that the hippocampal neurons acidify due to entry of Ca²⁺ (Irwin et al., 1994; Wang et al., 1994; Trapp et al., 1996; Cheng et al., 2008). Accordingly, when 30 mM K⁺ was applied in zero Ca²⁺ saline, the acid transient was diminished (Figure 2A), and in 19 of 47 neurons, no acid transient was observed. Absence of external Ca²⁺ reduced the acid transient and the molar acid flux by 53 ±6.3 (n = 23/3) and 54 ± 11 percent, respectively (n = 47/4; Figure 2B, C).

Figure 2.

The K⁺ evoked acid shifts were Ca²⁺-dependent. A. Transition to zero Ca²⁺ saline reduced the early acid transient, and increased the alkaline shift. Inset shows overlay of responses to emphasize late effect of zero Ca²⁺ saline on the alkaline shift. B. Mean effect of zero Ca²⁺ saline on the peak amplitude of the acid and alkaline shifts. C. Mean effect of zero Ca²⁺ saline on the net acid and alkaline molar fluxes. D. Sequential responses to 30 mM K⁺ in a hippocampal neuron. The repetitive alkaline responses were highly consistent. For statistical comparisons, p values here and elsewhere are represented as p < 0.05 (*); p < 0.01 (**); p < 0.001 (***).

The reduction in the acid response in the absence of bath Ca²⁺ was accompanied by an 84 ± 11 percent increase in the alkaline shift (n = 27/3; Figure 2B, C) which was highly consistent over sequential trials (Figure 2D). Thus, in paired responses (at an interval of 26.8 ± 4.3 min.) the respective amplitude of the first and second DIA was 0.42 ± 0.04 vs. 0.42 ± 0.05 unit pH (p=0.89), with initial rates of 0.16 ± 0.01 vs. 0.17 ± 0.01 pH-min.⁻¹ (p = 0.83) and net alkaline fluxes of 8.36 ± 0.52 vs. 8.31 ± 0.82 mM-min⁻¹ (p = 0.95; n = 19/3). The alkalosis was enhanced mainly in its late phase (superimposed records, Figure 2A), suggesting that the mechanism of Ca²⁺-dependent acidification was far more prolonged than the observed acid transients. The long duration of this acid source was revealed in subsequent experiments using 4,4′-diisothiocyanatostilbene-2,2′-disulfonic acid (DIDS).

The Effect of Acid Transport Inhibitors on the Evoked Alkaline Shifts

In the presence of the HCO₃⁻ transport blocker DIDS (100 μM), the alkaline component of the response was abolished. Instead, a large, prolonged acidification occurred, that persisted for the duration of the high K⁺ pulse. Figure 3A shows a pronounced example of this effect. On average, a peak acid transient of −0.09 ± 0.02 unit pH in control saline was transformed into a sustained fall of −0.16 ± 0.04 unit pH in DIDS (n = 15/3; Figure 3B). The initial molar acid flux was not significantly changed by DIDS (−5.4 ± 1.4 vs. −3.9 ± 0.7 mM-min.⁻¹; p = 0.73), suggesting that it had little or no effect on the acid transient. Thus, by blocking the alkaline shift, DIDS revealed the prolonged nature of the acid source.

Figure 3.

Effect of DIDS on the K⁺-evoked pH_i shifts. A. DIDS abolished the alkaline shift and revealed a prolonged acid response. B. Mean effect of DIDS on the peak amplitude of the K⁺- evoked acid transient and alkaline shift. C. The prolonged acidosis revealed by DIDS was largely decreased in zero Ca²⁺ saline. D. Mean effect of DIDS on the response amplitudes in zero Ca²⁺ saline.

The prolonged acid source was largely dependent on the entry of Ca²⁺, since it was greatly reduced (to −.04 ± 0.01 unit pH; p < 0.01 compared to standard saline) when the DIDS protocol was performed in zero Ca²⁺ media. Thus, the generation of the alkaline shift acted to curtail and terminate the Ca²⁺-dependent fall in pH_i. Since the alkalosis was variably diminished by the ongoing acid source, most of the subsequent experiments that addressed the nature of the alkalosis were performed in zero Ca²⁺ saline, so as to maximize the amplitude, and consistency of the responses.

The complete block of the alkaline shift by DIDS is consistent with the properties of an HCO₃⁻ transporter. Moreover, two principal HCO₃⁻-independent acid extrusion mechanisms could be ruled out. NHE was not involved, as the DIA was undiminished by 100 μM HOE-694 (0.29 ± 0.02 control vs. 0.33 ± 0.03 in HOE-694, n=9/1, p > 0.05) which blocks the amiloride-insensitive Na+-H+ exchanger of these neurons (Yao et al., 1999], nor was it reduced by 100 μM cariporide, (0.32 ± 0.03 control vs. 0.36 ± 0.02 cariporide, n=13/2, p > 0.05), a related, but more selective NHE inhibitor (Weichert et al., 1997; Xue et al., 2008). A plasma membrane H⁺-ATPase could also be ruled out as a cause of the DIA, since 100 nM bafilomycin did not block the response (0.47 ± 0.02 control vs. 0.53 ± 0.02 bafilomycin, n=25/3, p < 0.05). The slight increase in the DIA in the presence of bafilomycin is unexplained, but suggests that intracellular proton pumps can modestly limit its amplitude.

The Response to Elevated K⁺ is a Graded DIA

If the K⁺-evoked rise in pH_i were a DIA, rather than a response to elevation of K⁺ per se, then another depolarizing agent would be expected to elicit a similar alkalosis. Exposure to 50 μM AMPA caused pH_i to increase by 0.30 ± 0.01 (Figure 4A) at a rate of 0.16 ± 0.01unit pH-min.⁻¹ (n = 39/5), strongly suggesting that the alkaline shift was a DIA (Figure 4A). When 30 mM K⁺ was added with 50 μM AMPA (Figure 4B) the resulting DIA (0.31 ± 0.03) was larger than the AMPA response alone (0.23 ± 0.03; p < 0.05, n=6/2), consistent with a larger net depolarization, however, the pH_i recovered only slightly following the paired exposure (Figure 4B). The cause of the curtailed recovery was not investigated.

Figure 4.

The alkaline shift is a DIA. A. Depolarization by 50 μM AMPA produced an alkaline shift similar to the K⁺-evoked responses. B. AMPA with 30 mM K⁺ caused a larger DIA than AMPA alone, but failed to recover to baseline. C. Graded elevation of K⁺ elicited DIAs with stepwise increases in peak amplitude. Responses separated by intervals of 20–25 min. D. Mean responses elicited by 6, 12 and 24 mM K⁺. Acid shifts did not significantly increase beyond the response seen in 6 mM K⁺. Corresponding alkaline shifts were significantly elevated in comparison to the response at the preceding lower K⁺ concentration. E. Acid and alkaline transients elicited by transition from 3 to 6 mM K⁺ in standard saline containing 2 mM Ca²⁺. AMPA experiments utilized 100 μM cyclothiazide to prevent receptor desensitization.

Since depolarization could arise in part from increased synaptic activity and firing during the application of elevated K⁺, we examined responses before and after exposure to saline containing 1 μM tetrodotoxin plus DL-2-Amino-5-phosphonovalerate (APV), 6-cyano-7-nitro-nitroquinoxaline-2,3-dione (CNQX), and picrotoxin (all 50 μM). This cocktail of inhibitors caused just a small decrease in the DIA to 96 ± 8 percent of the control (n = 34/4; p < 0.01), indicating that the response was triggered almost entirely via direct, K⁺-mediated depolarization.

We tested whether more physiological (i.e., smaller) elevations of K⁺ could cause a DIA. In the absence of external Ca²⁺, sequential elevation of K⁺ to 6, 12 and 24 mM elicited graded DIAs (Figures 4C, D). In separate measurements on 4 neurons, these transitions were associated with depolarizations of 12 ± 1.7, 16 ± 2.6, and 25 ± 3.6 mV, respectively. The more physiological elevation to 6 mM K⁺ could also elicit a significant alkaline shift in saline containing 2 mM Ca²⁺, where it caused a DIA of 0.21 ± 0.04 pH (n = 25/2, Figure 4E).

Role of Chloride in the DIA

An intracellular chloride load associated with depolarization might indirectly raise pH_i by reducing efflux of HCO₃⁻ by a Cl⁻-HCO₃⁻ exchanger. In one report (Slemmer et al., 2004), depolarization-associated Cl⁻ influx in hippocampal neurons was blocked by NPPB (5-Nitro-2-(3-phenylpropylamino)benzoic acid). In our cells, however, 100 μM NPPB had no effect on the DIA elicited by 30 mM K⁺ (not shown). The DIA was similarly unaffected by the Cl⁻ transport blockers bumetinide (100 μM), furosemide (100 μM), niflumic acid (300 μM) and anthracene-9-carboxylic acid (100 μM).

To fully eliminate the possibility of Cl⁻ entry, we tested the effect of zero Cl⁻ saline. Withdrawal of Cl⁻ from the bath caused a rise in pH_i, commonly attributed to reversal of Cl⁻-HCO₃⁻ exchange (Boyarsky et al., 1988a; Raley-Susman et al., 1993; Baxter and Church, 1996). To assess DIA amplitudes at a comparable pH_i and buffering capacity, the pH_i was subsequently reduced, using a 3–5 min., 10 mM NH₄⁺ pre-pulse in the presence of HOE-694 (or cariporide) to block NHE. In 27 neurons, the subsequent DIA was always significantly reduced compared to control (Figure 5A), and in 13 of these cells, where the baseline pH_i was exactly matched to the control value, the DIA and molar alkaline flux were 49 ± 5.7 and 45 ± 6.6 percent of controls, respectively (3 coverslips; p < 0.001 for both; Figure 5B). This suggested that both a Cl⁻-dependent and a Cl⁻-independent mechanism contribute significantly to the DIA.

Figure 5.

The DIA has Cl⁻-dependent and Cl⁻-independent components. A. In the absence of external Cl⁻, the amplitude of the DIA was roughly half of the control value. B. Mean effect of zero Cl⁻ saline on the DIA amplitude and initial alkaline molar flux. Since Cl⁻ free saline caused a rise in pH_i, an NH₄⁺ prepulse and HOE-694were used to bring pH_i down to control level prior to initiating the second DIA. The NH₄⁺ prepulse and recovery were omitted for clarity.

Role of NBCe1 in the Neuronal DIA

We postulated that the component of the DIA that persisted in the absence of external Cl⁻ was due to NBCe1. In support of this hypothesis, mRNA for Slc4a4, measured by QPCR (relative to β-actin), was abundant in our cultures (Figure 6A), and on the same order as message for the acid extruders Slc4a8 (NDCBE) and Slc9a1 (NHE1). In addition, single cell RT-PCR confirmed the presence of Slc4a4 message in individual neurons (Figure 6B).

Figure 6.

Presence and function of NBCe1 in cultured cells. A. QPCR of neuronal cultures revealed NBCe1 message. Levels were same order of magnitude as messages for the Na⁺-HCO₃⁻ cotransporter NDCBE (gene Slc4a8) and the Na⁺-H⁺ exchanger NHE1 (Slc9a1). B. Single neuron RT-PCR. Message for NBCe1 was detected in two individual neurons. C. Astrocytes in WT cultures displayed a rapid DIA. No DIA could be elicited in astrocytes cultured from Slc4a4 KO mice. D. Representative DIAs in hippocampal neurons cultured from WT and Slc4a4 KO mice. E. Peak amplitude of pH_i shifts in neurons from WT vs. Slc4a4 KO mice. Mean acid shifts were not significantly different. In the neurons from KO mice the DIA was roughly half the amplitude seen in WT cells. F. Net molar fluxes in WT vs. Slc4a4 KO neurons. Net acid flux was no different in WT vs. KO. In Slc4a4 KO neurons, the net alkaline flux was roughly one fourth the flux observed in WT cells.

To test whether the DIA was reliant on NBCe1, we studied responses in cells cultured from wild type (WT) mice vs. animals with a global KO of Slc4a4. Some initial experiments were performed on scattered astrocytes in the neuronal cultures, identified as flat cells without processes that stained positive for glial fibrillary acidic protein. Since the pronounced DIA in astrocytes has been widely attributed to NBCe1 in physiological studies (Deitmer and Rose, 1996), these glial cells could be expected to provide a physiological correlate of the KO. Indeed, in astrocytes cultured from WT mice, 30 mM K⁺ evoked a DIA of 0.16 ± 0.02 unit pH (n = 8/2), but failed to elicit any pH_i change in astrocytes from Slc4a4 KO animals, (n = 29/3; Figure 6C). The astrocyte DIA was therefore fully attributable to NBCe1, as expected.

Analogous experiments performed on neurons from WT vs. KO mice (in standard saline with 2 mM Ca²⁺) are shown in Figure 6D. Early acid transients were unchanged (Figure 6E, F) and there was no significant difference in baseline pH_i in the two groups (WT: 6.97 ± 0.03, n = 48/5; KO: 6.99 ± 0.02, n = 53/6; p = 0.42). In neurons from KO mice, however, the mean alkaline shift and the corresponding alkaline flux were about one half and one quarter of their respective magnitude in WT cells, suggesting a prominent, but not exclusive role of NBCe1 in generation of the neuronal DIA.

We postulated that the remaining DIA in the neurons from Slc4a4 KO mice would be mostly due to the previously noted Cl⁻-dependent mechanism, and accordingly tested whether this response required external Cl⁻. To maximize the alkaline responses, external Ca²⁺ was omitted in these experiments. As predicted, in zero Cl⁻ saline, the DIA of the KO neurons was virtually abolished, with 96 percent reduction in mean peak amplitude compared to WT neurons in the same media (p <0.001; WT, n = 24/5; KO, n = 35/5, Figure 7A, B). In the KO neurons, the absence of much of the DIA was associated with an increase in the initial acid transient (Figure 7B). In a few instances (2 of 35 cells) a small DIA remained in the neurons from KO mice (Figure 7C).

Figure 7.

DIA in Slc4a4 KO neurons was Cl⁻-dependent. A. In zero Cl⁻ media, a DIA persisted in WT neurons but was virtually abolished in KO neurons. B. Mean amplitude of acid transients and DIA in WT vs. KO neurons. The mean acid shift was larger in the KO neurons, whereas the mean alkaline shift was nearly zero in the KO cells. C. Example of a DIA that persisted in 0 Cl⁻ media in 2 of 35 KO neurons. Experiments were conducted in the presence of 100 μM HOE-694 to lower pH_i after withdrawal of bath Cl⁻.

Discussion

A principal finding of these studies is that hippocampal neurons respond to depolarization by the activation of a DIDS-sensitive, acid extrusion processes that elicits a net increase in pH_i during sustained depolarization. This behavior derives in part from the activation of neuronal NBCe1, and in this respect is similar to the long recognized DIA of astrocytes. Whereas the glial response relies exclusively on NBCe1, as shown in Figure 6C, a component of the neuronal DIA is generated by a parallel DIDS-sensitive mechanism dependent on external Cl⁻. Accordingly, in the absence of extracellular Cl⁻, the DIA was virtually abolished in neurons lacking Slc4a4. Given the presence of multiple components to the response, which could have overlapping ionic dependencies, use of the NBCe1 KO was essential, and provided specific, compelling evidence for the operation of this transporter.

Experiments utilizing DIDS indicated that without these mechanisms to generate a DIA, depolarization could cause a large, prolonged fall in pH_i. As such, the neuronal DIA functions to preempt much of the acidosis. This behavior differs from classic pH regulatory responses, wherein acid extrusion is activated only subsequent to a fall in pH_i (Boron, 2004). Mechanisms that activate net acid extrusion in response to depolarization would appear particularly adaptive for neurons that are subject to large acid loads generated by the influx of Ca²⁺, given the sensitivity of numerous channels to pH_i, and the deleterious effects of prolonged acidosis (Ding et al., 2000; Ying et al., 1999).

In several previous reports, depolarizing agents were found to cause only a short latency, prolonged acidosis of hippocampal neurons (Irwin et al., 1994; Hartley and Dubinsky, 1993; Wang et al., 1994). The absence of an early alkaline response may have been due to more than one factor. First, these studies either omitted or used little bicarbonate in the saline, which would have limited intracellular buffering power, thereby magnifying the acidosis. Second, activation of NBCe1 as well as the Cl⁻-dependent mechanism (see below) would have been precluded or curtailed in low bicarbonate media. Third, there may have been an especially large Ca²⁺-dependent acid source, particularly when NMDA receptors were activated. These acid responses were likely caused in part by the PMCA, (Schwiening et al., 1993; Trapp et al., 1996; Cheng et al., 2008), as this transporter imports H⁺ in exchange for cytosolic Ca²⁺ (Di Leva et al., 2008). Metabolic sources may also have contributed to the acidosis in this and the previous studies, given the persistence of a small acid shift in the nominal absence of extracellular Ca²⁺.

Cheng et al. (2008) noted the occurrence of a DIA in hippocampal neurons in response to elevation of K⁺ in a range from 25 – 140 mM. It was postulated that these pH shifts arose by an H⁺ efflux through a proton conductance. The DIA described in the present report cannot be ascribed to such a mechanism, as a large component was clearly generated by NBCe1, and a second major component was due to a DIDS-sensitive process that required external Cl⁻, features inconsistent with properties of an H⁺ conductance (Decoursey, 2003). It also appears unlikely that DIA mediated by a conductive pathway could occur in response to depolarization of just 10–15 mV (Figure 4), since the driving force for H⁺ would have remained inward. In the study of Cheng and colleagues, the DIA was studied exclusively in HCO₃⁻-free media buffered with HEPES, and was therefore elicited under conditions of lower intracellular buffering capacity, which would have amplified the pH shifts. Their relationship to the DIA of the present study is therefore unclear.

A prominent component of the neuronal DIA was due to a DIDS-sensitive process that required external Cl⁻. A number of known mechanisms linked to Cl⁻ may be considered (Romero et al., 2004). NDCBE (gene Slc4a8) is a key acid extruder of hippocampal neurons that utilizes the energy of the Na⁺ gradient to power the export of cytoplasmic Cl⁻ in exchange for HCO₃⁻. However, this mechanism is not electrogenic, and therefore should be insensitive to depolarization. Moreover, the activity of NDCBE is not readily inhibited in the absence of external Cl⁻, as this anion is well retained in the cytosol of these cells. For example, after three hours in the absence of external Cl⁻, acid extrusion attributed to NDCBE remained functional in hippocampal neurons (Schwiening and Boron, 1994). In the present experiments, the DIAs were elicited within 20 minutes after transition to Cl⁻-free media.

In principle, a Cl⁻-dependent DIA sensitive to DIDS could be generated by a downturn in constitutive acid loading by a Cl⁻-HCO₃⁻ exchanger that might lead to Cl⁻ loading. NPPB had no effect on the DIA, however, nor did a number of other Cl⁻ transport inhibitors. To address this possibility further, additional studies should be carried out using neurons from Slc4a4 KO mice, so as to permit the study of the Cl⁻-dependent DIA in relative isolation.

The majority of experiments in this report were carried out using 30 mM K⁺ to elicit a DIA. Elevation of K⁺ of this order occurs under conditions such as brain ischemia, traumatic brain injury and spreading depression (Hansen, 1985; Martins-Ferreira et al., 2000). Depolarization induced acid extrusion may therefore be relevant to neuronal survival, since an untoward acidosis can foster injury by the facilitation of apoptotic pathways and the generation of reactive oxygen species (Ding et al., 2000; Ying et al., 1999). During seizure activity, the elevation of extracellular K⁺ is less severe, but can approach 12 mM (Somjen, 1979), a level associated with a considerable DIA in our studies. Whether a net DIA occurred under such conditions would depend on the degree of concurrent acid generation. However, even where acidosis was predominant, as in brain ischemia (Rehncrona et al., 1981), depolarization induced acid extrusion could still serve to limit the fall in neuronal pH_i. In this respect, it is notable that hippocampal pyramidal neurons are especially susceptible to hypoxic and ischemic insults (Pulsinelli et al., 1982; Schurr and Rigor, 1992). Therefore, it would be interesting to determine whether these DIA mechanisms exist in neurons from other brain regions, and whether the level of their expression is different.

In addition to limiting acidosis, the neuronal DIA may function to increase the neuronal metabolic rate under conditions of prolonged depolarization. Phosphofructokinase, the rate limiting enzyme of the glycolytic pathway, is highly sensitive to pH_i, and exhibits a steep increase in its activity as pH_i rises (Trivedi and Danforth, 1966). Thus, the neuronal DIA might serve as a signal to raise neuronal glucose utilization under conditions requiring increased generation of ATP, such as seizure, spreading depression and ischemia. Indeed, in astrocytes, the suggestion of coupling between a DIA and the glycolytic rate has received recent experimental support (Bittner et al., 2010).

A key question raised by these studies is whether depolarization activated acid extrusion plays a role under physiological conditions. A rise of K⁺ from 3 to 6 mM, can occur during normal synchronous activity (Somjen, 1979) and this increase was found to cause a significant activation of acid extrusion (Figure 4). Prolonged positive shifts in membrane potential, which might cause a sustained net alkaline shift, are in fact normal occurrences. For example, a depolarization of 10 mV or more, lasting several minutes, occurs in cortical neurons in the transition from sleep to wakefulness (Steriade et al., 2001). It is conceivable that a significant rise in pH_i might accompany these transitions, and thereby modulate metabolic rate and excitability. However, it remains to be determined whether neurons from other brain regions display a DIA similar to the response of hippocampal pyramidal cells.

In summary, we show that the regulation of intracellular pH in hippocampal neurons is strongly governed by membrane potential, due to two separate, DIDS-sensitive mechanisms that serve to limit the acidosis linked to Ca²⁺ entry. Our results demonstrate that the electrogenic Na⁺-HCO₃⁻ cotransporter NBCe1 contributes prominently to this response. In addition, these experiments have uncovered a parallel second mechanism of DIA, which requires external Cl⁻. The full ionic basis and molecular identity of the Cl⁻-dependent process remain to be established. The evolution of DIA in neurons may have been an adaptation to preempt untoward acidification from large intracellular Ca²⁺ loads, while maintaining or accelerating the rate of glucose utilization through the glycolytic pathway.