Skip to main content
UKPMC Funders Author Manuscripts logoLink to UKPMC Funders Author Manuscripts
. Author manuscript; available in PMC: 2010 Mar 5.
Published in final edited form as: J Neurosci. 2008 Aug 20;28(34):8644–8654. doi: 10.1523/JNEUROSCI.2320-08.2008

Wnt regulates axon behavior through changes in microtubule growth directionality: a new role for Adenomatous Polyposis Coli

Silvia A Purro 1,*, Lorenza Ciani 1,*, Monica Hoyos-Flight 1,*, Eleanna Stamatakou 1, Eliza Siomou 1, Patricia C Salinas 1
PMCID: PMC2832753  EMSID: UKMS28870  PMID: 18716223

Abstract

Axon guidance and target-derived signals control axonal behavior by regulating the cytoskeleton through poorly defined mechanisms. In particular, how these signalling molecules regulate the growth and directionality of microtubules is not well understood. Here we examine the effect of Wnts on growth cone remodelling, a process that precedes synapse formation. Time-lapse recordings reveal that Wnt3a rapidly inhibits growth cone translocation while inducing growth cone enlargement. These changes in axonal behavior are associated with changes in the organization of microtubules. Time-lapse imaging of EB3-GFP (green fluorescent protein) labeled microtubule plus-ends demonstrates that Wnt3a regulates microtubule directionality, resulting in microtubule looping, growth cone pausing and remodelling. Analyzes of Dvl1 mutant neurons demonstrate that Dvl1 is required for Wnt-mediated microtubule reorganization and axon remodelling. Wnt signalling directly affects the microtubule cytoskeleton by unexpectedly inducing APC loss from microtubule plus-ends. Consistently, shRNA knockdown of APC mimics Wnt3a function. Together our findings define APC as a key Wnt signalling target in the regulation of microtubule growth direction.

Keywords: neurons, Wnt, Dishevelled, Gsk3, microtubules, APC

INTRODUCTION

The formation of a functional nervous system requires the proper navigation and terminal remodelling of axons. Members of the Wnt family of secreted proteins, can function as axon pathfinding cues and target-derived factors that regulate axon terminal arborization (Umemori et al., 2004; Ciani and Salinas, 2005; Zou, 2006). During early stages of synapse formation, Wnts can act retrogradely to induce axonal remodelling, a process characterized by axonal spreading and growth cone enlargement (Hall et al., 2000; Krylova et al., 2002). Importantly, loss of Wnt7a or Dishevelled-1 (Dvl1), a key component of the Wnt pathway, causes severe defects in the terminal remodelling of axons in vivo (Hall et al., 2000; Ahmad-Annuar et al., 2006). Although these changes are accomplished through modifications in the axonal cytoskeleton, the precise effects of Wnt signalling on the cytoskeleton are poorly characterized.

Profound changes in the organization of microtubules (MTs) are associated with terminal remodelling during synapse formation. Studies at the Drosophila neuromuscular junction (NMJ) have shown that MTs form loops and grow backward, away from the leading edge of the synaptic bouton (Packard et al., 2002). Importantly, this MT organization contributes to changes in synaptic bouton size and shape and is regulated by Wingless/Wnt (Packard et al., 2002). Studies using cultured neurons have revealed that during axon outgrowth, MTs splay and orient along the axis of extension such that their plus-ends are captured at the leading edge of the growth cone by MT plus-end binding proteins (+TIPs) such as Adenomatous Polyposis Coli (APC), CLIP-170 and EB1 (for review see, Galjart, 2005). In the presence of Wnts, in contrast, MTs form loops as observed in synaptic boutons (Hall et al., 2000). This MT reorganization is likely to determine changes in axon behavior. Although +TIPs could contribute to changes in MT behavior, little is known about the effect of extracellular cues on the localization or function of +TIPs in axons.

Here, we have examined the mechanism by which Wnts induce axon terminal remodelling. Time-lapse recordings show that Wnt3a rapidly decreases the speed of growth cone advance whilst increasing growth cone size. This remodelling is induced by activation of a canonical Wnt-ß-catenin pathway that is independent of transcription. Recordings of MTs labeled with the MT plus-end binding protein EB3-green fluorescent protein (GFP) reveal that Wnt3a induces the loss of MT growth directionality resulting in MT looping. During axon elongation, APC is localized at MT tips in growth cones (Zhou et al., 2004; Gartner et al., 2006). In contrast, during axon remodelling, Wnt3a decreases endogenous APC from MT plus-ends at the leading edge. Importantly, APC knockdown mimics Wnt-induced remodelling and MT looping. These results are unexpected. Although APC is known to negatively regulate canonical Wnt signalling to the nucleus (Gordon and Nusse, 2006), its regulation and localization to MTs was thought to be independent of Wnt signalling. Our studies demonstrate a novel function for Wnt signalling in regulating MT growth directionality through changes in APC on MT plus-ends.

MATERIALS AND METHODS

Neuronal cultures and transfections

DRG neurons were isolated from embryonic day 13.5 or from newborn mice according to Kleitman et al. (Kleitman et al., 1991). Neurons were plated at 180 cells/mm2 on coverslips coated with poly-D-lysine (Sigma) (100 μg/ml) and laminin (Sigma) (20 μg/ml). Neurons were cultured in serum-free medium in the presence of NGF (Alexis Biochemicals) (50 μg/ml). Conditioned medium from GFP or Wnt3-hemagglutinin (HA)-expressing Rat1B cells or purified Wnt3a (50 ng/ml) was added 2 hours after plating. For transfections, DRG neurons were electroporated using Amaxa Biosystems. Briefly, dissociated DRGs were centrifuged at 110g for 5 minutes and resuspended in mouse nucleofector solution containing 5-10 μg of DNA. Different DNA constructs were used: enhanced GFP (EGFP), EB3- EGFP, Dvl1-HA, Gsk3βS9A-HA, Armadillo β-catenin-HA, APC1 shRNApSuper, APC2 shRNApSuper and APC3 shRNApSuper, Scrambled shRNApSuper. Expression of proteins was detected 16 hours after transfection. For glycogen synthase kinase-3 (Gsk3) inhibition neurons were treated with 100 nM 6-bromoindirubin-3′-oxime (Bio) (EMD Biosciences) or 2 μM of CHIR 99201 (kindly provided by Dr Calum Sutherland) for two hours. To block actin dynamics or to induce low levels of actin depolymerization, neurons were treated with 100 nM or 1 μM Latrunculin B (Sigma), respectively, for 30 min before addition of Wnt3a or vehicle for a period of 2 hours.

Time-lapse

Time-lapse experiments were performed on an inverted Axiovert Zeiss 200 microscope with a heated stage and CO2 chamber. Images were collected using Metamorph software. For long-term recordings (9 hours) frames were captured every 2 minutes. To analyze the movements of EB3 comets frames were taken every 3 seconds over a period of 2 to 3 minutes.

Wnt conditioned media

Wnt3-conditioned media was obtained from Rat1B cells stably transfected with HA-tagged Wnt3 cDNA. Antibiotic-resistant, non-Wnt expressing Rat1B cells were used as controls. The level of Wnt3-HA protein was monitored by western blot using anti-HA antibody (Roche diagnostics) and Wnt3 activity was assessed by β-catenin stabilization in L cells. Purified Wnt3a was purchased from R&D Systems and used at a concentration of 50 ng/ml.

Mutant mice

C57Bl/6J Dvl-1 null mice were obtained from heterozygous crosses. Genomic tail DNA was used for genotyping the animals using PCR amplification. The primers used were forward Dvl1 primer (5′tctgcccaattccacctgcttctt), the reverse Dvl1 primer (5′cgccgccgatcccctctc) and the forward Neo primer (5′aggcctacccgcttccattgctca).

APC knockdown using shRNA

NB2a neuroblastoma mouse cells were transfected with EGFP, scrambled shRNApSuper, APC1 shRNApSuper, APC2 shRNApSuper and APC3 shRNApSuper using Lipofectamine (Invitrogen). The last three vectors target different regions of the same APC gene. After 2 days of transfection, total RNA was isolated using RNeasy Mini kit (Qiagen). cDNA was synthesized using AMV RT (Promega). Amplification of cDNA samples was performed using primers APC-Fw 5′tccacaacatcattcactcacag and APC-Rv 5′tccaaagcacattccatcaa to detect APC. As control, the levels of 18S RNA were detected using 18S-Fw 5′ccgcgaaagagtcctgta and 18S-Rv 5′gggaacgcgtgcatttat primers. PCR products were separated by electrophoresis in 2% agarose gel. Two isoforms (probably due to alternative splicing) were detected for APC. The level of APC knockdown was assessed by the ratio of APC over 18s PCR products.

Immunofluorescence microscopy

Neurons were fixed in 4% PFA- 4% sucrose at room temperature for 20 minutes, permeabilized with 0.05% Triton-X-100 for 5 minutes and blocked in 5% BSA in PBS for 1 hour. When it was necessary to look only at the cytoskeleton, neurons were fixed with 3% formaldehyde and 0.2% gluteraldehyde in the presence of 0.2% Triton X100 for 10 minutes at 37°C. Primary antibodies against Dvl1 (Krylova et al., 2000), tyrosinated tubulin (Abcam), GAP-43 (Abcam), EGFP (Millipore), APC (kindly provided by Dr I. Nathke), CLIP170 (Santa Cruz), EB1 (Signal Transduction) were used. Alexa488-, Alexa546-, Alexa647- and Phalloidin-conjugated secondary antibodies (Invitrogen) were used. Images were captured with an inverted Zeiss M200 microscope using a CCD camera (Orca ER).

Image analysis and quantification

Metamorph software was used to acquire and analyze the images. 20 random fields per cover slip were acquired and analyzed. The drawing tool was used to delineate axons (defined as the longest process), MT tips and trace growth cones. Axons were measured from the axon hillock to the distant edge of the growth cone. All graphs are the result of at least 3 independent experiments. Branching order was measured by defining the first point of divergence from the main axon as secondary branches. Tertiary branches result from the next point of divergence. Growth cones with looped MTs were those containing at least 30% of their MTs bent at an angle of 90° or bigger. Kymographs were obtained using ImageJ software. Z-stacks of consecutives frames were projected for the most highly intense comets and the last frame was labelled in red to indicate directionality. Two-factor ANOVA test was used to determine statistically significant differences between treatments.

RESULTS

Wnt3a induces axonal remodelling in neonatal DRG sensory neurons

We have previously shown that Wnt3 induces axonal remodelling in NT3-responsive DRG cells from embryonic day 13.5 (E13.5) (Krylova et al., 2002). Here we show that Wnt3 also induces remodelling in neonatal DRGs (Supplemental Fig. 1A). To elucidate the sequence of events leading to Wnt-induced axon remodelling, we decided to establish a reliable system in which Wnt function can be examined. We first examined whether purified Wnt3a, a protein highly related to Wnt3, induces remodelling in DRG neurons. We found that Wnt3a induces a 30% increase in the average size of growth cones after two hours (Supplemental Fig. 1B and C), which was manifested by a shift towards larger growth cones (Supplemental Fig. 1D). Axon branching and length are also affected as the number of tertiary and quaternary branches increases (Supplemental Fig. 1B and E) whereas axon length decreases (Supplemental Fig.1 B and F). The effect of purified Wnt3a or Wnt3-conditioned medium remain unchanged for at least 22 hours as a similar increase in growth cone size and branching is observed when compared with 2 hours exposure to Wnt (Supplemental Fig. 1B, C and E). Together, these results indicate that Wnt3-conditioned media and purified Wnt3a have a similar remodelling activity in embryonic and neonatal sensory neurons and that exposure to Wnts for only 2 hours is sufficient to induce remodelling. Due to the more reproducible effect with purified Wnt3a, all subsequent experiments were performed with Wnt3a purified protein.

Wnt3a induces rapid changes in axonal behavior: analyzes by time-lapse microscopy

To examine in detail the effect of Wnts on axonal remodelling, we performed time-lapse experiments. DRG neurons were transfected with EGFP before plating and cultured for approximately 5 hours to allow gene expression. Recordings began 20 minutes prior to the addition of Wnt3a or control media and frames were taken every 2 minutes for a period of up to 9 hours after Wnt3a addition. Control axons grow at a steady rate, undergo few branching events and display no significant changes in growth cone size (Fig. 1A, Video 1A). In contrast, axons exposed to Wnt3a extend at much slower rates, branch more, and exhibit a steady increase in growth cone size (Fig. 1B, Video 1B). No differences in the number of collapsed growth cones were observed. Quantification demonstrates that Wnt3a reduces the speed of growth cone advance within the first 20 minutes of Wnt addition (data not shown). The average speed of growth cone advance, 20 minutes after addition of control media, was 0.32 μm/minute, while the average speed of growth cone advance 20 minutes after Wnt3a addition was 0.07 μm/minute. Despite the slower growth cone advance, Wnt3a increases the membrane protrusion in growth cones and at the distal portion of axons (Fig. 1B and Video 1B). Over time, control growth cones become smaller or maintain their size, whereas Wnt3a-treated growth cones slowly but steadily increase their size. This effect becomes more apparent after 60 minutes of Wnt3a exposure (Fig. 1B). On average, Wnt3a induces a 55% increase in growth cone size, whereas control growth cones decrease in size by 20%. These findings demonstrate that Wnt3a induces rapid changes in axon and growth cone behavior.

Figure 1. Wnt3a induces changes in axon behavior.

Figure 1

(A) Frames from a time-lapse recording illustrating the typical response of an axon growing in the presence of control media: steady advance is observed with only occasional pausing and no attempt of branching. Growth cone (GC) size does not significantly change. (B) Frames illustrating the typical response to Wnt3a. Upon addition of Wnt3a at time point 0, the axon stops extending, the growth cone on the right attempts to branch and both growth cones become enlarged. Bar, 20 μm. Wnt3a decreases the speed of growth cone advance within 20 minutes and increases growth cone size after 60 minutes (see Supplemental Video 1A and 1B).

Wnt-ß-catenin signalling pathway regulates axon remodelling independently of transcription

Wnts are known to signal through three main pathways to regulate cell fate, polarity and behavior. Through different receptors Wnts can activate the canonical or ß-catenin pathway resulting in Gsk3 inhibition, elevation of ß-catenin and transcriptional activation. Wnts also signal through a Rho GTPases and JNK pathway or through a calcium/calmodulin pathway (Gordon and Nusse, 2006). Although the canonical pathway has been well studied for its role in transcriptional mediated changes, recent studies demonstrate that components of this pathway interact with or regulate the cytoskeleton directly (for review see Salinas, 2007). To begin to dissect the mechanism by which Wnts induce axon remodelling, we focused our study on the canonical Wnt pathway because Gsk3 directly phosphorylates several cytoskeletal proteins, therefore changes in Gsk3 activity could affect axon behavior (Lucas et al., 1998; Goold et al., 1999; Shi et al., 2004; Gartner et al., 2006; Kim et al., 2006).

We first examined the contribution of Dvl, a protein required for Wnt signalling but that also binds to both MTs and actin filaments (Krylova et al., 2000; Torres and Nelson, 2000; Capelluto et al., 2002). To test whether Dvl mediates Wnt3a-induced axonal remodelling, we examined the effects of Dvl expression on neuronal morphology. Dvl1 causes significant changes in the axonal morphology of DRGs, as axons become shorter and thicker and growth cones are larger than GFP-expressing control axons (Fig 2A). Quantification reveals that Dvl1 increases growth cone size by 30% (Fig. 2B). In addition, expression of Dvl1 results in a 17% decrease in axonal length compared to GFP controls (Supplemental Fig. 2B) and, like Wnt3 and Wnt3a, Dvl1 expression increases the number of branches (Supplemental Fig. 2C). To examine the Wnt pathway involved in remodelling, we tested the contribution of Gsk3ß, a serine/threonine kinase that is inhibited by Wnts in the canonical pathway (Gordon and Nusse, 2006). Inhibition of Gsk3 by Bio and CHIR 99021, two specific pharmacological inhibitors (Ring et al., 2003; Cohen and Goedert, 2004), induces extensive axon remodelling (Fig. 2C, D, and Supplemental Fig. 2D). Interestingly, time course experiments showed that inhibition of Gsk3 by Bio induces a significant enlargement of growth cone size after 60 minutes of treatment (Supplemental Fig. 2E). To further test the role of Gsk3, we examined the effect of Wnt3a on DRG neurons expressing a constitutive active form of Gsk3ß (Gsk3ß S9A). We found that expression of Gsk3ß S9A partially blocks the Wnt effect on growth cone size (Fig. 2D). These results suggest that Wnt3a regulates axon remodelling through a pathway involving Dvl1 and inhibition of Gsk3ß.

Figure 2. Wnt3a-induced axonal remodelling is mimicked by Dvl1 or β-catenin and inhibition of Gsk3ß but does not require transcription.

Figure 2

(A) Expression of Dvl1 in DRG neurons induces growth cone enlargement (arrowheads), axon shortening and branching compared to control EGP-expressing neurons. Bar, 30 μm. (B) Quantification of growth cone size reveals a 30% increase in Dvl1-expressing cells compared to controls. (C) Application of the Gsk3 specific pharmacological inhibitor Bio for 2 hrs mimics the effect of Wnt3a on axon remodelling (arrowheads). Bar, 30 μm. (D) Quantification shows a significant increase in the size of growth cones (30%) in the presence of Bio. Expression of a constitutive form of Gsk3β (Gsk3βS9A) partially blocks the effect of Wnt3a on growth cone size. (E) Expression of β-catenin-Arm (β-cat-Arm) induces growth cone enlargement in DRG neurons (arrowheads) compared to control EGP-expressing neurons. Bar, 30 μm. (F) Quantification of growth cone size reveals a 60% increase in β-catenin-Arm-expressing cells compared to controls. (G) Wnt3a induces axonal remodelling (arrowheads) in the presence of actinomycin D (Act D). Bar, 30 μm. (H) Average growth cone size is significantly larger in DRGs exposed to both Wnt3a and actinomycin D than in controls and indistinguishable from neurons treated with both Wnt3a and vehicle. Values are mean ± SEM of three independent experiments. * P< 0.05; *** P< 0.001. n = 50.

We then examined the role of ß-catenin, which lies downstream of Gsk3ß. We found that expression of ß-catenin mimics the effect of Wnt by inducing growth cone enlargement (data not shown). Results from time-lapse experiments demonstrated that Wnt3a induces changes in axon growth within 20 minutes. This finding raises the possibility that Wnt3a may regulate axon behavior through a nuclear independent mechanism, as observed with a number of guidance molecules (Campbell and Holt, 2001). Consistent with this finding, expression of a mutant ßcatenin (ß-catenin-Arm), which does not signal to the nucleus due to the lack of the transactivating domain, also induces remodelling (Fig. 2E and F). These results suggest that Wnt signalling modulates axon remodelling through ß-catenin but independently of transcription.

To shed further light on the mechanism by which Wnt3a regulates axonal morphology, we inhibited transcription with actinomycin D. DRG neurons were treated with 10 μg/ml actinomycin D for 30 minutes before addition of Wnt3a and examined after two hours of exposure to Wnt. We have previously shown that this concentration of actinomycin D completely blocks transcription (Ciani et al., 2004). Actinomycin D does not block the Wnt3a effect on growth cones size (Fig. 2G and H), indicating that Wnt3a induces axonal remodelling independently of transcription.

Wnt3a signalling regulates axon remodelling through changes in microtubule organization

Our previous studies in mossy fibre axons have shown that Wnt induces changes in the MT cytoskeleton (Hall et al., 2000). We therefore decided to examine whether Wnt signalling regulates the MT cytoskeleton during remodelling in DRG neurons. In control growth cones, MTs splay in the central region and invade the peripheral domain. In contrast, Wnt3a or expression of Dvl1 significantly increases the proportion of growth cones containing looped MTs (Fig. 3A, C and Supplemental Fig. 2A). Interestingly, MT loops have been described in pausing growth cones (Dent et al., 1999). Thus, our data suggest that the decrease in growth cone advance induced by Wnt3a is associated with MT looping.

Figure 3. Wnt3a and Dvl1 regulate the amount and organization of microtubules along axons and in growth cones.

Figure 3

(A) DRG neurons from wild type and Dvl1 mutant mice were exposed to vehicle or Wnt3a for two hours. In wild type neurons Wnt3a induces the formation of looped MTs at growth cones. In contrast, Dvl1 mutant neurons do not remodel as their axons are long and terminate in small growth cones. Bars, top, 30 μm; bottom, 15 μm. (B) Quantification shows that Wnt3a does not induce growth cone remodelling in Dvl1 mutant neurons. (C) Graph illustrating that Wnt3a does not increase the percentage of growth cones with looped MTs in Dvl1 mutant neurons. Values are mean ± SEM of three independent experiments. ** P< 0.01. n = 100.

We then examined whether Dvl1 was required for axon remodelling and MTs reorganization. Neurons from Dvl1 mutant mice were exposed to Wnt3a for two hours and axon remodelling was assessed by the distribution of dynamic MTs. In the absence of Wnt3a, no apparent differences in axonal outgrowth were observed between Dvl1 mutant and wild type neurons (Fig. 3A). In contrast, Dvl1 mutant neurons contain splayed MTs in growth cones even in the presence of Wnt indicating that they are unable to respond to Wnt3a (Fig. 3A). Quantification reveals that the growth cone size of Wnt3a-treated Dvl1 mutant neurons remains the same as control untreated neurons (Fig. 3B) and that Wnt3a does not increase the number of cells containing looped MTs when compared to untreated wild type cells (Fig. 3C). These results demonstrate that Dvl1 is required for Wnt3a-induced remodelling and MT organization.

The increased membrane protrusion induced by Wnt3a (see Fig. 1 and Video 1B) raises the possibility that changes in the actin cytoskeleton might contribute to the Wnt-mediated growth cone remodelling. We therefore examined whether Wnt3a induces axon remodelling and MT looping in the presence of Latrunculin B, an actin-depolymerizing drug. We used low concentrations of Latrunculin B in which actin dynamics is compromised without resulting in total actin depolymerization (Zmuda and Rivas, 2000; Wakatsuki et al., 2001). Pretreatment with 100 nM Latrunculin B significantly decreases the length of filopodia in control and Wnt3a treated neurons (Supplemental Fig. 3A and C). However, Wnt3a still induces remodelling and MT looping. At 1 μM Latrunculin B, when growth cones begin to collapse, Wnt3a also induces enlargement of growth cones and the formation of looped MTs (Supplemental Fig. 3A and B). Although the possibility that Wnt3a affects the actin cytoskeleton can not be excluded, these results indicate that changes in MT reorganization induced by Wnt3a significantly contributes to the enlargement of growth cones and that Wnts directly signal to the MT cytoskeleton.

Wnt3a and Dvl1 regulate the organization and directionality of microtubule growth

We next examined in detail the organization of MTs in cultured DRG neurons. As mentioned above, Wnt3a significantly increases the proportion of growth cones containing looped MTs (Fig. 3A). This appearance of looped MTs could be explained by the continued polymerization of MTs in non-advancing growth cones. Alternatively, Wnt3a could induce a loss of direction of MT growth as they enter at the growth cone.

To begin to distinguish between these two possibilities, we decided to examine the dynamic behavior of MTs. We therefore labelled the plus-ends of MTs by expressing EB3-GFP, a MT plus-end binding protein (Nakagawa et al., 2000), which has been used to examine MT behavior in neurons (Stepanova et al., 2003; Hasaka et al., 2004). In DRG cells, EB3-GFP forms puncta along MTs that rapidly disappear after addition of nocodazole, indicating that EB3-GFP binds to actively growing MTs (data not shown). Time-lapse recordings of EB3-GFP-labelled MTs enabled us to examine the direction of MT growth. In control neurons, EB3-GFP forms comet-like dashes along the axon shaft and in growth cones, comet movements reflect the typical splaying behavior of MTs as they move towards the leading edge of the growth cone (Fig. 4A and Supplemental Video 2A). In contrast, in Wnt3a-treated axons, many of the EB3-GFP comets bend and move across the growth cone before they reach the leading edge (Fig. 4A and Supplemental Video 2B). Similarly, expression of Dvl1 induces a significant increase in the number of comets moving across the growth cone, even in growth cones of similar size to control (Fig. 4B and Supplemental Video 2C). Quantification revealed that 77% of the EB3-GFP comets in control neurons grow forwards (towards the leading edge), 19% of them grow backwards (away from the leading edge, towards the neck of the growth cone and cell body) and a small proportion, 4%, move across the growth cone (defined as MTs moving perpendicular ± 30° to the direction of growth) (Fig. 4B). In Wnt3a-treated neurons and in Dvl1-expressing neurons, although no statistically significant differences were found in the percentage of comets moving forwards or backwards compared to controls, a tendency for fewer comets moving forwards was observed (Fig. 4B). However, a significantly larger percentage of EB3-GFP comets were found to move across the growth cone in Wnt3a-treated neurons (18%, p<0.05). Interestingly, in growth cones exposed to Wnt3a, some MTs display a kinking behavior not observed in control growth cones (Fig. 4A insert). Because MTs change their direction of growth as they enter the growth cone rather than bending when they reach the leading edge, our findings suggest that MT looping induced by Wnt-Dvl signalling results from to the loss of MT growth directionality.

Figure 4. Wnt signalling induces the loss of directionality of microtubule growth.

Figure 4

(A) Kymograph of ten consecutives frames of a control and Wnt3a-treated growth cone expressing EB3-GFP; the last frame was labeled in red to indicate directionality. In control neurons, most MTs splay as they enter the growth cone (red arrows). In the presence of Wnt3a, the direction of MT growth is altered as more MTs grow across the growth cone (black arrows). Insert shows a trace of one representative microtubule from each growth cone. In Wnt3a-treated growth cones MTs kink several times instead of growing with a persistent directionality. Bar, 15 μm. (B) Diagram illustrates how the direction of EB3 comets was quantified. Quantification shows that Wnt3a and Dvl1 significantly increase the number of comets moving across the growth cone whilst decreasing the number moving forwards, towards the leading edge. The direction of EB3-GFP comets from at least 12 growth cones was analyzed per condition in four independent experiments. Values are mean ± SEM of at least three independent experiments. * P<0.05. n = 200.

Wnt signalling decreases the level of APC at microtubule plus-ends located at the leading edge of growth cones

+TIPs have been implicated in MT capture and direction of growth (for review see Kalil and Dent, 2004, 2005). Therefore, it is possible that the loss of MT directionality, induced by Wnt3a-Dvl signalling, is due to changes in the localization or levels of MT plus-end binding proteins. To address this issue, we examined the distribution of APC, a component of the canonical Wnt pathway (Bienz, 2002) that directly binds to MTs (Zumbrunn et al., 2001). Because Gsk3ß phosphorylates APC resulting in a decreased interaction with MTs (Zumbrunn et al., 2001), we predicted that Wnt3a, which inhibits Gsk3ß, would increase the level of APC bound to MTs. In DRG neurons, APC localizes to MTs along the axon and at the periphery of growth cones, labeling MT plus-ends (Fig. 5A). Surprisingly, when neurons were treated with Wnt3a for two hours a significant decrease in the level of APC at MT plus-ends at the leading edge of growth cones was observed (Fig. 5A and C). Moreover, APC remains unchanged along the axon shaft of DRG neurons treated with Wnt3a (data not shown) indicating that the decrease in APC observed at the leading edge of the growth cone is not due to a general down regulation of APC in the entire neuron. We then examined two other +TIPs, CLIP-170 and EB1, which promote MT rescue and stability, respectively (Tirnauer et al., 1999; Komarova et al., 2002; Rogers et al., 2002; Wen et al., 2004). Interestingly, Wnt3a does not affect the level of EB1 or CLIP-170 at MT plus-ends in growth cones (Supplemental Fig. 4). These results show that Wnt signalling specifically regulates the level of APC at MT plus-ends located at the periphery of growth cones.

Figure 5. Wnt3a decreases the level of APC at microtubule plus-ends in the periphery of growth cones.

Figure 5

(A) In control DRG neurons, endogenous APC localizes along axonal MTs and at the plus-ends of splayed MTs at the leading edge of the growth cone. Application of Wnt3a for 2 hours decreases the level of APC at MT plus-ends at the leading edge of the growth cone. Enlarged images of growth cones show the significant loss of APC at MT plus-ends (arrowheads) when neurons are exposed to Wnt3a. Bar, top, 15 μm; bottom, 5μm. (B) Time course experiment shows that APC is lost from MT tips by 30 min after Wnt3a exposure (arrowheads). (C) Quantification shows that after 10 min of exposure to Wnt3a the level of APC at the tips of MTs is similar to control untreated neurons, whereas after 30 min of application a 25% loss of APC is observed at the tips of MTs, reaching up to a 55% after 120 min of Wnt exposure. (D) Quantification shows a significant increase in growth cone size is evident after 60 min on Wnt treatment. (E) MT looping correlates with growth cone enlargement. Growth cones from DRG neurons in presence of Wnt3a exhibit more looped MT after 60 min of Wnt exposure. Values are mean ± SEM of at least three independent experiments * P< 0.05; ** P< 0.01; *** P< 0.001. n= 100.

To test whether the loss of endogenous APC is correlated with growth cone remodelling, time-course experiments were performed. We found that Wnt3a induces a significant loss of APC from MT plus-ends within 30 minutes, before a statistically significant increase in growth cone size is detected (Fig. 5B, C and D). Similarly, the number of growth cones with looped MTs significantly increases after 60 minutes (Fig. 5E). Thus, the loss of APC from MT plus-ends precedes growth cone enlargement and the appearance of looped MTs.

We then examined the contribution of Dvl and Gsk3ß in APC localization. In neurons from Dvl1 mutant mice Wnt3a does not affect the number of MT tips with APC (Fig. 6B). In contrast, inhibition of Gsk3 induces a significant decrease in the percentage of MTs with APC at their plus-ends in wild type or in Dvl1 mutant neurons (Fig. 6A and D). Consistently, inhibition of Gsk3 induces axon remodelling in Dvl1 mutant neurons (Fig. 6A and C). These results demonstrate that Dvl1 is required for changes in the localization of APC and that Gsk3ß lies downstream of Dvl1.

Figure 6. Pharmacological inhibition of Gsk3 decreases the level of APC at microtubule plus-end of DRG neurons from wild type or Dvl1 mutant mice.

Figure 6

(A) In DRG neurons from wild type mice the Gsk3 inhibitor Bio induces the loss of APC from MT tips at the periphery of the growth cone (arrowheads). Similarly, DRG neurons from Dvl1 mutant mice show a decrease in the level of APC at the tips of MTs when compared to control neurons (arrowheads). Bar, 15 μm. (B) DRG neurons from Dvl1 mutant mice do not show a decrease in the number of MT plus-ends containing APC after Wnt3a treatment when compare with untreated neurons. (C) Quantification shows that Gsk3 inhibition with Bio increases growth cone size at the same extent on DRG neurons from wild type or Dvl1 mutant mice. (D) Quantification shows that the percentage of MT tips with APC per growth cone decreases similarly in wild type or Dvl1 mutant DRG neurons when exposed to Bio. Values are mean ± SEM of at least three independent experiments. *** P< 0.001. n= 100.

Knockdown of APC induces microtubule looping in growth cones and increases growth cone size

We then examined whether APC was involved in Wnt-mediated MT looping using a loss of function approach. For these experiments, neurons were transfected with three different APC shRNAs or with scrambled control shRNA constructs. APC1 and APC2 shRNAs induce a 75% and APC3 shRNA a 60% decrease in the level of endogenous APC mRNA when compared to neurons expressing scrambled shRNA as control (Supplemental Fig. 5A and B). DRG neurons were examined for possible changes in MT looping and growth cone remodelling. In cultures from scrambled shRNA expressing neurons only 25% of growth cones contain looped MTs, similar to control untransfected neurons (Fig. 7A). In contrast, expression of APC1 shRNA induces a significant increase (66%) in the number of growth cones with looped MTs (scrambled shRNA: 25±3, APC1 shRNA: 73±3) (Fig. 7A). Importantly, increased MT looping correlates with an increase in growth cone size (Growth cone size: scrambled shRNA: 33±2, APC1 shRNA 71±6 μm2). We then examined whether the localization of APC at MT tips was affected in growth cones of APC1 shRNA expressing neurons. Indeed, a 40% of the endogenous APC is no longer present at MT plus-ends (scrambled shRNA: 86±4.1, APC1 shRNA: 51±4.7) as observed when neurons were treated with Wnt3a (Fig. 5A and 6B). Similar results were obtained using APC2 and APC3 shRNA (Supplemental Fig. 5C, D and E). Importantly, all these effects were also observed in Dvl1−/− neurons expressing APC shRNA, confirming again that APC lies downstream of Dvl (scrambled shRNA: 88±2.10, APC1 shRNA 52±5.2, thus inducing a 40% decrease) (Fig. 7B). These experiments demonstrate that APC is a major target of Wnt-Dvl signalling that regulates axon remodelling and MT looping.

Figure 7. APC knockdown in wild type or Dvl1 DRG neurons induces the formation of looped microtubules and enlargement of growth cone size.

Figure 7

(A) DRG neurons co-expressing scrambled shRNA construct and EGFP have small growth cones like control neurons, whereas DRG neurons co-expressing an APC1 shRNA construct and EGFP have enlarged growth cones with looped MTs. Bars, top 30 μm; bottom, 5 μm. See Results section for quantifications of number of growth cones with looped MTs, size of growth cones and % of MT tips containing APC. (B) Dvl1 mutant DRG neurons exhibit enlarged growth cones with looped MT when co-expressing APC1 shRNA construct and EGFP. In contrast, Dvl1 mutant DRG neurons co-expressing scrambled shRNA construct and EGFP exhibit growth cones with comparable size to control neurons. Growth cones show the significant loss of APC at MT tips (arrowheads). Bars, top, 30 μm; bottom, 5 μm. See Results section for quantification of percentage of MT tips with APC per growth cone. (C) Model for Wnt signalling in the regulation of MT directionality. Activation of Wnt-Dvl1 signalling pathway regulates APC localization on MT plus-ends at the periphery of the growth cone, resulting in MT looping and enlargement of growth cones. Values are mean ± SEM of at least three independent experiments. ** P< 0.01; *** P< 0.001. n= 100.

DISCUSSION

The precise mechanisms by which axon guidance or target-derived signals modulate the cytoskeleton to elicit changes in axon behavior and morphology are poorly understood. Wnt3 has previously been shown to act as a retrograde signal that controls the terminal arborization of a subset of embryonic DRG neurons (NT-3 responsive neurons) at the time when sensory-motor connections are forming in the vertebrate spinal cord (Krylova et al., 2002). To shed light on the mechanism by which Wnts regulate axon growth and remodelling, we first examined the effects of Wnt proteins on the behavior of axons and the axonal cytoskeleton in live cells. Time-lapse recordings reveal that Wnt3a rapidly reduces the rate of axonal extension (within the first 20 minutes) and subsequently increases membrane protrusion causing a significant increase in growth cone size. This response time is similar to that observed with typical axon guidance molecules (Fournier et al., 2000; Aizawa et al., 2001; Dent et al., 2004). However, the behavior elicited by Wnt3a is distinct, because instead of promoting extension or repulsion, Wnt3a reduces axon extension by increasing growth cone pausing and growth cone size and branching. Therefore, the axon behavior observed on neurons exposed to Wnt is more consistent with a role for Wnt3a as a target-derived signal that retrogradely regulates terminal arborization of axons before synapses begin to form.

How does Wnt3a influence axon behavior? Signalling through Wnt receptors results in the activation of Dvl. In the canonical Wnt pathway, Dvl activation leads to inhibition of Gsk3ß, accumulation of ß-catenin, and transcriptional activation through the LEF/TCF transcription factors (Reya et al., 2003). Although Dvl1 is required for axon remodelling and inhibition of Gsk3ß mimics Wnt-induced remodelling, our new studies show that transcription is not required. Interestingly, expression of full-length or a mutant ß-catenin lacking its transactivating domain fully mimics the effect of Wnts on growth cone size. Thus, the Wnt3a-ß-catenin pathway, through inhibition of Gsk3ß, directly signals to the cytoskeleton.

During remodelling, Wnt3a causes dramatic changes in the organization of MTs. In contrast to the typical splayed distribution of MTs in growth cones, Wnt3a treated growth cones contain looped MTs. Conversely, Dvl1 mutant neurons, that do not remodel in the presence of Wnts, exhibit typical splayed MTs in the presence of Wnt3a. Our data strongly suggest that Wnt-mediated axon remodelling is due to increased MT looping at remodelled growth cones.

To what extent does MT looping contribute to growth cone remodelling? Wnt3a increases membrane protrusion suggesting changes in actin dynamics. Our experiments, using low levels of Latrunculine B, indicate that Wnt3a can still induce MT looping and growth cone enlargement when actin dynamics is blocked. Although a possible effect of Wnt on actin cannot be excluded, our results strongly suggest that MT reorganization significantly contributed to Wnt-mediated remodelling at the growth cone.

MT looping could directly contribute to changes in growth cone behavior observed during terminal remodelling. Looped MTs have been previously observed in pausing and enlarged growth cones (Tsui et al., 1984; Tanaka and Kirschner, 1991; Dent et al., 1999; Dent and Kalil, 2001; Schaefer et al., 2002). Interestingly, looped MTs have also been observed in synaptic boutons at the Drosophila NMJ (Packard et al., 2002) where they are implicated in the regulation of synaptic growth (Roos et al., 2000). MT looping could result from the continuous polymerization of tubulin in a paused growth cone, which could cause MTs to bend backwards when they reach the leading edge. Alternatively, looped MTs could form by their loss of directional growth due to direct changes on the microtubule cytoskeleton or by influencing actin retrograde flow. Our time-lapse recordings of neurons expressing EB3-GFP show that Wnt3a and Dvl1 increase the number of MTs that bend and grow across the growth cone instead of exhibiting a typical splayed behavior observed during axon outgrowth. In Wnt3a-treated neurons, some MTs kink several times during polymerization at the center of the growth cone, instead of growing with a persistent trajectory as observed in control growth cones. These changes in MT behavior are observed before MTs reach the periphery of the growth cone, consistent with the notion that Wnt signalling regulates the direction of MT growth. Importantly, this loss of directionality could contribute to the continued MT growth resulting in increased content of MTs, which are no longer tethered to the leading edge of the growth cone.

Gsk3ß has been implicated in the regulation of axon growth. In cerebellar granule cells, mossy fibres and DRG neurons, as reported here, inhibition of Gsk3ß results in decreased axon extension and increased growth cone size (Lucas et al., 1998; Goold et al., 1999; Hall et al., 2000; Krylova et al., 2002). However, inhibition of Gsk3ß has also been reported to stimulate axon outgrowth (Zhou et al., 2004). A recent study has provided a possible explanation for this apparent paradox. Different levels of Gsk3ß inhibition elicit different responses in the behavior of axons as weak inhibition results in axon outgrowth, whereas strong inhibition decreases extension (Kim et al., 2006). Interestingly, Wnt3a has been reported to increase axon outgrowth in NGF-responsive DRG sensory neurons after long exposure (Lu et al., 2004). These results, together with ours, suggest that the same Wnt protein can elicit distinct responses, possibly by inducing different levels of Gsk3ß inhibition depending on the cellular context and/or cell type.

Wnt signalling regulates MT looping and growth cone remodelling through changes in the MT plus-end binding protein APC. At the leading edge of remodelled growth cones, Wnt signalling through inhibition of Gsk3ß decreases the number of MT plus-ends containing endogenous APC. Interestingly, Wnt3a does not affect the levels of other MT plus-end binding proteins such as CLIP170 and EB1, which have been shown to promote MT rescue (Komarova et al., 2002), MT stability and elongation (Wen et al., 2004; Strickland et al., 2005). The specific effect of Wnt on APC is observed within 30 minutes, just before a significant increase in growth cone size and in the number of looped MTs become evident. Importantly, knockdown of APC in DRG neurons induces MT looping and the formation of large growth cones as observed with Wnt3a. Taken together our results demonstrate that Wnt3a modulates MT directionality by specifically affecting APC at MT plus-ends (Fig.7C) and reveal a novel function of APC in the regulation of MT growth direction.

APC at the axon tip modulates the rate of axon elongation, pausing and remodelling. APC has previously been implicated in MT capture at the leading edge of migrating cells (Watanabe et al., 2004; Reilein and Nelson, 2005) and its localization at MT plus-ends is crucial for cell polarization (Etienne-Manneville and Hall, 2003; Etienne-Manneville et al., 2005). Moreover, the localization of APC at the tip of neurites is essential for axon determination during early stages of neurite outgrowth (Shi et al., 2004). In extending neurons, APC is localized at the growth cones of actively extending neurites (Zhou et al., 2004) and the levels of APC at the end of neuronal processes correlate with increased neurite growth (Votin et al., 2005). Consistent with these findings, asymmetric inactivation of APC by micro-scale chromophore-assisted laser inactivation results in growth cone turning due to axon extension on the side containing APC (Koester et al., 2007). But how is APC localization regulated? Studies in migrating fibroblasts indicate that Wnt5a, a non-canonical Wnt, induces the accumulation of APC at the leading edge in the direction of migration through the activation of aPKC (Schlessinger et al., 2007). Interestingly, a recent study showed that in axons, Wnt5a also activates aPKC to determine axon specification, a process that requires rapid outgrowth (Zhang et al., 2007). Although the role of APC in Wnt5a mediated cell protrusion or axon extension has not been examined, our studies suggest a central role for APC in Wnt mediated axon responses. Distinct Wnt pathways may determine axon outgrowth versus growth cone pausing and remodelling. Activation of a Wnt pathway that requires aPKC stimulates rapid axon extension. In contrast, activation of a divergent canonical pathway decreases APC from MT plus-ends leading to the loss of MT growth directionality, resulting in axon remodelling. Here we provide the first evidence that Wnts can directly affect the localization of APC to induce changes in axon behavior.

Supplementary Material

Movie 1
Download video file (14.1MB, mov)
Movie 2
Download video file (7.4MB, mov)
Movie 3
Download video file (18.4MB, mov)
Movie 4
Download video file (10.4MB, mov)
Movie 5
Download video file (751.8KB, mov)
supplementary Data

ACKNOWLEDGEMENT

We would like to thank to Drs Daniel Sussman and Tony Wynshaw-Boris for generously providing the Dvl1 mutant mice, Niels Galjart, Britta Eickholt, Rober Kypta, Avri Ben-Ze'ev, Inke Nathke, Jos Veldscholte, Jeremy Nathans and Calum Sutherland for constructs and reagents, and Peter Baas, Louise Crammer and Britta Eickholt for helpful discussions. We also thank members of our laboratory for useful discussion and comments on the manuscript. The Wellcome Trust and the BBSRC supported this work.

ABREVIATIONS

MT

Microtubule

Dvl

Disheveled

Gsk3

glycogen synthase kinase-3

+TIPs

microtubule plus-end binding proteins

APC

adenomatous polyposis coli.

REFERENCES

  1. Ahmad-Annuar A, Ciani L, Simeonidis I, Herreros J, Fredj NB, Rosso SB, Hall A, Brickley S, Salinas PC. Signaling across the synapse: a role for Wnt and Dishevelled in presynaptic assembly and neurotransmitter release. J Cell Biol. 2006;174:127–139. doi: 10.1083/jcb.200511054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Aizawa H, Wakatsuki S, Ishii A, Moriyama K, Sasaki Y, Ohashi K, Sekine-Aizawa Y, Sehara-Fujisawa A, Mizuno K, Goshima Y, Yahara I. Phosphorylation of cofilin by LIM-kinase is necessary for semaphorin 3A-induced growth cone collapse. Nat Neurosci. 2001;4:367–373. doi: 10.1038/86011. [DOI] [PubMed] [Google Scholar]
  3. Bienz M. The subcellular destinations of APC proteins. Nat Rev Mol Cell Biol. 2002;3:328–338. doi: 10.1038/nrm806. [DOI] [PubMed] [Google Scholar]
  4. Campbell DS, Holt CE. Chemotropic responses of retinal growth cones mediated by rapid local protein synthesis and degradation. Neuron. 2001;32:1013–1026. doi: 10.1016/s0896-6273(01)00551-7. [DOI] [PubMed] [Google Scholar]
  5. Capelluto DG, Kutateladze TG, Habas R, Finkielstein CV, He X, Overduin M. The DIX domain targets dishevelled to actin stress fibres and vesicular membranes. Nature. 2002;419:726–729. doi: 10.1038/nature01056. [DOI] [PubMed] [Google Scholar]
  6. Ciani L, Salinas PC. WNTs in the vertebrate nervous system: from patterning to neuronal connectivity. Nat Rev Neurosci. 2005;6:351–362. doi: 10.1038/nrn1665. [DOI] [PubMed] [Google Scholar]
  7. Ciani L, Krylova O, Smalley MJ, Dale TC, Salinas PC. A divergent canonical WNT-signaling pathway regulates microtubule dynamics: dishevelled signals locally to stabilize microtubules. J Cell Biol. 2004;164:243–253. doi: 10.1083/jcb.200309096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cohen P, Goedert M. GSK3 inhibitors: development and therapeutic potential. Nat Rev Drug Discov. 2004;3:479–487. doi: 10.1038/nrd1415. [DOI] [PubMed] [Google Scholar]
  9. Dent EW, Kalil K. Axon branching requires interactions between dynamic microtubules and actin filaments. J Neurosci. 2001;21:9757–9769. doi: 10.1523/JNEUROSCI.21-24-09757.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Dent EW, Barnes AM, Tang F, Kalil K. Netrin-1 and semaphorin 3A promote or inhibit cortical axon branching, respectively, by reorganization of the cytoskeleton. J Neurosci. 2004;24:3002–3012. doi: 10.1523/JNEUROSCI.4963-03.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dent EW, Callaway JL, Szebenyi G, Baas PW, Kalil K. Reorganization and movement of microtubules in axonal growth cones and developing interstitial branches. J Neurosci. 1999;19:8894–8908. doi: 10.1523/JNEUROSCI.19-20-08894.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Etienne-Manneville S, Hall A. Cdc42 regulates GSK-3beta and adenomatous polyposis coli to control cell polarity. Nature. 2003;421:753–756. doi: 10.1038/nature01423. [DOI] [PubMed] [Google Scholar]
  13. Etienne-Manneville S, Manneville JB, Nicholls S, Ferenczi MA, Hall A. Cdc42 and Par6-PKCzeta regulate the spatially localized association of Dlg1 and APC to control cell polarization. J Cell Biol. 2005;170:895–901. doi: 10.1083/jcb.200412172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fournier AE, Kalb RG, Strittmatter SM. Rho GTPases and axonal growth cone collapse. Methods Enzymol. 2000;325:473–482. doi: 10.1016/s0076-6879(00)25467-0. [DOI] [PubMed] [Google Scholar]
  15. Galjart N. CLIPs and CLASPs and cellular dynamics. Nat Rev Mol Cell Biol. 2005;6:487–498. doi: 10.1038/nrm1664. [DOI] [PubMed] [Google Scholar]
  16. Gartner A, Huang X, Hall A. Neuronal polarity is regulated by glycogen synthase kinase-3 (GSK-3beta) independently of Akt/PKB serine phosphorylation. J Cell Sci. 2006;119:3927–3934. doi: 10.1242/jcs.03159. [DOI] [PubMed] [Google Scholar]
  17. Goold RG, Owen R, Gordon-Weeks PR. Glycogen synthase kinase 3beta phosphorylation of microtubule-associated protein 1B regulates the stability of microtubules in growth cones. J Cell Sci. 1999;112(Pt 19):3373–3384. doi: 10.1242/jcs.112.19.3373. [DOI] [PubMed] [Google Scholar]
  18. Gordon MD, Nusse R. Wnt signaling: multiple pathways, multiple receptors, and multiple transcription factors. J Biol Chem. 2006;281:22429–22433. doi: 10.1074/jbc.R600015200. [DOI] [PubMed] [Google Scholar]
  19. Hall AC, Lucas FR, Salinas PC. Axonal remodeling and synaptic differentiation in the cerebellum is regulated by WNT-7a signaling [see comments] Cell. 2000;100:525–535. doi: 10.1016/s0092-8674(00)80689-3. [DOI] [PubMed] [Google Scholar]
  20. Hasaka TP, Myers KA, Baas PW. Role of actin filaments in the axonal transport of microtubules. J Neurosci. 2004;24:11291–11301. doi: 10.1523/JNEUROSCI.3443-04.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kalil K, Dent EW. Hot +TIPS: guidance cues signal directly to microtubules. Neuron. 2004;42:877–879. doi: 10.1016/j.neuron.2004.06.009. [DOI] [PubMed] [Google Scholar]
  22. Kalil K, Dent EW. Touch and go: guidance cues signal to the growth cone cytoskeleton. Curr Opin Neurobiol. 2005;15:521–526. doi: 10.1016/j.conb.2005.08.005. [DOI] [PubMed] [Google Scholar]
  23. Kim WY, Zhou FQ, Zhou J, Yokota Y, Wang YM, Yoshimura T, Kaibuchi K, Woodgett JR, Anton ES, Snider WD. Essential roles for GSK-3s and GSK-3-primed substrates in neurotrophin-induced and hippocampal axon growth. Neuron. 2006;52:981–996. doi: 10.1016/j.neuron.2006.10.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kleitman N, Wood PM, Bunge RP. Tissue culture methods for the study of myelination. In: Banker G, Goslin K, editors. Culturing Nerve Cells. The MIT Press; Cambridge, Massachusetts: 1991. pp. 351–353. [Google Scholar]
  25. Koester MP, Muller O, Pollerberg GE. Adenomatous polyposis coli is differentially distributed in growth cones and modulates their steering. J Neurosci. 2007;27:12590–12600. doi: 10.1523/JNEUROSCI.2250-07.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Komarova YA, Akhmanova AS, Kojima S, Galjart N, Borisy GG. Cytoplasmic linker proteins promote microtubule rescue in vivo. J Cell Biol. 2002;159:589–599. doi: 10.1083/jcb.200208058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Krylova O, Messenger MJ, Salinas PC. Dishevelled-1 regulates microtubule stability: a new function mediated by glycogen synthase kinase-3beta. J Cell Biol. 2000;151:83–94. doi: 10.1083/jcb.151.1.83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Krylova O, Herreros J, Cleverley K, Ehler E, Henriquez J, Hughes S, Salinas P. WNT-3, Expressed by Motoneurons, Regulates Terminal Arborization of Neurotrophin-3-Responsive Spinal Sensory Neurons. Neuron. 2002;35:1043. doi: 10.1016/s0896-6273(02)00860-7. [DOI] [PubMed] [Google Scholar]
  29. Lu W, Yamamoto V, Ortega B, Baltimore D. Mammalian Ryk is a Wnt coreceptor required for stimulation of neurite outgrowth. Cell. 2004;119:97–108. doi: 10.1016/j.cell.2004.09.019. [DOI] [PubMed] [Google Scholar]
  30. Lucas FR, Goold RG, Gordon-Weeks PR, Salinas PC. Inhibition of GSK-3beta leading to the loss of phosphorylated MAP-1B is an early event in axonal remodelling induced by WNT-7a or lithium. J Cell Sci. 1998;111:1351–1361. doi: 10.1242/jcs.111.10.1351. [DOI] [PubMed] [Google Scholar]
  31. Nakagawa H, Koyama K, Murata Y, Morito M, Akiyama T, Nakamura Y. EB3, a novel member of the EB1 family preferentially expressed in the central nervous system, binds to a CNS-specific APC homologue. Oncogene. 2000;19:210–216. doi: 10.1038/sj.onc.1203308. [DOI] [PubMed] [Google Scholar]
  32. Packard M, Koo ES, Gorczyca M, Sharpe J, Cumberledge S, Budnik V. The Drosophila Wnt, wingless, provides an essential signal for pre- and postsynaptic differentiation. Cell. 2002;111:319–330. doi: 10.1016/s0092-8674(02)01047-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Reilein A, Nelson WJ. APC is a component of an organizing template for cortical microtubule networks. Nat Cell Biol. 2005;7:463–473. doi: 10.1038/ncb1248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Reya T, Duncan AW, Ailles L, Domen J, Scherer DC, Willert K, Hintz L, Nusse R, Weissman IL. A role for Wnt signalling in self-renewal of haematopoietic stem cells. Nature. 2003;423:409–414. doi: 10.1038/nature01593. [DOI] [PubMed] [Google Scholar]
  35. Ring DB, Johnson KW, Henriksen EJ, Nuss JM, Goff D, Kinnick TR, Ma ST, Reeder JW, Samuels I, Slabiak T, Wagman AS, Hammond ME, Harrison SD. Selective glycogen synthase kinase 3 inhibitors potentiate insulin activation of glucose transport and utilization in vitro and in vivo. Diabetes. 2003;52:588–595. doi: 10.2337/diabetes.52.3.588. [DOI] [PubMed] [Google Scholar]
  36. Rogers SL, Rogers GC, Sharp DJ, Vale RD. Drosophila EB1 is important for proper assembly, dynamics, and positioning of the mitotic spindle. J Cell Biol. 2002;158:873–884. doi: 10.1083/jcb.200202032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Roos J, Hummel T, Ng N, Klambt C, Davis GW. Drosophila Futsch regulates synaptic microtubule organization and is necessary for synaptic growth. Neuron. 2000;26:371–382. doi: 10.1016/s0896-6273(00)81170-8. [DOI] [PubMed] [Google Scholar]
  38. Salinas PC. Modulation of the microtubule cytoskeleton: a role for a divergent canonical Wnt pathway. Trends Cell Biol. 2007;17:333–342. doi: 10.1016/j.tcb.2007.07.003. [DOI] [PubMed] [Google Scholar]
  39. Schaefer AW, Kabir N, Forscher P. Filopodia and actin arcs guide the assembly and transport of two populations of microtubules with unique dynamic parameters in neuronal growth cones. J Cell Biol. 2002;158:139–152. doi: 10.1083/jcb.200203038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Schlessinger K, McManus EJ, Hall A. Cdc42 and noncanonical Wnt signal transduction pathways cooperate to promote cell polarity. J Cell Biol. 2007 doi: 10.1083/jcb.200701083. in press. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Shi SH, Cheng T, Jan LY, Jan YN. APC and GSK-3beta are involved in mPar3 targeting to the nascent axon and establishment of neuronal polarity. Curr Biol. 2004;14:2025–2032. doi: 10.1016/j.cub.2004.11.009. [DOI] [PubMed] [Google Scholar]
  42. Stepanova T, Slemmer J, Hoogenraad CC, Lansbergen G, Dortland B, De Zeeuw CI, Grosveld F, van Cappellen G, Akhmanova A, Galjart N. Visualization of microtubule growth in cultured neurons via the use of EB3-GFP (end-binding protein 3-green fluorescent protein) J Neurosci. 2003;23:2655–2664. doi: 10.1523/JNEUROSCI.23-07-02655.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Strickland LI, Wen Y, Gundersen GG, Burgess DR. Interaction between EB1 and p150glued is required for anaphase astral microtubule elongation and stimulation of cytokinesis. Curr Biol. 2005;15:2249–2255. doi: 10.1016/j.cub.2005.10.073. [DOI] [PubMed] [Google Scholar]
  44. Tanaka EM, Kirschner MW. Microtubule behavior in the growth cones of living neurons during axon elongation. J Cell Biol. 1991;115:345–363. doi: 10.1083/jcb.115.2.345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Tirnauer JS, O'Toole E, Berrueta L, Bierer BE, Pellman D. Yeast Bim1p promotes the G1-specific dynamics of microtubules. J Cell Biol. 1999;145:993–1007. doi: 10.1083/jcb.145.5.993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Torres MA, Nelson WJ. Colocalization and redistribution of dishevelled and actin during Wnt-induced mesenchymal morphogenesis. J Cell Biol. 2000;149:1433–1442. doi: 10.1083/jcb.149.7.1433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Tsui HT, Lankford KL, Ris H, Klein WL. Novel organization of microtubules in cultured central nervous system neurons: formation of hairpin loops at ends of maturing neurites. J Neurosci. 1984;4:3002–3013. doi: 10.1523/JNEUROSCI.04-12-03002.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Umemori H, Linhoff MW, Ornitz DM, Sanes JR. FGF22 and its close relatives are presynaptic organizing molecules in the mammalian brain. Cell. 2004;118:257–270. doi: 10.1016/j.cell.2004.06.025. [DOI] [PubMed] [Google Scholar]
  49. Votin V, Nelson WJ, Barth AI. Neurite outgrowth involves adenomatous polyposis coli protein and {beta}-catenin. J Cell Sci. 2005;118:5699–5708. doi: 10.1242/jcs.02679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Wakatsuki T, Schwab B, Thompson NC, Elson EL. Effects of cytochalasin D and latrunculin B on mechanical properties of cells. J Cell Sci. 2001;114:1025–1036. doi: 10.1242/jcs.114.5.1025. [DOI] [PubMed] [Google Scholar]
  51. Watanabe T, Wang S, Noritake J, Sato K, Fukata M, Takefuji M, Nakagawa M, Izumi N, Akiyama T, Kaibuchi K. Interaction with IQGAP1 links APC to Rac1, Cdc42, and actin filaments during cell polarization and migration. Dev Cell. 2004;7:871–883. doi: 10.1016/j.devcel.2004.10.017. [DOI] [PubMed] [Google Scholar]
  52. Wen Y, Eng CH, Schmoranzer J, Cabrera-Poch N, Morris EJ, Chen M, Wallar BJ, Alberts AS, Gundersen GG. EB1 and APC bind to mDia to stabilize microtubules downstream of Rho and promote cell migration. Nat Cell Biol. 2004;6:820–830. doi: 10.1038/ncb1160. [DOI] [PubMed] [Google Scholar]
  53. Zhang X, Zhu J, Yang G-Y, Wang Q-J, Qian L, Chen Y-M, Chen F, Tao Y, Hu H-S, Wang T, Luo Z-G. Dishevelled promotes axon differentiation by regulating atypical protein kinase C. Nature Cell Biology. 2007;9:743–754. doi: 10.1038/ncb1603. [DOI] [PubMed] [Google Scholar]
  54. Zhou FQ, Zhou J, Dedhar S, Wu YH, Snider WD. NGF-induced axon growth is mediated by localized inactivation of GSK-3beta and functions of the microtubule plus end binding protein APC. Neuron. 2004;42:897–912. doi: 10.1016/j.neuron.2004.05.011. [DOI] [PubMed] [Google Scholar]
  55. Zmuda JF, Rivas RJ. Actin disruption alters the localization of tau in the growth cones of cerebellar granule neurons. J Cell Sci. 2000;113(Pt 15):2797–2809. doi: 10.1242/jcs.113.15.2797. [DOI] [PubMed] [Google Scholar]
  56. Zou Y. Navigating the anterior-posterior axis with Wnts. Neuron. 2006;49:787–789. doi: 10.1016/j.neuron.2006.03.004. [DOI] [PubMed] [Google Scholar]
  57. Zumbrunn J, Kinoshita K, Hyman AA, Nathke IS. Binding of the adenomatous polyposis coli protein to microtubules increases microtubule stability and is regulated by GSK3 beta phosphorylation. Curr Biol. 2001;11:44–49. doi: 10.1016/s0960-9822(01)00002-1. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Movie 1
Download video file (14.1MB, mov)
Movie 2
Download video file (7.4MB, mov)
Movie 3
Download video file (18.4MB, mov)
Movie 4
Download video file (10.4MB, mov)
Movie 5
Download video file (751.8KB, mov)
supplementary Data

RESOURCES