Differential proteomic analysis of human hepatocellular carcinoma cell line metastasis-associated proteins

Abstract

Purpose

The comparative study of differentially expression of protein profiles of hepatocellular carcinoma cell lines with various metastasic potential and screening key molecules related to hepatocellular carcinoma metastasis and recurrence.

Methods

Using two-dimensional electrophoresis and liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI-MS/MS), we analyzed differentially displayed proteomics of human hepatocellular carcinoma cell lines Hep3B, MHCC97L, MHCC97H with different metastasic potential.

Results

Approximate 1,000 protein spots were detected on silver-stained gel by ImageMaster (977±113 spots in Hep3B, 1092±40 in MHCC97L, and 889±14 in MHCC97H). Fifty distinct different protein spots were analyzed with online LC-ESI-MS/MS. Only 26 protein spots had a positive result, including annexin1, S100A4, and so on. In comparison with nonmetastasis Hep3B cell lines, there were 16 proteins overexpressed in MHCC97H and MHCC97L, 10 proteins underexpressed in MHCC97H and MHCC97L. Applying cell immunohistochemistry and RT-PCR, we further validated two interesting and different proteins, annexin1 and S100A4.

Conclusion

The protein profile of metastatic hepatocellular carcinoma cell lines displayed obvious differences compared with non-metastatic liver cancer cell lines. The results imply that various different proteins may lead to HCC metastasis together.

Introduction

Hepatocellular carcinoma (HCC) is one of the most common malignant tumors in southeast Asia which involves various genetic alteration, complex pathological mechanisms, and multi-step processes. The clinical characteristics of HCC are rapid progress, hard to diagnose, poor prognosis, etc. One of the major factors of lower post-operation survival rate is metastasis and recurrence (Hanazaki et al. 2000; Tang 2000; Tang et al. 1999; Tang et al. 1998). Metastasis and recurrence are also complex aggressive processes, closely related with cancer cell biological behavior (such as adhesion, motility, proliferation), extracellular matrix, liver immunity, tumor angiogenesis, etc (Tang 2003). Proteomics is the study of the complete protein complement or the proteome of the cell. The proteome is dynamic and is in constant flux at each stage of the disease. At the protein level, distinct changes occur in pathological processes, including altered expression, differential protein modification, changes in specific activity, and aberrant localization, all of which may affect cellular function. Identifying and understanding these changes is the goal of proteomics. Powerful proteomic techniques with high resolution, high throughput, and real-time express analysis can provide new ideas for detecting more key proteins in pathological processes. In order to screen more key proteins related to the HCC metastasis process, we used two-dimensional electrophoresis (2-DE) and electrospray ionization-mass spectrometry (LC-ESI-MS/MS) and found some distinctly different proteins among human HCC cell lines with different metastasis potential.

Materials and methods

Sample preparation

Human hepatocellular carcinoma cell lines Hep3B were obtained from Cornell University. The cell lines were cultured in RPMI1640 containing 10% fetal bovine serum. Human hepatocellular carcinoma cell lines MHCC97H, CC97L were established in the Liver Cancer Institute, Fudan University (Tian J et al. 1999; Li Y et al. 2001). The two cell lines were cultured in Dulbecco’s modified Eagle medium (DMEM). After growth and reaching 80% confluence, the cells were harvested by treatment with trypsin, and rinsed three times in cold PBS. They were then solubilized in lysis buffer (urea7 mol/l, thiourea2 mol/l, CHAPS 4%, Tris 40 mmol/l, DTT 65 mmol/l, pharmylte 2%, PMSF 1 mmol/l). The cell mixtures, 1.5×10⁶ cells per 100 μl, were vortexed for 1 h and centrifuged at 20,000 g for 45 min at 4 °C. Aliquots of supernatant were extracted by pipette and stored at −80 °C for 2-DE.

Reagents

DMEM was supplied by GIBCO BRL. DTT, urea, CHAPS, IPG buffer, pharmaylte, IPG gel strip (24 cm, 3~10NL), SDS, acrylamide, N,N’-methylen-bis-acrylamide were purchased from Amersham Pharmacia. Thiourea was obtained from SIGMA and iodoacetamide from Fluka. 2-D standard protein marker was obtained from Biorad, acetonitrile from Merck, and trypsin from Roche (sequence level). HPLC was acquired from Agilent. Other chemicals are commercial available (analytical grade).

IPG-DALT two-dimensional electrophoresis

We pipetted 450-μl rehydration solution (8 mol/l urea, 2% CHAPS, 0.5% IPG buffer, 18 mmol/l DTT) into an Immobiline Drystrip Reswelling Tray. The IPG strip with the gel-side down was soaked in the solution and rehydrated overnight. We applied a 150-μg sample with cup-loading positioned at the acid region and cariied out 2-DE standard at the same time. Total voltage was 52~70 kvh. After IEF finished, each IPG strip was incubated for 15 min with equilibration solution 1(6 mol/l urea, 50 mmol/l Tris, 30%(V/V) glycerol, 2% SDS, 1% DTT) and equilibration solution 2 (same as equilibration solution 1 plus 2.5% iodoacetamide and with exception of DTT), respectively, then the IPG strip was placed in contact with the top surface of SDS-PAGE and sealed with 0.5% agarose. SDS-PAGE electrophoresis was run at a constant power of 5 W/gel for 45 min and followed with 10 W/gel. The protein spots were visualised in gel by ammoniacal silver nitrate staining (analytical) and Coomassie brilliant blue staining (preperative) when electrophoresis ended.

Image acquisition and analysis

Stained 2-D gels were captured by transmission scanning (ImageScanner). Target gels were analysed with ImageMaster software including spot detection, background subtraction, matching, etc.

LC-ESI-MS/MS analysis for differential protein spots

In-gel proteolytic digestion

The differential protein spots of interest were excised manually from Coomassie brilliant blue stained gel with a disposable pipette, cut into small pieces, and transferred into 0.5 ml Eppendorf tubes. The gel pieces were destained by adding 60 μl acetonitrile/200 mM NH₄HCO₃(1:1), vortexed 5 min, and centrifuged at 12,000 g for 5 min and then the supernatant removed. This step was repeated until the gel pieces were completely destained. Sixty microlitres of acetonitrile were added, vortexed for 5 min, and centrifuged at 12,000 g for 5 min and then thesupernatant removed; this was repeated twice until the gel pieces were completely white. The gel pieces were dried, rehydrated, and incubated in 18 μl ice-cold trypsin solution (12.5 ng/ μl in 100 mM NH₄HCO₃ ) at 4 °C for 20 min. The supernatant was removed and pipetted in 15 μl of the previous buffer without trypsin to maintain proteolytic digestion for 12 h at 37 °C in a wet environment. We added 60 μl extract solution (5% formic acid in 50% acetonitrile) then sonicated the extract solution for 5 min. Peptides were collected in supernatant.

Reverse-phase HPLC and ion trap mass spectrometry

The reversed-phase HPLC system used was the Agilent 1100 series HPLC system. This was coupled with the Esquire 3000 ion-trap mass spectrometer (Bruker Daltonics). The nebulizer gas pressure was 15 psi, the drying gas flow 5 l/min, the dry temperature 300 °C, and the capillary voltage −4,000 V. The MS/MS fragmentation amplitude parameter was 1 V. A 0.3×15 mm column (5 µm, 218TP51 C₁₈) was used for HPLC, and peptides were eluted with 0.1% formic acid (A) and 0.1% formic acid in acetonitrile solution (B). The gradient program was 5 min, 5% B; 35 min, 60% B; and 45 min, 95% B, respectively.

Identification of proteins using MASCOT ion search

Tandem mass spectra were analyzed using MASCOT MS/MS ion search. The search parameters were as follows: the database was NCBInr, taxonomy Homo Sapiens [human], and the enzyme was trypsin, allowing up to 1 missed cleavage. Peptide mass tolerance was 2.0 Da and MS/MS mass tolerance was 1.0 Da.

RT-PCR

Total RNA were extracted from hep3B, MHCC97H, MHCC97L, respectively, according to the manufacturer’s instructions (Invitrogen). cDNA synthesis was performed in 20-μl reaction volume at 42 °C for 60 min after brief denaturation of template RNA at 70 °C. The reaction system consists of 4 μg template RNA, 0.5 μg primer oligo(dT)₁₈, 4 μl 5×buffer, 1 mM dNTP, 20 U ribonuclease inhibitor, and 200 U reverse transcriptase. the reaction was stopped through inactivating reverse transcriptase at 70 °C for 10 min. Amplification of cDNA was carried out in a DNA Thermal cycler (Perkin Elmer, USA) with 50 μl reaction mixtures containing 2 μl cDNA template, 0.2 mM dNTP,1 mM MgCL_2, 0.4 pmol/ μl sense primer, 0.4 pmol/ μl antisense primer, 2U Taq DNA polymerase, and 5 μl 10×buffer with (NH₄)₂SO₄. The amplification program was as follows: 95 °C 5 min (95 °C 1 min, 62 °C 1 min, 72 °C 1 min, 35 cycles) and 72 °C 7 min. PCR products were detected by 2% agarose gel with ethidium bromide and analyzed by VDS imagemaster. Annexin1 sense primer was: 5’cagccaagtcttcattcacacc3’; antisense primer: 5’aacttcgtgctgccatgaagg3’. S100A4 sense primer was 5’caagtactcgggcaaagagg3’; antisense primer: 5’tgcaggacaggaagacacag3’. β- actin sense primer was 5’tgggcatgggtcagaaggat3’, β-actin antisense primer 5’aagcatttgcggtggacgat3’.

Cell immunohistochemistry

Cultured cells were grown on sterile glass slides overnight at 37 °C. They were washed briefly with PBS and cells fixed by cold acetone (−20 °C) for 10 min. The slides were washed in two changes of PBS and incubated in 0.1–1% hydrogen peroxide in PBS for 30 min at room temperature. They were washed with PBS twice for 5 min each. After blocking non-specific binding sites with 1.5% goat serum in PBS, the slides were incubated with primary antibody (1:200 rabbit anti-human annexin1 polyclonal antibody or 1:25 rabbit anti-human S100A4 antibody) for 1 h at 37 °C. They were washed in PBS three times for 5 min each and then diluted alkaline phosphatase conjugated goat anti-rabbit antibody(1:500) added for 15–30 min at 37 °C. The chromogen was NCIP/NBT, and lightly counterstained with nuclear fast red.

Results

2-DE was performed three times for each cell line to ensure reproducibility. Approximately 1,000 protein spots were detected on the silver-stained gel by ImageMaster (977±113 spots in Hep3B, 1092±40 in MHCC97L and 889±14 in MHCC97H) (Fig. 1). Fifty distinct different protein spots were excised from the CBB-stained gel, and in-gel digestion with trypsin was then carried out to analyze extracted peptides with on-line LC-ESI-MS/MS. Only 26 protein spots including annexin1 and S100A4 have been identified (Fig. 2). In comparison with nonmetastasis Hep3B cell lines, 16 proteins overexpressed in MHCC97H and MHCC97L (Table 1), ten proteins underexpressed in MHCC97H and MHCC97L (Table 2). Figure 3 showed MS/MS spectra for spot 12 (annexin 1).

Fig. 1A–C.

2-DE silver staining result of A Hep3B; B MHCC97L; C MHCC97H

Fig. 2A,B.

Different protein spots in the CBB staining map of MHCC97H (A) and Hep3B (B) for ESI-MS/MS. The arrows represent different spots among HCC cell lines successfully identified by ESI-MS/MS

Table 1.

Up-expression protein in MHCC97H and MHCC97L identified by ESI-MS/MS

No.	Protein name	Score	Coverage(%)	Mr(KDa)	PI
10	Aldo-keto reductase	208	14	36.0	7.67
12	Annexin I	229	24	35.02	7.77
13	Glucose-6-phosphate dehydrogenase	141	13	55.17	6.62
29	Keratin20	226	19	48.5	5.60
24	Capping protein (actin filament)	159	14	38.5	5.88
28	N-myc downstream regulated gene 1	44	7	42.8	5.49
1	S100 calcium-binding protein A4	93	24	11.721	5.85
2	S100 calcium-binding protein A11	64	26	11.733	6.56
50	S100 calcium-binding protein A6	43	16	10.173	5.33
69	2-phosphopyruvate-hydratase	315	26	47.079	7.01
42	Pyruvate kinase	263	23	57.841	7.58
55	Aldehyde dehydrogenase 1	96	10	54.8	6.30
66	Glyceraldehyde-3-phosphate dehydrogenase	65	7	36.031	8.26
39	Dihydrodiol dehydrogenase isoform DD1	111	13	34.771	8.10
41	Aldolase A	81	12	39.307	8.34
26	Lactate dehydrogenase B	52	6	36.615	5.71

Table 2.

Down-expression protein in MHCC97H and MHCC97L identified by ESI-MS/MS

No	Protein name	Score	Coverage(%)	Mr(KDa)	PI
15	Transferrin	66	4	77.0	6.81
33	The ha1225 gene product related to human alpha-glucosidase	176	11	106.7	5.71
36	Similar to human albumin	137	12	52.05	5.69
37	Reading frame HSA	53	8	69.25	5.92
62	Chaperonin containing TCP1	128	11	57.988	6.23
53	Calreticulin precursor	125	7	48.112	4.29
54	60 kDa heat shock protein	115	11	61.016	5.70
63	ZNF202 alpha	41	7	24.695	8.35
74	Manganese superoxide dismutase	40	7	24.695	8.35
38	Phospholipase C-alpha	85	8	56.666	6.23

Fig. 3A–C.

LC-ESI-MS/MS result for spot 12 (annexin 1). A spot 12 total ion chromatogram; B peptide MS map for spot 12 at 31 min; C tandem MS map for peptide1262

Two distinct different proteins were further validated by RT-PCR and cell immunohistochemistry. The RT-PCR results showed that the mRNA expression level of annexin1 in MHCC97H and MHCC97L were increased by 4.75-fold and 3.29-fold (Fig. 4) in density compared to those in Hep3B. The mRNA expression level of S100A4 in MHCC97H and MHCC97L were also increased by 11.9-fold and 8.7 fold (Fig. 4). β-actin was taken as reference to normalize relative mRNA expression. To examine the expression of annexin1 and S100A4 at the cellular level, we performed cell immunohistochemistry three times. The same staining patterns observed in Fig. 5 show intense staining in cytoplasma-associated membrane with anti-human annexin1 antibody both in MHCC97H and MHCC97L (A,B). Weak but definite staining was observed in Hep3B (C). When S100A4 expression was analyzed, the same staining pattern was found. S100A4 in MHCC97H and MHCC97L show strong positive staining(D,E).

Fig. 4.

RT-PCR result for annexin1 and S100A4 in Hep3B, MHCC97L, and MHCC97H. A annexin1, S S100A4, C β-actin, 1 Hep3B, 2 MHCC97L, 3 MHCC97H, M 100 bp DNA ladder

Fig. 5A–F.

The expression of annexin1 and S100A4 in HCC cell lines detected by immunohistochemistry (200×). Upper picture A MHCC97H; B MHCC97L; C Hep3B for annexin1. Bottom picture D MHCCC97H; E MHCC97L; F Hep3B for S100A4

Discussion

Comparative proteomics is a common and effective strategy for rapidly screening between healthy and diseased distinctly different proteins. This approach encompasses the identification and quantitative analysis of differentially expressed protein relative to normal cells or tissue at different stages of disease. Powerful proteomics techniques could be used to identify key protein molecules for disease diagnosis (Brunagel et al. 2002; Coffey 2002), to scan therapeutic targets (Steiner et al. 2000), and to find important signal molecules (Soskic et al. 1999). Currently, 2-DE and MS have become the two core techniques for proteomics research. The former is the most commonly used method for simultaneous separation of complex protein samples and the latter is powerful tool for the identification of the proteins of interest. It is believed that LC-ESI-MS/MS is an efficient method due to introducing ions into the mass spectrometry from the solution phase, allowing the interfacing of LC and MS. The whole process includes chromatography separation, concentration of peptide, collision-induced dissociation (CID) spectra of selected peptides in tandem MS. Then spectras obtained by tandem MS are searched for directly against a protein database for identification of proteins from which the peptide originated. The major advantages of ESI-MS^N are the possibility of an MS^N experiment, high sensitivity, and easy manipulation (Timperman et al. 2000; Yu et al. 2000). A comparative proteomic study between human HCC cell lines, BEL-7404, and normal liver cell lines, L02, by using 2-DE and LC-MS/MS were reported. Twelve different proteins which may be related to carcinogenesis were identified (Yu et al. 2000). Eberhart et al. reported tumor-associated proteins, rat aldose reductase-like protein1 (rARLP-1) and its other three subtypes, and rat aldo-keto reductase protein-C (Rak-C) were detected in the animal tumor model induced by various carcinogens. (Zeindl-Eberhart et al. 2001). In our proteomics study on established HCC cell lines with different metastasis potentials. We analyzed and defined different spots in 2-DE profiles of Hep3B (non-metastasis), MHCC97L (low metastasis), MHCC97H (high metastasis), then in-gel proteolytic digestion with trypsin, followed by these proteins identified by LC-MS/MS. Finally, the tryptic peptides spectrum was used to search for homologues in the protein with MASCOT MS/MS ions searched for in the NCBInr database. Twenty-six distinctly different proteins were identified. The theoretical isoelectric point and molecular weight of identified proteins were equal to the measured value. We further validated the mRNA expression of annexin1 and S100A4 in HCC cell lines by semiquantitative RT-PCR analysis as well as their protein expression level by cell immunohistochemistry. The same different expression modes in HCC cell lines with different metastasic potentials were found as with 2-DE analysis. These identified proteins could be classified as: (1) enzymes which play a critical role in energy metabolism; (2) structural proteins related to cell skeletal structure and cell motility; (3) proteins involved in signal transduction of cell growth and apoptosis; and (4) the heat shock protein superfamily, such as HSP60 which reacts under stress conditions, and others associated with HCC carcinogenesis.

The more interesting proteins were S100 and the annexin superfamily. The S100 family is one of the largest subfamilies of the so-called EF-hand calcium-bind proteins. EF-hand motifs are a special characteristic structure which has a high affinity for calcium. Ca²⁺-binding S100 proteins are activated by calcium ions, then probably induce a conformation change resulting in exposure of the binding site at the protein surface. Target protein binding leads to many biological changes. Most S100 family proteins are located on the chromosome 1q21 region which is related to HCC metastasis. Three low molecular weight calcium-bind S100 proteins, S100A4, S100A6, and S100A11, were identified in HCC cell lines in our work. Previous studies have documented that S100A4 and S100A6 are involved in cell motility, cell proliferation, differentiation, carcinogenesis, and cancer cell metastasis in breast cancer, colorectal cancer, and gall bladder cancer (Pedersen et al. 2002; Nakamura et al. 2002; Komatsu et al. 2000). Our study discovered high expression of S100A4, S100A6, and S100A11 only in metastasic cell lines which implies that these proteins may play an important role in HCC metastasis. Annexin1 is a member of the annexin superfamily. The precise functions of annexin1 are still unknown at present. This may be involved in membrane fusion, intracellular signal transduction, and cell differential (Masaki et al. 1996). We also found that both annexin1 and α-enolase were all upregulated in HCC metastasis cell lines the same as in metastasis-associated protein in head and neck cancer cell lines (Wu et al. 2002). Some key enzymes in the glycolytic pathway and phentose phosphate pathway had upregulated expression in metastasic cell lines. This result may involve enzyme pattern alteration and malignant cell change which are also characteristic of high metastasis cell lines. Thus, the protein profile of metastatic hepatocellular carcinoma cell lines displayed obvious differences compared with non-metastatic liver cancer cell lines. A detailed analysis of these proteins discovered in metastasis HCC cell lines is now in process.

Abbreviations

HCC

Hepatocellular carcinoma

IPG-DALT

Immobilized pH gradient-Dalton

2-DE

Two-dimensional electrophoresis

LC-ESI-MS/MS

Liquid chromatography-electrospray ionization-tandem mass spectrometry

RT-PCR

Reverse transcription polymerase chain reaction

DMEM

Dulbecco’s modified Eagle medium

CBB

Coomassie brilliant blue

HPLC

High performance liquid chromatography

PBS

Phosphate buffered saline

BCIP/NBT

5-bromo-4-chloro-3-indodyl phosphate /nitroblue tetrazolium

rARLP-1

Rat aldose reductase-like protein1

Rak-C

Rat aldo-keto reductase protein-C