Skip to main content
NCBI home page
American Journal of Human Genetics logoLink to American Journal of Human Genetics
. 2005 Mar 9;76(5):859–864. doi: 10.1086/429839

Single- and Multilocus Allelic Variants within the GABAB Receptor Subunit 2 (GABAB2) Gene Are Significantly Associated with Nicotine Dependence

Joke Beuten 1, Jennie Z Ma 1, Thomas J Payne 2, Randolph T Dupont 3, Karen M Crews 2, Grant Somes 4, Nancy J Williams 4, Robert C Elston 5, Ming D Li 1
PMCID: PMC1199374  PMID: 15759211

Abstract

Twelve single-nucleotide polymorphisms (SNPs) in the human γ-aminobutyric acid type B (GABAB) receptor subunit 2 gene (GABAB2) were tested for association with nicotine dependence (ND) in an extensively phenotyped cohort of 1,276 smokers and nonsmokers, representing ∼404 nuclear families of African American (AA) or European American (EA) origin. The GABAB2 gene encodes a subunit of the GABAB receptor for GABA, an inhibitory neurotransmitter involved in the regulation of many physiological and psychological processes in the brain. The gene is located within a region of chromosome 9q22 that showed a “suggestive” linkage to ND. Individual SNP analysis performed using the PBAT-GEE program indicated that two SNPs in the AAs and four SNPs in the EAs were significantly associated with ND. Haplotype analysis using the Family-Based Association Test revealed that, even after Bonferroni correction, the haplotype C-C-G of rs2491397-rs2184026-rs3750344 had a significant positive association with ND in both the pooled and the AA samples. In the EAs, we identified two haplotypes, C-A-C-A and T-A-T-A, formed by SNPs rs1435252-rs378042-rs2779562-rs3750344, that showed a highly significant negative and positive association with ND, respectively. In summary, our findings provide evidence of a significant association of GABAB2 variants with ND, implying that this gene plays an important role in the etiology of this drug addiction.

Tobacco use is a major worldwide health problem, and nearly one-third of the global adult population smokes tobacco products (United States Department of Health and Human Services [USDHHS] 2000). Nicotine is the primary reward component in tobacco that maintains continued use and results in addiction (USDHHS 2000). Nicotine dependence (ND [MIM 188890]), like many other substance dependencies, is a complex trait determined by strong genetic and environmental factors (Sullivan and Kendler 1999; Li et al. 2003a). Our previous meta-analysis of the genetic parameter for ND, which was based on 17 reported twin studies, indicated an average weighted mean polygenic heritability of 0.56 for adult smokers (Li et al. 2003a). On the basis of the results from genomewide linkage analyses for smoking behavior, several chromosomal regions appear to harbor susceptibility loci for ND (for recent reviews, see the studies by Uhl et al. [2002] and Li et al. [2004]). However, no susceptibility genes for ND have yet been identified within these positive regions. In addition, although numerous population-based association studies have been conducted to examine the effects of functional candidate genes on ND, only a limited number of variants have been confirmed in multiple cross-sectional studies (Li et al. 2004).

We previously identified an ∼13-cM interval on chromosome 9q22 that showed “suggestive” linkage with ND (measured as the number of cigarettes smoked per day, called “smoking quantity”) in the Framingham Heart Study (FHS) samples (Li et al. 2003b). Furthermore, three additional independent studies reported linkage—at a nominally significant level—of smoking to a region on chromosome 9 overlapping with our linked region (Bergen et al. 1999; Bierut et al. 2004; Gelernter et al. 2004). The gene encoding the human γ-aminobutyric acid (GABA) type B receptor subunit 2 (GABAB2, also called “G-protein–coupled receptor 51” [MIM 607340]) has been mapped to the 9q22.1 region, spans ∼420,000,000 bp, and consists of a 3.1-kb coding region that is distributed over 19 exons (Martin et al. 2001). GABA is a major neurotransmitter in the mammalian brain and controls neuronal excitability. The GABAB receptor inhibits neuronal activity through G-protein–coupled second-messenger systems, which regulate the release of neurotransmitters and the activity of ion channels and adenylyl cyclase (Kaupmann et al. 1998). Two types of GABAB receptors (GABAB1 and GABAB2) have been identified (Jones et al. 1998; Kaupmann et al. 1998). Although no unique pharmacological or physiological roles have been determined for either subtype of the GABAB receptor to date (Schuler et al. 2001), studies in both humans and animals have implicated GABAergic mechanisms in drug dependence, including ND (Dewey et al. 1999; Corrigall et al. 2000). Moreover, baclofen, a widely used GABAB agonist, is able to antagonize nicotine-rewarding effects in mice and rats (Fattore et al. 2002). Although there are lines of evidence suggesting biological links between GABAB2 and smoking behavior (Cousins et al. 2001; Fattore et al. 2002), few genetic studies have examined the role of GABAB2 in the etiology of ND, and no polymorphism in the GABAB2 gene has been reported to be associated with any addictive behavior. On the other hand, association of the α2 subunit of the GABAA receptor with alcohol dependence has been reported (Edenberg et al. 2004). The linkage results in the chromosomal 9q22 region, together with a likely biological function of GABAB2 in drug addiction, make this gene a plausible candidate for association with ND.

The subjects used in this study were of either African American (AA) or European American (EA) origin and were recruited primarily from the mid-South states in the United States from 1999 to 2004. The symptoms of ND of probands and other smoker participants were assessed with the Fagerstrom Test for Nicotine Dependence (FTND) scale (Heatherton et al. 1991). Once a proband was recruited, additional siblings and parents were recruited whenever possible, regardless of smoking status. Extensive clinical data were collected on all participants, including demographics (e.g., sex, age, race, biological relationships, weight, height, years of education, and marital status), medical history, smoking history, smoking experience, ND, and personality characteristics, as assessed by various questionnaires (National Institute on Drug Abuse, Center for Genetic Studies). Of the families recruited, 75.7% (EAs: 74.2%; AAs: 76.7%) had at least two siblings whose FTND score was 5 or above. All subjects agreed to participate in this study and signed the consent form, which was approved by each institutional review board.

In the present study, the ND of each smoker was ascertained by the three most commonly used measures in the literature: smoking quantity (SQ) (also used in our previous linkage study for ND in the FHS samples [Li et al. 2003b]); the heaviness of smoking index (HSI [0–6 scale]), which includes SQ and smoking urgency (i.e., how soon after waking up does the subject smoke the first cigarette?); and the FTND score (0–10 scale). Given the presence of overlap in the contents of the three ND measures, there exist fairly robust correlations among them (r=0.88–0.94). The primary reason for running similar analyses for each of the three ND measures was for comparison with previous findings. Demographic and clinical characteristics are presented in table 1. DNA from the participants was obtained using a blood extraction kit from Qiagen. Selection of the SNPs for association analysis was based on (1) a preference for SNPs located in coding or regulatory regions of the gene, (2) high heterozygosity (minor-allele frequency ⩾0.15), and (3) a uniform coverage of the gene. The 12 SNPs used were selected from the dbSNP, JSNP, and Celera Genomics databases. SNPs rs3750344 and rs2304389 are synonymous variants located in exons 2 and 15, respectively, of GABAB2 (rs3750344 has an A/G transition at the third position of the 120th codon for alanine; rs2304389 has a G/A transition at the third position of the 684th codon for proline). The remaining 10 SNPs are located within intronic regions of GABAB2. Data for these SNPs, including their locations within the gene, chromosomal position, allele frequency, and primer/probe sequences, are provided in table A1 (online only). SNPs were genotyped using the TaqMan assay in a 384-well microplate format (Applied Biosystems). Briefly, 15 ng of DNA was amplified in a total volume of 7 μl containing a minor groove binder (MGB) probe and 2.5 μl of TaqMan Universal PCR Master Mix. Amplification conditions were 2 min at 50°C and 10 min at 95°C, followed by 40 cycles of 95°C for 25 s and 60°C for 1 min. Allelic discrimination analysis was performed on the ABI Prism 9700 Sequence Detection System. We applied the PedCheck program (O’Connell and Weeks 1998) to identify any inconsistent Mendelian inheritance, nonpaternity, or other typing errors. To avoid bias, 135 inconsistencies (88 in the AA samples and 47 in the EA samples) among ∼18,000 reactions for 12 SNPs were excluded from further statistical analyses.

Table 1.

Clinical Characteristics of the AA, EA, and Pooled Sample Groups

Characteristic AA EA Pooled
No. of families 253 151 404
Average no. of members/family (mean ± SD) 3.1 ± .8 3.2 ± .7 3.2 ± .8
No. of subjects 793 483 1,276
% Female 64.6 68.7 66.1
Age (years) (mean ± SD) 40.0 ± 14.5 41.1 ± 15.2 40.4 ± 14.8
No. of smokers 622 468 990
Age at smoking onset (years) (mean ± SD) 17.2 ± 4.7 15.5 ± 4.4 16.6 ± 4.7
Years smoked (mean ± SD) 21.0 ± 12.7 24.1 ± 12.8 22.1 ± 12.8
SQ/day (mean ± SD) 17.9 ± 12.5 18.0 ± 13.7 18.0 ± 12.9
HSI score (mean ± SD) 3.7 ± 1.4 3.9 ± 1.4 3.8 ± 1.4
FTND score (mean ± SD) 6.3 ± 2.1 6.2 ± 2.2 6.2 ± 2.2
Open in a new tab

The pairwise |D′| values for the 12 selected SNPs within GABAB2 were calculated using the GOLD program (Abecasis and Cookson 2000) and showed a |D′| value of >0.72 for pairwise combinations of rs1547272, rs1930139, and rs509747 in the AA, EA, and pooled sample groups (see fig. A1 [online only]). In the AA samples, an additional SNP pair (rs1537959 and rs3780422) showed a |D′| value of >0.72. These findings suggest that the SNPs rs1547272-rs1930139-rs509747 and SNPs rs1537959-rs3780422 are part of a single haplotype block. We noticed differences for several SNPs, compared with the allele frequencies presented on various SNP Web sites, when we calculated the allele frequency by directly counting the numbers of each allele from the progenitors of our samples, especially in the AA samples (see table A2 [online only]), suggesting an ethnicity-specific allele distribution.

Association between a single SNP and three ND measures was determined by the Pedigree-Based Association Test (PBAT) program with the use of generalized estimating equations (Lange et al. 2003). Association between each ND measure and a haplotype was examined using the Family-Based Association Test (FBAT) program, with the option of computing P values of the Z statistic with the use of Monte Carlo sampling under the null distribution of no linkage and no association (Horvath et al. 2004). Three genetic models (additive, dominant, and recessive) were tested, with correction for sex and age in the AA or EA samples and for sex, age, and ethnicity in the pooled samples.

Analysis of individual SNPs indicated a significant association for 4 of the 12 SNPs with at least one age-, sex-, or ethnicity-adjusted ND measure in the pooled samples (table 2). Given the potential genetic differences in ND between ethnic groups, we analyzed all 12 SNPs in the two ethnic groups separately. Two SNPs in the AA samples and four SNPs in the EA samples showed significant or highly significant association with at least one ND measure under different genetic models. The association of SNPs rs1435252 and rs3750344 in the EA samples remained significant with the adjusted SQ and FTND after correction for multiple testing, on the basis of the SNP spectral decomposition approach (Nyholt 2004).

Table 2.

P Values of PBAT-GEE Statistic for Significant Association (P<.05) for Individual GABAB2 SNPs with Three ND Measures[Note]

P Value(s) for Sample Group and ND Measure
Pooled
 AA
 EA
SNP ID SQ HSI FTND SQ HSI FTND SQ HSI FTND
rs2304389 .01a,b .01a,b .03a,b .53 .74 .81 .07 .06 .14
rs1435252 .03a,b .10 .13 .07 .09 .09 .003a,b .009a,b .004a, .005b
rs3780422 .35 .28 .21 .43 .56 .49 .09 .08 .04a,b
rs1537959 .09 .03a,b .07 .02a,b .007a,b .02a,b .49 .40 .38
rs2491397 .03a,b .03a,b .07 .02a,b .04a,b .11 .17 .19 .12
rs2779562 .40 .29 .38 .78 .71 .44 .06 .01a,b,c .008c
rs3750344 .14 .30 .35 .33 .56 .74 .004c, .003a,b .03c, .02a,b .01c, .007a, .006b
Open in a new tab

Note.— Significant P values are shown in bold italics. The adjusted P value after correction for multiple testing at the .05 significance level is .0043. For the pooled samples, the three ND measures were adjusted for age, sex, and ethnicity; for each ethnic-specific sample group, only age and sex were used as covariates for the ND measures.

a

Dominant model.

b

Recessive model

c

Additive model.

Haplotype analysis of SNPs rs2491397, rs2184026, and rs3750344, which cover ∼135 kb of GABAB2, revealed four major haplotypes (⩾5%) in the AA samples and five major haplotypes in the pooled and EA samples. In both the pooled and the AA samples, the C-C-G haplotype of the three SNPs, with a frequency of 6.2% and 7.6%, respectively, showed a highly significant positive association with the three adjusted ND measures (max Z=4.02 and permutation P=.00001 for association with FTND in the pooled samples and max Z=3.55 and permutation P=.0004 for association with FTND in the AA samples, with 76 and 58 families contributing to the associations, respectively) (see table 3). These results remained highly significant after Bonferroni correction for testing of the major haplotypes in each sample group. In the EA samples, we did not find a haplotype for these three SNPs that remained significantly associated with ND after Bonferroni correction.

Table 3.

Z Values and Permutation P Values for Highly Significant Association (P<.01) of Major Haplotypes Formed by a Three- or Four-SNP Combination within GABAB2 with Three ND Measures[Note]

Percentage and Z Value(s) (Permutation P Value[s]) for Sample Group and ND Measure
Pooled
 AA
 EA
No. of SNPsand Haplotype % SQ HSI FTND % SQ HSI FTND % SQ HSI FTND
Three:a
 C-C-G 6.2 3.65 (.0002)b,3.73 (.0002)c 3.69 (.0002)b,3.74 (.0002)c 3.98 (.0001)b,4.02 (.0001)c 7.6 3.03 (.002)b,3.12 (.002)c 3.20 (.001)b,3.26 (.001)c 3.50 (.0003)b,3.55 (.0004)c 3.9 1.98 (.05) 1.59 (.12) 1.73 (.10)
Four:d
 C-A-C-A 7.7 −1.05 (.33) −1.19 (.24) −1.07 (.29) 4.6 2.22 (.028)b,2.24 (.02)c 2.21 (.03)b,2.2 (.02)c 2.10 (.03)b,2.07 (.04)c 12.8 −3.05 (.001)b,−3.28 (.0006)c −3.22 (.0009)b,−3.40 (.0003)c −3.03 (.001)b,−3.16 (.0008)c
 T-A-T-A 3.8 1.61 (.11) 1.30 (.18) 1.69 (.09) 2.6 −.11 (.90) −.47 (.64) −.24 (.81) 6.6 2.41 (.015)b,2.28 (.024)c 2.43 (.014)b,2.42 (.017)c 2.73 (.006)b,2.69 (.007)c
Open in a new tab

Note.— Significant P values are shown in bold italics. The adjusted P value at the .01 significance level after Bonferroni correction for five major haplotypes formed by the three SNPs in the pooled samples is .002, and, for the four major haplotypes in the AA samples, the adjusted P value is .0025. The adjusted P values for six major haplotypes formed by the four SNPs in the EA samples are .0083 and .0016 for the .05 and .01 significance levels, respectively. The ND measures used in the analysis were corrected for age, sex, and ethnicity in the pooled samples and for age and sex in each ethnic-specific sample group.

a

rs2491397-rs2184026-rs3750344.

b

Additive model.

c

Dominant model.

d

rs1435252-rs3780422-rs2779562-rs3750344.

Haplotype analysis of the rs1435252-rs3780422-rs2779562-rs3750344 combination, which covers a region extending from exon 2 to intron 13 of GABAB2 (∼237 kb), revealed eight major haplotypes in the pooled and AA samples and six major haplotypes in the EA samples. In the EA samples, the haplotype consisting of alleles C-A-C-A at a frequency of 12.8% showed a highly significant inverse association, even after Bonferroni correction, with all three adjusted ND measures (max Z=-3.40 and permutation P = .0003 for HSI, with 33 families contributing to the analysis) (see table 3). Additionally, in this EA sample group, we found another haplotype (T-A-T-A) that was formed by the same four SNPs at a frequency of 6.6% and that showed a significant association with the three adjusted ND measures; however, this haplotype only remained significant for FTND after Bonferroni correction (table 3). These findings indicate haplotype specificities in the two ethnic groups and further suggest different effects of haplotypes within GABAB2 on ND in AAs and EAs.

Our study has several advantages. We chose to use the single-marker PBAT program because it allows correction for covariates such as age, sex, and/or ethnicity. This represents an important feature for our analysis, as age, sex, and ethnic differences have been documented for ND (Heath et al. 1999; Madden et al. 1999; Li et al. 2003a; Tyndale 2003). We used a family-based approach for association analysis, which has an advantage over unconditional analyses (e.g., case-control analysis), in that it minimizes the potential for the confounding effects of population stratification. Furthermore, large samples of smokers and nonsmokers from two ethnic groups were analyzed, which allowed analysis of interethnic differences. Extensive phenotypic data on the individuals were collected, which can be used to investigate different aspects of ND in future studies. The three ND measures analyzed herein are commonly employed in the genetic research and clinical settings of tobacco smoking and thus would be readily available for cross-study replication. To our knowledge, this cohort represents one of the largest family-based genetic samples designed specifically for studies of tobacco smoking.

We here provide the first evidence of an association between the allelic variants of GABAB2 and ND. We are aware that none of the GABAB2 SNPs included in the current study represents an obvious causative variant. Only one significantly associated SNP (rs3750344) is located within a coding region of GABAB2, but the polymorphism does not result in an amino acid change. Thus, no coding differences are present in any of the GABAB2 SNPs from the higher-risk or protective haplotypes. Because the associated SNPs are not necessarily exclusive to GABAB2, a functional allelic variant(s) close to or in strong linkage disequilibrium (LD) with these SNPs may be responsible for ND vulnerability. We therefore plan to analyze more SNPs within GABAB2, as well as adjacent genes in this 13-cM region on chromosome 9, not only because 9 of the 12 SNPs do not show significant LD but also because of the data of the haplotype analyses: the higher-risk haplotypes C-C-G and T-A-T-A were found in 7.6% of the AA smokers and in 6.6% of the EA smokers, respectively, and the protective haplotype C-A-C-A was found in 12.8% of the EA smokers. This suggests that these haplotypes play an important role in a relatively small proportion of smokers.

In summary, our association results provide evidence of a significant impact of GABAB2 on ND—both for individual SNPs and for multilocus haplotypes. We also demonstrate that ethnic differences exist in the association between GABAB2 and vulnerability to ND. This study not only confirms molecular and pharmacological data about the importance of the family of GABA receptor genes in addictive/behavioral traits but it also provides new information on the genetics of ND, showing the importance of the GABAB2 gene as a biological candidate in future studies of ND.

Acknowledgments

We acknowledge the invaluable contributions of personal information and blood samples by all participants in the study, as well as the dedicated work of many research staff at different clinical sites. This project was funded by National Institutes of Health grants DA12844 (to M.D.L.) and RR03655 and GM28356 (to R.C.E.).

Appendix A: Supplemental Material

Figure A1.

Figure A1

Open in a new tab

Pairwise combinations of rs1547272, rs1930139, and rs509747 in the AA, EA, and pooled sample groups.

Table A1.

Position, Nucleotide Variation, Minor-Allele Frequency, and Primer/Probe Sequences of 12 SNPs within GABAB2

Sequence
SNP ID SNP Localization Chromosome Position(bp) Alleles Minor-Allele Frequency Forward Reverse Probe
rs2304389 Exon 15 96448418 G/A .18 ACTCATCCCGATGTACTTGCT GGGAGACCCGCAACGT ATCCCC/TGCACTCAA
rs1435252 Intron 13 96483429 C/T .33 GGTGTCCACAGCCACGT GCCGAGCCGAGGCT CAGGATCCATG/ACCAGAAG
rs3780422 Intron 11 96522642 A/G .49 GTGGAGCTGTCTGCAAGGA CCAGAGCCGGGTCAGC CCCTTCCCCC/TTGGCAC
rs1537959 Intron 7 96552532 A/G .38 AGCTGGCAGGCGATTCTG CTTGTGGCAGGGACTGGAA CCTGAAACT/CACATTTC
rs2491397 Intron 7 96585000 T/C .48 GCTTCATCATCACATGGCATTCTC CTGAAGTAAGGTAATCCAATATAACCAGTGT CTGTCTTC/TAAATCTC
rs2779547 Intron 5 96622859 C/T .24 GGTTAGACTGAGGTCCCTGGTT CCTCTTTCCAGGGAGCTAAAACC CAGAACAATACCG/ATCATCGA
rs2779562 Intron 3 96657519 C/T .44 CTTTGCACTTCAAGGTGGAGTTT GAAAGCTGCTAATAAAAAGTGCAGTGA CTCAGAAAG/AGAGTCCTT
rs2184026 Intron 2 96684186 T/C .41 GTGGTTGCAGCAAAAGAAAGCT GTAGGAAAGATGCTGGGTCACA AGTAAAAAGCG/ATTGTCTC
rs3750344 Exon 2 96720154 A/G .18 GCCTCCAAACACCATCAAGTG ACAACGCAAAAGGGTTGAAAGC CTACGATGCA/GATAAAA
rs1547272 Intron 1 96772593 A/G .33 CACTGCTCAAGCTCCTGTAGTC GCTGTGGATACCTGGCATCAG CTCACAATA/GCCTGTGTCAGT
rs1930139 Intron 1 96809426 A/G .29 CTGCTGCTGGCATTCACTTTC TCCCTCTAACTTCCTCTTGTAAGCT TCTGTTTAGTAAA/GTTCACC
rs509747 Intron 1 96849772 C/G .25 GCGCCGCTGCTGTTG CTGCTAGGTCGGATGCTTCAA TTCTCACGC/GCTCAGGC
Open in a new tab

Table A2.

Observed versus Reported Allele Frequency of 12 SNPs within GABAB2

Corresponding Allele Frequency in Sample Group
SNP ID Alleles Reported Minor-Allele Frequencya AA EA Pooled
rs2304389 G/A .18 .15 .17 .16
rs1435252 C/T .33 .34 .31 .33
rs3780422 A/G .49 .80 .47 .64
rs1537959 A/G .38 .53 .35 .44
rs2491397 T/C .48 .56 .46 .51
rs2779547 C/T .24 .34 .32 .33
rs2779562 C/T .44 .62 .47 .55
rs2184026 T/C .41 .94 .82 .88
rs3750344 A/G .18 .27 .17 .22
rs1547272 A/G .33 .42 .27 .35
rs1930139 A/G .29 .47 .25 .36
rs509747 C/G .25 .47 .77 .61
Open in a new tab
a

Based on the allele frequency presented in the dbSNP, JSNP, and Celera Genomics SNP databases.

Electronic-Database Information

The URLs for data presented herein are as follows:

  1. Celera Genomics, http://www.celera.com/
  2. dbSNP Home Page, http://www.ncbi.nlm.nih.gov/SNP/
  3. JSNP, http://snp.ims.u-tokyo.ac.jp/
  4. National Institute on Drug Abuse, Center for Genetic Studies, http://zork.wustl.edu/nida/ (for questionnaires used in the study)
  5. Online Mendelian Inheritance in Man (OMIM), http://www.ncbi.nlm.nih.gov/Omim/ (for ND and GABRB2)

References

  1. Abecasis GR, Cookson WO (2000) GOLD—graphical overview of linkage disequilibrium. Bioinformatics 16:182–183 10.1093/bioinformatics/16.2.182 [DOI] [PubMed] [Google Scholar]
  2. Bergen AW, Korczak JF, Weissbecker KA, Goldstein AM (1999) A genome-wide search for loci contributing to smoking and alcoholism. Genet Epidemiol Suppl 17:S55–S60 [DOI] [PubMed] [Google Scholar]
  3. Bierut LJ, Rice JP, Goate A, Hinrichs AL, Saccone NL, Foroud T, Edenberg HJ, Cloninger CR, Begleiter H, Conneally PM, Crowe RR, Hesselbrock V, Li TK, Nurnberger JI Jr, Porjesz B, Schuckit MA, Reich T (2004) A genomic scan for habitual smoking in families of alcoholics: common and specific genetic factors in substance dependence. Am J Med Genet 124A:19–27 [DOI] [PubMed] [Google Scholar]
  4. Corrigall WA, Coen KM, Adamson KL, Chow BL, Zhang J (2000) Response of nicotine self-administration in the rat to manipulations of mu-opioid and γ-aminobutyric acid receptors in the ventral tegmental area. Psychopharmacology (Berl) 149:107–114 [DOI] [PubMed] [Google Scholar]
  5. Cousins MS, Stamat HM, de Wit H (2001) Effects of a single dose of baclofen on self-reported subjective effects and tobacco smoking. Nicotine Tob Res 3:123–129 10.1080/14622200110042624 [DOI] [PubMed] [Google Scholar]
  6. Dewey SL, Brodie JD, Gerasimov M, Horan B, Gardner EL, Ashby CR Jr (1999) A pharmacologic strategy for the treatment of nicotine addiction. Synapse 31:76–86 [DOI] [PubMed] [Google Scholar]
  7. Edenberg HJ, Dick DM, Xuei X, Tian H, Almasy L, Bauer LO, Crowe RR, Goate A, Hesselbrock V, Jones K, Kwon J, Li TK, Nurnberger JI Jr, O’Connor SJ, Reich T, Rice J, Schuckit MA, Porjesz B, Foroud T, Begleiter H (2004) Variations in GABRA2, encoding the α2 subunit of the GABA(A) receptor, are associated with alcohol dependence and with brain oscillations. Am J Hum Genet 74:705–714 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Fattore L, Cossu G, Martellotta MC, Fratta W (2002) Baclofen antagonizes intravenous self-administration of nicotine in mice and rats. Alcohol Alcohol 37:495–498 [DOI] [PubMed] [Google Scholar]
  9. Gelernter J, Liu X, Hesselbrock V, Page GP, Goddard A, Zhang H (2004) Results of a genomewide linkage scan: support for chromosomes 9 and 11 loci increasing risk for cigarette smoking. Am J Med Genet B Neuropsychiatr Genet 128B:94–101 [DOI] [PubMed] [Google Scholar]
  10. Heath AC, Kirk KM, Meyer JM, Martin NG (1999) Genetic and social determinants of initiation and age at onset of smoking in Australian twins. Behav Genet 29:395–407 10.1023/A:1021670703806 [DOI] [PubMed] [Google Scholar]
  11. Heatherton TF, Kozlowski LT, Frecker RC, Fagerstrom KO (1991) The Fagerstrom Test for Nicotine Dependence: a revision of the Fagerstrom Tolerance Questionnaire. Br J Addict 86:1119–1127 [DOI] [PubMed] [Google Scholar]
  12. Horvath S, Xu X, Lake SL, Silverman EK, Weiss ST, Laird NM (2004) Family-based tests for associating haplotypes with general phenotype data: application to asthma genetics. Genet Epidemiol 26:61–69 10.1002/gepi.10295 [DOI] [PubMed] [Google Scholar]
  13. Jones KA, Borowsky B, Tamm JA, Craig DA, Durkin MM, Dai M, Yao WJ, Johnson M, Gunwaldsen C, Huang LY, Tang C, Shen Q, Salon JA, Morse K, Laz T, Smith KE, Nagarathnam D, Noble SA, Branchek TA, Gerald C (1998) GABA(B) receptors function as a heteromeric assembly of the subunits GABA(B)R1 and GABA(B)R2. Nature 396:674–679 10.1038/25348 [DOI] [PubMed] [Google Scholar]
  14. Kaupmann K, Malitschek B, Schuler V, Heid J, Froestl W, Beck P, Mosbacher J, Bischoff S, Kulik A, Shigemoto R, Karschin A, Bettler B (1998) GABA(B)-receptor subtypes assemble into functional heteromeric complexes. Nature 396:683–687 10.1038/25360 [DOI] [PubMed] [Google Scholar]
  15. Lange C, Silverman EK, Xu X, Weiss ST, Laird NM (2003) A multivariate family-based association test using generalized estimating equations: FBAT-GEE. Biostatistics 4:195–206 10.1093/biostatistics/4.2.195 [DOI] [PubMed] [Google Scholar]
  16. Li MD, Cheng R, Ma JZ, Swan GE (2003a) A meta-analysis of estimated genetic and environmental effects on smoking behavior in male and female adult twins. Addiction 98:23–31 10.1046/j.1360-0443.2003.00295.x [DOI] [PubMed] [Google Scholar]
  17. Li MD, Ma JZ, Beuten J (2004) Progress in searching for susceptibility loci and genes for smoking-related behaviour. Clin Genet 66:382–392 10.1111/j.1399-0004.2004.00302.x [DOI] [PubMed] [Google Scholar]
  18. Li MD, Ma JZ, Cheng R, Dupont R, Williams KC, Payne TJ, Elston RC (2003b) A genome-wide scan to identify loci for smoking quantity in the Framingham Heart Study populations. BMC Genetics Suppl 4:S103 10.1186/1471-2156-4-S1-S103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Madden PA, Heath AC, Pedersen NL, Kaprio J, Koskenvuo MJ, Martin NG (1999) The genetics of smoking persistence in men and women: a multicultural study. Behav Genet 29:423–431 10.1023/A:1021674804714 [DOI] [PubMed] [Google Scholar]
  20. Martin SC, Russek SJ, Farb DH (2001) Human GABA(B)R genomic structure: evidence for splice variants in GABA(B)R1 but not GABA(B)R2. Gene 278:63–79 10.1016/S0378-1119(01)00678-3 [DOI] [PubMed] [Google Scholar]
  21. Nyholt DR (2004) A simple correction for multiple testing for single-nucleotide polymorphisms in linkage disequilibrium with each other. Am J Hum Genet 74:765–769 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. O’Connell JR, Weeks DE (1998) PedCheck: a program for identification of genotype incompatibilities in linkage analysis. Am J Hum Genet 63:259–266 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Schuler V, Luscher C, Blanchet C, Klix N, Sansig G, Klebs K, Schmutz M, Heid J, Gentry C, Urban L, Fox A, Spooren W, Jaton AL, Vigouret J, Pozza M, Kelly PH, Mosbacher J, Froestl W, Kaslin E, Korn R, Bischoff S, Kaupmann K, van der Putten H, Bettler B (2001) Epilepsy, hyperalgesia, impaired memory, and loss of pre- and postsynaptic GABA(B) responses in mice lacking GABA(B(1)). Neuron 31:47–58 10.1016/S0896-6273(01)00345-2 [DOI] [PubMed] [Google Scholar]
  24. Sullivan PF, Kendler KS (1999) The genetic epidemiology of smoking. Nicotine Tob Res Suppl 1:S51–S57, S69–S70 [DOI] [PubMed] [Google Scholar]
  25. Tyndale RF (2003) Genetics of alcohol and tobacco use in humans. Ann Med 35:94–121 10.1080/07853890310010014 [DOI] [PubMed] [Google Scholar]
  26. Uhl GR, Liu QR, Naiman D (2002) Substance abuse vulnerability loci: converging genome scanning data. Trends Genet 18:420–425 10.1016/S0168-9525(02)02719-1 [DOI] [PubMed] [Google Scholar]
  27. United States Department of Health and Human Services (USDHHS) (2000) Reducing tobacco use: a report of the Surgeon General. United States Department of Health and Human Services, Center for Disease Control and Prevention, National Center for Chronic Disease Prevention and Health Promotion, Atlanta, GA [Google Scholar]

Articles from American Journal of Human Genetics are provided here courtesy of American Society of Human Genetics

RESOURCES