Skip to main content
PMC home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2009 Nov 1.
Published in final edited form as: Diagn Microbiol Infect Dis. 2008 Aug 20;62(3):272–279. doi: 10.1016/j.diagmicrobio.2008.07.004

A duplex real-time RT-PCR assay for the detection of St. Louis encephalitis and Eastern equine encephalitis viruses

Rene Hull 1, Seela Nattanmai 1,†, Laura D Kramer 1,2, Kristen A Bernard 1,2, Norma P Tavakoli 1,2,*
PMCID: PMC2615585  NIHMSID: NIHMS77772  PMID: 18715737

Abstract

A duplex TaqMan real-time RT-PCR assay was developed for the detection of St. Louis encephalitis virus (SLEV) and Eastern equine encephalitis virus (EEEV), for use in human and vector surveillance. The respective targets selected for the assay were the conserved NS5 and E1 genes of the two viruses. Due to the insufficient number of NS5 sequences from SLEV strains in the GenBank database, we determined the sequence of an approximately 1-kb region for each of 25 strains of SLEV in order to select primers and probes in a conserved region. Our assay has a sensitivity of 5 gene copies/reaction for EEEV and 10 gene copies/reaction for SLEV, and it’s performance is linear over at least 6 log10 gene copies. The assay is specific and detected all strains of SLEV (69) and EEEV (12) that were tested. An internal control ensures detection of efficient nucleic acid extraction and possible PCR inhibition.

Keywords: molecular detection, real-time RT-PCR, Saint Louis encephalitis virus, Eastern equine encephalitis virus

1. Introduction

Eastern equine encephalitis virus (EEEV) is an arthropod-borne virus belonging to the genus Alphavirus in the family Togaviridae. The virus is transmitted by mosquitoes to equines, birds, and humans and causes a febrile disease (including encephalitis) with a significant frequency of fatal outcomes. With an overall case fatality rate of approximately 36% (Deresiewicz et al., 1997), it is the most severe of the arboviral encephalitides. EEEV is a spherical, enveloped virus with an 11.5-kb genome consisting of single-stranded, positive-sense RNA. The 5′ end of the alphavirus genome encodes for the nonstructural proteins (NSP1-4), and the 3′ end of the genome encodes for the structural proteins (core and envelope proteins). The E1 and E2 proteins, virally encoded surface glycoproteins, are the target of numerous serological reactions and tests. The E2 protein is the site of most of the neutralizing epitopes (Roehrig, 1986), and the E1 protein contains more conserved, cross-reactive epitopes (Dalrymple et al., 1976; Wolcott et al., 1984). Apart from the six C-terminal codons, the E1 gene is largely conserved among alphaviruses (Powers et al., 2001), although there is sufficient diversity to allow selection of primers and probes that are specific for the EEEV genome.

St. Louis encephalitis virus (SLEV) is also an arthropod-borne virus. This virus belongs to the Japanese encephalitis virus serocomplex within the genus Flavivirus of the family Flaviviridae. SLEV is endemic in the United States and circulates in a transmission cycle involving Culex mosquitoes and passerine birds (Tsai and Mitchell, 1989), with humans and other vertebrates as incidental hosts. Clinical disease caused by SLEV infection can vary from mild symptoms, including febrile illness and headache, to severe disease, including meningitis and encephalitis. Reports of case fatalities range from 5 to 20% (Tsai and Mitchell, 1989) although the numbers are higher still among the elderly population. The virus has a single-stranded positive-sense RNA genome of approximately 11-kb. The 5′ end of the viral genome consists of genes for the structural proteins, and the 3′ end consists of genes for the non-structural proteins. The NS5 gene encodes the RNA-dependent RNA polymerase, which is reported as being the most highly conserved of the flavivirus nonstructural proteins (Iacono-Connors et al., 1992; Scaramozzino et al., 2001).

Serology is the gold standard for diagnostic testing of arboviruses. However, serological tests have certain limitations; cross-reactivity of flaviviral antibodies is problematic in immunoglobulin M (IgM) capture enzyme-linked immunosorbent assays (MAC-ELISA), and plaque reduction neutralization is time-consuming, cumbersome and requires biosafety level 3 (BSL-3) containment (Calisher, 1994; Russell and Dwyer, 2000; Martin et al., 2004). The traditional method of virus isolation also has the latter limitations and in addition, since the period of viremia is generally short, the likelihood of obtaining an isolate is low (Calisher, 1994). RT-PCR is a rapid and sensitive method that is being used increasingly as an adjunct to serology for the diagnosis of arboviruses. Case in point is the wide-spread use of PCR for the detection of West Nile virus (WNV) (Lanciotti and Kerst, 2001; Briese et al., 2000).

Our aim was to develop a duplex TaqMan real-time RT-PCR assay for the detection of EEEV and SLEV, to test cerebrospinal fluid specimens from patients suspected of having arboviral encephalitis. Since there was not sufficient sequence information on the NS5 region of SLEV strains available in the GenBank database, we determined the sequence of an approximately 1-kb region of the NS5 gene for each of 25 strains. Primers and probes were then selected from conserved sequences in this region.

2. Materials and methods

2.1 Viruses and controls

In order to construct a positive control for the EEEV assay, conventional RT-PCR was performed using primers EEE-E1-F and EEE-E1-R (Table 1) targeting EEEV strain 69-7836 (a 1969 isolate from New York State). The resultant 146-bp fragment of the E1 gene of EEEV was cloned into the PCR-Blunt II-TOPO plasmid (Invitrogen, Carlsbad, CA). The plasmid (pNT21) was linearized and used to transcribe a control RNA transcript containing the real-time RT-PCR target sequence, utilizing the T7 RiboMax Large Scale RNA Production System (Promega, Madison, WI). The transcript RNAs were subjected to two rounds of DNase I digestion and were purified by phenol-chloroform extraction and sepharose chromatography. The purified transcript was quantified by measurement of the absorbance at 260 nm. Ten-fold serial dilutions of genomic EEEV strain 69-7836 viral RNA and the transcript were made, and real-time RT-PCR was performed. A standard curve was constructed, allowing quantitation of the genomic viral RNA. Conventional RT-PCR was performed using primers SLE-NS5-F1 and SLE-NS5-R1 (Table 1) targeting SLEV strain MSI-7. A plasmid (pNT26) was constructed that contained the 63-bp NS5 target fragment as described above. The SLEV transcript was made and quantified and, using this transcript, genomic RNA was quantified as described above.

Table 1.

Primers and probes used in real-time RT-PCR assays for SLEV and EEEV and for internal control detection and for PCR and sequencing of the NS5 region of genomes of SLEV strains.

Name of primer or probe Sequence (5′ → 3′) Nucleotide start Reference
EEE-E1-F ACACTAAATTCACCCTAGTTCGAT 11,376 This study
EEE-E1-R GTGTATAAAATTACTTAGGAGCAGCATTATG 11,522 This study
EEE-E1-Fam 6- FAM-CGAGCTATGGTGACGGTGGTGCA–BHQ1 11,407 This study
SLE-NS5-F1 GGTGGTTCGGGAGCCCTT 8,678 This study
SLE-NS5-F2 GGTGGTTCGGGAGCCTTT 8,678 This study
SLE-NS5-R2 CACGCCTTTTGGCCAACAA 8,616 This study
SLE-NS5-R3 CACGCCTTTTGGTCAACAA 8,616 This study
SLE-NS5-Vic1 VIC-CAACCTTTTCTTTGAACACC-MGB 8,656 This study
SLE-NS5-Vic2 VIC-CAACCTTTTCTTTGAAGACC-MGB 8,656 This study
GFP forward primer CACCCTCTCCACTGACAGAAAAT 549 Tavakoli et al., 2007
GFP reverse primer TTTCACTGGAGTTGTCCCAATTC 470 Tavakoli et al., 2007
GFP probe 6-FAM-TGTGCCCATTAACATCACCATCTAATTCAACA-TAMRA 525 Tavakoli et al., 2007
FG1 TCAAGGAACTCCACACATGAGATGTACT 8,206 Fulop et al., 1993
FG2 GTGTCCCATCCTGCTGTGTCATCAGCATACA 9,167 Fulop et al., 1993
Seq-1-F GGAACTATCATGGAAGTTATGAAG 8,486 This study
Seq-1-R TTGCTTTGAATTCTTCTGGGG 8,782 This study
Seq-2-F CTGGCTGTGGGACTTCG 8,715 This study
Seq-2-R GGTCTGGCTTCTCTGTGAGC 8,398 This study
Seq-3-F CCCCAGAAGAATTCAAAGCAAAGG 8,762 This study
Seq-3-R GGCTTCTCTGTGAGCTTTCC 8,393 This study
Seq-4-F CTGGTTGTGGGACTTTGTTGC 8,715 This study
Open in a new tab

EEE, Eastern equine encephalitis; SLE, St. Louis encephalitis; GFP, green fluorescent protein; 6-FAM, 6-carboxyfluorescein; BHQ1, black hole quencher; MGB, minor groove binder; TAMRA, 6-carboxy-tetramethyl-rhodamine. EEEV sequence is from GenBank accession EF568607 (EEEV strain NJ/60). SLEV sequence is from GenBank accession EF158050 (SLEV MSI-7). Nucleotide numbers are given based on the genome of MSI-7 but not all primers perfectly match this strain. GFP sequence is from GenBank accession EU341596 (cloning vector pGFPm-T).

EEEV and SLEV cultures were amplified in African green monkey kidney (Vero) cell cultures in a BSL-3 facility. Since EEEV is a CDC Select Agent (SA), the virus and RNA were handled by SA-approved personnel only, in a BSL-3 lab with controlled access, certified under protocol number C2005 0318-0344. Powered air purifying respirators (PAPRs) were worn at all times when personnel were working with infectious EEEV.

Sixty-nine SLEV strains were cultured in Vero cells (Table 2). Sixty-six of these strains were received by the Arbovirus Laboratory from the World Reference Center of Emerging Viruses and Arboviruses at the University of Texas Medical Branch in Galveston, Texas.

Table 2.

SLEV strains used in this study.

Strain Name Acc. Id. Strain Name Acc. Id. Strain Name Acc. Id.
GML 902612 EF158064 BFS 508 N/A 798-55 N/A
PAN AR 902745 EU076713 Fort Washington N/A BeAn 208331 N/A
TNM-4-711K EF158065 BeAn 421498 N/A BeAn 211991 N/A
GHA-3 EF158066 BeAn 423728 N/A BeAn 212371 N/A
BeAn 247377 EF158067 BE H 203235 N/A TD6-4G N/A
BeAr 23379 EF158048 BFN 1324 N/A P17787 N/A
904.3 EF158049 Hubbard N/A L69-5121.05 N/A
CorAn 9275 EF158068 BeAn 261207 N/A TEX 16017 N/A
72 V 4749 EF158069 GML 902613 N/A TEX M6 N/A
MSI-7 EF158050 GML 902981 N/A VP 34 N/A
Parton EF158070 GML 902984 N/A TH 4-9f N/A
65 V 310 EF158059 GML 902991 N/A Texas 1955 N/A
GML 903797 EF158060 GML 903050 N/A TEX 1198 N/A
GMO 94 EF158051 BV7 (GML 900968) N/A VP 7 N/A
CorAn 9124 EF158063 75256 PG3 N/A 3082=B32 N/A
V 2380-42 EF158052 2088 N/A 2785=B37 N/A
BeAn 246262 EF158053 2234 N/A M04 (U0476) N/A
75 D 90 EF158054 6943 STL N/A GML 903369 N/A
69 M 1143 EF158061 61V 2416 N/A V 4285 (M 59) N/A
TBH 28 EF158055 68V 1587 N/A
TRVL 9464 EF158056 BeAn 421297 N/A
78 A 28 EF158057 75V 14868 N/A
FL 79-411 EF158062 BeAn 401517 N/A
Kern-217 EF158058 75V 6507 N/A
CoAv 608 EU099355 75V 2533 N/A
Open in a new tab

N/A, sequence information in the NS5 region was not available for this strain in the GenBank database; Acc. Id., GenBank accession identification number.

Genomic copy numbers of cell culture-propagated EEEV and SLEV genomic RNAs were determined from a standard curve produced from the assay of 10-fold dilutions of purified and quantified EEEV and SLEV RNA transcripts. The RNA from the cell culture-propagated EEEV and SLEV and the RNA transcripts were assayed with the EEEV E1 and SLEV NS5 primer and probe sets (Table 1). We quantified genomic SLEV and EEEV RNA by performing real-time RT-PCR on serial dilutions of transcript and genomic RNAs and then constructing a standard curve, using serial dilutions of quantified transcript RNA as standards. In addition, a no RT control was performed at a high transcript RNA concentration in order to ensure that the bulk of the DNA had been digested.

EEEV RNA transcript (500 gene copies/reaction) was used as the positive control. The advantage of using RNA transcript rather than genomic RNA as the positive control is that the RNA transcript, unlike the genomic EEEV RNA, can be handled in a BSL-2 laboratory that is not SA-certified, by non SA-approved personnel; diagnostic testing for EEEV is generally performed in BSL-2 facilities. Genomic MSI-7 RNA (1,100 gene copies/reaction) was used as the positive control for the SLEV assay.

As an internal nucleic acid extraction control, and for detection of potential PCR inhibition, each clinical specimen was spiked, during the lysis step of the extraction process, with a known quantity of green fluorescent protein (GFP) RNA transcript (2,200 gc/ul). After completion of the extraction, a 1/10 dilution of the extracted nucleic acid was analyzed by a one-step real-time RT-PCR with a primer and probe set specific for GFP (Table 1). A positive result, with a Ct value falling within the defined range (34–38), from the GFP assay confirmed the successful extraction of nucleic acid.

SARS coronavirus Urbani strain was obtained from the CDC, cytomegalovirus (CMV) DNA (0.01 μg/μl) was purchased from Sigma-Aldrich (St. Louis, MO), and adenovirus and human herpes virus 6 (HHV-6) DNA were obtained from ATCC (Manassas, VA). Virus suspensions of Coxsackievirus A9 (Cox A9), Coxsackievirus B12 (Cox B12), echovirus 9 (Echo 9), human coronavirus 229E (HCoV 229E), human metapneumovirus (hMPV), influenza A-H1 virus (FluA H1), influenza A-H3 virus FluA H3), influenza B virus (FluB), respiratory syncytial virus (RSV), human rhinovirus (HRV), Epstein Barr virus (EBV), herpes simplex viruses (HSV) 1 and 2, and varicella zoster virus (VZV) were obtained from the Proficiency Testing Laboratory and Virus Reference and Surveillance Laboratory at the Wadsworth Center. Dengue virus serotypes 1–4 (DENV1-4), Western equine encephalomyelitis (WEE) virus, Highlands J virus, WNV, Murray Valley encephalitis (MVE) virus (MK6684), Japanese encephalitis (JE) virus (Nakayama-NIH), yellow fever (YF) virus (YF 17D), Powassan (POW) virus 64-7062 (representative of POW virus lineage I) and DT-SPO (representative of POW virus lineage II) were obtained from the Arbovirus Laboratory at the Wadsworth Center. Bacterial cultures of Corynebacterium xerosis, Group A Streptococcus, Haemophilus influenzae, Haemophilus parainfluenzae, Neisseria meningitidis groups B, C, and Y, Neisseria subflava, Streptococcus sanguis, and Steptococcus pneumoniae serotypes 10A, 11A and 18F were obtained from the Bacteriology Department at the Wadsworth Center.

2.2 Nucleic Acid Extraction

Nucleic acid was extracted from specimens using the NucliSens miniMAG or easyMAG system (bioMerieux, Durham, NC). Two hundred and fifty microliters of each specimen were added to 2 ml of lysis buffer. Five microliters of GFP transcript (2,100 gene copies/μl) were spiked into the lysed sample. Following miniMAG or easyMAG extraction, the nucleic acid was eluted in 50 or 55 μl of elution buffer, respectively.

2.3 Real-Time RT-PCR

Real-time RT-PCR for the detection of SLEV and EEEV viruses was performed using primers and probe developed in-house (Table 1). The EEEV probe was labeled with the reporter 6-carboxyfluorescein [6-FAM] at the 5′ end and a black hole quencher [BHQ1] (Operon, Huntsville, AL) at the 3′end. The two SLE probes were each labeled with the reporter VIC™ at the 5′ end and a minor groove binder [MGB] (Applied Biosystems, Foster City, CA) at the 3′ end. Amplification was carried out in a 25-μl volume reaction using the SuperScript III Platinum One-Step Quantitative RT-PCR System (Invitrogen, Carlsbad, CA), 0.5 μl of 5× ROX reference dye, 400 nM each of four SLEV primers, 500 nM each of two EEEV primers, 75 nM each of two SLEV probes, and 200 nM EEEV probe. The reactions were incubated at 48° C for 30 min, followed by 95° C for 10 min, 45 cycles of 95°C for 15 sec, and 60°C for 1 min. A separate real-time RT-PCR for the detection of GFP was performed with the primers and probes listed in Table 1. The GFP probe was labeled with the reporter 6-carboxyfluorescein [6-FAM] at the 5′ end and the quencher 6-carboxy-tetramethyl-rhodamine [TAMRA] at the 3′end. The reaction consisted of universal buffer (Applied Biosystems, Foster City, CA), the forward and reverse primers at 900 nM each, and 250 nM probe (Tavakoli et al., 2007). The reaction conditions were as above. PCR reactions were performed using an ABI 7500 instrument.

2.4 PCR and sequence determination of SLEV strains

Nucleic acid from SLEV cultures was extracted with the MasterPure™ Complete DNA and RNA Purification Kit (Epicentre Biotechnologies, Madison, WI). RNA was transcribed to cDNA with the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA). PCR to amplify a portion of the NS5 region of SLEV was performed essentially as reported previously (Fulop et al., 1993; Table 1), except that an initial incubation time of 95°C for 15 min was used to activate the HotStar Taq polymerase (Qiagen, Valencia, CA). PCR products were analyzed by agarose gel electrophoresis and were stained by ethidium bromide. The PCR products, which were approximately 958-bp in size, were extracted from the gel and spun through an Ultrafree-DA Filter Device (Millipore, Billerica, MA). Sequencing reactions of the PCR products were performed with multiple primers shown in Table 1. The concentration of each primer was 3.2 pmol, and sequencing reactions were performed at the Wadsworth Center Molecular Genetics Core facility on an automated DNA sequencer Model 3100 (Applied Biosystems, Foster City, CA). The obtained sequences were submitted to the GenBank database (see Table 2 for accession numbers).

3. Results

Sequence information was obtained for approximately 950-bp of the NS5 gene from each of 25 different strains of SLEV (Table 2). The sequences were aligned with the MEGA 4 software (Tamura et al., 2007). Regions that showed minimal sequence variation were chosen as candidate regions for primer/probe target selection. The same process was repeated for the E1 region from sequences from multiple strains of EEEV found in the GenBank database. Primers and probes were selected with the Primer Express software (Applied Biosystems, Foster City, CA) (Table 1). For detection of the maximum number of SLE strains, we selected two forward primers, two reverse primers and two probes, since we were unable to find one set of primers and probe that were 100% homologous with all strains. Each of the forward primers, reverse primers, and probes had 1 mismatch.

Because of the SA status of EEEV, a positive control for the assay was constructed that could be used in a BSL-2 laboratory by non-SA approved personnel, thereby facilitating the assay’s diagnostic application. The control was an RNA transcript containing a 146-bp portion of the envelope-coding gene of EEEV. This control was also used for the quantification of genomic EEEV RNA. The SLEV transcript which was used for the quantification of SLEV genomic RNA was prepared from a recombinant plasmid containing a 63-bp portion of the NS5-coding gene of SLEV strain MSI-7.

After construction and quantification of the controls for the assay, various real-time PCR kits from several manufacturers were evaluated for the optimization of our duplex assay. These were: TaqMan One-Step RT-PCR kit (Applied Biosystems, Foster City, CA), BioRad iScript One-Step RT-PCR kit for Probes (Bio-Rad, Laboratories, Hercules, CA), FailSafe Probes Real-Time PCR Optimization kit (Epicentre, Biotechnologies, Madison, WI), SuperScript III Platinum One-Step Quantitative RT-PCR System (Invitrogen, Carlsbad, CA), Quantitect Multiplex PCR kit (Qiagen, Valencia, CA), Quantitect Probe RT-PCR kit (Qiagen, Valencia, CA) and LightCycler FastStart DNA Master Hybridization Probes kit (F. Hoffmann-La Roche, Nutley, NJ). Because the SuperScript III Platinum One-Step Quantitative RT-PCR System presented a combination of the lowest Ct and highest ΔRn values (data not shown), we optimized the assay using this kit.

Primer optimization was performed with primer concentrations ranging from 100 to 1000 nM, and probe optimization was performed with probe concentrations ranging from 50 to 400 nM. For a TaqMan assay, optimal performance is achieved by selecting primer/probe concentrations that provide the lowest Ct and the highest ΔRn for a fixed amount of target template (Cirino et al., 2007). The Ct and ΔRn data taken together show that the optimal SLEV primer concentrations were 400 nM each, and the optimal SLEV probe concentrations were 75 nM each. Optimal EEEV primer concentrations were 500 nM each, while the optimal EEEV probe concentration was 200 nM.

Serial dilutions of the SLEV and EEEV transcripts were made, and the duplex real-time RT-PCR assay was performed. The assay can detect a range between 5 and 5 × 106 gene copies of EEEV, and a range between 10 and 3 × 106 gene copies for SLEV. We were consistently able to detect 5 gene copies of EEEV target (performed 12 times) and 10 gene copies of SLEV target (performed 14 times). The assay range and sensitivity of the duplex assay when compared to the SLE and EEE assays performed separately as singleplex assays gave similar results indicating that there is no negative interference between the primer probe sets of the two assays (data not shown).

In order to determine the specificity of the assay, we performed the assay using high concentrations (for each virus approximately 106 gene copies) of nucleic acid from the following organisms: Cox A9, Cox B12, Echo 9, HCoV 229E, hMPV, FluA H1, FluA H3, FluB, RSV, HRV, SARS coronavirus, adenovirus, CMV, EBV, HHV-6, HSV 1 and 2, VZV, WEE virus, Highlands J virus, DENV1-4, POW virus (representatives of lineage I and II), WNV, YF virus, MVE virus, JE virus, Corynebacterium xerosis, Group A Streptococcus, Haemophilus influenzae, Haemophilus parainfluenzae, Neisseria meningitidis groups B, C, and Y, Neisseria subflava, Streptococcus sanguis, and Steptococcus pneumoniae serotypes 10A, 11A and 18F. No cross-reactivity was observed between the EEEV and SLEV primer/probe sets and any of the organisms selected in the specificity panel. PCR results for the panel were all negative; therefore, the assay was specific upon testing a wide range of pathogens.

EEEV is the sole species in the EEEV antigenic complex and is divided into North American and South American antigenic varieties based on hemagglutination inhibition tests. On the basis of nucleotide sequencing and serological tests, including plaque reduction neutralization tests, four major lineages/clusters (clusters 1–4) with distinct antigenic subtypes have been identified (Brault et al., 1999). Serial dilutions were made of the RNA from representatives of each cluster (Table 3). We then performed the singleplex real-time RT-PCR assay for the detection of EEEV on various RNA dilutions in order to determine whether nucleic acid from the 12 different strains would be amplified by the real-time RT-PCR reaction. Real-time RT-PCR was performed on the various nucleic acid dilutions in a BSL-3 laboratory. Results showed that all 12 strains were detected and amplified by the EEEV primer/probe set.

Table 3.

EEEV strains used in this study.

Strain (Acc. Id.) Year and State of isolation Classification
39030199 2003, New York Cluster 1
04002727 2004, New York Cluster 1
US03-1974v1 2003, New Jersey Cluster 2
US03-1977v1 2003, New Jersey Cluster 2
04002073 2004, New York Cluster 3
US02-4341v1 2002, Florida Cluster 3
36040401 2004, New York Cluster 4
US03-2767 unknown Cluster 4
NY69-7836 (EF594003) 1969, New York NC
36030127 2003, New York NC
EEE71-20686 (EF594005) 1971, New York NC
EEE74-39100 (EF594015) 1974, New York NC
Open in a new tab

Acc. Id., Accession identification numbers from the GenBank database are presented in parentheses where available; NC, not classified.

Nucleic acid was extracted from each strain of amplified SLEV, and dilutions were made and tested in the duplex real-time RT-PCR assay. All strains were detected and amplified. Since we were unable to obtain patient specimens that were positive for either SLEV or EEEV, we spiked SLEV culture and EEEV transcript, at each of three dilutions, into negative cerebrospinal fluid (CSF) specimens. Appropriate dilutions of SLEV strain MSI-7 culture were made to obtain the high (9.9 × 103 gc/250 μl CSF equivalent to 9,000 gc/reaction), medium (990 gc/250 μl CSF equivalent to 90 gc/reaction), and low (99 gc/250 μl CSF equivalent to 9 gc/reaction) concentrations. Similarly, a range of nucleic acid concentrations that included high (5.5 × 103 gc/250 μl CSF equivalent to 5,000 gc/reaction), medium (5.5 × 102 gc/250 μl CSF equivalent to 500 gc/reaction), and low (550 gc/250 μl CSF equivalent to 50 gc/reaction) were selected for the EEEV transcript. These dilutions were then spiked into CSF that had previously tested negative for EEEV and SLEV. Forty negative samples, were either not spiked or spiked with one of three concentrations of SLEV culture, or of EEEV transcript in various combinations (Table 4). All 40 blinded samples were also spiked with a known amount of GFP RNA transcript (2,200 gc/μl), which acts as the internal control. RNA was extracted from the specimens using the NucliSens easyMAG system. GFP was then detected in the sample via real-time RT-PCR in order to determine extraction efficiency and the presence of inhibitors (Table 4).

Table 4.

Average Ct values obtained when the EEEV, SLEV and GFP real-time RT-PCR assays were performed on extracts of cerebrospinal fluid specimens spiked with SLEV culture and EEEV transcript.

Sample Virus/transcript spike Average Ct for viral assay Ct range for viral assay CV for viral assay Average Ct for GFP assay Ct range for GFP assay CV for GFP assay
NTC – ≥45 ≥45 – ≥45 0 ≥45 ≥45 – ≥45 0
EEEV spike
Negative ≥45 ≥45 – ≥45 0 35.01 34.89 – 35.11 0.2%
Low 39.22 37.55 – 41.3 2.85% 35.30 34.87 – 35.87 0.97%
Medium 36.41 35.44 – 38.81 2.47% 35.65 34.92 – 38.66 3.04%
High 32.21 31.57 – 32.62 0.83% 35.52 34.92 – 35.97 1.09%
SLEV spike
Negative ≥45 ≥45 – ≥45 0 35.21 34.87 – 35.87 0.98%
Low 39.62 38.04 – 41.75 2.44% 35.27 34.92 – 35.97 1.09%
Medium 34.07 33.48 – 34.78 0.75% 35.27 34.96 – 35.69 0.77%
High 29.67 29.39 – 30.08 0.63% 35.73 34.95 – 38.66 3.02%
Open in a new tab

NTC, no template control; the high, medium and low spikes for SLEV were 9000, 90, 9 gene copies/reaction respectively; the high, medium and low spikes for EEEV were 5000, 500, 50 gene copies/reaction respectively. The average numbers are from 10 assays performed in duplicate for virus detection and performed singly for GFP detection.

For each of the blinded samples, the high, medium, and low gene copy samples could all be detected indicating minimal loss in sensitivity following nucleic acid extraction (Table 4). All of the negative extraction controls had Ct values of >45, indicating that false positives were not detected, and that no cross contamination had occurred during extraction of the samples. Also, all real-time RT-PCR experiments included positive EEEV (500 gc/reaction) and SLEV (1,100 gc/reaction) controls. Both EEEV and SLEV positive controls gave Ct values within the acceptable ranges for each (29–32 and 31–34 respectively). The Ct values for GFP for all the samples were within the acceptable range (34–38), with the exception of one sample (Table 4, sample with Ct of 38.66) which showed slight inhibition. The EEEV-spike and SLEV-spike were both detected for this sample. In general, if a clinical specimen showed a higher than acceptable GFP Ct value, the recommendation would be to repeat the extraction and real-time RT-PCR.

In a separate experiment, 30 different negative CSF specimens were spiked with one of three concentrations of EEEV culture (5 × 104, 5 × 103, 5 × 102 gc/250 μl CSF equivalent to 5,000, 500, and 50 gc/reaction). Following nucleic acid extraction with an internal GFP control, we performed real-time RT-PCR for the detection of EEEV. In addition, we performed the singleplex real-time RT-PCR assay for the detection of EEEV on RNA extracts from five uninfected mosquito pools and on RNA extracts from five EEEV-infected mosquito pools (log10 pfu ranging from 0.4 to 4.4/0.1 ml). The assay correctly identified all specimens, showing that it is suitable for use on vector specimens as well as viral culture.

4. Discussion

Human infections by SLEV and EEEV are relatively rare although EEEV infection of equines occurs regularly. Nevertheless, severe morbidity and mortality associated with these two arboviruses make them important public health concerns. The surveillance of virologic activity in natural hosts, as well as of disease in humans and horses, is essential for early detection of outbreaks and implementation of vector control measures. Molecular detection by RT-PCR is an ideal method for detection of these viruses in hosts, since it is rapid, sensitive, specific, reproducible, and amenable to automation. RT-PCR has been used for the detection of arboviruses at the group level (Sanchez-Seco et al., 2001; Bronzoni et al., 2004; Scaramozzino et al., 2001; Pfeffer et al., 1997) and for specific detection of individual arboviruses (O’Guinn et al., 2004; Lee et al., 2002; Linssen et al., 2000; Lambert et al., 2003; Lanciotti and Kerste, 2001), as well as for a sequential detection at both levels (Bronzoni et al., 2005).

In terms of geographic distribution, EEEV is found mainly in the eastern half of the United States, with most transmissions occurring near freshwater hardwood swamps in states along the Atlantic seaboard and the Gulf Coast, and in the Great Lakes region. Between 1964 and 2004, the greatest numbers of human cases in the U.S. occurred in Florida, Georgia, Massachusetts, and New Jersey (http://www.cdc.gov/ncidod/dvbid/arbor/eeefact.htm). SLEV in contrast, is found throughout the 48 contiguous states, but periodic epidemics have only been documented in the Midwest and the Southeastern U.S. (including Florida) (http://www.cdc.gov/ncidod/dvbid/sle/index.html; Wells et al., 1990). A molecular assay that detects both SLEV and EEEV thus has considerable application for patients suspected of having arboviral encephalitis who reside in these areas, as well as travelers who could have come into contact with infected mosquitoes.

We report the development of a duplex TaqMan real-time RT-PCR assay for the detection of SLEV and EEEV. The targets for the PCR assay are sited within conserved regions of the genome; namely, the E1 gene of EEEV and the NS5 gene of SLEV. The assay is intended for patient CSF samples but can easily be used for vector surveillance. We found the optimal PCR kit for this assay to be the SuperScript III Platinum One-Step Quantitative RT-PCR System. The linear assay range is 5 to 5 × 106 gc/reaction for EEEV, and 10 to 3 × 106 gc/reaction for SLEV. The sensitivity of the assay is 5 gc/reaction for EEEV and 10 gc/reaction for SLEV. The assay is specific, in that the primers and probes did not cross-react with any of the organisms in the specificity panel that we used. The assay detected all of the strains of SLEV (69 strains) and EEEV (12 strains) that we tested. We compared our assay to a previously published real-time TaqMan RT-PCR assay for the detection of SLEV which targets the envelope gene (Lanciotti and Kerst, 2001). Although the two assays were similar in sensitivity and specificity, the previously published assay did not detect all SLEV strains; four of the 69 SLEV strains in Table 2 (CorAn 9275, CorAn 9124, GML 903797, and GML 903369) were not detected (data not shown). This is not surprising, given that the primers and probe had multiple mismatches when aligned with the genome sequence of these strains; as many as 10 mismatches in total occurred for each of strains CorAn 9275 and CorAn 9124. In our SLEV assay, the primers and probes were selected to enable the detection of a greater variety of strains by targeting the conserved NS5 region.

The spiking experiments in patient CSF specimens show that our extraction procedure is efficient, i.e. there is little loss of virus or internal control during the process, and that the assay correctly identifies the EEEV or SLEV genome present in the specimen. In addition, many of the samples had both viruses present; in some cases at high concentration. Nevertheless, detection of both viral genomes occurred just as efficiently as if there was no competitor virus present (Table 4), indicating that neither assay was inhibited.

The use of the GFP internal control ensures that an extraction and PCR inhibition control are included in the assay. It should be noted, that in our experience, after having tested well over 1,000 CSF specimens, CSF specimens rarely (<1%) exhibit significant PCR inhibition whereas a larger number of plasma and serum specimens show inhibition. We would therefore recommend that if plasma or serum specimens are tested, the nucleic acid extracts from the specimens are not diluted prior to performing the GFP real-time RT-PCR assay in order to detect inhibition more accurately since the pre-dilution may overcome some of the inhibitory effect.

Our data show that the duplex assay is highly specific, reproducible, and sensitive; furthermore, with a turn-around time of approximately 5 hr (including the nucleic acid extraction step), it is a rapid method of detecting EEEV and SLEV RNA in patient samples. Additionally, it is suitable for high-throughput approaches useful in surveillance activities.

Acknowledgments

This publication was supported in part by the National Institute of Allergy and Infectious Diseases (NIAID), National Institutes of Health contract #N01-A1-25490, and by Cooperative Agreement Number U01/CI000311 from the Centers for Disease Control and Prevention (CDC). Its contents are solely the responsibility of the authors and do not necessarily represent the official views of CDC.

The authors thank the Arbovirus Laboratory staff at Wadsworth Center for arbovirus cultures, Dr. Robert Tesh and the World Reference Center for Emerging Viruses and Arboviruses at the University of Texas Medical Branch in Galveston for SLE virus cultures, and the Virology Proficiency Testing, and Virus Reference and Surveillance Laboratories and Bacteriology Department at the Wadsworth Center for viral and bacterial cultures used in the specificity panel. The authors also thank the Molecular Genetics Core at the Wadsworth Center for performing the sequencing reactions.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Brault AC, Powers AM, Chavez CLV, Lopez RN, Cachon MF, Gutierrez LFL, Kang W, Tesh RB, Shope RE, Weaver SC. Genetic and antigenic diversity among Eastern equine encephalitis viruses from North, Central and South America. Am J Trop Med Hyg. 1999;61:579–586. doi: 10.4269/ajtmh.1999.61.579. [DOI] [PubMed] [Google Scholar]
  2. Briese T, Glass WG, Lipkin WI. Detection of West Nile virus sequences in cerebrospinal fluid. Lancet. 2000;355:1614–1615. doi: 10.1016/s0140-6736(00)02220-0. [DOI] [PubMed] [Google Scholar]
  3. Bronzoni RVM, Baleotti FG, Nogueira RMR, Nunes M, Figueiredo LTM. Duplex reverse transcription-PCR followed by nested PCR assays for detection and identification of Brazilian alphaviruses and flaviviruses. J Clin Micro. 2005;43:696–702. doi: 10.1128/JCM.43.2.696-702.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bronzoni RVM, Moreli ML, Cruz ACR, Figueiredo LTM. Multiplex nested PCR for Brazilian alphavirus diagnosis. Trans R Soc Trop Med Hyg. 2004;98:456–461. doi: 10.1016/j.trstmh.2003.09.002. [DOI] [PubMed] [Google Scholar]
  5. Calisher CH. Medically important arboviruses of the United States and Canada. Clin Micro Rev. 1994;7:89–116. doi: 10.1128/cmr.7.1.89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cirino N, Tavakoli NP, Madison-Antenucci S, Egan C. Real-time multiplex PCR. In: McKay IM, editor. Real-time PCR in Microbioloy: from diagnosis to characterization. Norfolk, UK: Horizon Scientific Press; 2007. pp. 183–229. [Google Scholar]
  7. Dalrymple JM, Schlesinger S, Russell PK. Antigenic characterization of two Sindbis envelope glycoproteins separated by isoelectric focusing. Virology. 1976;69:93–103. doi: 10.1016/0042-6822(76)90197-5. [DOI] [PubMed] [Google Scholar]
  8. Deresiewicz RL, Thaler SJ, Hsu L, Zamani AA. Clinical and neuroradiographic manifestations of eastern equine encephalitis. N Eng J Med. 1997;336:1867–1874. doi: 10.1056/NEJM199706263362604. [DOI] [PubMed] [Google Scholar]
  9. Fulop L, Barret ADT, Phillpotts R, Martin K, Leslie D, Titbal R. Rapid identification of flaviviruses based on conserved NS5 gene sequences. J Virol Methods. 1993;44:179–188. doi: 10.1016/0166-0934(93)90053-t. [DOI] [PubMed] [Google Scholar]
  10. Iacono-Connors LC, Schmaljohn CS. Cloning and sequence analysis of the genes encoding the non-structural proteins of Langat virus and comparative analysis with other flaviviruses. Virology. 1992;188:875–880. doi: 10.1016/0042-6822(92)90545-z. [DOI] [PubMed] [Google Scholar]
  11. Lambert AJ, Martin DA, Lanciotti RS. Detection of North American Eastern and Western equine encephalitis viruses by nucleic acid amplification assays. J Clin Micro. 2003;41:379–385. doi: 10.1128/JCM.41.1.379-385.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Lanciotti RS, Kerst AJ. Nucleic acid sequence-based amplification assays for rapid detection of West Nile virus and St. Louis encephalitis viruses. J Clin Micro. 2001;39:4506–4513. doi: 10.1128/JCM.39.12.4506-4513.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Lee J-H, Tennessen K, Lilley BG, Unnasch TR. Simultaneous detection of three mosquito-borne encephalitis viruses (Eastern equine, La Crosse, and St. Louis) with single-tube multiplex reverse transcriptase polymerase chain reaction assay. J Am Mosq Control Assoc. 2002;18:26–31. [PubMed] [Google Scholar]
  14. Linssen B, Kinney RM, Aguilar P, Russell KL, Watts DM, Kaaden O-R, Pfeffer M. Development of reverse transcription-PCR assays specific for detection of equine encephalitis viruses. J Clin Micro. 2000;38:1527–1535. doi: 10.1128/jcm.38.4.1527-1535.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Martin DA, Noga A, Kosoy O, Johnson AJ, Petersen LR, Lanciotti RS. Evaluation of a diagnostic algorithm using immunoglobulin M enzyme-linked immunosorbent assay to differentiate human West Nile virus and St. Louis encephalitis virus infections during the 2002 West Nile virus epidemic in the United States. Clin Diagn Lab Immunol. 2004;11:1130–1133. doi: 10.1128/CDLI.11.6.1130-1133.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. O’Guinn ML, Lee JS, Kondig JP, Fernandez R, Carbajal F. Field detection of Eastern equine encephalitis virus in the Amazon Basin region of Peru using reverse transcription-polymerase chain reaction adapted for field identification of arthropod-borne pathogens. Am J Trop Med Hyg. 2004;70:164–171. [PubMed] [Google Scholar]
  17. Pfeffer M, Proebster B, Kinney RM, Kaaden O-R. Genus-specific detection of alphaviruses by a semi-nested reverse transcription-polymerase chain reaction. Am J Trop Med Hyg. 1997;57:709–718. doi: 10.4269/ajtmh.1997.57.709. [DOI] [PubMed] [Google Scholar]
  18. Powers AM, Brault AC, Shirako Y, Strauss EG, Kang W, Strauss JH, Weaver SC. Evolutionary relationships and systematics of the alphaviruses. J Virol. 2001;75:10118–10131. doi: 10.1128/JVI.75.21.10118-10131.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Roehrig GT. The use of monoclonal antibodies in studies of the structural proteins of togaviruses and flaviviruses. In: Schlesinger MJ, Schlesinger S, editors. The Togaviridae and Flaviviridae. New York: Plenum press; 1986. pp. 251–278. [Google Scholar]
  20. Russell RC, Dwyer DE. Arboviruses associated with human disease in Australia. Microb Infect. 2000;2:1693–1704. doi: 10.1016/s1286-4579(00)01324-1. [DOI] [PubMed] [Google Scholar]
  21. Sanchez-Seco MP, Rosario D, Quiroz E, Guzman G, Tenorio A. A generic nested-RT-PCR followed by sequencing for detection and identification of members of the alphavirus genus. J Virol Methods. 2001;95:153–161. doi: 10.1016/s0166-0934(01)00306-8. [DOI] [PubMed] [Google Scholar]
  22. Scaramozzino N, Crance J-M, Jouan A, DeBriel DA, Stoll F, Garin D. Comparison of flavivirus primer pairs and development of a rapid, highly sensitive reverse transcription-PCR assay for detection of flavivirus targeted to a conserved region of the NS5 gene sequences. J Clin Microbiol. 2001;39:1922–1927. doi: 10.1128/JCM.39.5.1922-1927.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24:1596–1599. doi: 10.1093/molbev/msm092. [DOI] [PubMed] [Google Scholar]
  24. Tavakoli NP, Nattanmai S, Hull R, Fusco H, Dzigua L, Wang H, Dupuis M. Detection and typing of human herpes virus 6 by molecular methods in specimens from patients diagnosed with encephalitis/meningitis. J Clin Microbiol. 2007;45:3972–3978. doi: 10.1128/JCM.01692-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Tsai TF, Mitchell CJ. St. Louis encephalitis. In: Monath TP, editor. The arboviruses: epidemiology and ecology. Vol. 4. Boca Raton, FL: CRC Press; 1989. pp. 113–143. [Google Scholar]
  26. Wells DL, Buff E, Lewis AL, Calder RA. Epidemiologic Notes and Reports Update: Arboviral Surveillance -- Florida, 1990. Mor Mortal Wkly Rep. 1990;39:650–651. [PubMed] [Google Scholar]
  27. Wolcott JA, Wust CJ, Brown A. Identification of immunologically cross-reactive proteins of Sindbis virus: evidence for unique conformation of E1 glycoprotein from infected cells. J Virol. 1984;49:379–385. doi: 10.1128/jvi.49.2.379-385.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES