Abstract
We recently described a hemi-deletion on chromosome 9p24.2 at the SLC1A1 gene lcous and its co-segregation with schizophrenia in an extended Palauan pedigree. This finding represents a point of convergence for several pathophysiological models of schizophrenia. The present report sought to characterize the biological consequences of this hemi-deletion. Dual luciferase assays demonstrated that the partially-deleted allele (lacking exon 1 and the native promoter) can drive expression of a 5'-truncated SLC1A1 using sequence upstream of exon 2 as a surrogate promoter. However, confocal microscopy and electrophysiological recordings demonstrate that the 5'-truncated SLC1A1 lacks normal membrane localization and glutamate transport ability. To identify downstream consequences of the hemi-deletion we first used a themed qRT-PCR array to compare expression of 84 GABA and glutamate genes in RNA from peripheral blood leukocytes in deletion carriers (n=11) vs. non-carriers (n=8) as well as deletion carriers with psychosis (n=5) vs. those without (n=3). Then, targeted RNA-Seq (TREx) was used to quantify expression of 375 genes associated with neuropsychiatric disorders in HEK293 cells subjected to either knockdown of SLC1A1 or overexpression of full-length or 5'-truncated SLC1A1. Expression changes of several genes strongly implicated in schizophrenia pathophysiology were detected (e.g., SLC1A2, SLC1A3, SLC1A6, SLC7A11, GRIN2A, GRIA1, DLX1).
Keywords: EAAT3, glutamate, psychosis, CNV, hemi-deletion, RNA-Seq, real-time PCR, Palau
INTRODUCTION
Schizophrenia is a chronic and debilitating disorder with a complex behavioral and cognitive phenotype, thought to reflect a similarly complex etiopathogenesis involving interactions between various susceptibility genes and environmental factors [1]. Glutamatergic systems have been strongly implicated in the pathophysiology of schizophrenia [2]. Although initially focused on disturbances in neurotransmission at N-methyl-D-aspartate (NMDA)-type glutamate receptors, the "glutamate hypothesis" has since been expanded to include a potential role for dysfunction at other types of glutamate receptors, as well as other glutamate-related entities, such as transporters [3].
A growing amount of experimental, epidemiological and clinical evidence also implicates neuroinflammation as a possible key element in the pathophysiology of schizophrenia [4, 5]. This emerging school of thought postulates that increased risk of psychosis occurs as a result of elevated proinflammatory molecule production following exposure to oxidative stress, infectious agents, toxins, or even acute psychological stressors [6]. In support of this idea, several cytokines have been reported to be elevated in plasma from schizophrenic subjects [7, 8], and neuroimaging studies have shown active inflammation in the brains of patients with psychosis [9]. Conversely, subjects with psychosis exhibit reduced symptoms when administered anti-inflammatory agents [11, 12]. Unifying these findings, Steullet and colleagues recently proposed that a tightly-regulated balance exists between redox state, neuroinflammatory processes and glutamate systems, forming a "central hub" where imbalances can lead to the pathophysiological changes seen in the brains of subjects with schizophrenia [12].
We recently discovered a hemi-deletion at the SLC1A1 glutamate transporter gene, co-segregating with psychosis in multiple members of a 5-generation family from the Pacific island of Palau [13]. This finding led to the designation of a new susceptibility locus- SCZD18. SLC1A1 encodes the excitatory amino acid transporter 3 (EAAT3), a member of the neuronal high-affinity glutamate transporter family. Along with other EAATs, this protein helps terminate the postsynaptic action of glutamate and maintain extracellular glutamate concentrations below neurotoxic levels [14]. Consequently, EAAT3 plays a major role in regulating glutamate-mediated neuroplasticity [15]. In addition to these functions, EAAT3 is important for the synthesis of intracellular glutathione (GSH) and subsequent protection of neurons from oxidative stress [16, 17]. Thus, if the hemi-deletion in SLC1A1 we identified acts as loss of function allele, it may increase the risk of psychosis through alterations in glutamate transport or impairment of cellular responses to oxidative stress or inflammation, suggesting that SLC1A1 may form a point of convergence for several lines of evidence in the field.
The specific hemi-deletion we found is an 84-kb copy number variation (CNV) in SLC1A1 that eliminates the entire promoter and first exon, including the first 59 amino acids of the EAAT3 protein, but preserves nearly all of intron 1 and the remaining structure of the SLC1A1 gene. Thus, the deletion impacts, at a minimum, the first transmembrane domain of the protein, which helps form the Na2+/ dicarboxylate symporter domain that is critically involved in glutamate transport and also appears essential for trimerization of EAAT3 into functional complexes. Since our initial report, we have examined the available data from other groups that reported CNVs affecting SLC1A1 in subjects with schizophrenia and related psychiatric disorders. Stewart and colleagues found a 135-kb hemi-deletion in the promoter and exon 1 of SLC1A1 in a single subject with both schizophrenia and epilepsy following a screen of 235 individuals with dual diagnoses of these disorders [18]. Horiuchi and colleagues found a 10-kb CNV in the first intron of SLC1A1 in a case–control study of 1,920 Japanese schizophrenic patients and 1,920 Japanese control subjects [19]. Although the CNV failed to demonstrate association with schizophrenia in their sample, evidence for association with nearby SNPs was detected as was association of these SNPs with the expression level of SLC1A1 in post mortem samples of prefrontal cortex. More recently, Priebe and colleagues found an exonic 95,102-bp deletion in SLC1A1, spanning the first 5 exons in a single schizophrenic subject from a study of 1,637 cases and 1,627 control [20]. Costain and colleagues reported the presence of a 487-kb deletion affecting all but the first exon of SLC1A1 in a single case (out of 459 unrelated adults with schizophrenia), and subsequently found the same CNV in a sibling of that proband, who exhibited mood and/or anxiety disorder, obsessive compulsive symptoms, and learning deficits [21, 22]. Lastly, Rees and colleagues reported exonic CNVs affecting SLC1A1 in a total of 10 schizophrenics (out of 21,450 cases) and 2 controls (out of 26,529) in different subpopulations of European Caucasians and African American subjects, in a study that screened data from the International Schizophrenia Consortium (ISC) [23]. Taken together, the combined genetic evidence clearly suggests that rare CNVs of large effect involving SLC1A1 may help explain a small proportion of the incidence of schizophrenia across multiple populations. Moreover, it also appears that the greatest degree of overlap among the microdeletion cases occurs in the 5' region of the gene. Each of these 5' CNVs, including the one we observed in the Palau pedigree, could be predicted to result in haploinsufficiency or reduced SLC1A1 expression.
Complementing the human genetic data, there have also been consistent reports of decreased SLC1A1 expression in the striatum of idiopathic schizophrenic subjects compared to controls [24, 25]. Moreover, earlier studies of the SLC1A1-knockout mouse also lend support to its importance in normal brain function. These mice exhibited cortical thinning, ventricular enlargement, reduced size of the CA1 field of the hippocampus and the corpus callosum, along with some behavioral changes and cognitive impairments [16, 26, 27]. Moreover, neurons within the hippocampus and cerebral cortex of SLC1A1-knockout mice were found to have lower GSH content, increased oxidant levels and increased susceptibility to oxidant injury [16, 26, 28]. Interestingly, many of these changes were reversed by treating the knockout mice with N-acetylcysteine, a membrane-permeable precursor for cysteine which is required for glutathione synthesis [16, 26] and has recently been shown to improve psychotic symptoms in human subjects [12, 29]. Importantly, however, although many of these features are consistent with findings in schizophrenia, the SLC1A1-knockout mouse studies to date have not specifically examined phenotypes considered the most relevant for models of this disorder. Moreover, no data have been published on the heterozygous mice, which would more closely mimic the human subjects identified to date that have a single putative loss of function allele.
Given the well-established functional roles that SLC1A1/EAAT3 plays in neuronal function, there are compelling reasons to determine the potential importance of SLC1A1 CNVs in the risk for schizophrenia and psychosis. As a first step toward characterizing the biological consequences of the hemi-deletion we discovered, the present report examines four key questions: 1) In the absence of the native promoter and exon 1, can intron 1 function as a surrogate or alternative promoter for the remaining truncated portion of the gene? 2) Does a 5'-truncated version of SLC1A1 retain its normal cellular localization and glutamate transporter function? 3) Does the 5'-truncation of SLC1A1 affect the expression of any other glutamate-related genes that are strongly implicated in the pathophysiology of schizophrenia? 4) Does knockdown of SLC1A1 expression or overexpression of the 5'-truncated or wildtype protein impact the expression of other schizophrenia, neurotransmission, and stress-related genes?
METHODS
Subjects
Methods of ascertainment and clinical assessment have been described in detail in prior publications [30]. All human subject protocols and procedures were approved by institutional review boards (IRBs) in the US and the Republic of Palau. All individuals in this study were members of the same pedigree reported in our previous study (pedigree 3501) and provided written informed consent or assent to participate after receiving a full explanation of the study in both English and Palauan. A total of 21 family members, including 12 subjects without the deletion (who were all unaffected), and 9 subjects with the deletion (5 of whom were affected) participated (Supplementary Table S1).
Promoter Assays
Dual luciferase assay
To determine if the sequence upstream of exon 2 was capable of promoting transcription of a 5'-truncated mRNA, we cloned 1 kb of sequence upstream of exon 1 or exon 2 into PGL4 Firefly luciferase vector (Promega) without any reporter gene promoter or enhancer elements and with minimal transcription factor binding sites. HEK293 cells were then co-transfected with plasmid containing either exon 1 or exon 2 promoter (upstream) insert as well as the Renilla luciferase vector as an internal control (at a ratio of 10:1 to reduce the trans effects between promoters on co-transfected plasmids and to provide low-level, constitutive expression of Renilla luciferase). A total of 10 wells of a 96-well plate for each promoter construct (20 wells in total) were used for these comparisons. After 24 hours, a dual luciferase assay (Promega) was performed using a Synergy 2 plate reader (BioTek) to measure the activities of firefly and Renilla luciferases sequentially from each well. Comparisons of the relative levels of promoter activity were made using an unpaired Student's t test.
Transcription factor profiling array
To gain additional insight into the possible differences in regulation of the full-length WT SLC1A1 gene compared to the 5'-truncated construct lacking the native promoter and exon 1, we performed a competitive promoter binding assay (Promoter Binding TF Profiling Plate Array II; Signosis; Cat# FA-2002) according to manufacturer protocol. Briefly, 1 uM of the same sequences used in the dual luciferase assays (containing 1 kb of exon 1 or exon 2 promoter sequence) were hybridized in a solution containing a pre-made mixture of biotinylated transcription factor (TF) probes, along with a total of 30 ug of nuclear extracts (as sources of unlabeled transcription factors) that we prepared from human neural stem cells (AppliedStemCell), or purchased for human liver and human heart (Active Motif). In this assay, if our SLC1A1 exon 1 or exon 2 promoter regions contain specific TF DNA binding sites, they will compete with the biotinylated TF probes provided in the kit resulting in reduced chemiluminescence at that location due to competitive inhibition. As a result, greater affinity of the SLC1A1 promoter region for a TF results in lower signal. The pattern of TF probe signal changes were measured using a Synergy2 plate reader (BioTek) and relative comparisons made between the native exon 1 promoter and putative exon 2 promoter constructs. Because these experiments were only performed one time, we focused only on those TFs which showed changes of +/-3-fold or greater (approximately the top 10% of the findings).
Cellular Localization and Function Assays
Confocal microscopy
To examine whether full-length or 5'-truncated SLC1A1 proteins showed evidence of altered localization within cells, we prepared HEK293 cells for confocal imaging analysis following transfection with 1 ug of GFP-tagged full-length or 5'-truncated SLC1A1 construct. The full-length construct contained the sequence-verified wildtype (WT) human SLC1A1 ORF (1575 bp) subcloned into pCMV6-AC-GFP vector (Origene; PS100040). The 5'-truncated construct used the same vector but contained a sequence-verified SLC1A1 ORF with the first 91 bp removed. The HEK293 cells receiving these constructs were transfected for 6 hours using Lipofectamine 2000 (Invitrogen), maintained for 24 hours, stained with the cell membrane dye CellMask Orange (Life Technologies), and fixed in 4% paraformaldehyde. Images were taken using a 40x oil immersion lens on a Zeiss LSM 510 confocal microscope.
Electrophysiological recordings and western immunoblot
To examine whether the 5'-truncated SLC1A1 protein can still function as a glutamate transporter, we performed in vitro transcription (using the T7 MaxiScript kit, Ambion) to generate capped mRNAs using the full-length and 5'-truncated cDNA constructs described above, except for the absence of the GFP-tags. The RNAs were coded in a blind fashion and submitted to Ecocyte Biosciences for electrophysiological recording. Using a Robocyte automated injection system, oocytes isolated from adult Xenopus Laevis were injected with one of the following: (1) water, (2) full-length SLC1A1 mRNA (200 ng/μL), (3) 5'-truncated SLC1A1 mRNA (200 ng/μL), or (4) a 50–50 mixture of full-length/ 5'-truncated SLC1A1 mRNA (100 ng/uL each). A total of 9–21 oocytes were used for each treatment. Glutamate transporter activity was measured after three to five days of incubation in Barth's solution. For these assays, oocytes were clamped to a holding potential of -60 mV and 2 mM glutamate or Frog Ringer's solution (as a control) was bath applied at 3–4 mL/min. Glutamate-induced inward currents were recorded at a sampling rate of 1000 Hz at room temperature. Two-electrode voltage-clamp recordings were performed at a holding potential of -60 mV or with 20 mV step voltage increments from -120 mV to 80 mV. Drug-induced current amplitudes were calculated with respect to the holding current. Results are given as means ± SEM. At the conclusion of the recording, the oocytes from each preparation were rapidly frozen and returned to our lab for confirmation of protein expression using western immunoblot. Total protein was extracted from the cell pellets using standard conditions and transferred to PVDF membranes after separation using SDS-PAGE on two 10% gels. The EAAT3 protein was detected using rabbit antibody (Sigma-Aldrich) at 1:500 dilution. GAPDH was used as a loading control and mouse monoclonal antibody to this protein was used at 1:1000 dilution. The antibodies were visualized by chemiluminescence after incubation with HRP–conjugated antibody to rabbit IgG (Promega). Optical densities of the protein bands were measured using the ImageJ software. The protein band densities for EAAT3 were normalized to the densities of the GAPDH bands from the same samples in the second immunoblot.
Gene Expression Studies
Measurement of GABA and glutamate gene expression by PCR array on human peripheral blood RNA
To examine the consequences of the hemi-deletion on gene expression, we compared mRNA levels in CNV carriers and non-carriers, as well as affected and unaffected subjects, in peripheral blood leukocyte (PBL) RNA obtained from subjects in the K3501 pedigree. For these studies, peripheral venous blood was collected into PaxGene RNA tubes (Qiagen) and shipped by courier to the US at ambient temperature. Total RNA was purified according to manufacturer protocol using the PAXgene Blood RNA Kit (Qiagen). Purified RNA samples were subjected to quality control using the Agilent Bioanalyzer RNA 6000 Nano Kit.
Because of the typically low level of expression of neurotransmission genes in leukocytes, we compared the expression level of 84 genes of interest (Supplementary Table S2) using a human GABA and glutamate RT2 Profiler PCR Array (Qiagen; PAHS-152ZG-4), which uses gene-specific reverse transcription to enhance the detectability of such transcripts during PCR. A total of 19 RNA samples were used for this assay, including 5 affected deletion carriers, 3 unaffected deletion carriers and 11 non-carrier controls from the K3501 pedigree. The total RNA was prepared according to manufacturer protocol. Thermal cycling was performed using a LightCycler 480 (Roche), and data normalized according to the ΔΔCt method, with the arithmetic mean of two reference genes used for standardization (HPRT1, RPLP). Resulting data were log2 scaled and comparisons made between deletion carriers (n=8) and non-carriers (n=11) in the pedigree and between deletion carriers with psychosis (n=5) and deletion carriers without psychosis (n=3) in the pedigree using an unpaired Student's t test without correction for multiple testing. Results were visualized in a volcano plot.
Examination of the effects of knockdown of SLC1A1 or overexpression of WT and truncated SLC1A1
Because of our interest in knowing how the expression level and the presence of a truncated SLC1A1 transcript might affect genes involved in brain function, we next examined the effects of shRNA-mediated knockdown of SLC1A1 or overexpression of full-length and 5'-truncated SLC1A1 in HEK293 cells. Four replicate wells in a 24 well plate were used for each experimental condition, each containing 150,000 cells at 70% confluence. For the overexpression studies, we transfected HEK293 cells with 1 ug of the same constructs used in the confocal imaging analysis using Lipofectamine 2000 (Invitrogen), as well as an empty cDNA vector as a negative control. For the knockdown studies, identical preparations of HEK293 cells were transfected using Lipofectamine 2000 (Invitrogen) with 0.7 ug of a cocktail of three validated human MISSION SLC1A1 shRNAs (Sigma-Aldrich; product # SHCLNG-NM_004170) or 0.7 ug of pLKO1-puro non-target shRNA (Sigma-Aldrich) or blank shRNA as a negative control. All cells were maintained for 48 hours after treatment. For qualitative confirmation of the overexpression and knockdown of SLC1A1 in these cells, we also co-transfected an additional set of identically-treated HEK293 samples with a mixture of both GFP-tagged full-length SLC1A1 cDNA and the shRNA cocktail or control construct and measured the SLC1A1 mRNA levels and fluorescence of these wells after 48 hours.
After 48 hours treatment, the RNA from each well was isolated using the RNeasy mini kit (Qiagen). We first performed quantitative confirmation of overexpression and knockdown of SLC1A1 using real-time quantitative RT-PCR in triplicate reactions with a custom-designed primer pair that amplified a 102 bp sequence in exon 10 of the gene (left primer: ATTCGTGTTACCCGTTGGTG; right primer: CCCAAGTCCAGGTCATTCAA). Thermal cycling was performed using 5 uL of cDNA from each sample, with 0.5 uL of each forward and reverse primer in a standard qPCR reaction in 20 uL volumes using LightCycler 480 SybrGreen I Master Mix (Roche) and the following conditions: 95°C for 5 min, then 40 cycles of 95°C for 10 sec, 59°C for 15 sec and 72°C for 10 sec. Quantification was performed using the ΔΔCt method, with RPLP1 used as the reference gene. Resulting data were log2 scaled and comparisons made between full-length and 5'-truncated cDNA treated cells and their control, as well as between the shRNA treated cells and their control using unpaired Student's t tests.
After confirmation of the desired effect on SLC1A1 expression in the various cell treatments, the same HEK293 RNA samples were subjected to a more comprehensive expression profiling using a custom gene expression panel of 375 genes related to schizophrenia, neurotransmission and immune function (Supplementary Table S3). These genes were selected based on their public annotations and relevance to neuropsychiatric disorders, as judged from the results of large genome-wide association and CNV studies, meta-analyses and expression studies. These genes were interrogated using custom-designed Targeted RNA-Seq (TREx) assay (Illumina) according to the manufacturer protocol with an Illumina MiSeq system. Only genes with at least 5 read counts in five or more of the samples were retained for analysis (n=240). The resulting read counts for these genes were normalized within each sample to the geometric mean of two reference genes (PPIA and RPLP), subjected to cube-root transformation, then mean-centered and range-scaled (divided by the range of values for that gene) across the samples. To simplify the statistical comparisons, we combined the data for the 3 control groups (n=12 samples from 4 blank cDNA, 4 blank shRNA and 4 non-targeting shRNA preparations) into a single control group. A 1 x 4 ANOVA was then performed to compare the effects of knockdown of SLC1A1 or overexpression of the full-length or 5'-truncated cDNA on the expression of the 240 genes in the TREx assay. False-discovery rate (FDR) correction was applied to the main effect p values, with a threshold of q<0.15. Post-hoc contrasts were obtained from Tukey's honestly significant difference. Genes with significant changes were subjected to hierarchical cluster analysis to help discern patterns in the data. Due to the number of control samples (n=12), replicates within each control group were averaged to single data point for clustering.
RESULTS
The sequence upstream of exon 2 promotes transcription of 5'-truncated SLC1A1
Using a dual luciferase assay, we compared the transcriptional activities of 1 Kb upstream of exon 1 and exon 2 of SLC1A1. The alternative exon 2 promoter activity was significantly increased more than 7 fold (p< 5.7E-8) compared to the native promoter (Fig. 1). These data strongly suggest that a 5’-truncated form of EAAT3 could be expressed as a result of an alternative start site introduced by the deletion of the native promoter and exon 1.
Fig. 1. Sequence upstream of exon 2 can function as an alternative promoter.
Exon 1 promoter and exon 2 putative promoter region, each 1 kb in size, were cloned into a firefly luciferase vector and dual luciferase assays were performed. The promoter activity of exon 2 upstream sequence was 7.3 fold more than the native promoter, which implies that a 5'-truncated form of EAAT3 could be expressed.
Transcription factors have different binding affinities in alternative vs. native promoters
Based on the dual luciferase assay results, we next sought to determine possible transcription factors that might contribute to increased expression of a truncated protein. This was performed using the Promoter Binding TF Profiling Plate Array II. Our results indicated the presence of several putative transcription factors that showed increased binding affinity (NFAT, SATB1, Myb, HNF-1, all > 3-fold increased), along with others that showed decreased binding affinity (VDR, TFEB, SOX18, SOX9, TFE3 and USF-1, all > 3-fold decreased) for the alternative promoter compared to the native promoter (Fig. 2; Table 1). These observations strongly suggest that the expression of the full-length and truncated isoforms is differentially regulated by a number of potentially important transcription factors.
Fig. 2. Different transcription factors act on alternative vs. native promoters.
The scatter plot shows the signal intensities from the competitive binding of transcription factors to 1 kb of exon 1 promoter versus exon 2 promoter sequences, as measured in the Promoter Binding TF Profiling Plate Array II (Signosis). Note that due to the competitive nature of the assay, a higher chemiluminescence signal means less binding affinity of the transcription factor to the relevant promoter sequence of SLC1A1 and vice versa.
Table 1.
Fold changes of the binding affinity of transcription factors to the SLC1A1 alternative vs native promoters.
| Decreased | Increased | ||
|---|---|---|---|
| Transcription Factor | Fold Change | Transcription Factor | Fold Change |
|
|
|
||
| TFEB | −13.46 | HNF-1 | 7.00 |
| VDR | −7.43 | NFAT | 4.61 |
| TFE3 | −7.10 | SATB1 | 4.24 |
| USF-1 | −5.18 | Myb | 3.37 |
| S0X9 | −4.78 | PLAG1 | 2.68 |
| S0X18 | −4.27 | TFIID | 2.55 |
| ROR (RZR) | −2.98 | NF-1 | 2.42 |
| ProX1 | −2.73 | PIT1 | 2.29 |
| WT1 | −2.10 | SRF | 2.28 |
| F0X01 | −2.04 | IRF Pax2 XBP |
2.16 2.11 2.04 |
Full-length and 5'-truncated EAAT3 isoforms localize in different parts of the cell
Previous immunocytochemical studies have shown that EAAT3 can be localized both intracellularly and on the cell membrane of neurons [31, 32]. We used confocal microscopy to determine if the full-length and truncated isoforms of the protein were differentially localized using C-terminal GFP-tagged constructs. High-resolution imaging demonstrated that most of the full-length EAAT3 was found on the cell membrane whereas most of the truncated EAAT3 was found intracellularly (Fig. 3). These differences were present despite generally similar levels of expression, although some cells expressing the truncated EAAT3 clearly had reduced fluorescence. Overall, our results strongly suggest different patterns of localization for these two proteins.
Fig. 3. Full-length and 5'-truncated EAAT3 isoforms localize differently.

C-terminal GFP-tagged open reading frame clones of wildtype and 5’-truncated human SLC1A1 gene were transfected into HEK293 cells. Confocal images were taken using a 40x oil immersion lens. Cell Mask orange stain (Invitrogen) was used to label the cell membrane. A) Full-length EAAT3, B) Truncated EAAT3. Note that the wildtype isoform localizes mainly in the cell membrane, while the truncated form (lacking exon 1) mainly localizes in the cytoplasm.
5'-truncated EAAT3 cannot function as a glutamate transporter
We next sought to determine if the 5'-truncated EAAT3 that would be expressed from an intron 1 promoter was functional as a glutamate transporter. For this purpose, glutamate-induced inward currents in Xenopus Laevis oocytes were measured after injections with water (as a negative injection control) or the mRNA encoding full-length or 5'-truncated SLC1A1. In the oocytes injected with full-length SLC1A1 mRNA, bath-applied glutamate (2 mM) induced a robust inward current characteristic of glutamate transport (Fig. 4A and B). However, electrogenic glutamate transport was minimal in the oocytes injected with water or truncated SLC1A1 mRNA. These differences existed despite comparable overall expression levels of each protein, according to western immunoblot (Fig. 4D).
Fig. 4. 5'-truncated EAAT3 does not transport glutamate.
Xenopus Laevis oocytes were injected with one of four solutions: (1) water, (2) full-length WT SLC1A1 mRNA (200 ng/ uL), (3) 5'-truncated SLC1A1 mRNA (200ng/ μL) or (4) a 1:1 mixture of full-length/ 5'-truncated SLC1A1 mRNA (100 ng/uL, each). After three to five days of incubation in Barth's solution, oocytes were clamped to a holding potential of -60mV and 2mM glutamate or Frog Ringer's solution were bath applied at 3–4 mL/min. Glutamate-induced inward currents were recorded at a sampling rate of 1000Hz at room temperature. Two-electrode voltage-clamp recordings were performed at a holding potential of -60mV for comparing: (A) water, full-length and 5'-truncated SLC1A1 mRNA or (B) full-length vs. 1:1 mixture of full-length/ 5'-truncated SLC1A1 mRNA. C) The results obtained from recording with step voltage increments of 20mV from -120mV to 80mV following application of glutamate or Ringer's. Drug-induced current amplitudes were calculated with respect to the holding current and the results shown as means +/- SEM for each treatment. Note that electrogenic glutamate transport was minimal in the oocytes injected with water or 5'-truncated SLC1A1 mRNA but in oocytes injected with full-length SLC1A1 mRNA, glutamate induced a strong inward current (A and C). Also note that injecting half as much full-length SLC1A1 mRNA in the presence of an equal amount of 5'-truncated mRNA produced approximately 60% of the current recorded after injections of twice as much full-length mRNA alone (B). D) The expression level of SLC1A1 was compared in each treatment group using western immunoblot on the same oocytes that were used in recording experiments. GAPDH was measured as a loading control and the density of SLC1A1 bands determined relative to this protein. Predicted molecular weight of SLC1A1: 57kDa and GAPDH: 37kDa. Note that the truncated protein was highly expressed. Also note that despite the loss of 59 amino acids, we were unable to discern a shift in the molecular weight of SLC1A1 or a doublet band in the co-injection experiment.
Based on the results from the initial oocyte recordings, in a separate experiment, we examined the potential for the 5'-truncated form of EAAT3 to possibly function in a dominant negative manner. Electrophysiological recordings were repeated after injections in another set of oocytes (n=9–21) with either the full-length SLC1A1 mRNA (200 ng/uL) or a 1:1 mixture of full-length and 5'-truncated mRNA (100 ng/uL each). Expression of the protein was confirmed by immunoblot (Fig. 4D). Results indicated that injecting half as much full-length mRNA in the presence of an equal amount of 5'-truncated mRNA still enabled inward glutamate currents to be produced after bath application. Moreover, the amount recorded was approximately 60% of that recorded after injections of twice as much full-length mRNA alone (Fig. 4C). These observations do not support a dominant negative effect of the truncated mRNA or protein.
mRNA expression changes in peripheral blood cells of deletion carriers
To examine the consequences of the hemi-deletion on gene expression, we compared the expression level of 84 genes of interest related to glutamate and GABA transmission in 8 subjects with the deletion and 11 non-carrier controls from the same pedigree using a commercial PCR array. Comparisons between these subject groups were made using an uncorrected t test and visualized in a volcano plot (Fig. 5). Our results demonstrate nominally significant changes in expression of a small subset of genes in deletion carriers (Fig. 5A). Interestingly, these genes encode well-characterized members of the AMPA, NMDA and metabotropic classes of glutamate receptors (GRIA1, GRIN2A and GRM8) as well as a neuronal high-affinity glutamate/ aspartate transporter (SLC1A6).
Fig. 5. Cells from subjects with the SLC1A1 hemi-deletion show altered expression of glutamate and GABA genes.
Gene expression differences were measured using a PCR array on human PBL RNA of (A) SLC1A1 hemi-deletion carriers (n=8) compared to non-carriers (n=11) from the K3501 pedigree or (B) deletion carriers with psychosis (n=5) compared to carriers without psychosis (n=3). Horizontal blue line indicates p = 0.05 threshold for significance. Vertical pink dashed lines indicate 1.5-fold (50%) change in mRNA expression.
mRNA expression changes in deletion carriers with and without psychosis
In addition to comparing all deletion carriers versus non-carriers from the pedigree, we also performed an exploratory analysis using the same PCR array data to compare expression in the peripheral blood RNA of deletion carriers with psychosis (n=5) to those without psychosis (n=3). Although the results must be viewed as preliminary, they revealed nominally significant expression increases in a kainate receptor subunit (GRIK4) and decreases in a glial glutamate transporter (SLC1A3) as well as alpha-synuclein (SNCA) (Fig. 5B), which is involved in the recycling and maintenance of presynaptic glutamate-containing vesicles.
Transcriptional effects of SLC1A1 knockdown or overexpression of full-length and 5'-truncated SLC1A1
We confirmed that in HEK293 cells treated with SLC1A1 shRNA or cDNA-containing plasmids, the expression level of this gene significantly decreases or increases, respectively. Specifically, when normalized to the SLC1A1 expression level in the non-target shRNA-treated HEK293 cells, the cocktail of three validated human MISSION SLC1A1 shRNAs (Sigma-Aldrich) had knocked down the SLC1A1 mRNA expression by more than 37% (Fig. 6A). Conversely, compared to untreated cells, the HEK293 cells transfected with full-length SLC1A1 plasmids had significantly increased SLC1A1 mRNA expression according to qRT-PCR (>400 fold) (Fig. 6B). This increase was significantly attenuated when the full-length cDNA was co-transfected with SLC1A1 shRNA, although the levels were still nearly 100-fold above baseline (Fig. 6B). These findings were strongly supported at the protein level based on the trends in the fluorescent signal intensity observed in the same cell cultures (data not shown). Notably, the specificity of the overexpression of full-length vs. 5'-truncated SLC1A1 was also strongly confirmed, since we observed no increase in SLC1A1 exon 1 reads in the HEK293 cells receiving the 5'-truncated construct, compared with the marked increase in exon 10 reads in the same samples.
Fig. 6. Confirmation of expression changes in transfected HEK293 cells.
A) compared to the blank control or the vector containing scrambled non-targeting shRNA, the cells receiving shRNA for SLC1A1 showed significantly decreased mRNA expression in real-time quantitative RT-PCR. B) PCR also confirmed that overexpression of the cDNA for full-length SLC1A1 significantly increased the mRNA levels, with an attenuation of this effect seen following co-transfection of the cDNA and shRNA for SLC1A1. Mean expression levels +/− SEM (normalized to the blank) are shown for each group. Statistical comparisons were made with a Student's t test.
Examination of the more global effects of altered SLC1A1 mRNA expression on genes relevant to schizophrenia and brain function was enabled by targeted RNA-sequencing expression (TREx) analysis. A total of 36 unique genes demonstrated significant changes in expression (FDR q < 0.15) out of the total 375 genes included in the assay and the 240 genes subjected to statistical testing (Table 2). Not surprisingly, the most significant changes were seen in cells that received the SLC1A1 overexpression constructs. Note that data for two different regions of SLC1A1 are shown. The first region includes a sequence in exon 10 common to all known SLC1A1 isoforms. It demonstrated a clear pattern of increase in the eight samples overexpressing either 5'-truncated (TR) or full-length (WT) cDNA (Fig. 7). The second region is in exon 1 which also showed a significant increase in expression, but only in the full-length samples compared to all other samples (Fig. 7; Table 2). These results were not unexpected, given the construct design and the qRT-PCR results.
Table 2.
Genes in HEK293 cells treated with shRNA- or cDNA-containing vectors which demonstrate significant changes in expression (FDR q < 0.15) in targeted RNA-Seq assay.
| Gene Symbol | p-value | FDR | Significant Contrasts (Tukey's HSD) |
|---|---|---|---|
| SLC1A1 (exon 10) | 2.1E-24 | 5.0E-22 | TR > CT, WT > CT, TR > SH, WT > SH |
| SLC1A1 [exon 1) | 1.0E-23 | 1.3E-21 | WT > CT, WT > SH, WT > TR |
| S100B | 1.9E-06 | 0.0002 | TR > CT, WT > CT, TR > SH, WT > SH |
| GRIA1 | 2.7E-05 | 0.0016 | TR > CT, WT > CT, TR > SH, WT > SH |
| GRIN1 | 0.00011 | 0.0047 | TR > CT, WT > CT, TR > SH, WT > SH |
| GRM5 | 0.00012 | 0.0047 | TR > CT, WT > CT, WT > SH |
| TSPO | 0.00021 | 0.0071 | CT > SH, TR > SH, WT > SH |
| GFAP | 0.00064 | 0.0158 | TR > CT, WT > CT, WT > SH |
| PPP1R1B | 0.00066 | 0.0158 | TR > CT, WT > CT, TR > SH, WT > SH |
| ITPR1 | 0.00067 | 0.0158 | TR > CT, TR > SH, WT > SH |
| GRM3 | 0.00073 | 0.0158 | CT > SH, WT > CT, TR > SH, WT > SH |
| FEZ1 | 0.00081 | 0.0160 | WT > CT, TR > SH, WT > SH |
| SNAP25 | 0.00091 | 0.0160 | TR > CT, WT > CT, TR > SH, WT > SH |
| SORBS3 | 0.00093 | 0.0160 | TR>CT,TR>SH,WT>SH |
| SLC1A2 | 0.00101 | 0.0162 | TR > CT, WT > CT |
| SLC1A3 | 0.00173 | 0.0250 | TR > CT, WT > CT, WT > SH |
| CTNNA3 | 0.00185 | 0.0250 | WT > CT, WT > SH, WT > TR |
| PHGDH | 0.00194 | 0.0250 | TR > CT, TR > SH, WT > SH |
| NTRK3 | 0.00198 | 0.0250 | TR > CT, TR > SH, TR > WT |
| SLC7A11 | 0.00310 | 0.0372 | WT > CT, WT > SH |
| ARRB1 | 0.00428 | 0.0488 | WT > CT, WT > SH |
| CYP2D6 | 0.00448 | 0.0488 | CT > TR, WT > TR |
| ADCY3 | 0.00509 | 0.0521 | WT > CT, WT > SH |
| PDE4A | 0.00521 | 0.0521 | TR > CT, TR > SH |
| GABRG2 | 0.00721 | 0.0692 | TR > CT, TR > SH |
| HOXA1 | 0.00764 | 0.0705 | WT > CT, WT > SH |
| NAT1 | 0.01190 | 0.1005 | CT > TR, WT > TR |
| SLC32A1 | 0.01213 | 0.1005 | WT > CT |
| HES5 | 0.01238 | 0.1005 | TR > CT |
| GABRA4 | 0.01257 | 0.1005 | TR > SH,WT > SH |
| AKT3 | 0.01303 | 0.1008 | TR > CT, WT > CT |
| DLX1 | 0.01394 | 0.1024 | TR > CT,TR > SH |
| PLCB1 | 0.01408 | 0.1024 | TR > CT |
| NDE1 | 0.01589 | 0.1122 | WT > SH |
| GRIA2 | 0.01690 | 0.1158 | WT > SH |
| SPRY2 | 0.01737 | 0.1158 | TR > SH |
| GABBR1 | 0.02180 | 0.1414 | TR > CT |
CT, control; SH, shRNA-treated; TR, 5'truncated SLC1A1; WT, wildtype full-length SLC1A1.
Fig. 7. Transcriptional effects of knocking down or overexpressing full-length or truncated.
SLC1A1. A custom panel of 375 genes was interrogated in HEK293 cells using targeted RNA-sequencing. The normalized read counts were subjected to statistical analysis using ANOVA with FDR correction and hierarchical clustering. Note that only one column is shown for each of the 4 samples in each type of control sample (blank cDNA, blank shRNA and scrambled non-targeting shRNA vector preparations). CT, control; SH, shRNA-treated; TR, 5'-truncated SLC1A1; WT, wildtype full-length SLC1A1.
In addition to SLC1A1 itself, there were several other significant changes seen as a result of either knockdown or overexpression of either truncated or full-length SLC1A1. Rather than describing each of these observations individually, we will merely point out a few general patterns of change, and highlight some of the genes. Overall, most of the significantly changed genes showed expression changes that mirrored those seen for exon 10 of SLC1A1, with increases following transfection with either truncated or full-length cDNA (e.g., SLC1A3, S100B, GRIA2, GFAP, ARRB1, AKT3, SNAP25, PPP1R1B, GRIA1, GRIN1, SLC1A2) (Fig. 7A). However, some genes showed patterns of decreased expression in the shRNA samples and increased expression in the full-length samples (e.g., GABRA4, GABRG2, GRM5, NDE1, GRM3, CTNNA3). Of particular note were genes that appeared to be somewhat selectively decreased in the shRNA samples and increased in the truncated cDNA samples (e.g., DLX1, TSPO, SORBS3, NTRK3, PDE4A, PLCB1) or somewhat selectively decreased in the truncated samples and increased in the full-length samples (e.g., CYP2D6, NAT1). Representative expression profiles for some of these genes make these patterns more easy to discern (Fig. 7B).
DISCUSSION
The present study has four major findings. First, the region of chromosome 9 upstream of the second exon of SLC1A1 appears to have the ability to drive expression of a truncated form of SLC1A1, potentially through activation by transcription factors that are distinct from those which act on the native promoter. Second, the expression of a 5'-truncated isoform of SLC1A1 lacking exon 1 reduced the membrane localization of the protein and led to its inability to transport glutamate. Third, in PBLs from human subjects who inherited the exon 1 and native promoter deletion, there appears to be compensatory or downstream effects that lead to significant changes in a set of genes related to glutamate and GABA neurotransmission. Fourth, knockdown or overexpression of either full-length or 5'-truncated SLC1A1 mimics some of the changes seen in the human PBLs as well as some of the more general changes in gene expression previously reported in schizophrenia. We now discuss some of the implications of these findings.
Sequence upstream of exon 2 can drive expression of a truncated form of SLC1A1
As a first step toward characterizing the potential consequences of our newly-discovered hemi-deletion, we used a dual luciferase assay and showed that the intron 1 sequence upstream of exon 2 can promote expression at an even higher level than the native promoter. This sequence would replace the native promoter in the hemi-deleted allele in subjects from the K3501 pedigree and function as a “surrogate” or alternative promoter for the expression of a truncated protein at one of three possible start codons at the beginning of exon 2. Although there was some indication from public databases that this region of SLC1A1 could function as a “weak promoter” in normal contexts, the robust and highly significant result we obtained was completely unexpected.
Because different transcription factors (TFs) act on promoters to drive or reduce gene expression in different cellular and physiological conditions, we also performed a screen to identify TFs which would have different actions on the two promoters. Our results show that the two promoters are acted upon differently by a relatively small subset of TFs, including some with considerable relevance for brain function. The well-characterized vitamin D receptor (VDR) was one such TF and showed more than 7-fold less binding affinity for the alternative promoter region. VDR is expressed widely in many tissues but in the brain shows particular enrichment in hypothalamus and in the dopaminergic neurons within the substantia niagra [33]. The VDR acts in combination with other entities, such as retinoid X receptors (RXRs), to form transcription complexes that induce or repress gene expression [34]. Interestingly, low vitamin D status has been linked to a range of psychiatric conditions [35], with a recent meta-analysis demonstrating a strong association between vitamin D deficiency and schizophrenia [36]. Moreover, Graham and colleagues reported a direct association between lower vitamin D levels and increased severity of negative symptoms and cognitive deficits in schizophrenic subjects [37] and McGrath and colleagues reported that vitamin D supplementation during the first year of life is associated with reduced risk of schizophrenia in males [38]. Complementing these findings, there is also a well-established vitamin D deprivation model of schizophrenia in rodents [39, 40]. Interestingly, Simmons and colleagues recently found that the expression of SLC1A1 was increased more than 7-fold by the VDR ligand, 1,25-dihydroxyvitamin D3 (1,25D), in hTERT-HME cells [41]. Taken together, these results suggest that the psychiatric disturbances associated with vitamin D deficiency might be due, in part, to reduced SLC1A1 expression. Furthermore, the loss of the VDR binding site in subjects with a hemi-deleted SLC1A1 allele provides a possible mechanistic explanation for the observed findings.
Expression of 5'-truncated SLC1A1 alters its localization and glutamate transport function
The expression level and membrane localization of EAAT3 promote its ability to act as a glutamate transporter which helps maintain the strength and dynamics of normal glutamatergic transmission. This transport activity limits the diffusion of glutamate molecules in one synapse to its neighboring synapses, a phenomenon known as "spillover" [42]. Despite the fact that EAAT3 must be expressed at the cell membrane to function as a transporter, a large proportion of the protein is known to be localized in intracellular pools [31, 32, 43]. In fact, some estimates have indicated that up to 80% of EAAT3 can be located intracellularly under baseline conditions [44, 45]. However, it is also thought that when cells are activated, various intracellular messengers (including PKC, PDGF) promote rapid mobilization, cell surface expression and activity of EAAT3 [44, 45, 46, 47, 48]. Moreover, Levenson and colleagues suggested that translocation of the EAAT3 from the cytosol to the plasma membrane is required for long-term potentiation (LTP) in area CA1 of the hippocampus [49]. Our physiological and confocal imaging results indicate that even if subjects with the hemi-deletion express a 5’-truncated form of EAAT3, this protein lacks normal cell surface expression and the ability to transport glutamate. Importantly, however, the deficit created by the expression of 5’-truncated EAAT3 does not appear to act in a dominant negative manner, further suggesting that some residual EAAT3 function should still be present in these subjects, though they may clearly be at an increased risk for psychosis. Support for the non-dominant nature of the truncated EAAT3 is also seen in previous studies. By co-expressing wildtype EAAT3 subunits with different mutant subunits [50, 51], different groups have shown that EAAT3 assembles as trimers but individual subunits in the assembly have distinct glutamate-binding sites and transport pathways which function independently of each other. These studies help explain our observation that coexpression of full-length WT and 5'-truncated EAAT3 generated approximately half as much glutamate transport as when only WT mRNA was injected.
Cells from subjects with the SLC1A1 hemi-deletion show altered expression of glutamate and GABA genes
To probe for potential compensatory changes occurring in the cells of subjects with the hemi-deletion, we examined the expression of genes involved in glutamate and GABA function using a commercial PCR array. Our results showed that a small subset of these genes demonstrated altered (increased) expression as a consequence of the deletion, including GRIA1, GRIN2A and GRM8 as well as a neuronal high-affinity glutamate/ aspartate transporter, SLC1A6. Moreover, in subjects with the deletion who exhibited psychosis, there was an apparent increase in expression of GRIK4 and decreased expression of SLC1A3 and SNCA compared to subjects with the deletion who did not exhibit psychosis. We now discuss the potential significance of these findings.
Deletion carriers vs. Non-Carriers
Three of the genes with increased expression in the peripheral blood of SLC1A1 deletion carriers encode glutamate receptor subunits , specifically the alpha 2 subunit of the NMDA receptor (GRIN2A), the ionotropic AMPA 1 receptor (GRIA1) and the metabotropic glutamate receptor 8 (GRM8). Current evidence indicates that in schizophrenia, the levels of glutamate receptors such as these can be increased, decreased, or unchanged, depending on the brain region being studied [52] with variability likely arising from different drug histories, co-morbid diseases and underlying clinical heterogeneity [53]. Despite these limitations, there are considerable data available that strengthen the potential impact of our observations regarding these genes.
GRIN2A
Glutamatergic theories of schizophrenia were originally based heavily on the observation that NMDA receptor antagonists such as phencyclidine and ketamine can induce schizophrenia-like symptoms in normal humans and worsen psychotic symptoms in persons with schizophrenia [54, 55]. Since then, converging evidence suggests hypofunction of NMDA receptors in schizophrenia and decreased expression of GRIN2A in the dorsolateral prefrontal cortex of subjects with schizophrenia [2, 56, 57]. Moreover, auto-antibodies to NMDA receptors have been reported to cause schizophrenia-like symptoms in previously normal subjects [58, 59] and the presence of such antibodies has been described in up to 10% of patients with an initial clinical diagnosis of schizophrenia [5, 60]. Drugs that potentiate or modulate NMDA receptors have also been studied as potential therapeutic targets for schizophrenia [61]. In our subjects with the deletion, the increased expression we detected in the peripheral blood could be interpreted as a compensatory (defensive) mechanism to prevent or diminish psychosis subsequent to the hemi-deletion of SLC1A1 and resultant disruption of glutamate transmission. However, it is also important to point out that the measures we obtained in the blood may not reflect the state of what is occurring in the brain.
GRIA1
The AMPA1 receptor subunit is a good candidate gene for susceptibility to schizophrenia since it maps to 5q33, a region consistently implicated in several independent genome-wide linkage scans and meta-analyses [62, 63, 64, 65] and also because its expression has been found to be decreased in the brains of some schizophrenia patients [66]. Furthermore, polymorphisms in GRIA1 have been associated with schizophrenia and its clinical symptoms in different populations [66, 67]. Moreover, positive allosteric modulators of the AMPA receptor have become of increasingly high interest as potential new treatments for schizophrenia [68]. Based on these data, the increased expression we detected in the blood could likewise represent a possible compensatory response to glutamate transporter hypofunction in subjects with the hemi-deletion.
GRM8
Group III mGluRs are generally thought to be expressed presynaptically and to serve as autoreceptors that modulate glutamate transmission [69, 70]. Although genetic variations of GRM8 in schizophrenia and the antipsychotic effects of mGluR8 agonists have been inconsistently reported in the literature [71, 72, 73, 74], there are conclusive reports regarding its role in mediating excitatory transmission in response to environmental stressors. In fact, the mGlu8 receptor has been specifically implicated in anxiety and stress-related behaviors and its activation has been shown to produce strong anxiolytic effects [75, 76]. Thus, the observed increase in its expression might represent another adaptive response in SLC1A1 deletion carriers, thereby helping them to deal better with stressful stimuli or events.
SLC1A6
Similar to what has been suggested regarding GRIN2A, GRIA1 and GRM8, we also believe that the increased SLC1A6 expression may represent a potential compensatory response to the hemi-deletion of SLC1A1. SLC1A6 encodes EAAT4, a neuronal high-affinity glutamate/ aspartate transporter and its expression is highly localized, mostly expressed in the Purkinje cells of the cerebellum [77]. Both EAAT3 and EAAT4 are required to form trimeric complexes to function as glutamate transporters [78]. However, Nothmann and colleagues suggested that unlike other EAATs, EAAT3 and EAAT4 can co-assemble into stable heterotrimers in which individual subunits are functionally independent. Moreover, they found that the particular composition of these trimeric glutamate transporters may affect cellular localization. When expressed alone in canine kidney cells, EAAT3 homotrimers were inserted exclusively in the apical membrane. However, when EAAT4 was co-expressed with EAAT3, some of the EAAT3 was trafficked to the basolateral surface and associated with EAAT4 in heterotrimers [79]. Thus, increased EAAT4 in SLC1A1 hemi-deletion carriers might indicate an effort by the cells to replace the nonfunctional (5'-truncated) EAAT3 transporters with EAAT4 in order to keep the number of excitatory glutamate transporter oligomers constant. However, it is quite likely that such a response could also lead to altered localization and functional properties.
Psychotics vs. Non-psychotics within deletion-carriers
Although the number of subjects with the SLC1A1 hemi-deletion in the K3501 pedigree was relatively small, we attempted to gain additional insight into the relevance of the deletion for psychosis by comparing the deletion carriers with and without psychosis in an exploratory fashion. This analysis revealed decreased expression of two glutamate-related genes and increased expression of another.
SLC1A3
Among the hemi-deletion carrier subjects, those who manifested psychosis showed a >3-fold decreased expression of SLC1A3 when compared to the non-psychotic carriers. This gene encodes EAAT1, a glial-enriched high-affinity glutamate/ aspartate transporter, which is the major glutamate transporter in the cerebellum [80], although it is also found at high levels throughout the brain. It is tempting to speculate that along with the hemi-deletion of SLC1A1, the lower expression of SLC1A3 in our psychotic deletion carriers might be involved in the primary pathogenesis of schizophrenia symptoms. Evidence for this speculation stems from studies of the EAAT1-knockout mouse, which shows cerebellar dysfunction as well as behavioral abnormalities that model the positive, negative, and cognitive/ attentional disturbances seen in the disorder [81, 82, 83]. Moreover, reversal of some of these symptoms was seen with either haloperidol or mGlu2/3 agonist administration [82].
SNCA
Alterations in alpha-synuclein (SNCA) sequence and copy number have been very well-described in Parkinson's disease and alpha-synucleinopathies [84, 85, 86, 87, 88]. With regard to the present study, it is particularly interesting to note the common occurrence of psychosis and hallucinations in subjects with amplifications of SNCA [89, 90, 91, 92], as well as the finding that such subjects often display reductions in SNCA mRNA expression. Given these findings, the 2.2-fold decreased expression in SNCA that we detected in deletion-carriers with psychosis might represent a protective mechanism to attenuate the pathologic condition.
GRIK4
The kainate receptor subunit KA1 plays a key role in regulating glutamate transmission in several brain areas implicated in psychosis as well as cognitive and memory functions, including the amygdala, hippocampal formation and entorhinal cortex [93]. Moreover, genome-wide association studies support the role of GRIK4 as a risk factor for schizophrenia as well as bipolar disorder [94, 95]. A deletion variant within GRIK4 that caused increases in its mRNA expression and protein abundance has been found to be associated with a reduced risk of bipolar disorder [95, 96]. Complementing these data, GRIK4-knockout mice demonstrate impairments in pre-pulse inhibition, spatial memory acquisition and recall [97]. Thus, it is possible that the increased expression of KA1 in our psychotic deletion carrier subjects compared to non-psychotic carrier subjects is a compensatory response to reduce psychosis as well as mood disorders.
HEK293 cells under- or overexpressing SLC1A1 mimic some expression changes seen in PBL samples from deletion carriers as well as genes associated with schizophrenia
Our expression data from the HEK293 cells overexpressing the full-length or 5'-truncated forms of SLC1A1 confirmed the highly specific increases in each of these constructs, and confirmed the significant reductions in SLC1A1 seen following treatment with shRNA to model a state of haploinsufficiency. Interestingly, with the artificially increased or decreased expression of SLC1A1, we observed changes in several other genes altered in deletion carriers and also reported to be changed in other studies of subjects with schizophrenia. Space limitations do not allow a full description of all of these expression changes. Nonetheless, we highlight some of the more salient ones. For example, with overexpression of both full-length or 5'-truncated isoforms of SLC1A1, the expression level of the two glial members of this glutamate transporter family, SLC1A2 and SLC1A3 increased as well. These genes encode EAAT2 and EAAT1, respectively, both of which are mainly expressed in the astrocytes in all parts of the brain with EAAT1 enriched in the cerebellum and EAAT2 enriched in the hippocampus [80, 98]. Depending on the brain region examined, the expression level of these genes has been reported as either decreased or increased in schizophrenia. Smith and colleagues detected significantly higher levels of EAAT1 and EAAT2 mRNA expression in the thalamus of subjects with schizophrenia [99], while another group found decreased expression of EAAT1 and EAAT2 proteins in the superior temporal gyrus and decreased EAAT2 protein in the hippocampus in schizophrenia [100].
SLC1A3
The function of EAAT1 and the implications of its reduced expression have been discussed earlier. Similar to what seen in psychotic deletion carriers, the reduced expression of this gene in cells with knockdown of SLC1A1 and its increased expression in cells overexpressing SLC1A1 implicates a strong association between the expression level of these two transporters, one responsible for glutamate uptake on neurons and the other on glial cells. Moreover, since EAAT1-knockout mice exhibit symptoms similar to the positive symptoms of schizophrenia [82], such a strong positive association could exacerbate the psychiatric/ metabolic consequences of the low levels of EAAT3.
SLC1A2
Most of the glutamate uptake in the brain and importantly about 95% of such an uptake in young adult forebrain tissue is accomplished by EAAT2 [101, 102]. It has been shown that the deletion of the EAAT2 causes a synaptic glutamate spillover and has dramatic developmental consequences. Mutations of this gene have been associated with schizophrenia, alcoholism, smoking behavior and bipolar disorder [102]. The higher expression of this gene with the knockdown of SLC1A1 can represent a compensatory mechanism to clear the excess glutamate from the synapses and prevent the glutamate spillover.
SLC7A11
Another glutamate transporter with increased expression in response to SLC1A1 knockdown or overexpression was SLC7A11, which encodes xCT, the light chain subunit of the glutamate/ cystine exchange protein, system xc- (SXC). The main function of the xCT is to provide substrate for the synthesis of glutathione (GSH) in glial cells, a function which is performed by EAAT3 in neurons [103, 104]. GSH is the most abundant antioxidant in the central nervous system, protecting it against oxidative stress. First postulated in the 1930s by Roy Hoskins, the significance of oxidative stress in the pathophysiology of schizophrenia is now well established [12, 105]. It has also been suggested that cells are able to increase SXC expression and activity when increased intracellular redox control is required [106]. Thus, the higher expression of SLC7A11 after knockdown of SLC1A1 might represent a mechanism to maintain GSH concentrations at normal levels and hence protect the cells against oxidative stress.
Another group of genes with significant expression changes encode different subunits of ionotropic (GRIN1, GRIA1 and GRIA2) or metabotropic (GRM3) glutamate receptors, all having been implicated in the pathophysiology of schizophrenia. The importance of functional interaction between glutamate transporters and receptors for normal glutamatergic tone and higher brain functions cannot be overstated. By rapid uptake of glutamate from the synaptic space, glutamate transporters not only supply the neurotransmitter to the nerve terminals and decrease spillover of glutamate and putative excitotoxic processes, they also help regulate the duration and amplitude of excitatory postsynaptic potentials, limit receptor desensitization and control synaptic plasticity [107]. As an example of such an intricate interplay, Cao and colleagues have suggested that EAAT3 is responsible for regulating the plasma membrane trafficking of GluR1 (GRIA1) in hippocampus [108]. Since rapid trafficking of AMPA receptors is known to be a fundamental process in learning and memory, EAAT3 plays a critical role in the biochemical cascade of such cognitive functions. Thus, disruption of its normal interplay with glutamate receptors can be one of the mechanisms by which decreased or increased expression of SLC1A1 can increase the risk of psychosis.
Finally, we observed changes in expression of several GABA-related genes in the HEK293 studies (e.g., GABBR1, GABRA4, GABRG2, DLX1). These changes generally followed the direction of change that was introduced to SLC1A1 (i.e., reduced in the SLC1A1 knockdown samples, increased in the SLC1A1 overexpression samples). These observations lend further support the coupling of GABA and glutamate systems and underpin previous reports that imbalances in excitatory/ inhibitory signaling have potential profound consequences for normal cognition and higher brain functions. In fact, there is abundant evidence that abnormal GABAergic activity contributes to the pathology of schizophrenia [109]. As a suggested mechanism, reduced NMDA receptor activity on inhibitory GABAergic interneurons leads to disinhibition of the glutamatergic input from the basolateral nucleus of the amygdala to the hippocampus, increasing synaptic activity of glutamate which in turn leads to excitotoxicity [2, 110, 111]. Thus, reducing glutamate neurotransmission through a modulatory mechanism such as agonism of GRM2 and GRM3 which are inhibitory presynaptic glutamate autoreceptors can be a potential therapeutic approach that might correct for the decreased GABAergic activation. On the other hand, the DLX family of homeobox transcription factors are necessary for GABAergic neuron differentiation, migration, and survival [112, 113, 114, 115]. The changes in DLX1 expression that we observed in HEK293 cells following alteration of SLC1A1 expression suggest that a hypofunctional SLC1A1 allele might affect GABAergic neuron proliferation and development. Interestingly, mice lacking the DLX1 gene have been shown to exhibit postnatal subtype-specific loss of GABA interneurons and specific behavioral abnormalities consistent with models of schizophrenia [116], further supporting the involvement of GABAergic systems in the pathophysiology of this disorder.
CONCLUSIONS
In summary, although CNVs in SLC1A1 may be rare, they appear to be of large effect size. Our recently discovered hemi-deletion affecting SLC1A1 maintains an alternative promoter region which enables the expression of a 5'-truncated form of EAAT3. However, the protein that might be expressed from such a locus lacks normal cell surface expression and the ability to transport glutamate, although it does not appear to act in a dominant negative manner and affect expression from the other intact allele. Interestingly, however, the presence of the hemi-deleted allele does alter expression of many genes related to GABA and glutamate signaling, potentially in a compensatory manner. Cell culture studies following knockdown of SLC1A1 or overexpression of either a 5-truncated form of EAAT3 or wildtype EAAT3 produced changes in some of the same genes altered in the human subjects with the hemi-deletion, and also revealed several strong biological relationships between many genes implicated in pathophysiology of schizophrenia. Overall, the present study adds to the growing literature strongly implicating glutamatergic dysfunction in schizophrenia, and may help explain some of the phenotypes reported with the knock out of this gene. Future studies will be needed to formally address the impact of the specific hemi-deletion we identified on redox state, neuroinflammation and glutamatergic signaling in the intact brain as well as its behavioral relevance. The data we have presented suggest that SCZD18 may represent one of many glutamatergic pathways that could lead to psychosis either directly or in combination with other genetic and environmental factors. Clearly, this report represents merely a first step toward characterizing the full biological consequences of alterations in the SLC1A1 gene.
Supplementary Material
Acknowledgments
This study was supported by NIH grants MH080373 and MH096257 and a Brain and Behavior Research Foundation NARSAD Award. We are also grateful to the Palauan community members who participated in this research, as well as K. Gentile, B. Devlin, K. Roeder and N. Melhem for their assistance with the CNV mapping.
Footnotes
CONFLICTS OF INTEREST
The authors have no conflicts of interest to report.
References
- 1.Sarnyai Z, Jashar C, Olivier B. Modeling combined schizophrenia-related behavioral and metabolic phenotypes in rodents. Behav Brain Res. 2015;276:130–142. doi: 10.1016/j.bbr.2014.04.016. [DOI] [PubMed] [Google Scholar]
- 2.Coyle JT. Glutamate and Schizophrenia: Beyond the Dopamine Hypothesis. Cell Mol Neurobiol. 2006;26(4–6):363–382. doi: 10.1007/s10571-006-9062-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Kantrowitz J, Javitt DC. Glutamatergic transmission in schizophrenia: from basic research to clinical practice. Curr Opin Psychiatry. 2012;25(2):96–102. doi: 10.1097/YCO.0b013e32835035b2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Jones AL, Mowry BJ, Pender MP, Greer JM. Immune dysregulation and self-reactivity in schizophrenia: do some cases of schizophrenia have an autoimmune basis? Immunol Cell Biol. 2005;83(1):9–17. doi: 10.1111/j.1440-1711.2005.01305.x. [DOI] [PubMed] [Google Scholar]
- 5.Ezeoke A, Mellor A, Buckley P, Miller B. A systematic, quantitative review of blood autoantibodies in schizophrenia. Schizophr Res. 2013;150(1):245–251. doi: 10.1016/j.schres.2013.07.029. [DOI] [PubMed] [Google Scholar]
- 6.Sperner-Unterweger B, Fuchs D. Schizophrenia and psychoneuroimmunology: an integrative view. Curr Opin Psychiatry. 2015;28(3):201–206. doi: 10.1097/YCO.0000000000000153. [DOI] [PubMed] [Google Scholar]
- 7.Upthegrove R, Manzanares-Teson N, Barnes NM. Cytokine function in medication-naive first episode psychosis: a systematic review and meta-analysis. Schizophr Res. 2014;155(1–3):101–108. doi: 10.1016/j.schres.2014.03.005. [DOI] [PubMed] [Google Scholar]
- 8.Nielsen J, Røge R, Pristed SG, Viuff AG, Ullum H, Thørner LW, Werge T, Vang T. Soluble urokinase-type plasminogen activator receptor levels in patients with schizophrenia. Schizophr Bull. 2015;41(3):764–771. doi: 10.1093/schbul/sbu118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Doorduin J, de Vries EF, Willemsen AT, de Groot JC, Dierckx RA, Klein HC. Neuroinflammation in schizophrenia-related psychosis: a PET study. J Nucl Med. 2009;50(11):1801–1807. doi: 10.2967/jnumed.109.066647. [DOI] [PubMed] [Google Scholar]
- 10.Sommer IE, van Westrhenen R, Begemann MJ, de Witte LD, Leucht S, Kahn RS. Efficacy of anti-inflammatory agents to improve symptoms in patients with schizophrenia: an update. Schizophr Bull. 2014;40(1):181–191. doi: 10.1093/schbul/sbt139. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Bumb JM, Enning F, Leweke FM. Drug repurposing and emerging adjunctive treatments for schizophrenia. Expert Opin Pharmacother. 2015;16(7):1049–1067. doi: 10.1517/14656566.2015.1032248. [DOI] [PubMed] [Google Scholar]
- 12.Steullet P, Cabungcal JH, Monin A, Dwir D, O'Donnell P, Cuenod M, Do KQ. Redox dysregulation, neuroinflammation, and NMDA receptor hypofunction: A “central hub” in schizophrenia pathophysiology? Schizophr Res. 2014 doi: 10.1016/j.schres.2014.06.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Myles-Worsley M, Tiobech J, Browning SR, Korn J, Goodman S, Gentile K, Melhem N, Byerley W, Faraone SV, Middleton FA. Deletion at the SLC1A1 glutamate transporter gene co-segregates with schizophrenia and bipolar schizoaffective disorder in a 5-generation family. Am J Med Genet B Neuropsychiatr Genet. 2013;162B(2):87–95. doi: 10.1002/ajmg.b.32125. [DOI] [PubMed] [Google Scholar]
- 14.Kanai Y, Bhide PG, DiFiglia M, Hediger MA. Neuronal high-affinity glutamate transport in the rat central nervous system. Neuroreport. 1995;6(17):2357–2362. doi: 10.1097/00001756-199511270-00020. [DOI] [PubMed] [Google Scholar]
- 15.Scimemi A, Tian H, Diamond JS. Neuronal transporters regulate glutamate clearance, NMDA receptor activation, and synaptic plasticity in the hippocampus. J Neurosci. 2009;29(46):14581–14595. doi: 10.1523/JNEUROSCI.4845-09.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Aoyama K, Suh SW, Hamby AM, Liu J, Chan WY, Chen Y, Swanson RA. Neuronal glutathione deficiency and age-dependent neurodegeneration in the EAAC1 deficient mouse. Nat Neurosci. 2006;9(1):119–126. doi: 10.1038/nn1609. [DOI] [PubMed] [Google Scholar]
- 17.Robert SM, Ogunrinu-Babarinde T, Holt KT, Sontheimer H. Role of Glutamate Transporters in Redox Homeostasis of the Brain. Neurochem Int. 2014;73:181–191. doi: 10.1016/j.neuint.2014.01.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Stewart LR, Hall AL, Kang SH, Shaw CA, Beaudet AL. High frequency of known copy number abnormalities and maternal duplication 15q11-q13 in patients with combined schizophrenia and epilepsy. BMC Med Genet. 2011;12:154. doi: 10.1186/1471-2350-12-154. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Horiuchi Y, Iida S, Koga M, Ishiguro H, Iijima Y, Inada T, Watanabe Y, Someya T, Ujike H, Iwata N, Ozaki N, Kunugi H, Tochigi M, Itokawa M, Arai M, Niizato K, Iritani S, Kakita A, Takahashi H, Nawa H, Arinami T. Association of SNPs linked to increased expression of SLC1A1 with schizophrenia. Am J Med Genet B Neuropsychiatr Genet. 2012;159B(1):30–37. doi: 10.1002/ajmg.b.31249. [DOI] [PubMed] [Google Scholar]
- 20.Priebe L, Degenhardt F, Strohmaier J, Breuer R, Herms S, Witt SH, Hoffmann P, Kulbida R, Mattheisen M, Moebus S, Meyer-Lindenberg A, Walter H, Mössner R, Nenadic I, Sauer H, Rujescu D, Maier W, Rietschel M, Nöthen MM, Cichon S. Copy Number Variants in German Patients with Schizophrenia. PLoS One. 2013;8(7) doi: 10.1371/journal.pone.0064035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Costain G, Lionel AC, Fu F, Stavropoulos DJ, Gazzellone MJ, Marshall CR, Scherer SW, Bassett AS. Adult neuropsychiatric expression and familial segregation of 2q13 duplications. Am J Med Genet B Neuropsychiatr Genet. 2014;165B(4):337–344. doi: 10.1002/ajmg.b.32236. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Costain G, Lionel AC, Merico D, Forsythe P, Russell K, Lowther C, Yuen T, Husted J, Stavropoulos DJ, Speevak M, Chow EW, Marshall CR, Scherer SW, Bassett AS. Pathogenic rare copy number variants in community-based schizophrenia suggest a potential role for clinical microarrays. Hum Mol Genet. 2013;22(22):4485–4501. doi: 10.1093/hmg/ddt297. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Rees E, Walters JT, Chambert KD, O'Dushlaine C, Szatkiewicz J, Richards AL, Georgieva L, Mahoney-Davies G, Legge SE, Moran JL, Genovese G, Levinson D, Morris DW, Cormican P, Kendler KS, O'Neill FA, Riley B, Gill M, Corvin A, Sklar P, Hultman C, Pato C, Pato M, Sullivan PF, Gejman PV, McCarroll SA, O'Donovan MC, Owen MJ, Kirov G Wellcome Trust Case Control Consortium. CNV analysis in a large schizophrenia sample implicates deletions at 16p12.1 and SLC1A1 and duplications at 1p36. 33 and CGNL1. Hum Mol Genet. 2014;23(6):1669–1676. doi: 10.1093/hmg/ddt540. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.McCullumsmith RE, Meador-Woodruff JH. Striatal Excitatory Amino Acid Transporter Transcript Expression in Schizophrenia, Bipolar Disorder, and Major Depressive Disorder. Neuropsychopharmacology. 2002;26(3):368–375. doi: 10.1016/S0893-133X(01)00370-0. [DOI] [PubMed] [Google Scholar]
- 25.Nudmamud-Thanoi S, Piyabhan P, Harte MK, Cahir M, Reynolds GP. Deficits of neuronal glutamatergic markers in the caudate nucleus in schizophrenia. J Neural Transm Suppl. 2007;(72):281–285. doi: 10.1007/978-3-211-73574-9_34. [DOI] [PubMed] [Google Scholar]
- 26.Cao L, Li L, Zuo Z. N-acetylcysteine reverses existing cognitive impairment and increased oxidative stress in glutamate transporter type 3 deficient mice. Neuroscience. 2012;220:85–89. doi: 10.1016/j.neuroscience.2012.06.044. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Lee S, Park SH, Zuo Z. Effects of isoflurane on learning and memory functions of wild-type and glutamate transporter type 3 knockout mice. J Pharm Pharmacol. 2012;64(2):302–307. doi: 10.1111/j.2042-7158.2011.01404.x. [DOI] [PubMed] [Google Scholar]
- 28.Li L, Zuo Z. Glutamate transporter type 3 knockout reduces brain tolerance to focal brain ischemia in mice. J Cereb Blood Flow Metab. 2011;31(5):1283–1292. doi: 10.1038/jcbfm.2010.222. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Berk M, Malhi GS, Gray LJ, Dean OM. The promise of N-acetylcysteine in neuropsychiatry. Trends Pharmacol Sci. 2013;34(3):167–177. doi: 10.1016/j.tips.2013.01.001. [DOI] [PubMed] [Google Scholar]
- 30.Melhem N, Middleton F, McFadden K, Klei L, Faraone SV, Vinogradov S, Tiobech J, Yano V, Kuartei S, Roeder K, Byerley W, Devlin B, Myles-Worsley M. Copy number variants for schizophrenia and related psychotic disorders in Oceanic Palau: risk and transmission in extended pedigrees. Biol Psychiatry. 2011;70(12):1115–1121. doi: 10.1016/j.biopsych.2011.08.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Shashidharan P, Huntley GW, Murray JM, Buku A, Moran T, Walsh MJ, Morrison JH, Plaitakis A. Immunohistochemical localization of the neuron-specific glutamate transporter EAAC1 (EAAT3) in rat brain and spinal cord revealed by a novel monoclonal antibody. Brain Res. 1997;773(1–2):139–148. doi: 10.1016/s0006-8993(97)00921-9. [DOI] [PubMed] [Google Scholar]
- 32.Holmseth S, Dehnes Y, Huang YH, Follin-Arbelet VV, Grutle NJ, Mylonakou MN, Plachez C, Zhou Y, Furness DN, Bergles DE, Lehre KP, Danbolt NC. The density of EAAC1 (EAAT3) glutamate transporters expressed by neurons in the mammalian CNS. J Neurosci. 2012;32(17):6000–6013. doi: 10.1523/JNEUROSCI.5347-11.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Eyles DW, Smith S, Kinobe R, Hewison M, McGrath JJ. Distribution of the vitamin D receptor and 1 alpha-hydroxylase in human brain. J Chem Neuroanat. 2005;29(1):21–30. doi: 10.1016/j.jchemneu.2004.08.006. [DOI] [PubMed] [Google Scholar]
- 34.Kliewer SA, Umesono K, Mangelsdorf DJ, Evans RM. Retinoid X receptor interacts with nuclear receptors in retinoic acid, thyroid hormone and vitamin D3 signalling. Nature. 1992;355(6359):446–449. doi: 10.1038/355446a0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Eyles DW, Burne TH, McGrath JJ. Vitamin D, effects on brain development, adult brain function and the links between low levels of vitamin D and neuropsychiatric disease. Front Neuroendocrinol. 2013;34(1):47–64. doi: 10.1016/j.yfrne.2012.07.001. [DOI] [PubMed] [Google Scholar]
- 36.Valipour G, Saneei P, Esmaillzadeh A. Serum vitamin D levels in relation to schizophrenia: a systematic review and meta-analysis of observational studies. J Clin Endocrinol Metab. 2014;99(10):3863–3872. doi: 10.1210/jc.2014-1887. [DOI] [PubMed] [Google Scholar]
- 37.Graham KA, Keefe RS, Lieberman JA, Calikoglu AS, Lansing KM, Perkins DO. Relationship of low vitamin D status with positive, negative and cognitive symptom domains in people with first-episode schizophrenia. Early Interv Psychiatry. 2014 doi: 10.1111/eip.12122. [DOI] [PubMed] [Google Scholar]
- 38.McGrath J, Saari K, Hakko H, Jokelainen J, Jones P, Järvelin MR, Chant D, Isohanni M. Vitamin D supplementation during the first year of life and risk of schizophrenia: a Finnish birth cohort study. Schizophr Res. 2004;67(2–3):237–245. doi: 10.1016/j.schres.2003.08.005. [DOI] [PubMed] [Google Scholar]
- 39.Turner KM, Young JW, McGrath JJ, Eyles DW, Burne TH. Cognitive performance and response inhibition in developmentally vitamin D (DVD)-deficient rats. Behav Brain Res. 2013;242:47–53. doi: 10.1016/j.bbr.2012.12.029. [DOI] [PubMed] [Google Scholar]
- 40.Kesby JP, Cui X, Burne TH, Eyles DW. Altered dopamine ontogeny in the developmentally vitamin D deficient rat and its relevance to schizophrenia. Front Cell Neurosci. 2013;7:111. doi: 10.3389/fncel.2013.00111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Simmons KM, Beaudin SG, Narvaez CJ, Welsh J. Gene Signatures of 1,25-Dihydroxyvitamin D Exposure in Normal and Transformed Mammary Cells. J Cell Biochem. 2015 doi: 10.1002/jcb.25129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Stafford MM, Brown MN, Mishra P, Stanwood GD, Mathews GC. Glutamate spillover augments GABA synthesis and release from axodendritic synapses in rat hippocampus. Hippocampus. 2010;20(1):134–144. doi: 10.1002/hipo.20600. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Beart PM, O'Shea RD. Transporters for L-glutamate: an update on their molecular pharmacology and pathological involvement. Br J Pharmacol. 2007;150(1):5–17. doi: 10.1038/sj.bjp.0706949. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Fournier KM, González MI, Robinson MB. Rapid trafficking of the neuronal glutamate transporter, EAAC1: evidence for distinct trafficking pathways differentially regulated by protein kinase C and platelet-derived growth factor. J Biol Chem. 2004;279(33):34505–34513. doi: 10.1074/jbc.M404032200. [DOI] [PubMed] [Google Scholar]
- 45.Sheldon AL, González MI, Robinson MB. A carboxyl-terminal determinant of the neuronal glutamate transporter, EAAC1, is required for platelet-derived growth factor-dependent trafficking. J Biol Chem. 2006;281(8):4876–4886. doi: 10.1074/jbc.M504983200. [DOI] [PubMed] [Google Scholar]
- 46.Davis KE, Straff DJ, Weinstein EA, Bannerman PG, Correale DM, Rothstein JD, Robinson MB. Multiple signaling pathways regulate cell surface expression and activity of the excitatory amino acid carrier 1 subtype of Glu transporter in C6 glioma. J Neurosci. 1998;18(7):2475–2485. doi: 10.1523/JNEUROSCI.18-07-02475.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Sims KD, Straff DJ, Robinson MB. Platelet-derived growth factor rapidly increases activity and cell surface expression of the EAAC1 subtype of glutamate transporter through activation of phosphatidylinositol 3-kinase. J Biol Chem. 2000;275(7):5228–5237. doi: 10.1074/jbc.275.7.5228. [DOI] [PubMed] [Google Scholar]
- 48.González MI, Kazanietz MG, Robinson MB. Regulation of the neuronal glutamate transporter excitatory amino acid carrier-1 (EAAC1) by different protein kinase C subtypes. Mol Pharmacol. 2002;62(4):901–910. doi: 10.1124/mol.62.4.901. [DOI] [PubMed] [Google Scholar]
- 49.Levenson J, Weeber E, Selcher JC, Kategaya LS, Sweatt JD, Eskin A. Long-term potentiation and contextual fear conditioning increase neuronal glutamate uptake. Nat Neurosci. 2002;5(2):155–161. doi: 10.1038/nn791. [DOI] [PubMed] [Google Scholar]
- 50.Grewer C, Balani P, Weidenfeller C, Bartusel T, Tao Z, Rauen T. Individual subunits of the glutamate transporter EAAC1 homotrimer function independently of each other. Biochemistry. 2005;44(35):11913–11923. doi: 10.1021/bi050987n. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Leary GP, Stone EF, Holley DC, Kavanaugh MP. The glutamate and chloride permeation pathways are colocalized in individual neuronal glutamate transporter subunits. J Neurosci. 2007;27(11):2938–2942. doi: 10.1523/JNEUROSCI.4851-06.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Rubio MD, Drummond JB, Meador-Woodruff JH. Glutamate receptor abnormalities in schizophrenia: implications for innovative treatments. Biomol Ther (Seoul) 2012;20(1):1–18. doi: 10.4062/biomolther.2012.20.1.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Ulas J, Cotman CW. Excitatory amino acid receptors in schizophrenia. Schizophr Bull. 1993;19(1):105–117. doi: 10.1093/schbul/19.1.105. [DOI] [PubMed] [Google Scholar]
- 54.Javitt DC, Zukin SR. Recent advances in the phencyclidine model of schizophrenia. Am J Psychiatry. 1991;148(10):1301–1308. doi: 10.1176/ajp.148.10.1301. [DOI] [PubMed] [Google Scholar]
- 55.Moghaddam B, Javitt D. From revolution to evolution: the glutamate hypothesis of schizophrenia and its implication for treatment. Neuropsychopharmacology. 2012;37(1):4–15. doi: 10.1038/npp.2011.181. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Dracheva S, Marras SA, Elhakem SL, Kramer FR, Davis KL, Haroutunian V. N-methyl-D-aspartic acid receptor expression in the dorsolateral prefrontal cortex of elderly patients with schizophrenia. Am J Psychiatry. 2001;158(9):1400–1410. doi: 10.1176/appi.ajp.158.9.1400. [DOI] [PubMed] [Google Scholar]
- 57.Beneyto M, Meador-Woodruff JH. Lamina-specific abnormalities of NMDA receptor-associated postsynaptic protein transcripts in the prefrontal cortex in schizophrenia and bipolar disorder. Neuropsychopharmacology. 2008;33(9):2175–2186. doi: 10.1038/sj.npp.1301604. [DOI] [PubMed] [Google Scholar]
- 58.Dalmau J, Tüzün E, Wu HY, Masjuan J, Rossi JE, Voloschin A, Baehring JM, Shimazaki H, Koide R, King D, Mason W, Sansing LH, Dichter MA, Rosenfeld MR, Lynch DR. Paraneoplastic anti-N-methyl-D-aspartate receptor encephalitis associated with ovarian teratoma. Ann Neurol. 2007;61(1):25–36. doi: 10.1002/ana.21050. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Kayser MS, Dalmau J. Anti-NMDA receptor encephalitis, autoimmunity, and psychosis. Schizophr Res. 2014 doi: 10.1016/j.schres.2014.10.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Steiner J, Walter M, Glanz W, Sarnyai Z, Bernstein HG, Vielhaber S, Kästner A, Skalej M, Jordan W, Schiltz K, Klingbeil C, Wandinger KP, Bogerts B, Stoecker W. Increased prevalence of diverse N-methyl-D-aspartate glutamate receptor antibodies in patients with an initial diagnosis of schizophrenia: specific relevance of IgG NR1a antibodies for distinction from N-methyl-D-aspartate glutamate receptor encephalitis. JAMA Psychiatry. 2013;70(3):271–278. doi: 10.1001/2013.jamapsychiatry.86. [DOI] [PubMed] [Google Scholar]
- 61.Coyle JT, Tsai G, Goff DC. Ionotropic glutamate receptors as therapeutic targets in schizophrenia. Curr Drug Targets CNS Neurol Disord. 2002;1(2):183–189. doi: 10.2174/1568007024606212. [DOI] [PubMed] [Google Scholar]
- 62.Gurling HM, Kalsi G, Brynjolfson J, Sigmundsson T, Sherrington R, Mankoo BS, Read T, Murphy P, Blaveri E, McQuillin A, Petursson H, Curtis D. Genomewide genetic linkage analysis confirms the presence of susceptibility loci for schizophrenia, on chromosomes 1q32.2, 5q33.2, and 8p21-22 and provides support for linkage to schizophrenia, on chromosomes 11q23.3-24 and 20q12.1-11. 23. Am J Hum Genet. 2001;68(3):661–673. doi: 10.1086/318788. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Paunio T, Ekelund J, Varilo T, Parker A, Hovatta I, Turunen JA, Rinard K, Foti A, Terwilliger JD, Juvonen H, Suvisaari J, Arajärvi R, Suokas J, Partonen T, Lönnqvist J, Meyer J, Peltonen L. Genome-wide scan in a nationwide study sample of schizophrenia families in Finland reveals susceptibility loci on chromosomes 2q and 5q. Hum Mol Genet. 2001;10(26):3037–3048. doi: 10.1093/hmg/10.26.3037. [DOI] [PubMed] [Google Scholar]
- 64.Sklar P, Pato MT, Kirby A, Petryshen TL, Medeiros H, Carvalho C, Macedo A, Dourado A, Coelho I, Valente J, Soares MJ, Ferreira CP, Lei M, Verner A, Hudson TJ, Morley CP, Kennedy JL, Azevedo MH, Lander E, Daly MJ, Pato CN. Genome-wide scan in Portuguese Island families identifies 5q31-5q35 as a susceptibility locus for schizophrenia and psychosis. Mol Psychiatry. 2004;9(2):213–218. doi: 10.1038/sj.mp.4001418. [DOI] [PubMed] [Google Scholar]
- 65.Ng MY, Levinson DF, Faraone SV, Suarez BK, DeLisi LE, Arinami T, Riley B, Paunio T, Pulver AE, Irmansyah, Holmans PA, Escamilla M, Wildenauer DB, Williams NM, Laurent C, Mowry BJ, Brzustowicz LM, Maziade M, Sklar P, Garver DL, Abecasis GR, Lerer B, Fallin MD, Gurling HM, Gejman PV, Lindholm E, Moises HW, Byerley W, Wijsman EM, Forabosco P, Tsuang MT, Hwu HG, Okazaki Y, Kendler KS, Wormley B, Fanous A, Walsh D, O'Neill FA, Peltonen L, Nestadt G, Lasseter VK, Liang KY, Papadimitriou GM, Dikeos DG, Schwab SG, Owen MJ, O'Donovan MC, Norton N, Hare E, Raventos H, Nicolini H, Albus M, Maier W, Nimgaonkar VL, Terenius L, Mallet J, Jay M, Godard S, Nertney D, Alexander M, Crowe RR, Silverman JM, Bassett AS, Roy MA, Mérette C, Pato CN, Pato MT, Roos JL, Kohn Y, Amann-Zalcenstein D, Kalsi G, McQuillin A, Curtis D, Brynjolfson J, Sigmundsson T, Petursson H, Sanders AR, Duan J, Jazin E, Myles-Worsley M, Karayiorgou M, Lewis CM. Meta-analysis of 32 genome-wide linkage studies of schizophrenia. Mol Psychiatry. 2009;14(8):774–785. doi: 10.1038/mp.2008.135. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Magri C, Gardella R, Barlati SD, Podavini D, Iatropoulos P, Bonomi S, Valsecchi P, Sacchetti E, Barlati S. Glutamate AMPA receptor subunit 1 gene (GRIA1) and DSM-IV-TR schizophrenia: a pilot case-control association study in an Italian sample. Am J Med Genet B Neuropsychiatr Genet. 2006;141B(3):287–293. doi: 10.1002/ajmg.b.30294. [DOI] [PubMed] [Google Scholar]
- 67.Kang WS, Park JK, Kim SK, Park HJ, Lee SM, Song JY, Chung JH, Kim JW. Genetic variants of GRIA1 are associated with susceptibility to schizophrenia in Korean population. Mol Biol Rep. 2012;39(12):10697–10703. doi: 10.1007/s11033-012-1960-x. [DOI] [PubMed] [Google Scholar]
- 68.Ward SE, Pennicott LE, Beswick P. AMPA receptor-positive allosteric modulators for the treatment of schizophrenia: an overview of recent patent applications. Future Med Chem. 2015;7(4):473–491. doi: 10.4155/fmc.15.4. [DOI] [PubMed] [Google Scholar]
- 69.Conn PJ, Pin JP. Pharmacology and functions of metabotropic glutamate receptors. Annu Rev Pharmacol Toxicol. 1997;37:205–237. doi: 10.1146/annurev.pharmtox.37.1.205. [DOI] [PubMed] [Google Scholar]
- 70.Cartmell J, Schoepp DD. Regulation of neurotransmitter release by metabotropic glutamate receptors. J Neurochem. 2000;75(3):889–907. doi: 10.1046/j.1471-4159.2000.0750889.x. [DOI] [PubMed] [Google Scholar]
- 71.Bolonna AA, Kerwin RW, Munro J, Arranz MJ, Makoff AJ. Polymorphisms in the genes for mGluR types 7 and 8: association studies with schizophrenia. Schizophr Res. 2001;47(1):99–103. doi: 10.1016/s0920-9964(99)00235-2. [DOI] [PubMed] [Google Scholar]
- 72.Takaki H, Kikuta R, Shibata H, Ninomiya H, Tashiro N, Fukumaki Y. Positive associations of polymorphisms in the metabotropic glutamate receptor type 8 gene (GRM8) with schizophrenia. Am J Med Genet B Neuropsychiatr Genet. 2004;128B(1):6–14. doi: 10.1002/ajmg.b.20108. [DOI] [PubMed] [Google Scholar]
- 73.Ossowska K, Pietraszek M, Wardas J, Wolfarth S. Potential antipsychotic and extrapyramidal effects of (R,S)-3,4-dicarboxyphenylglycine [(R,S)-3,4-DCPG], a mixed AMPA antagonist/mGluR8 agonist. Pol J Pharmacol. 2004;56(3):295–304. [PubMed] [Google Scholar]
- 74.Robbins MJ, Starr KR, Honey A, Soffin EM, Rourke C, Jones GA, Kelly FM, Strum J, Melarange RA, Harris AJ, Rocheville M, Rupniak T, Murdock PR, Jones DN, Kew JN, Maycox PR. Evaluation of the mGlu8 receptor as a putative therapeutic target in schizophrenia. Brain Res. 2007;1152:215–227. doi: 10.1016/j.brainres.2007.03.028. [DOI] [PubMed] [Google Scholar]
- 75.Linden AM, Johnson BG, Peters SC, Shannon HE, Tian M, Wang Y, Yu JL, Köster A, Baez M, Schoepp DD. Increased anxiety-related behavior in mice deficient for metabotropic glutamate 8 (mGlu8) receptor. Neuropharmacology. 2002;43(2):251–259. doi: 10.1016/s0028-3908(02)00079-5. [DOI] [PubMed] [Google Scholar]
- 76.Gosnell HB, Silberman Y, Grueter BA, Duvoisin RM, Raber J, Winder DG. mGluR8 modulates excitatory transmission in the bed nucleus of the stria terminalis in a stress-dependent manner. Neuropsychopharmacology. 2011;36(8):1599–1607. doi: 10.1038/npp.2011.40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Dehnes Y, Chaudhry FA, Ullensvang K, Lehre KP, Storm-Mathisen J, Danbolt NC. The glutamate transporter EAAT4 in rat cerebellar Purkinje cells: a glutamate-gated chloride channel concentrated near the synapse in parts of the dendritic membrane facing astroglia. J Neurosci. 1998;18(10):3606–3619. doi: 10.1523/JNEUROSCI.18-10-03606.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Gendreau S, Voswinkel S, Torres-Salazar D, Lang N, Heidtmann H, Detro-Dassen S, Schmalzing G, Hidalgo P, Fahlke C. A trimeric quaternary structure is conserved in bacterial and human glutamate transporters. J Biol Chem. 2004;279(38):39505–39512. doi: 10.1074/jbc.M408038200. [DOI] [PubMed] [Google Scholar]
- 79.Nothmann D, Leinenweber A, Torres-Salazar D, Kovermann P, Hotzy J, Gameiro A, Grewer C, Fahlke C. Hetero-oligomerization of neuronal glutamate transporters. J Biol Chem. 2011;286(5):3935–3943. doi: 10.1074/jbc.M110.187492. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Lehre KP, Danbolt NC. The number of glutamate transporter subtype molecules at glutamatergic synapses: chemical and stereological quantification in young adult rat brain. J Neurosci. 1998;18(21):8751–8757. doi: 10.1523/JNEUROSCI.18-21-08751.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Watase K, Hashimoto K, Kano M, Yamada K, Watanabe M, Inoue Y, Okuyama S, Sakagawa T, Ogawa S, Kawashima N, Hori S, Takimoto M, Wada K, Tanaka K. Motor discoordination and increased susceptibility to cerebellar injury in GLAST mutant mice. Eur J Neurosci. 1998;10(3):976–988. doi: 10.1046/j.1460-9568.1998.00108.x. [DOI] [PubMed] [Google Scholar]
- 82.Karlsson RM, Tanaka K, Heilig M, Holmes A. Loss of glial glutamate and aspartate transporter (excitatory amino acid transporter 1) causes locomotor hyperactivity and exaggerated responses to psychotomimetics: rescue by haloperidol and metabotropic glutamate 2/3 agonist. Biol Psychiatry. 2008;64(9):810–814. doi: 10.1016/j.biopsych.2008.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Karlsson RM, Tanaka K, Saksida LM, Bussey TJ, Heilig M, Holmes A. Assessment of glutamate transporter GLAST (EAAT1)-deficient mice for phenotypes relevant to the negative and executive/cognitive symptoms of schizophrenia. Neuropsychopharmacology. 2009;34(6):1578–1589. doi: 10.1038/npp.2008.215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.Polymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A, Dutra A, Pike B, Root H, Rubenstein J, Boyer R, Stenroos ES, Chandrasekharappa S, Athanassiadou A, Papapetropoulos T, Johnson WG, Lazzarini AM, Duvoisin RC, Di Iorio G, Golbe LI, Nussbaum RL. Mutation in the alpha-synuclein gene identified in families with Parkinson's disease. Science. 1997;276(5321):2045–2047. doi: 10.1126/science.276.5321.2045. [DOI] [PubMed] [Google Scholar]
- 85.Singleton AB, Farrer M, Johnson J, Singleton A, Hague S, Kachergus J, Hulihan M, Peuralinna T, Dutra A, Nussbaum R, Lincoln S, Crawley A, Hanson M, Maraganore D, Adler C, Cookson MR, Muenter M, Baptista M, Miller D, Blancato J, Hardy J, Gwinn-Hardy K. alpha-Synuclein locus triplication causes Parkinson's disease. Science. 2003;302(5646):841. doi: 10.1126/science.1090278. [DOI] [PubMed] [Google Scholar]
- 86.Satake W, Nakabayashi Y, Mizuta I, Hirota Y, Ito C, Kubo M, Kawaguchi T, Tsunoda T, Watanabe M, Takeda A, Tomiyama H, Nakashima K, Hasegawa K, Obata F, Yoshikawa T, Kawakami H, Sakoda S, Yamamoto M, Hattori N, Murata M, Nakamura Y, Toda T. Genome-wide association study identifies common variants at four loci as genetic risk factors for Parkinson's disease. Nat Genet. 2009;41(12):1303–1307. doi: 10.1038/ng.485. [DOI] [PubMed] [Google Scholar]
- 87.Mak SK, Tewari D, Tetrud JW, Langston JW, Schüle B. Mitochondrial dysfunction in skin fibroblasts from a Parkinson's disease patient with an alpha-synuclein triplication. J Parkinsons Dis. 2011;1(2):175–183. doi: 10.3233/JPD-2011-11025. [DOI] [PubMed] [Google Scholar]
- 88.Flierl A, Oliveira LM, Falomir-Lockhart LJ, Mak SK, Hesley J, Soldner F, Arndt-Jovin DJ, Jaenisch R, Langston JW, Jovin TM, Schüle B. Higher vulnerability and stress sensitivity of neuronal precursor cells carrying an alpha-synuclein gene triplication. PLoS One. 2014;9(11):e112413. doi: 10.1371/journal.pone.0112413. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 89.Ross OA, Braithwaite AT, Skipper LM, Kachergus J, Hulihan MM, Middleton FA, Nishioka K, Fuchs J, Gasser T, Maraganore DM, Adler CH, Larvor L, Chartier-Harlin MC, Nilsson C, Langston JW, Gwinn K, Hattori N, Farrer MJ. Genomic investigation of alpha-synuclein multiplication and parkinsonism. Ann Neurol. 2008;63(6):743–750. doi: 10.1002/ana.21380. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90.Cummings JL. Toward a molecular neuropsychiatry of neurodegenerative diseases. Ann Neurol. 2003;54(2):147–154. doi: 10.1002/ana.10616. [DOI] [PubMed] [Google Scholar]
- 91.Papapetropoulos S. Regional alpha-synuclein aggregation, dopaminergic dysregulation, and the development of drug-related visual hallucinations in Parkinson's disease. J Neuropsychiatry Clin Neurosci. 2006;18(2):149–157. doi: 10.1176/jnp.2006.18.2.149. [DOI] [PubMed] [Google Scholar]
- 92.Kasten M, Klein C. The many faces of alpha-synuclein mutations. Mov Disord. 2013;28(6):697–701. doi: 10.1002/mds.25499. [DOI] [PubMed] [Google Scholar]
- 93.Chittajallu R, Braithwaite SP, Clarke VR, Henley JM. Kainate receptors: subunits, synaptic localization and function. Trends Pharmacol Sci. 1999;20(1):26–35. doi: 10.1016/s0165-6147(98)01286-3. [DOI] [PubMed] [Google Scholar]
- 94.Pickard BS, Malloy MP, Christoforou A, Thomson PA, Evans KL, Morris SW, Hampson M, Porteous DJ, Blackwood DH, Muir WJ. Cytogenetic and genetic evidence supports a role for the kainate-type glutamate receptor gene, GRIK4, in schizophrenia and bipolar disorder. Mol Psychiatry. 2006;11(9):847–857. doi: 10.1038/sj.mp.4001867. [DOI] [PubMed] [Google Scholar]
- 95.Pickard BS, Knight HM, Hamilton RS, Soares DC, Walker R, Boyd JK, Machell J, Maclean A, McGhee KA, Condie A, Porteous DJ, St Clair D, Davis I, Blackwood DH, Muir WJ. A common variant in the 3'UTR of the GRIK4 glutamate receptor gene affects transcript abundance and protects against bipolar disorder. Proc Natl Acad Sci U S A. 2008;105(39):14940–14945. doi: 10.1073/pnas.0800643105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 96.Knight HM, Walker R, James R, Porteous DJ, Muir WJ, Blackwood DH, Pickard BS. GRIK4/KA1 protein expression in human brain and correlation with bipolar disorder risk variant status. Am J Med Genet B Neuropsychiatr Genet. 2012;159B(1):21–29. doi: 10.1002/ajmg.b.31248. [DOI] [PubMed] [Google Scholar]
- 97.Lowry ER, Kruyer A, Norris EH, Cederroth CR, Strickland S. The GluK4 kainate receptor subunit regulates memory, mood, and excitotoxic neurodegeneration. Neuroscience. 2013;235:215–225. doi: 10.1016/j.neuroscience.2013.01.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 98.Lehre KP, Levy LM, Ottersen OP, Storm-Mathisen J, Danbolt NC. Differential expression of two glial glutamate transporters in the rat brain: quantitative and immunocytochemical observations. J Neurosci. 1995;15(3 Pt 1):1835–1853. doi: 10.1523/JNEUROSCI.15-03-01835.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 99.Smith RE, Haroutunian V, Davis KL, Meador-Woodruff JH. Expression of Excitatory Amino Acid Transporter Transcripts in the Thalamus of Subjects With Schizophrenia. Am J Psychiatry. 2001;158(9):1393–1399. doi: 10.1176/appi.ajp.158.9.1393. [DOI] [PubMed] [Google Scholar]
- 100.Shan D, Lucas EK, Drummond JB, Haroutunian V, Meador-Woodruff JH, McCullumsmith RE. Abnormal expression of glutamate transporters in temporal lobe areas in elderly patients with schizophrenia. Schizophr Res. 2013;144(1–3):1–8. doi: 10.1016/j.schres.2012.12.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 101.Danbolt NC, Storm-Mathisen J, Kanner BI. An [Na+ + K+]coupled L-glutamate transporter purified from rat brain is located in glial cell processes. Neuroscience. 1992;51(2):295–310. doi: 10.1016/0306-4522(92)90316-t. [DOI] [PubMed] [Google Scholar]
- 102.Zhou Y, Danbolt NC. GABA and Glutamate Transporters in Brain. Front Endocrinol (Lausanne) 2013;4:165. doi: 10.3389/fendo.2013.00165. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 103.Bannai S, Kitamura E. Transport interaction of L-cystine and L-glutamate in human diploid fibroblasts in culture. J Biol Chem. 1980;255(6):2372–2376. [PubMed] [Google Scholar]
- 104.Aoyama K, Watabe M, Nakaki T. Regulation of Neuronal Glutathione Synthesis. J Pharmacol Sci. 2008;108(3):227–238. doi: 10.1254/jphs.08r01cr. [DOI] [PubMed] [Google Scholar]
- 105.Emiliani FE, Sedlak TW, Sawa A. Oxidative stress and schizophrenia: recent breakthroughs from an old story. Curr Opin Psychiatry. 2014;27(3):185–190. doi: 10.1097/YCO.0000000000000054. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 106.Deneke SM, Fanburg BL. Regulation of cellular glutathione. Am J Physiol. 1989;257(4 Pt 1):163–173. doi: 10.1152/ajplung.1989.257.4.L163. [DOI] [PubMed] [Google Scholar]
- 107.Nieoullon A, Canolle B, Masmejean F, Guillet B, Pisano P, Lortet S. The neuronal excitatory amino acid transporter EAAC1/EAAT3: does it represent a major actor at the brain excitatory synapse? J Neurochem. 2006;98(4):1007–1018. doi: 10.1111/j.1471-4159.2006.03978.x. [DOI] [PubMed] [Google Scholar]
- 108.Cao J, Tan H, Mi W, Zuo Z. Glutamate transporter type 3 regulates mouse hippocampal GluR1 trafficking. Biochim Biophys Acta. 2014;1840(6):1640–1645. doi: 10.1016/j.bbagen.2014.01.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 109.Benes FM. Building models for postmortem abnormalities in hippocampus of schizophrenics. Schizophr Res. 2015 doi: 10.1016/j.schres.2015.01.014. [DOI] [PubMed] [Google Scholar]
- 110.Berretta S, Lange N, Bhattacharyya S, Sebro R, Garces J, Benes FM. Long-term effects of amygdala GABA receptor blockade on specific subpopulations of hippocampal interneurons. Hippocampus. 2004;14(7):876–894. doi: 10.1002/hipo.20002. [DOI] [PubMed] [Google Scholar]
- 111.Gisabella B, Bolshakov VY, Benes FM. Regulation of synaptic plasticity in a schizophrenia model. Proc Natl Acad Sci U S A. 2005;102(37):13301–13306. doi: 10.1073/pnas.0506034102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 112.Anderson S, Mione M, Yun K, Rubenstein JL. Differential origins of neocortical projection and local circuit neurons: role of Dlx genes in neocortical interneuronogenesis. Cereb Cortex. 1999;9(6):646–654. doi: 10.1093/cercor/9.6.646. [DOI] [PubMed] [Google Scholar]
- 113.Stühmer T, Anderson SA, Ekker M, Rubenstein JL. Ectopic expression of the Dlx genes induces glutamic acid decarboxylase and Dlx expression. Development. 2002;129(1):245–252. doi: 10.1242/dev.129.1.245. [DOI] [PubMed] [Google Scholar]
- 114.Long JE, Garel S, Alvarez-Dolado M, Yoshikawa K, Osumi N, Alvarez-Buylla A, Rubenstein JL. Dlx-dependent and -independent regulation of olfactory bulb interneuron differentiation. J Neurosci. 2007;27(12):3230–3243. doi: 10.1523/JNEUROSCI.5265-06.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 115.Long JE, Swan C, Liang WS, Cobos I, Potter GB, Rubenstein JL. Dlx1&2 and Mash1 transcription factors control striatal patterning and differentiation through parallel and overlapping pathways. J Comp Neurol. 2009;512(4):556–572. doi: 10.1002/cne.21854. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 116.Mao R, Page DT, Merzlyak I, Kim C, Tecott LH, Janak PH, Rubenstein JL, Sur M. Reduced conditioned fear response in mice that lack Dlx1 and show subtype-specific loss of interneurons. J Neurodev Disord. 2009;1(3):224–236. doi: 10.1007/s11689-009-9025-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.






