Abstract
We developed a duplex PCR assay targeting the hemagglutinin multigene families, vlhA and pMGA, of Mycoplasma synoviae and Mycoplasma gallisepticum, respectively. The assay proved to be specific and sensitive enough to justify its use for the simultaneous detection of the two major avian mycoplasma species from field isolates.
Mycoplasma gallisepticum and M. synoviae are considered important in commercial poultry industries. M. gallisepticum causes chronic respiratory disease in chickens and sinusitis in turkeys (17), and M. synoviae is commonly involved in respiratory tract infection, synovitis in chickens, and poor growth (12). The antigenic relatedness (1, 2, 7, 11) of these organisms make them difficult to identify with conventional serological tests (5, 6). Attempts to differentiate between these two major avian mycoplasmas by using molecular methods, such as PCR tests, were mainly based on the 16S rRNA gene (4, 10, 13). However, it often requires additional steps, such as restriction fragment length analysis (9) or hybridization with species-specific probes (3, 10). In addition, these analyses resulted in concomitant amplification of unrelated bacterial DNA, making this approach useless for the testing of clinical material.
We show here that PCR amplification targeting species-specific structural genes provides an efficient tool for the simultaneous detection and differentiation of M. gallisepticum and M. synoviae.
The Mycoplasma species and walled bacteria used in the present study are listed in Table 1. All of the mycoplasma strains were propagated in Frey's medium (8). Unrelated bacterial species were cultured in brain heart infusion broth (Difco Laboratories, Detroit, Mich.). Forty tracheal swabs were immediately processed for culture and used as clinical mycoplasma samples to test the applicability of the duplex PCR assay.
TABLE 1.
Mycoplasmal and other bacterial strains used in PCR specificity tests
Organism | Strain(s)a | |
---|---|---|
Mycoplasma synoviae | ATCC WVU1853, NCTC 10124 | |
Mycoplasma gallisepticum | ATCC S6, ATCC PG31 | |
Mycoplasma meleagridis | ATCC 17529 | |
Mycoplasma imitans | ATCC 4229 | |
Mycoplasma iowae | ATCC 695 | |
Mycoplasma iners | ATCC 19705 | |
Mycoplasma gallinarum | NCTC 10120 | |
Escherichia coli | Field strain | |
Bordetella avium | Field strain | |
Pasteurella multocida | Field strain | |
Salmonella spp. | Field strain |
ATCC, American Type Culture Collection; NCTC, National Collection of Type Cultures.
The template DNA of M. synoviae and M. gallisepticum was prepared from 200 μl of culture, to which an equal volume of nonionic detergent mix solution (0.45% Nonidet P-40, 0.45% Tween 20, and 100 μg of proteinase K/ml) was added. The sample was incubated at 56°C for 1 h, boiled for 10 min, and then centrifuged at 14,000 × g for 5 min. Then, 10 μl of the resulting supernatant was directly used for PCR.
All of the primers used in the present study are listed in Table 2. They targeted pMGA1.2 gene encoding a hemagglutinin protein (pMGA) from M. gallisepticum (14) and M. synoviae2/12 DNA fragment (accession no. M. synoviaeU66314) (3) of the M. synoviae hemagglutinin vlhA gene (15, 16). To confirm the specificity of the amplification reaction, a nested PCR was performed by using inner primers (Tab.2). Additional avian Mycoplasma spp. and other common bacteria (Table 1) were tested to determine the specificity of the duplex PCR assay.
TABLE 2.
Species-specific oligonucleotide primers
Primera | Sequence (5′ to 3′) | Gene source | Product size (bp) |
---|---|---|---|
pMGAFo | GTGAAGAAAAAAAACATATTAAAGTTT | MG pMGA1.2 | 1,900 |
pMGARo | CTAAGATGGATTTGAAACATTAGT | ||
MS1.2Fo | AAACTACAAAACTTTGTAATGGCT | MS2/12 | 1,200 |
MS1.2Ro | TTACAAGTACGGTGTTTAATCAAT | ||
pMGAF1i | CTAGTTAATACTAGTGATCAAGTGAAACTA | MG pMGA1.2 | 500 |
pMGAR1i | TTGAACATTGTTCTTTGGAACCATCAT | ||
MS1.2F1i | ATTACCAAGCAGATGGTTACGACGT | MS2/12 | 450 |
MS1.2R2i | AGTTATAGTAACTCCGTTTGTTCCA |
Subscripts: o, outer primer; i, inner primer.
The amplification reaction was performed in a total volume of 50 μl containing 5 μl of 10× PCR buffer (Amersham Biosciences), 250 μM concentrations of each deoxynucleoside triphosphate (Pharmacia), 50 pmol of each external or internal primers, 2.25 mM MgCl2, 2 U of Taq DNA polymerase (Amersham Biosciences), and 10 μl of DNA template. The mixture was subjected to 30 cycles of amplification consisting of 94°C for 1 min, 53°C for 2 min, and 72°C for 1 min in a thermal cycler (Perkin-Elmer GeneAmp PCR system 9700). Then, 7 μl of the amplified product was subjected to the second amplification round with the inner primers under the conditions of amplification described above except that the annealing temperature was 60°C.
As shown in Fig. 1, both outer and internal primers yielded the expected products from all M. gallisepticum and M. synoviae reference strains. No amplicons were observed with DNA from other avian mycoplasma species (Fig. 1a and b, lanes 6 to 10 and lanes 5 to 9, respectively) and unrelated bacteria (data not shown). Inner primers were also used in a nested PCR, and this confirmed the specificity of the amplicons generated by outer primers (data not shown). Optimization experiments showed that, in the duplex PCR, the optimal MgCl2 concentration is 2.25 mM.
FIG. 1.
(a) Specificity of the duplex PCR tested with various ATCC mollicutes. Lanes 1 and 13, 1-kb DNA ladder; lanes 2 to 5, M. synoviae and M. gallisepticum primers amplify individually and, respectively, DNA from M. synoviae WVU 1853, M. gallisepticum S6, M. synoviae NCTC 10124, and M. gallisepticum PG31; lanes 6 to 10, both M. synoviae and M. gallisepticum primers used, respectively, in duplex PCR with DNA from M. imitans, M. meleagridis, M. iowae, M. gallinarum, and M. iners; lane 11, M. synoviae and M. gallisepticum DNA amplified with the two pairs of M. synoviae and M. gallisepticum primers (duplex positive control); lane 12, extracted DNA from poultry blood with M. synoviae and M. gallisepticum primers (duplex internal negative control). (b) Ethidium bromide-stained agarose gel confirming the specificity results obtained after the first-round amplification of DNA from M. synoviae and M. gallisepticum and other mollicutes by using the inner M. synoviae and M. gallisepticum primers in duplex nested PCR. Lane 1, 50-bp DNA ladder; lanes 2 and 4, M. synoviae and M. gallisepticum inner primers amplify, respectively, in duplex nested PCR DNA from M. synoviae WVU 1853-M. gallisepticum S6 and M. synoviae NCTC 10124-M. gallisepticum PG31 (duplex nested positive control); lane 3, extracted DNA from poultry blood with M. synoviae and M. gallisepticum primers (duplex internal negative control); lanes 5 to 9, both M. synoviae and M. gallisepticum inner primers used, respectively, with DNA from M. imitans, M. meleagridis, M. iowae, M. gallinarum, and M. iners.
To assess the applicability and the robustness of the assay on clinical samples, 40 tracheal swabs were subjected to culture and duplex PCR. Of the 40 cultures, 32 were positive. The duplex PCR showed amplification only when the DNA was processed from a 24-h culture (enrichment step). A total of 26 samples turned out to be PCR positive; among these, 7 could be assigned to M. gallisepticum (Fig. 2, lanes 2, 5, 9, 13, 14, 21, and 25), whereas the other 19 corresponded to M. synoviae (Fig. 2, lanes 3, 4, 6, 10 to 12, 15 to 20, 22 to 24, and 26 to 29). The remaining six samples that were culture positive but PCR negative were identified as M. meleagridis by slot blot assay with a digoxigenin-labeled M. meleagridis DNA probe (data not shown). All PCR-positive clinical samples were confirmed by the nested PCR and a capture enzyme-linked immunosorbent assay ELISA (2). With regard to sensitivity, the duplex PCR allowed detection of 90 and 250 CFU of M. synoviae and M. gallisepticum, respectively (data not shown).
FIG. 2.
Electrophoretic profiles of M. gallisepticum and M. synoviae DNA fragments obtained from 28 clinical samples by duplex PCR. We used 5-μl samples of amplified DNA. Lane 1, 1-kb ladder; lanes 2, 5, 9, 13, 14, 21, and 25, pMGAF-pMGAR and MS1.2F-MS1.2R primers amplifying M. gallisepticum DNA from clinical samples; lanes 3, 4, 6, 10 to 12, 15 to 20, 22 to 24, and 26 to 29, pMGAF-pMGAR and MS1.2F-MS1.2R primers amplifying M. synoviae DNA from clinical samples; lanes 7 and 8, pMGAF-pMGAR and MS1.2F-MS1.2R primers used with extracted DNA from M. gallisepticum- and M. synoviae-negative cultures.
The primary objective of the present study was to develop a robust PCR for the simultaneous detection and differentiation of M. synoviae and M. gallisepticum. This aim was made possible by targeting conserved species-specific sequences that belong to multigene families (3, 14). With this duplex PCR, detection and differentiation of both mycoplasmas could be achieved in a single reaction, which greatly improves the rapid detection of these pathogens. The robustness of the test is further demonstrated by the fact that no amplification occurred with other mollicutes and unrelated bacteria commonly found in clinical samples.
The enrichment step, which consists of the incubation of specimens for 24 h prior to detergent treatment, is crucial. Indeed, the sensitivity of the duplex PCR was raised to 100% compared to culture. This is certainly due to an increase of the DNA starting material and the reduction of PCR inhibitors present in the original sample. It is also tempting to speculate that increased sensitivity of the test would have benefited from the multicopy nature of the targeted genes, thereby enhancing the intrinsic sensitivity of the test. In this respect, primers that result in small amplicons would also increase the sensitivity. This has been recently confirmed in our laboratory as enhanced sensitivity was achieved when the primer pairs pMGAF1i-pMGAR1i and MS1.2F1i-MS1.2R2i (500- and 450-bp products, respectively) were used directly with mycoplasma DNA in a single duplex PCR (data not shown).
Overall, these results strongly support the use of this duplex PCR assay as an efficient alternative to culture and serological identification, which are labor-intensive, extremely time-consuming, and often provide confusing results.
Acknowledgments
This study was supported by a grant for Developmental Scientific Research from Institut Pasteur de Tunis and the SERST (Secrétariat d'Etat à la Recherche Scientifique et à la Technologie), which is an organization of the Government of Tunisia.
REFERENCES
- 1.Ben Abdelmoumen, B., and R. S. Roy. 1995. Antigenic relatedness between seven avian mycoplasma species as revealed by Western blot analysis. Avian Dis. 39:250-262. [PubMed] [Google Scholar]
- 2.Ben Abdelmoumen, B., and R. S. Roy. 1995. An enzyme-linked immunosorbent assay for detection of avian mycoplasmas in culture. Avian Dis. 39:85-93. [PubMed] [Google Scholar]
- 3.Ben Abdelmoumen, B., R. S. Roy, and R. Brousseau. 1999. Cloning of Mycoplasma synoviae genes encoding specific antigens and their use as species-specific DNA probes. J. Vet. Diagn. Investig. 11:162-169. [DOI] [PubMed] [Google Scholar]
- 4.Boyle, J. S., R. T. Good, and C. J. Morrow. 1995. Detection of turkey pathogens Mycoplasma meleagridis and M. iowae by amplification of the 16S rRNA. J. Clin. Microbiol. 33:1335-1338. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Bradbury, J. M., and F. T. W. Jordan. 1971. The adsorption of gamma globulins to Mycoplasma gallisepticum and the possible role in nonspecific serological reactions. Vet. Rec. 89:318. [DOI] [PubMed] [Google Scholar]
- 6.Bradbury, J. M., and F. T. W. Jordan. 1973. Nonspecific agglutination of Mycoplasma gallisepticum. Vet. Rec. 92:591-592. [DOI] [PubMed] [Google Scholar]
- 7.Bradley, L. D., D. B. Snyder, and R. A. Van Deusen. 1988. Identification of species-specific and interspecies-specific polypeptides of Mycoplasma gallisepticum and Mycoplasma synoviae. Am. J. Vet. Res. 49:511-515. [PubMed] [Google Scholar]
- 8.Frey, M. L., R. P. Hanson, and D. P. Anderson. 1968. A medium for the isolation of avian mycoplasmas. Am. J. Vet. Res. 29:2163. [PubMed] [Google Scholar]
- 9.Garcia, M., M. W. Jackwood, S. Levisohn, and S. H. Kleven. 1995. Detection of Mycoplasma gallisepticum, M. synoviae, and M. iowae by multi-species polymerase chain reaction and restriction fragment length polymorphism. Avian Dis. 39:606-616. [PubMed] [Google Scholar]
- 10.Garcia, M., M. W. Jackwood, M. Head, S. Levisohn, and S. H. Kleven. 1996. Use of species-specific oligonucleotide probes to detect Mycoplasma gallisepticum, M. synoviae, and M. iowae PCR amplification products. J. Vet. Diagn. Investig. 8:56-63. [DOI] [PubMed] [Google Scholar]
- 11.Hwang, Y. S., V. S. Panangala, C. R. Rossi, J. J. Giambrone, and L. H. Lauerman. 1989. Monoclonal antibodies that recognize specific antigens of Mycoplasma gallisepticum and M. synoviae. Avian Dis. 33:42-52. [PubMed] [Google Scholar]
- 12.Kleven, S. H., G. N. Rowland, and N. O. Olson. 1991. Mycoplasma synoviae infection, p. 223-231. In B. W. Calnek, H. J. Barnes, C. W. Beard, W. M. Reid, and H. W. Yoder, Jr (ed.), Diseases of poultry, 9th ed. Iowa State University Press, Ames.
- 13.Lauerman, L. H., F. J. Hoerr, A. R. Sharpton, S. M. Shah, and V. L. Van Santen. 1994. Development and application of a polymerase chain reaction assay for Mycoplasma synoviae. Avian Dis. 37:829-834. [PubMed] [Google Scholar]
- 14.Markham, P. F., M. D. Glew, K. G. Whithear, and I. D. Walker. 1993. Molecular cloning of a member of the gene family that encodes pMGA, a hemagglutinin of Mycoplasma gallisepticum. Infect. Immun. 61:903-909. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Noormohammadi, A. H., P. F. Markham, M. F. Duffy, K. G. Whithear, and G. F. Browning. 1998. Multigene families encoding the major hemagglutinins in phylogenetically distinct mycoplasmas. Infect. Immun. 66:3470-3475. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Noormohammadi, A. H., P. F. Markham, A. Khanci, K. G. Whithear, and G. F. Browning. 2000. A novel mechanism for control of antigenic variation in the hemagglutinin gene family of Mycoplasma synoviae. Mol. Microbiol. 35:911-923. [DOI] [PubMed] [Google Scholar]
- 17.Yoder, H. W., Jr. 1991. Mycoplasma gallisepticum infection, p. 198-212. In B. W. Calnek, C. W. Beard, H. J. Barnes, M. W. Reid, and H. W. Yoder, Jr (ed.), Diseases of poultry, 9th ed. Iowa State University Press, Ames.