Skip to main content
PMC home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2010 Mar 4.
Published in final edited form as: J Neurosci. 2009 Mar 4;29(9):2948–2960. doi: 10.1523/JNEUROSCI.4424-08.2009

PSD-95 Uncouples Dopamine-Glutamate Interaction in the D1/PSD-95/NMDA Receptor Complex

Jingping Zhang 1, Tai-Xiang Xu 1, Penelope J Hallett 2, Masahiko Watanabe 3, Seth G N Grant 4, Ole Isacson 2, Wei-Dong Yao 1
PMCID: PMC2693913  NIHMSID: NIHMS82731  PMID: 19261890

Abstract

Classical dopaminergic signaling paradigms and emerging studies on direct physical interactions between the D1 dopamine (DA) receptor and the N-Methyl-D-Aspartate (NMDA) glutamate receptor predict a reciprocally facilitating, positive feedback loop. This loop, if not controlled, may cause concomitant overactivation of both D1 and NMDA receptors, triggering neurotoxicity. Endogenous protective mechanisms must exist. Here we show that PSD-95, a prototypical structural and signaling scaffold in the postsynaptic density, inhibits D1-NMDA receptor association and uncouples NMDA receptor-dependent enhancement of D1 signaling. This uncoupling is achieved, at least in part, via a disinhibition mechanism by which PSD-95 abolishes NMDA receptor-dependent inhibition of D1 internalization. Knockdown of PSD-95 immobilizes D1 receptors on the cell surface and escalates NMDA receptor-dependent D1 cAMP signaling in neurons. Thus, in addition to its role in receptor stabilization and synaptic plasticity, PSD-95 acts as a brake on the D1-NMDA receptor complex and dampens the interaction between them.

Keywords: Dopamine D1 receptor, NMDA receptor, synaptic scaffold, cAMP, trafficking, dendritic spine

Introduction

Dopaminergic and glutamatergic axon terminals converge onto the same dendritic spines of dopamineceptive neurons in DA target regions, forming "synaptic triads” (Freund et al., 1984; Goldman-Rakic et al., 1989; Carr and Sesack 1996; Yao et al., 2008). This triadic heterosynaptic architecture provides a structural basis for a close interplay between DA and glutamate systems, which is essential for many cognitive and motivational processes (Berke and Hyman, 2000; Schultz, 2002). A balanced DA-glutamate interaction is, to a large degree, mediated by the functional crosstalk between D1, the predominant subtype of the D1-class receptors and the NMDA glutamate receptor in postsynaptic neurons. These receptors co-localize extensively at synaptic, parasynaptic and nonsynaptic sites in dendritic spines and shafts (Hara and Pickel, 2005; Pickel et al., 2006). Under a classical scheme, D1 positively couples to Gαs to stimulate adenylate cyclases, increases the production of cAMP, and activates protein kinase A (PKA) (Lachowicz and Sibley, 1997; Missale et al., 1998), leading to increased phosphorylation and potentiation of NMDA receptors. In striatal neurons, activation of PKA also phosphorylates DARPP-32 (DA- and cAMP–regulated phosphoprotein of 32 kD) on Thr-34, which potently inhibits its substrate, protein phosphatase 1 (PP1), resulting in increased phosphorylation of NMDA receptors (Greengard et al., 1999). Finally, D1 activation also induces rapid trafficking of NMDA receptors from intracellular pools to the postsynaptic membrane via a tyrosine kinase signaling mechanism (Dunah et al., 2001). These distinct mechanisms all lead to an enhancement of NMDA receptor function.

Recent studies, however, reveal that NMDA receptors also reciprocally regulate D1 activity via direct physical coupling. The D1 receptor interacts with the NMDA receptor subunits 1 (NR1) through the carboxyl tails of these receptors (Lee et al., 2002; Fiorentini et al., 2003; Pei et al., 2004). Association with NMDA receptors facilitates D1 trafficking to the cell surface and inhibits agonist-induced D1 internalization (Scott et al., 2002; Fiorentini et al., 2003; Pei et al., 2004). Ligand-occupied NMDA receptors may also constrain the mobility of laterally diffusing dendritic D1 receptors and recruit them to spines through a diffusion-trap mechanism (Scott et al., 2006). Assuming that activation of NMDA receptors recruits D1 receptors to the plasma membrane, which in turn facilitates the activity and surface targeting of NMDA receptors, a positive feedback loop is created (Cepeda and Levine, 2006). This loop, if not controlled, might result in concomitant overactivation of both D1 and NMDA receptors, jeopardizing neuronal integrity and triggering neurotaxicity (Choi, 1988; Bozzi and Borrelli, 2006).

PSD-95 is a prototypical postsynaptic scaffold that interacts with both NMDA and D1 receptors. Through its first two PSD-95, Dlg, ZO-1 homology (PDZ) domains, PSD-95 interacts with the NR2 subunits of NMDA receptors (Kornau et al., 1995; Niethammer et al., 1996; Kennedy, 2000). This PDZ-mediated interaction may play a role in “functionally” localizing NMDA receptors in the synapse (Kennedy, 2000; Kim and Sheng, 2004) and in regulating synaptic efficacy (Migaud et al., 1998; Stein et al., 2003; Ehrlich and Malinow, 2004; Béïque et al., 2006; Xu et al., 2008). PSD-95 also interacts with the D1 receptor via the carboxyl terminal tail of the receptor and the NH2 terminus of PSD-95, an interaction shown to regulate D1 trafficking (Zhang et al., 2007). Together with the demonstrated D1-NR1 association and overlapping subcellular distributions of these proteins (Valtschanoff et al., 1999; Aoki et al., 2001; Hara and Pickel, 2005; Zhang et al., 2007), a tertiary protein complex containing these proteins may exist in the brain where the interplay between D1 and NMDA receptors is fine-tuned. In this study, we provide evidence that PSD-95 associates with D1 and the NMDA receptor complex and negatively regulates the physical and functional interactions between these receptors.

Materials and methods

Mice

All experiments were conducted in accordance with the National Institutes of Health guidelines for the care and use of animals and with an approved animal protocol from the Harvard Medical Area Standing Committee on Animals. PSD-95 wild-type (WT) and knock-out (KO) mice (Yao et al., 2004) were housed at standard lab conditions (12 h light/dark cycle) with food and water provided ad libitum.

Plasmid constructs

Plasmids encoding HA-D1, PSD-95-GFP, NR1, NR2B, and PSD-95-GFP mutants ΔNT-GFP, Δ12-GFP, ΔNT, 12-GFP, and NT-GFP have been described previously (Tezuka et al., 1999; Zhang et al., 2007). PSD-95 shRNA targeting sequence (Elias et al., 2006) in pLLox3.7 vector was a kind gift from Dr. Roger A. Nicoll. The control shRNA (TCACAGTCGGATCCATCACTCAGTATA) was inserted into pLLox3.7. All constructs were generated by polymerase chain reaction (PCR) and verified by automated sequencing.

Cell culture and transfection

Human embryonic kidney (HEK) 293, HEK293T, and HEK293 cells stably expressing the rhesus monkey D1 receptor (D1 stable cells) were cultured and transfected as previously described (Zhang et al., 2007). Embryonic (E18–19) rat and mouse primary neurons were grown on poly-D-lysine coated plates in neurobasal medium supplemented with B27 and 1% GlutaMax (GIBCO). Hippocampal neurons were transfected with sh-PSD-95 or sh-control and HA-D1 by lipofectamine 2000 (Invitrogen) or nucleofection (Amaxa).

Lentivirus production and neuronal infection

2 × 106 HEK293T cells were co-transfected with pLLox3.7 and helper vectors, pDelta8.9 and pVSV-G, using TransFectin (Bio-Rad). The supernatant was collected after 72 hr and titer was determined by infection of HEK293T cells. Striatal neurons were infected by lentivirus particles expressing sh-PSD-95 or sh-control with a titer of MOI 2 at DIV11, and grown for 6 additional days before western blot analyses and cAMP assays. The infection efficiency routinely reached > 70%.

Immunocytochemistry, confocal microscopy, and immunofluorescence analysis

Hippocampal neurons were fixed in 4% paraforaldehyde/4% sucrose at room temperature for 15 min, permeabilized, and blocked, as previously described (Zhang et al., 2007). Cells were incubated with the following primary antibodies overnight at 4°C: anti-D1 (1:50, Sigma), anti-PSD-95 (1:200), and anti-NR1 (1:50, BD Pharmingen), followed by incubation with secondary antibodies conjugated with appropriate Alexa dyes (1: 500, Molecular probe) at room temperature for 1 hr. Cells were mounted on glass slides.

D1 internalization was measured as described (Zhang et al., 2007). Briefly, HA-D1 transfected HEK293 cells or hippocampal neurons were incubated with a HA antibody (1:100, Covance) at 4 °C or 15 °C, respectively. After wash, cells were stimulated with SKF81297 (30 min, 37°C) in the presence or absence of NMDA receptor agonists and/or antagonists, as specified. Surface HA-D1 receptors were labeled with an Alexa Fluor 647-conjugated secondary antibody. The internalized HA-D1 receptor was recognized by an Alexa Fluor 568-conjugated secondary antibody after permeabilization. Confocal images were acquired using a Leica confocal microscope at the following excitation/emission wavelengths: 488/519 nm, 568/604 nm, or 647/669 nm. Image stacks were acquired under the same confocal settings along the z-axis, and were flattened into a single image using a maximum projection and analyzed with Metamorph (Universal Imaging Corporation). Surface and internal D1 fluorescence intensities were measured as integrated pixel intensities, and the internalization index for each cell was defined as the ratio of the internalized fluorescence intensity to the total fluorescence intensity. HA-D1 internalization in neurons was performed at the soma.

For quantification of colocalization, dendritic segments containing more than 50 fluorescence clusters (per neuron) were selected and traced. NR1 clusters were selected automatically in the pseudo-colored “blue” channel as discrete puncta of intensity >1.5-fold brighter than the background fluorescence. Selected clusters were transferred to the red channel to measure the D1 fluorescence. Colocalization of D1 over NR1 was measured as the percent of integrated D1 pixel intensities that overlap with the NR1 fluorescence in individual clusters and averaged for each neuron. All groups to be compared were run simultaneously using cells from the same culture preparation and transfection condition.

Immunoprecipitation and western blotting

HEK293 cells or cultured neurons were briefly sonicated in a DOC buffer (50 mM Tris-HCl, pH 9.0; 1% DOC, 1 mM EDTA, 1 mM EGTA and protease inhibitors), and the supernatants were extracted by centrifuge at 10000 x g for 20 min. Mouse striata, hippocampi and cortices were dissected, homogenized, and extracted in DOC buffer. Protein extracts were incubated with anti-D1 (10 µl, Sigma), anti-NR1 (4 µg, Upstate) or anti-HA (5 µl, Covance) antibodies at 4°C overnight with gentle rotation. Precipitated protein complexes were captured by Protein A/G agarose beads (Santa Cruz), immobilized to PDVF membranes, incubated with anti-D1 (1:200), anti-PSD-95 (1:500, BD Transduction Laboratories), anti-NR1 (1:200), anti-NR2B (1:200, Upstate), anti-GST (1:1000, Santa Cruz), anti-actin (1:1000, Chemicon), or anti-GFP (1:1000, Santa Cruz) antibodies as specified. Horseradish peroxidase-conjugated secondary antibody and signals were detected by an ECL-based LAS-3000 image system (Fujifilm). Densitometric analysis was carried out within linear range using ImageGauge (Fujifilm).

GST fusion proteins and pull-down assay

GST fusion proteins encoding D1 DA receptor C-terminal fragments CT1 (amino acids 361–389), CT2 (amino acids 385–415) or CT3 (amino acids 414–446) were generated by PCR and subcloned into pGEX6P-1 vector (GE Healthcare) in-frame. GST fusion protein production was induced by 0.5 mM isopropyl-B-D-thiogalactopyranoside (Promega) for 2 hr in BL21 bacterium and immobilized on glutathione-sepharouse 4B agarose (Amersham Biosciences). Equal amounts of GST fusion proteins were incubated at 4 °C overnight with lysates of HEK293 cells overexpressing PSD-95-GFP or cultured rat striatal neurons , followed by washes with ice-cold PBS containing 0.1 % Triton X-100. The pulled-down proteins were resolved by SDS-PAGE and analyzed by western blotting.

cAMP enzyme immunoassay

D1 stable HEK293 cells transiently transfected with NR1 and NR2B cDNAs in the presence or absence PSD-95-GFP coexpression, or striatal neurons infected by lentiviral particles expressing sh-PSD-95 or sh-control were stimulated by SKF81297 for 30 min in the presence or absence of NMDA receptor agonists/antagonist combinations. Whole-cell cAMP accumulation was measured using the Direct cAMP Enzyme Immunoassay Kit (Sigma or GE Healthcare) following manufacturers’ instructions. cAMP concentrations were measured as optical density at 405 or 450 nm by a microplate reader (PerkinElmer).

Radioligand competition binding

Cells were homogenized in 5 mM Tris-HCI containing 2 mM EDTA and protease inhibitors and centrifuged at 3400 x g for 30 min at 4°C. The pellet was resuspended in binding buffer (5 mM Tris containing 8.5 mM Hepes, 120 mM NaCI, 5.4 mM KCI, 1.2 mM CaCI2, 1.2 mM MgSO4 and 5 mM glucose, pH 7.4). 200 µg of sample was incubated with 0.4 nM of [3H] SCH23390 (86 Ci/mmol, Amersham Biosciences) in the presence of increasing concentrations of SKF81297 (10−12 to 10−4 M) at 4°C for 2 hr. Nonspecific binding was determined in the presence of 1 µM of SCH39166. All experiments were performed in triplicates. Binding data was analyzed by fitting the data with a sigmoidal dose response curve to derive Bmax and IC50 using Graphpad Prism software.

Results

The D1/PSD-95/NMDA receptor complex

We first tested the hypothesis that D1, PSD-95, and NMDA receptors reside in the same protein complex. HEK293T cells were transfected with various combinations of green fluorescent protein-tagged PSD-95 (PSD-95-GFP), N-terminus hemagglutinin-tagged D1 receptors (HA-D1) (Zhang et al., 2007), and NMDA receptors, which, in this study, represented coexpression of the NR1 and the NR2B subunits. Immunoblot analysis of whole cell lysates showed that, when coexpressed, PSD-95, NR1, and D1 coprecipitated with antibodies against either HA or NR1 (Fig. 1A), suggesting that these proteins formed a multiprotein complex in these cells. NR1 or PSD-95 coprecipitated with the anti-HA antibody when each was coexpressed with HA-D1. Similarly, D1 or PSD-95 coprecipitated with the anti-NR1 antibody when each was coexpressed with NMDA receptors. These data suggest that the tertiary complex is assembled by protein-protein interactions at multiple sites (Fig. 1G).

Figure 1. The D1, PSD-95, and NMDA receptor complex.

Figure 1

Open in a new tab

(A) Formation of D1/PSD-95/NMDA receptor complex in HEK293T cells. Cells were transfected with cDNA constructs encoding HA-D1, PSD-95-GFP, and/or NR1/NR2B. Coimmunoprecipitation was performed by incubation of cell lysates with the indicated antibodies followed by immunoblotting. (B) Formation of D1, PSD-95, and NMDA receptor complex in the mouse brain. DOC extracts of mouse forebrain tissues were immunoprecipitated with an anti-D1 antibody and the blots were revealed by antibodies against PSD-95, NR1, NR2A, and NR2B, respectively. (C) Colocalization of D1, PSD-95, and NR1 in subsets of spines or puncta in a dendritic process of a cultured mouse hippocampal neuron. Arrowheads indicate representative puncta where D1, PSD-95 and NR1 colocalize. Scale bar, 2 µm. (D, E) Schematics showing D1 domain structures (D) and GST fusion protein constructions (E). (F) PSD-95 binds distal D1 CT domains. GST-D1 CT2 or GST-D1 CT3, but not GST-D1 CT1 or GST alone precipitated PSD-95 from HEK293 cells overexpressing PSD-95-GFP or mouse striatal cultures. Equal amounts of GST fusion proteins were used in the pull-down assays. IgG was used as a control in all immunoprecipitation experiments. (G) Model depicting molecular interactions (thick bars connecting various proteins) that assemble the D1/PSD-95/NMDA receptor complex. PSD-95 and NR1 interact with distinct but a partially overlapping region on the D1 CT. All experiments were repeated at least three times with similar results.

To establish whether or not the D1/PSD-95/NMDA receptor complex exists in vivo, we performed coimmunoprecipitation experiments on mouse forebrain lysates (Fig. 1B). An anti-D1 antibody precipitated a protein complex that included PSD-95 and several NMDA receptor subunits, NR1, NR2A, and NR2B. To confirm the immunoprecipitation data, we also examined the subcellular distributions of D1, PSD-95, and NR1 in cultured hippocampal neurons using immunofluorescence confocal microscopy. D1, PSD-95 and NR1colocalized in a substantial portion of dendritic spines/clusters along dendritic processes (Fig. 1C). Together, these data provide support for the view that D1, PSD-95 and NMDA receptors coexist in the same protein complex in the brain.

PSD-95 and NR1 bind to an overlapping region on the D1 carboxyl tail

Our previous studies demonstrate that PSD-95, via its N-terminus (NT), directly interacts with the C-terminus of D1 (D1 CT) (Zhang et al., 2007). A peptide fragment (D1 CT2; L385-L415) in the middle of D1 CT has been shown to interact with NR1 (Lee et al., 2002). We investigated whether PSD-95 also binds this domain of D1 CT using recombinant glutathione S-transferase (GST) affinity purification assays (Fig. 1D, E, F). GST fusion proteins encoding the various fragments of D1 CT were constructed and used as baits to precipitate associated proteins (Fig. 1E). Incubation of GST, GST-D1 CT1, GST-D1 CT2, or GST-D1 CT3 fusion proteins with lysates prepared from HEK293 cells expressing PSD-95 revealed a copurification of PSD-95 and GST-D1 CT2 or GST-D1 CT3, but not GST-D1 CT1 or GST alone (Fig. 1F). Similarly, GST-D1 CT2 or GST-D1 CT3, but not GST-D1 CT1 or GST alone, was able to pull down PSD-95 from protein extracts prepared from mouse striatal cultures. These data suggest that while binding to distinct sequences, PSD-95 and NR1 recognize an overlapping region on the D1 CT.

PSD-95 interferes with D1-NR1 interaction

By associating with a region on the D1 CT that also mediates D1-NR1 interaction, PSD-95 could interfere with the physical coupling between the two receptors. To test this hypothesis, HEK293T cells were transfected with cDNAs encoding D1 and NMDA receptors in the presence or absence of PSD-95 cotransfection (Fig. 2A, B, C). The strength of D1-NR1 association was measured by coimmunoprecipitation using an antibody against NR1. PSD-95 coexpression did not affect the total D1 or NR1 expression (Fig. 2A, B). In the presence of PSD-95, however, the anti-NR1 antibody precipitated significantly less amount of D1 receptors, while the amount of coprecipitaed NR1 protein remained the same (Fig. 2A, C). This result suggests that the presence of PSD-95 inhibited D1-NR1 association.

Figure 2. PSD-95 inhibits D1-NR1 interaction.

Figure 2

Open in a new tab

(A) Coimmunoprecipitation of HA-D1 and NR1 in the presence or absence of PSD-95 overexpression in HEK293T cells. (B, C) Densitometric analyses of total (B) and coprecipitated (C) NR1 and D1 receptors. n = 3–4; data represent mean ± s.e.m. *, P < 0.05, two-tailed Student’s t test. (D) Schematic drawing of PSD-95 truncation constructs. (E) Effects of PSD-95 mutants on D1-NR1 interaction, as measured by coimmunoprecipitation in the presence or absence of overexpression of different PSD-95 constructs. HEK293T cells were transfected with HA-D1, NR1/NR2B, and different PSD-95-GFP constructs or a mock vector. Coimmunoprecipitation was performed by incubating HEK293T cell lysates with an anti-NR1 antibody followed by immunoblotting with an anti-HA or an anti-NR1 antibody. Total levels of D1 and NR1 were measured by western blots. Experiments were repeated 4 times with similar results.

To investigate whether the PSD-95 inhibition of D1-NR1 interaction is mediated by PSD-95 NT, we generated several PSD-95 truncation mutants (Fig. 2D) and analyzed their effects on D1-NR1 coprecipitation in co-transfected HEK293 cells (Fig. 2E). PSD-95 NT, the 72-amino acid peptide alone in the absence of the three PDZ, SH3, and GK domains, diminished the D1-NR1 association indistinguishable from that induced by the full-length PSD-95. Unexpectedly, a PSD-95 mutant lacking the NT (PSD-95 ΔNT) was still able to inhibit D1-NR1 association, but a mutant lacking both NT and PDZ1&2 domains (PSD-95 ΔNT,12) abolished the inhibition. These data suggest that the PSD-95 NT is sufficient but not necessary for inhibiting D1-NR1 interaction, and the first two PDZ domains that mediate PSD-95-NMDA receptor interaction also participate in the negative regulation of D1-NR1 interaction.

Removal of PSD-95 enhances D1-NR1 association

To confirm the inhibition of PSD-95 on D1-NR1 interaction in vivo, we performed coimmunoprecipitation on forebrain protein extracts prepared from wild-type mice (PSD-95 WT) and their littermates that lacked PSD-95 (PSD-95 KO) (Fig. 3A, B, C). The total D1 and NR1 levels were unaltered in PSD-95 KO forebrain tissues. An anti-D1 antibody precipitated similar amount of D1 but significantly higher amount of NR1 in PSD-95 KO mice, compared to the WT control. Thus, more NR1 was associated with a similar amount of D1 receptors in the absence of PSD-95.

Figure 3. Removal of PSD-95 enhances D1-NR1 association in vivo.

Figure 3

Open in a new tab

(A) Coimmunoprecipitation of D1 and NR1 in PSD-95 WT and KO mice. Coimmunoprecipitation was performed on forebrain extracts with an anti-D1 antibody and blotted with an anti-NR1 antibody. Total D1, NR1, and PSD-95 levels were measured by western blots. (B) Densitometric analyses of total D1 and NR1 levels in the forebrain of PSD-95 WT and KO littermates. n = 7. (C) Densitometric analysis of NR1 coprecipitated with an anti-D1 antibody. n = 6. (D) shRNA silencing of PSD-95 in primary hippocampal cultures. Cultured hippocampal neurons were transfected by electroporation with sh-PSD-95 or sh-control. Protein levels of PSD-95 and actin were analyzed by western blots. Experiments were repeated 3 times with essentially identical results. (E) Confocal images of hippocampal neurons transfected with sh-control or sh-PSD-95 shRNAs (left; scale bar, 20 µm). Merged GFP, D1 (red), and NR1 (blue) florescence are shown. Representative endogenous D1 and NR1 clusters on dendritic processes of these neurons are shown on the right (scale bar, 2 µm). (F) Quantification of D1 colocalization with NR1. n = 13 – 30 neurons; all data are expressed as mean ± s.e.m. **, P < 0.01, ***, P < 0.001; two-tailed Student’s t-tests.

To directly “visualize” the role of PSD-95 in D1-NR1 association, we examined the effect of small hairpin RNA (shRNA)-mediated PSD-95 knockdown (KD) on the colocalization of D1 and NMDA receptors in cultured hippocampal neurons (Fig. 3D, E, F). A shRNA carrying point mutations was used as a control (sh-control). Neurons were transfected with shRNA for PSD-95 (sh-PSD-95) or sh-control. Western blot analysis showed that sh-PSD-95 selectively silenced the expression of PSD-95 compared to sh-control (Fig. 3D; Elias et al., 2006). Neurons expressing shRNAs were identified by the expression of GFP in these cells (Fig. 3E). D1 receptor colocalization with NR1 in dendritic puncta/clusters was significantly higher in neurons expressing sh-PSD-95 than in neurons expressing sh-control (Fig. 3E, F). This increase occurred without changes in the densities of D1- or NR1 puncta (data not shown). Collectively these results suggest that PSD-95 fine-tunes the D1-NMDA receptor association within the same complex.

PSD-95 removes NMDA receptor inhibition of D1 internalization

The responsiveness of the D1 receptor, like most G protein-coupled receptors (GPCRs), is controlled primarily by the classical β-arrestin- and GPCR kinase (GRK)-regulated desensitization process (Gainetdinov et al., 2004). Association with NMDA receptors immobilizes D1 receptors in the plasma membrane and abolishes agonist-induced D1 desensitization (Fiorentini et al., 2003). We thus investigated the functional significance of the PSD-95 interference of D1-NR1 association by determining the effect of PSD-95 on this D1 trafficking process using an immunocytochemistry-based internalization assay (Zhang et al., 2007). HEK293 cells were transfected with HA-D1 and NMDA receptors in the presence or absence of PSD-95-GFP. The surface HA-D1 receptors were labeled with an anti-HA antibody and the internalization of these receptor-antibody complexes was monitored in live cells. Consistent with previous studies (Fiorentini et al., 2003; Zhang et al., 2007), HA-D1, when expressed alone or coexpressed with NMDA receptors, displayed little constitutive endocytosis but showed substantial spontaneous internalization when coexpressed with PSD-95. Stimulation with SKF81297 (10 µM, 30 min), a full D1 agonist, induced robust internalization of the HA-D1 receptors, regardless of the presence of NMDA receptor and/or PSD-95 overexpression (Fig. 4).

Figure 4. PSD-95 blocks NMDA receptor-dependent inhibition of D1 endocytosis.

Figure 4

Open in a new tab

HEK293 cells were transfected with HA-D1 alone (A), HA-D1 and PSD-95-GFP (B), HA-D1 and NR1/NR2B (C), or HA-D1, PSD-95-GFP, and NR1/NR2B (D). Surface receptors were live-conjugated with an anti-HA antibody, and were allowed for endocytosis (37°C, 30 min) under the indicated stimulation conditions. Following internalization, cells were processed for differential staining of remaining surface (before permeabilization) and internalized (after permeabilization) receptors.

We then examined how PSD-95 might regulate the NMDA receptor-dependent inhibition of agonist-induced D1 internalization. In cells cotransfected with HA-D1 and NMDA receptors, simultaneous stimulation of NMDA receptors with NMDA (50 µM)/glycine (10 µM) inhibited the SKF81297-induced D1 internalization (Fig. 4C,Fig 5E). This inhibition was blocked by the NMDA receptor antagonist MK-801 (10 µM), indicating the requirement for NMDA receptor activation (Fig. 4C). In contrast, this NMDA receptor-dependent inhibition of D1 internalization was abolished in cells cotransfected with D1, NMDA receptor, and PSD-95 (Fig. 4D,Fig 5E). Notably, the SKF81297-induced D1 internalization occurred regardless of NMDA receptor activation, and persisted in the presence of MK-801 in these cells. These data suggest that PSD-95 uncoupled modulation of D1 trafficking by the NMDA receptor, perhaps by acting as a physical barrier. Western blot analysis of total and surface labeled (with Sulfo-NHS-SS-biotin) receptors indicated that overexpression of PSD-95 did not alter the total or the surface expression of either the D1 or the NMDA receptor (data not shown). Thus, coexpression of PSD-95 with D1/NMDA receptors alters the rules that govern NMDA receptor modulation of D1 endocytosis without affecting the level or distribution of these receptors.

Figure 5. PSD-95 blockade of NMDA receptor inhibition of D1 endocytosis requires PSD-95 NT and PDZ1&2 domains.

Figure 5

Open in a new tab

(A–D) SKF81297-induced HA-D1 internalization in HEK293 cells expressing HA-D1, PSD-95-WT, and NR1/NR2B (A), HA-D1, PSD-95-ΔNT and NR1/NR2B (B), HA-D1, PSD-95-Δ1&2 and NR1/NR2B (C), or HA-D1, PSD-95-ΔNT,1&2 and NR1/NR2B (D). Note that only the PSD-95 mutant lacking both NT and PDZ1&2 domains failed to block the NMDA receptor-dependent inhibition of D1 internalization (D). Receptor internalization assay was performed as in Figure 4. (E) Summary graph showing the effects of overexpressing the various PSD-95 constructs on NMDA receptor inhibition of D1 internalization. Internalization index was defined as the ratio of internalized to total fluorescence intensities. n = 15–17 cells for each group. Data are expressed as mean ± s.e.m. *, P < 0.05; ***, P < 0.0001; n.s., not significant; Two-tailed Student’s t-tests.

Domain mapping of PSD-95 disinhibition of D1 internalization

We next investigated the domain mechanism by which PSD-95 removes, or disinhibits the NMDA receptor-dependent inhibition of D1 internalization by analyzing the effect of PSD-95 truncation mutants on D1 internalization in co-transfected HEK293 cells (Fig. 5). Consistent with the involvement of both PSD-95 NT and PDZ1&2 domains in inhibiting D1-NR1 interaction, deletion of either, but not both, domains still mimicked full-length PSD-95 in disinhibiting the NMDA receptor-dependent inhibition of D1 internalization. In particular, either PSD-95 ΔNT (Fig. 5B, E) or PSD-95 Δ12 (Fig. 5C, E) blocked the NMDA receptor-dependent inhibition of D1 internalization in a manner indistinguishable from that induced by the full-length PSD-95 (Fig. 5A, E). In contrast, PSD-95 ΔNT, 12 (Fig. 5D) failed to block the NMDA receptor-dependent inhibition of D1 internalization and instead induced D1 internalization patterns similar to cells expressing HA-D1 and NMDA receptors in the absence of PSD-95 coexpression (Fig. 5E). These data suggest that both the NT and PDZ1&2 domains of PSD-95 are involved in disinhibiting the NMDA receptor-dependent inhibition of D1 internalization.

PSD-95 knockdown enables inhibition of D1 internalization by NMDA receptors

We further investigated the role of PSD-95 in the NMDA receptor-dependent modulation of D1 trafficking in neurons using a receptor internalization assay (Fig. 6). Cultured hippocampal neurons were cotransfected with HA-D1 and sh-PSD-95 or sh-control, live labeled with an anti-HA antibody, stimulated, and processed for differential labeling and measurements of surface and internalized HA-D1 receptors, respectively (Fig. 6A). In both control (expressing sh-control) and PSD-95 KD (expressing sh-PSD-95) neurons, SKF81297 (10 µM) alone induced robust HA-D1 internalization, whereas NMDA (50 µM)/glycine (10 µM) alone had no effect. The SKF81297-induced HA-D1 internalization was abolished by the D1 antagonist SCH23390 (10 µM), suggesting that this process was specifically mediated by D1 (data not shown). However, simultaneous stimulation of NMDA receptors during D1 stimulation significantly inhibited the SKF81297-induced D1 internalization in PSD-95 KD neurons, but had no significant effect in control neurons (Fig. 6B). These data are consistent with the idea that under normal conditions a physiological role for PSD-95 is to uncouple modulation of D1 trafficking by NMDA receptors.

Figure 6. PSD-95 KD unmasks NMDA receptor-dependent inhibition of D1 endocytosis in hippocampal neurons.

Figure 6

Open in a new tab

(A) Agonist-induced D1 internalization in hippocampal neurons. Neurons were cotransfected with HA-D1 and sh-PSD-95 or sh-control. HA-D1 internalization was measured by an immunofluorescence-based antibody uptake assay. Representative images of the surface (left column) and internalized (middle column) HA-D1 receptors in sh-control- or sh-PSD-95-transfected neurons (identified by GFP expression, right column) under different stimulation conditions are shown. Surface HA-D1 receptors were live-conjugated with an anti-HA antibody and were allowed for endocytosis (37°C, 30 min) in normal culture medium or medium containing SKF81297 (10 µM), NMDA (50 µM)/glycine (10 µM), or both. (B) Quantification of HA-D1 internalization in neurons. n = 10–15 neurons per group. Data are expressed as mean ± s.e.m. *, P < 0.05; n.s., not significant; Two-tailed Student’s t-tests.

PSD-95 blocks NMDA receptor modulation of D1 signaling

The strength of D1 signaling is typically measured by the level of cAMP produced as a consequence of receptor activation. Because receptor trafficking is an integral regulatory mechanism of GPCR signaling, we hypothesized that PSD-95 may also uncouple D1 cAMP signaling from NMDA receptor modulation. A stable HEK293 cell line constitutively expressing the rhesus macaque D1 receptor (Zhang et al., 2007) was transiently transfected with NMDA receptors in the presence or absence of PSD-95 overexpression. D1 signaling was assessed by dose-response curves of D1-mediated cAMP production in response to various concentrations of SKF81297 stimulation (Fig. 7). Consistent with a previous study (Pei et al., 2004), activation of NMDA receptors in D1 stable cells that also expressed NMDA receptors significantly enhanced the SKF81297-stimulated, D1-mediated cAMP accumulation (Fig. 7A, C). NMDA receptor activation increased the maximal cAMP levels (Bmax) induced by saturating doses of SKF81297, but did not significantly alter the EC50 of SKF81297 (No stimulation: 4.4 ± 2.4 × 10−8 M; stimulation: 6.4 ± 3.2 × 10−8 M; p > 0.05). The potentiation was blocked by the NMDA receptor antagonist MK-801, confirming that NMDA receptor activation was required for this potentiation (Fig. 7A). In contrast, NMDA receptor activation-dependent potentiation of D1 function was absent (or slightly reversed) in D1 stable cells coexpressing both NMDA receptors and PSD-95 (Fig. 7B, C). These results suggest that PSD-95 association with the D1-NMDA heteroreceptor complex abolished the ability of NMDA receptor activation to potentiate D1-mediated cAMP production.

Figure 7. PSD-95 blocks NMDA receptor modulation of D1 cAMP signaling in HEK293 cells.

Figure 7

Open in a new tab

(A) Dose response curves of cAMP production in NR1/NR2B-transfected D1 stable cells. Cells were stimulated with increasing concentrations of SKF81297 for 30 min. Stimulation of NMDA receptors by NMDA (50 µM) and glycine (10 µM) increased the maximum cAMP accumulation. cAMP accumulation was measured with an enzyme immunoassay. (B) Dose response curves of cAMP production in D1 stable cells transfected with NR1/NR2B and PSD-95. Stimulation of NMDA receptors failed to increase the maximum cAMP accumulation. (C) Summary of D1-mediated cAMP production induced by 10 µM SKF81297 from independent experiments (n = 3 – 5). Results are presented in arbitrary units normalized to cAMP levels in cells not stimulated by NMDA/glycine. *, P < 0.01; n.s., not significant; Student’s t-tests. (D) Dose response curves of cAMP production in cells transfected with NMDA receptor, or both NMDA receptors and PSD-95, in the absence of NMDA/glycine stimulation. (E) Unaltered competition binding curves for D1 stable cells transfected with NR1/NR2B in the presence or absence of PSD-95 co-transfection. (F) PSD-95 coexpression did not affect IC50 or the total binding determined at saturating doses. The data represents the mean ± s.e.m. of three independent experiments. Competition binding experiments were carried out using 400 pM [3H]SCH23390 and 9 concentrations of competing SKF81297 ranging from 1 pM to 100 µM. Each data point in A, B, D, E represents the mean ± s.e.m. of three replications. All experiments were repeated at least three times with essentially identical results.

To determine whether the PSD-95 abolishment of NMDA receptor modulation of D1 cAMP signaling required activation of the NMDA receptor per se, we repeated the above experiments in the absence of NMDA receptor stimulation (Fig. 7D). We found that, when transfected into the D1 stable cells, unstimulated NMDA receptors significantly suppressed the SKF81297-stimulated, D1-mediated cAMP accumulation (D1 stable cells: 94.6 ± 2.9 pmol/ml at 0.1 mM; D1 stable cells transfected with NMDA receptors: 55.9 ± 9.2 pmol/ml; p < 0.05). This finding is consistent with the current evidence that most physical heteroreceptor interactions lead to mutual inhibitory effects (Gines et al., 2000; Liu et al., 2000; Hillion et al., 2002; Lee et al., 2002). PSD-95 partially removed this NMDA receptor-mediated inhibition of D1 signaling in D1 stable cells cotransfeccted with both NMDA receptor and PSD-95 (D1 stable cells transfected with NMDA receptors and PSD-95: 79.9 ± 7.4 pmol/ml at 0.1 mM; p < 0.05 vs. cells transfected with NMDA receptor only). These data indicate that activation of these receptors or their Ca2+-coupled downstream signaling is not necessary for the PSD-95 interference of D1-NMDA receptor interaction.

Finally, we investigated whether PSD-95 might modulate the agonist binding efficacy of the NMDA receptor-associated D1 receptor. Radioligand competition binding experiments were performed to quantify the number as well as agonist binding parameters of D1 in D1 stable cells transfected with NMDA receptors in the presence or absence of PSD-95 coexpression, using the ligand [3H]SCH23390 and increasing concentrations of SKF81297 (Fig. 7E). PSD-95 overexpression had no effect on either the total number of D1 receptors expressed or the IC50 of SKF81297 (Fig. 7F), suggesting that the ligand-binding properties of the receptor were not modified by PSD-95. Taken together, the effects of PSD-95 on NMDA receptor-dependent modulation of D1 signaling are independent of either a modification of D1 pharmacological profiles or activation of NMDA receptors, findings consistent with a simple physical obstruction of the interaction between the two receptors.

PSD-95 knockdown escalates NMDA receptor-dependent D1 cAMP signaling in striatal neurons

The role of endogenous PSD-95 in NMDA receptor dependent modulation of D1 signaling was examined in cultured striatal neurons infected with lentivirus (Lois et al., 2002) expressing sh-PSD-95. To rule out potential viral associated side effects, lentivirus expressing sh-control was used as a control. sh-PSD-95 eliminated the vast majority of endogenous PSD-95 in striatal neurons compared to sh-control (Fig. 8A). This represents an underestimate of the knockdown efficiency in infected cells, as our infection efficiency routinely reached 70%. In control neurons, stimulation of the D1-class receptors with SKF81297 (10 µM, 30 min) increased cAMP accumulation (Fig. 8B). Simultaneous activation of NMDA receptors by NMDA (50 µM)/glycine (10 µM) during D1 stimulation did not further increase the SKF81297-induced, D1-mediated cAMP production, suggesting that an endogenous protective mechanism may exist under normal conditions. Acute PSD-95 KD in sh-PSD-95 expressing cultures retained SKF81297-induced cAMP production activity (Fig. 8C). However, concomitant stimulation of NMDA receptors elicited a marked increase of SKF81297-induced cAMP levels, which was partially reversed by MK-801 (10 µM). These data support the hypothesis that a normal role for PSD-95 is to prevent excessive potentiation of D1 signaling by NMDA receptors.

Figure 8. PSD-95 KD enhances NMDA receptor modulation of D1 signaling in striatal neurons.

Figure 8

Open in a new tab

(A) shRNA silencing of PSD-95 in striatal cultures. Dissociated striatal neurons were infected with sh-PSD-95 or sh-control lentivirus. Protein levels of PSD-95, D1, and actin were analyzed by western blots. (B, C) D1-mediated cAMP production in striatal neurons infected with sh-PSD-95 (C) or sh-control (B) lentiviruses. Neurons were stimulated (30 min) with combinations of SKF81297 (10 µM), NMDA (50 µM)/glycine (10 µM), and MK-801 (10 µM) as indicated. Data represent mean ± s.e.m. of three replications. *, P < 0.05; **, P < 0.01; ***, P < 0.001; Two-tailed Student’s t test. Experiments were repeated at least four times with similar results.

Discussion

In this study, we identified a novel gain-of-function for the prototypical synaptic scaffold PSD-95 and illustrated a mechanism by which the physical and functional interplay between DA and glutamate systems can be fine-tuned by this glutamatergic scaffold. We show that PSD-95, D1, and NMDA receptors are components of a multiprotein complex. Within the complex, PSD-95 inhibits the physical association between D1 and NMDA receptors and functionally uncouples D1 receptor trafficking and signaling from modulation by NMDA receptors. This PSD-95 interference may represent an effective means to weaken the constitutive D1-NMDA receptor interaction and to prevent this interaction from being abnormally strengthened by DA and/or glutamate during neural activity. As concomitant overactivation of both D1 and NMDA receptors can be detrimental to functional and structural integrity of neurons, our study illustrates a mechanism by which the D1-NMDA receptor coupling can be dampened to afford neuroprotection (Fig. 9).

Figure 9. Proposed mechanism by which PSD-95 interferes with D1-NMDA receptor interaction and uncouples modulation of D1 function by the NMDA receptor.

Figure 9

Open in a new tab

(A) Upon activation by DA, stand-alone D1 receptor stimulates adenylate cyclase, increases the production of cAMP, and signals through the PKA/DARPP-32/PP1 cascade to modulate various downstream effectors and substrates, including NMDA receptors. D1 receptors also undergo agonist-induced internalization via the classical dynamin-dependent, vesicle-mediated endocytic pathway (not shown), to regulate the surface availability and responsiveness of the receptor. (B) Association with NMDA receptors can enhance D1 surface availability and signaling through multiple mechanisms, e.g. inhibition of D1 endocytosis, facilitation of D1 exocytosis (not shown), or allosteric trapping by NMDA receptors (not shown), leading to a reciprocal facilitation of the NMDA receptor through the PKA/DARPP-32/PP1 cascade. (C) Presence of PSD-95 in the D1-NMDA receptor complex places a physical barrier between these receptors, weakening their interaction. This physical interference could in theory abolish NMDA receptor-dependent D1 surface recruitment, regardless of the mechanisms involved. As a result, D1-mediated cAMP signaling is dampened, NMDA receptor potentiation is suppressed, and the positive D1-NMDA receptor feedback is ultimately antagonized. PSD-95 also promotes constitutive D1 endocytosis, adding another level of inhibition on D1 signaling. Line thickness and arrowhead size indicate signaling strength.

At least three distinct interactions may contribute to the assembly of the D1/PSD-95/NMDA receptor complex: the D1-NR1 interaction mediated by the CTs of these proteins, the D1-PSD-95 interaction mediated by the NT of PSD-95 and CT of D1, and the PDZ-mediated interactions between PSD-95 and NR2. Our data demonstrate that these protein-protein interactions are not always cooperative to stabilize a multiprotein complex, and in the contrary, some of them may even be antagonizing to destabilize formation of the complex. In particular, by associating with both D1 and NMDA receptors, PSD-95 interferes with the interaction between these receptors. Our deletion analyses suggest that the PSD-95 interference is mediated by both the NT and PDZ1&2 domains of PSD-95. While PSD-95 NT may conceivably inhibit NR1 association with the D1 receptor since the two proteins bind an overlapping region on the D1 CT, the mechanism by which the PDZ1&2 domains exert the interference is less clear.

The PSD-95 interference of NMDA receptor modulation of D1 demonstrated here may be achieved through a direct, physical obstruction of D1-NR1 coupling by the presence of PSD-95, independent of intracellular signaling. First, the enhancement of D1-mediated cAMP signaling by NMDA receptor activation depends on the physical interaction between the two receptors, because it was abolished by overexpression of mini-genes encoding either D1 or NR1 CT fragments that disrupt D1-NR1 interaction (Pei et al., 2004). The ability of PSD-95 to mimic these peptide fragments in blocking the modulation of D1 cAMP signaling by NMDA receptor, regardless of its activation state, suggests that PSD-95 serves simply as a physical barrier. Second, The PSD-95 abolishment of D1 cAMP signaling modulation by unstimulated NMDA receptors indicates that opening of the receptor, the downstream intracellular signaling triggered by Ca2+ influx through activated receptors, and any potential functional modification of the receptor by PSD-95, is unlikely to contribute to the PSD-95 interference of D1-NR1 interaction per se. However, PSD-95 may recruit additional signaling systems to the D1-NMDA receptor complex (Husi et al., 2000; Kennedy, 2000; Kim and Sheng, 2004). Although the engagement of these signaling modalities by NMDA receptor-mediated Ca2+ influx is not expected to contribute to the PSD-95 interference, the possibility that these signaling complexes may themselves interfere with D1-NMDA receptor interaction can not be ruled out.

Regulation of the surface availability of a GPCR is an important means to control the functional responsiveness of the receptor, which in the case of D1 receptors, is calibrated by agonist-induced cAMP production. Several receptor trafficking mechanisms could contribute to NMDA receptor-dependent D1 surface recruitments and the enhancement of D1 cAMP signaling. In heterologous cells, coexpression of D1 with NR1/NR2B NMDA receptors facilitates D1 receptor targeting to the plasma membrane and abolishes agonist-induced D1 receptor sequestration (Fiorentini et al., 2003). In both heterologous cells and cultured neurons, NMDA receptor activation recruits D1 receptors to the plasma membrane via a soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE)-dependent mechanism (Pei et al., 2004). Lastly, ligand-occupied NMDA receptors in cultured striatal slices can recruit laterally diffusing D1 receptors to dendritic spines via a diffusion-trap mechanism (Scott et al., 2006). These mechanisms, while not entirely consistent, all appear to depend on direct D1-NR1 interaction. By physically weakening this interaction, PSD-95 could negatively affect these processes. Our studies in both transfected HEK293 cells and cultured neurons confirmed that the ability of NMDA receptors to inhibit agonist-induced D1 internalization was indeed disrupted by the presence of PSD-95. Whether or not PSD-95 interferes with other NMDA receptor-dependent D1 trafficking events, i.e. the SNARE-dependent exocytosis or the NMDA receptor-D1 trap, remains to be determined.

Activation of D1 receptors is long recognized to enhance NMDA receptor-mediated responses in the cortex (Cepeda et al., 1992; Seamans et al., 2001; Gonzalez-Islas and Hablitz, 2003; Chen et al., 2004) and striatum (Cepeda et al., 1993; Blank et al., 1997; Snyder et al., 1998; Flores-Hernández et al., 2002), involving primarily the cAMP/PKA/DARPP-32/PP1 cascade. Together with the reciprocal facilitation of D1 receptor function as a consequence of NMDA receptor activation, a positive feedback would be created that, if left uncontrolled, could result in overactivation of both D1 and NMDA receptors. Excessive activation of the NMDA receptor mediates excitotoxicity associated with neurodegenerative diseases and traumatic brain injuries (Choi, 1988; Lipton and Rosenberg, 1994). Elevated DA tone is also neurotoxic, contributing to the degeneration of postsynaptic DA-receiving neurons, via receptor-independent mechanisms involving oxidative stress-induced apoptosis and largely undefined receptor-dependent mechanisms (Cyr et al., 2003; Bozzi and Borrelli, 2006). Among all DA targets, the striatum is the most densely innervated and a particularly susceptible region for degeneration. We showed that NMDA receptor activation failed to enhance the D1 agonist-induced cAMP signaling in normal striatal neurons but drastically increased this response in PSD-95 KD striatal neurons. This finding indicates that the positive coupling between D1 and NMDA receptor is normally under control, at least in the striatum, and that the PSD-95 interference may represent such a negative control mechanism.

The PSD-95-mediated interference mechanism reported here provides an efficient means to constitutively dampen excessive D1-NMDA receptor stimulation. Activation of D2-class DA receptors could counteract the D1-NMDA receptor coupling because their signaling antagonizes D1-mediated cAMP cascade and reduces NMDA receptor responses (Bozzi and Borrelli, 2006). Compared to this classical dopaminergic neuroprotective mechanism, the PSD-95 interference mechanism might offer distinct advantages. First, it is fast and constitutive because it depends primarily on direct protein-protein interactions, rather than receptor activation and intracellular signaling. Second, it could operate in essentially every synapse where D1 and NMDA receptors are colocalized, provided that PSD-95 is sufficiently abundant to occupy these synapses. Finally, it could substitute the D2-mediated protection in synapses to which D2 receptors are not targeted, and more importantly, in neurons where D2 receptors are not expressed. For instance, the D1 receptor-expressing striatonigral neurons associated with the direct pathway of the basal ganglion circuitry express few D2 receptors (Gerfen, 1992). In these cells, the PSD-95 interference mechanism could have a more dominant role in preventing D1-NMDA receptor overexcitation.

Acknowledgements

We thank Drs. Roger Nicoll for the PSD-95 shRNA construct, Fang Liu for GST D1 CT plasmids, and Tadashi Yamamoto for the PSD-95 mutant cDNA lacking PDZ1&2. We thank Dr. Roger Spealman and members of Division of Neuroscience at NEPRC for helpful discussions. This work was supported by NIH grants RR00168 (NEPRC), NS39793 (OI), DA021420, NS057311, a National Alliance for Research on Schizophrenia and Depression Young Investigator Award, and Williams F. Milton Fund of Harvard University (W.-D.Y.).

References

  1. Aoki C, Miko I, Oviedo H, Mikeladze-Dvali T, Alexandre L, Sweeney N, Bredt DS. Electron microscopic immunocytochemical detection of PSD-95, PSD-93, SAP-102, and SAP-97 at postsynaptic, presynaptic, and nonsynaptic sites of adult and neonatal rat visual cortex. Synapse. 2001;40:239–257. doi: 10.1002/syn.1047. [DOI] [PubMed] [Google Scholar]
  2. Béïque JC, Lin DT, Kang MG, Aizawa H, Takamiya K, Huganir RL. Synapse-specific regulation of AMPA receptor function by PSD-95. Proc Natl Acad Sci USA. 2006;103:19535–19540. doi: 10.1073/pnas.0608492103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Berke JD, Hyman SE. Addiction, dopamine, and the molecular mechanisms of memory. Neuron. 2000;25:515–532. doi: 10.1016/s0896-6273(00)81056-9. [DOI] [PubMed] [Google Scholar]
  4. Blank T, Nijholt I, Teichert U, Kügler H, Behrsing H, Fienberg A, Greengard P, Spiess J. The phosphoprotein DARPP-32 mediates cAMP-dependent potentiation of striatal N-methyl-D-aspartate responses. Proc Natl Acad Sci USA. 1997;94:14859–14864. doi: 10.1073/pnas.94.26.14859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bozzi Y, Borrelli E. Dopamine in neurotoxicity and neuroprotection: what do D2 receptors have to do with it? Trends Neurosci. 2006;29:167–174. doi: 10.1016/j.tins.2006.01.002. [DOI] [PubMed] [Google Scholar]
  6. Carr DB, Sesack SR. Hippocampal afferents to the rat prefrontal cortex: synaptic targets and relation to dopamine terminals. J Comp Neurol. 1996;369:1–15. doi: 10.1002/(SICI)1096-9861(19960520)369:1<1::AID-CNE1>3.0.CO;2-7. [DOI] [PubMed] [Google Scholar]
  7. Cepeda C, Radisavljevic Z, Peacock W, Levine MS, Buchwald NA. Differential modulation by dopamine of responses evoked by excitatory amino acids in human cortex. Synapse. 1992;11:330–341. doi: 10.1002/syn.890110408. [DOI] [PubMed] [Google Scholar]
  8. Cepeda C, Levine MS. Where do you think you are going? The NMDA-D1 receptor trap. Sci STKE PE20. 2006 doi: 10.1126/stke.3332006pe20. [DOI] [PubMed] [Google Scholar]
  9. Cepeda C, Buchwald NA, Levine MS. Neuromodulatory actions of dopamine in the neostriatum are dependent upon the excitatory amino acid receptor subtypes activated. Proc Natl Acad Sci USA. 1993;90:9576–9580. doi: 10.1073/pnas.90.20.9576. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chen G, Greengard P, Yan Z. Potentiation of NMDA receptor currents by dopamine D1 receptors in prefrontal cortex. Proc Natl Acad Sci USA. 2004;101:2596–2600. doi: 10.1073/pnas.0308618100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Choi DW. Glutamate neurotoxicity and diseases of the nervous system. Neuron. 1988;1:623–634. doi: 10.1016/0896-6273(88)90162-6. [DOI] [PubMed] [Google Scholar]
  12. Cyr M, Beaulieu JM, Laakso A, Sotnikova TD, Yao WD, Bohn LM, Gainetdinov RR, Caron MG. Sustained elevation of extracellular dopamine causes motor dysfunction and selective degeneration of striatal GABAergic neurons. Proc Natl Acad Sci USA. 2003;100:11035–11040. doi: 10.1073/pnas.1831768100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Dunah AW, Standaert DG. Dopamine D1 receptor-dependent trafficking of striatal NMDA glutamate receptors to the postsynaptic membrane. J Neurosci. 2001;21:5546–5558. doi: 10.1523/JNEUROSCI.21-15-05546.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Ehrlich I, Malinow R. Postsynaptic density 95 controls AMPA receptor incorporation during long-term potentiation and experience-driven synaptic plasticity. J Neurosci. 2004;24:916–927. doi: 10.1523/JNEUROSCI.4733-03.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Elias GM, Funke L, Stein V, Grant SG, Bredt DS, Nicoll RA. Synapse-Specific and Developmentally Regulated Targeting of AMPA Receptors by a Family of MAGUK Scaffolding Proteins. Neuron. 2006;52:307–320. doi: 10.1016/j.neuron.2006.09.012. [DOI] [PubMed] [Google Scholar]
  16. Fiorentini C, Gardoni F, Spano P, Di Luca M, Missale C. Regulation of dopamine D1 receptor trafficking and desensitization by oligomerization with glutamate N-methyl-D-aspartate receptors. J Biol Chem. 2003;278:20196–20202. doi: 10.1074/jbc.M213140200. [DOI] [PubMed] [Google Scholar]
  17. Flores-Hernández J, Cepeda C, Hernández-Echeagaray E, Calvert CR, Jokel ES, Fienberg AA, Greengard P, Levine MS. Dopamine enhancement of NMDA currents in dissociated medium-sized striatal neurons: role of D1 receptors and DARPP-32. J Neurophysiol. 2002;88:3010–3020. doi: 10.1152/jn.00361.2002. [DOI] [PubMed] [Google Scholar]
  18. Freund TF, Powell JF, Smith AD. Tyrosine hydroxylase-immunoreactive boutons in synaptic contact with identified striatonigral neurons, with particular reference to dendritic spines. Neuroscience. 1984;13:1189–11215. doi: 10.1016/0306-4522(84)90294-x. [DOI] [PubMed] [Google Scholar]
  19. Gainetdinov RR, Premont RT, Bohn LM, Lefkowitz RJ, Caron MG. Desensitization of G protein-coupled receptors and neuronal functions. Annu Rev Neurosci. 2004;27:107–144. doi: 10.1146/annurev.neuro.27.070203.144206. [DOI] [PubMed] [Google Scholar]
  20. Gerfen CR. The neostriatal mosaic: multiple levels of compartmental organization in the basal ganglia. Annu Rev Neurosci. 1992;15:285–320. doi: 10.1146/annurev.ne.15.030192.001441. [DOI] [PubMed] [Google Scholar]
  21. Ginés S, Hillion J, Torvinen M, Le Crom S, Casadó V, Canela EI, Rondin S, Lew JY, Watson S, Zoli M, Agnati LF, Verniera P, Lluis C, Ferré S, Fuxe K, Franco R. Dopamine D1 and adenosine A1 receptors form functionally interacting heteromeric complexes. Proc Natl Acad Sci USA. 2000;97:8606–8611. doi: 10.1073/pnas.150241097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Goldman-Rakic PS, Leranth C, Williams SM, Mons N, Geffard M. Dopamine synaptic complex with pyramidal neurons in primate cerebral cortex. Proc Natl Acad Sci USA. 1989;86:9015–9019. doi: 10.1073/pnas.86.22.9015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Gonzalez-Islas C, Hablitz JJ. Dopamine enhances EPSCs in layer II–III pyramidal neurons in rat prefrontal cortex. J Neurosci. 2003;23:867–875. doi: 10.1523/JNEUROSCI.23-03-00867.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Greengard P, Allen PB, Nairn AC. Beyond the dopamine receptor: the DARPP-32/protein phosphatase-1 cascade. Neuron. 1999;23:435–447. doi: 10.1016/s0896-6273(00)80798-9. [DOI] [PubMed] [Google Scholar]
  25. Hara Y, Pickel VM. Overlapping intracellular and differential synaptic distributions of dopamine D1 and glutamate N-methyl-D-aspartate receptors in rat nucleus accumbens. J Comp Neurol. 2005;492:442–455. doi: 10.1002/cne.20740. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Hillion J, Canals M, Torvinen M, Casado V, Scott R, Terasmaa A, Hansson A, Watson S, Olah ME, Mallol J, Canela EI, Zoli M, Agnati LF, Ibanez CF, Lluis C, Franco R, Ferre S, Fuxe K. Coaggregation, cointernalization, and codesensitization of adenosine A2A receptors and dopamine D2 receptors. J Biol Chem. 2002;277:18091–18097. doi: 10.1074/jbc.M107731200. [DOI] [PubMed] [Google Scholar]
  27. Husi H, Ward MA, Choudhary JS, Blackstock WP, Grant SG. Proteomic analysis of NMDA receptor-adhesion protein signaling complexes. Nat Neurosci. 2000;3:633–635. doi: 10.1038/76615. [DOI] [PubMed] [Google Scholar]
  28. Kennedy MB. Signal-processing machines at the postsynaptic density. Science. 2000;290:750–754. doi: 10.1126/science.290.5492.750. [DOI] [PubMed] [Google Scholar]
  29. Kim E, Sheng M. PDZ domain proteins of synapses. Nat Rev Neurosci. 2004;5:771–781. doi: 10.1038/nrn1517. [DOI] [PubMed] [Google Scholar]
  30. Kornau HC, Schenker LT, Kennedy MB, Seeburg PH. Domain interaction between NMDA receptor subunits and the postsynaptic density protein PSD-95. Science. 1995;269:1737–1740. doi: 10.1126/science.7569905. [DOI] [PubMed] [Google Scholar]
  31. Lachowicz JE, Sibley DR. Molecular characteristics of mammalian dopamine receptors. Pharmacol Toxicol. 1997;81:105–113. doi: 10.1111/j.1600-0773.1997.tb00039.x. [DOI] [PubMed] [Google Scholar]
  32. Lee FJ, Xue S, Pei L, Vukusic B, Chery N, Wang Y, Wang YT, Niznik HB, Yu XM, Liu F. Dual regulation of NMDA receptor functions by direct protein-protein interactions with the dopamine D1 receptor. Cell. 2002;111:219–230. doi: 10.1016/s0092-8674(02)00962-5. [DOI] [PubMed] [Google Scholar]
  33. Lipton SA, Rosenberg PA. Excitatory amino acids as a final common pathway for neurologic disorders. N Engl J Med. 1994;330:613–622. doi: 10.1056/NEJM199403033300907. [DOI] [PubMed] [Google Scholar]
  34. Liu F, Wan Q, Pristupa ZB, Yu XM, Wang YT, Niznik HB. Direct protein-protein coupling enables cross-talk between dopamine D5 and gamma-aminobutyric acid A receptors. Nature. 2000;403:274–280. doi: 10.1038/35002014. [DOI] [PubMed] [Google Scholar]
  35. Lois C, Hong EJ, Pease S, Brown EJ, Baltimore D. Germline transmission and tissue-specific expression of transgenes delivered by lentiviral vectors. Science. 2002;295:868–872. doi: 10.1126/science.1067081. [DOI] [PubMed] [Google Scholar]
  36. Migaud M, Charlesworth P, Dempster M, Webster LC, Watabe AM, Makhinson M, He Y, Ramsay MF, Morris RG, Morrison JH, O’Dell TJ, Grant SG. Enhanced long-term potentiation and impaired learning in mice with mutant postsynaptic density-95 protein. Nature. 1998;396:433–439. doi: 10.1038/24790. [DOI] [PubMed] [Google Scholar]
  37. Missale C, Nash SR, Robinson SW, Jaber M, Caron MG. Dopamine receptors: from structure to function. Physiol Rev. 1998;78:189–225. doi: 10.1152/physrev.1998.78.1.189. [DOI] [PubMed] [Google Scholar]
  38. Niethammer M, Kim E, Sheng M. Interaction between the C terminus of NMDA receptor subunits and multiple members of the PSD-95 family of membrane-associated guanylate kinases. J Neurosci. 1996;16:2157–2163. doi: 10.1523/JNEUROSCI.16-07-02157.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Pei L, Lee FJ, Moszczynska A, Vukusic B, Liu F. Regulation of dopamine D1 receptor function by physical interaction with the NMDA receptors. J Neurosci. 2004;24:1149–1158. doi: 10.1523/JNEUROSCI.3922-03.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Pickel VM, Colago EE, Mania I, Molosh AI, Rainnie DG. Dopamine D1 receptors co-distribute with N-methyl-D-aspartic acid type-1 subunits and modulate synaptically-evoked N-methyl-D-aspartic acid currents in rat basolateral amygdala. Neuroscience. 2006;142:671–690. doi: 10.1016/j.neuroscience.2006.06.059. [DOI] [PubMed] [Google Scholar]
  41. Schultz W. Getting formal with dopamine and reward. Neuron. 2002;36:241–263. doi: 10.1016/s0896-6273(02)00967-4. [DOI] [PubMed] [Google Scholar]
  42. Scott L, Kruse MS, Forssberg H, Brismar H, Greengard P, Aperia A. Selective up-regulation of dopamine D1 receptors in dendritic spines by NMDA receptor activation. Proc Natl Acad Sci USA. 2002;99:1661–1664. doi: 10.1073/pnas.032654599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Scott L, Zelenin S, Malmersjö S, Kowalewski JM, Markus EZ, Nairn AC, Greengard P, Brisma,r H, Aperia A. Allosteric changes of the NMDA receptor trap diffusible dopamine 1 receptors in spines. Proc Natl Acad Sci USA. 2006;103:762–767. doi: 10.1073/pnas.0505557103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Seamans JK, Durstewitz D, Christie BR, Stevens CF, Sejnowski TJ. Dopamine D1/D5 receptor modulation of excitatory synaptic inputs to layer V prefrontal cortex neurons. Proc Natl Acad Sci USA. 2001;98:301–306. doi: 10.1073/pnas.011518798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Snyder GL, Fienberg AA, Huganir RL, Greengard P. A dopamine/D1 receptor/protein kinase A/dopamine- and cAMP-regulated phosphoprotein (Mr 32 kDa)/protein phosphatase-1 pathway regulates dephosphorylation of the NMDA receptor. J Neurosci. 1998;18:10297–10303. doi: 10.1523/JNEUROSCI.18-24-10297.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Stein V, House DR, Bredt DS, Nicoll RA. Postsynaptic density-95 mimics and occludes hippocampal long-term potentiation and enhances long-term depression. J Neurosci. 2003;23:5503–5506. doi: 10.1523/JNEUROSCI.23-13-05503.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Tezuka T, Umemori H, Akiyama T, Nakanishi S, Mamoto T. PSD-95 promotes Fyn-mediated tyrosine phosphorylation of the N-methyl-D-aspartate receptor subunit NR2A. Proc Natl Acad Sci USA. 1999;96:435–440. doi: 10.1073/pnas.96.2.435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Valtschanoff JG, Burette A, Wenthold RJ, Weinberg RJ. Expression of NR2 receptor subunit in rat somatic sensory cortex: synaptic distribution and colocalization with NR1 and PSD-95. J Comp Neurol. 1999;410:599–611. [PubMed] [Google Scholar]
  49. Xu W, Schlüter OM, Steiner P, Czervionke BL, Sabatini B, Malenka RC. Molecular dissociation of the role of PSD-95 in regulating synaptic strength and LTD. Neuron. 2008;57:248–262. doi: 10.1016/j.neuron.2007.11.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Yao WD, Gainetdinov RR, Arbuckle MI, Sotnikova TD, Cyr M, Beaulieu JM, Torres GE, Grant SG, Caron MG. Identification of PSD-95 as a regulator of dopamine-mediated synaptic and behavioral plasticity. Neuron. 2004;41:625–638. doi: 10.1016/s0896-6273(04)00048-0. [DOI] [PubMed] [Google Scholar]
  51. Yao WD, Spealman RD, Zhang J. Dopaminergic signaling in dendritic spines. Biochem Pharmacol. 2008;75:2055–2069. doi: 10.1016/j.bcp.2008.01.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Zhang J, Vinuela A, Neely MH, Hallett PJ, Grant SG, Miller GM, Isacson O, Caron MG, Yao WD. Inhibition of the dopamine D1 receptor signaling by PSD-95. J Biol Chem. 2007;282:15778–15789. doi: 10.1074/jbc.M611485200. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES