Clinical and Environmental Isolates of Cryptococcus gattii from Australia That Retain Sexual Fecundity

Abstract

Cryptococcus gattii is a primary pathogenic yeast that causes disease in both animals and humans. It is closely related to Cryptococcus neoformans and diverged from a common ancestor ∼40 million years ago. While C. gattii has a characterized sexual cycle dependent upon a dimorphic region of the genome known as the MAT locus, mating has rarely been observed in this species. In this study, we identify for the first time clinical (both human and veterinary) and environmental isolates from Australia that retain sexual fecundity. A collection of 120 isolates from a variety of geographic locations was analyzed for molecular type, mating type, and the ability to develop mating structures when cocultured with fertile tester strains. Nine isolates produced dikaryotic filaments with paired nuclei, fused clamp connections, and basidiospores. DNA sequence analysis of three genes (URA5, the MATα-specific SXI1α gene, and the MATa-specific SXI2a gene) revealed little or no variability in URA5 and SXI2a, respectively. However across the 108 MATα strains sequenced, the SXI1α gene was found to exist as 11 different alleles. Phylogenetic analysis found most variation to occur in the more fertile genotypes. Although some lineages of Australian C. gattii have retained the ability to mate, the majority of isolates were sterile, suggesting that asexuality is the dominant mode of propagation in these populations.

While many organisms undergo sexual recombination, others have limited sexual ability or appear to lack sex entirely. Sex can increase the rate of adaptive evolution by creating offspring with favorable gene combinations that are more robust than those of their parents in changing environments, and sex can also limit the accumulation of deleterious mutations by shuffling unfavorable gene combinations (2). However, sex can also disturb beneficial gene combinations and can be disadvantageous when a proportion of the population does not contribute to the fecundity of the opposite mating type or sex, for example, investing resources in the development of males not ultimately involved in reproduction, as this can adversely affect the growth rate of sexual populations (34, 47). Sex also confers a cost, in fully outcrossing reproduction, in that the relatedness between parent and offspring is halved in comparison to offspring produced asexually (8, 34). The maintenance of the sexual process requires considerable time and energy; in contrast, asexuality is an efficient means of propagation but has been thought to be impractical in the long term or under nonuniform conditions (2). Recent experimental studies have shown that sexual yeast populations adapt more rapidly to harsh environmental conditions than asexual populations (11). In pathogenic eukaryotes, an understanding of the mode of reproduction is important for disease diagnosis and treatment (42, 43). In a recombining pathogen, genetic material conferring increased virulence or antimicrobial resistance traits may be shuffled to produce hypervirulent offspring. This has been observed in the parasite Toxoplasma gondii, where the recombination of the genomes of two less virulent strains resulted in strains of greater pathogenicity (12, 37).

The reproductive strategies of fungi are diverse, ranging from the highly sexual fungal species such as the ascomycete Saccharomyces cerevisiae to the arbuscular mycorrhizal fungi (Glomeromycota), thought to be an ancient lineage of asexual fungi and the deuteromycetes, which possess no known sexual cycle (15, 32). The pathogenic yeast Cryptococcus neoformans is a haploid, heterothallic basidiomycete with a bipolar mating system involving a and α mating types. C. neoformans causes cryptococcosis in animals and humans, which can progress to meningoencephalitis that is uniformly fatal if untreated (20, 25).

C. neoformans exists as four haploid serotypes (A, B, C, and D) and a hybrid diploid serotype (AD), which have traditionally comprised three varieties based on biochemical, ecological, and epidemiological differences. C. neoformans var. grubii (serotype A) and C. neoformans var. neoformans (serotype D) are cosmopolitan, opportunistic human pathogens (3). Serotypes B and C (previously C. neoformans var. gattii) have recently been afforded species designation as Cryptococcus gattii. This primary human pathogen causes disease in immunocompetent hosts and is typically restricted to tropical and subtropical climates (3, 23). However, an ongoing outbreak of isolates with high sexual fecundity on Vancouver Island, British Columbia, Canada, is a recent exception to this ecological pattern (9, 10, 18).

C. neoformans and C. gattii have been further subdivided into distinct molecular types based on DNA sequence polymorphisms detected by PCR fingerprinting, randomly amplified polymorphic DNA, and restriction fragment length polymorphism (RFLP) analyses (29, 36). Serotype A isolates produce VNI or VNII fingerprints, AD hybrids produce a VNIII pattern, and serotype D isolates produce a VNIV pattern. Serotypes B and C define the groups VGI to VGIV (30).

Mating was first reported in C. gattii over 25 years ago (21). This species is endemic in the Australian environment and can be isolated in high numbers from certain native Australian eucalyptus trees (4, 7, 19). Although the α mating type predominates, mixed populations of α and a mating types have been observed in one Australian sampling site (14). Population genetics analysis revealed no apparent meiotic recombination among isolates, however, and it was not possible to induce mating in the laboratory with any of the known tester strains. It was suggested that the eucalyptus tree may simply be a favorable substrate for clonal propagation, and a different primary ecological niche might support the complete fungal life cycle (13). Recently, mating was recapitulated in several C. gattii isolates; however, mating had yet to be observed in any environmental isolates of C. gattii from Australia (9).

In this study, 120 Australian C. gattii isolates were assayed for mating ability using serotype C tester strains recently developed to induce sex in this species (9). We report the first mating of confirmed Australian C. gattii isolates and provide biological evidence supporting the model that mating ability is linked to the VGII molecular type, an observation of particular import given that the fertile Australian isolates and the Vancouver outbreak isolates share this characteristic.

MATERIALS AND METHODS

Strains and media.

All strains used in this study are listed in the supplemental material (see Table S1 in the supplemental material). Reference strains used were the congenic serotype D strains JEC20 (MATa) and JEC21 (MATα), serotype B strains E566 (MATa) and WM276 (MATα), serotype C strains B4546 (MATa) and NIH312 (MATα), and the serotype C crg1Δ mutant derivatives JF109 (MATa) and JF101 (MATα). All strains were maintained on yeast extract-peptone-dextrose medium. Isolates were originally serotyped at the source laboratories, and serotypes were confirmed using the Crypto Check kit (Iatron Laboratories Inc., Tokyo, Japan).

Mating assays.

The ability to mate was tested using the serotype D tester strains JEC20 (MATa) and JEC21 (MATα), serotype C strains B4546 (MATa) and NIH312 (MATα), and their crg1Δ mutant derivatives JF109 (MATa) and JF101 (MATα) (9). Strains were pregrown on yeast extract-peptone-dextrose medium for 2 days and then cultured on V8 medium (5% [vol/vol] V8 juice, 3 mM KH₂PO₄, 4% [wt/vol] agar, pH 7), both alone and mixed with a tester strain, at room temperature for 21 days in the dark and assessed for filament and basidiospore formation via light microscopy. Similarly, monokaryotic fruiting was assessed by culturing isolates alone or adjacent to cocultured MATa/MATα pheromone donors on V8 medium at pH 7 at room temperature in the dark for 21 days.

Determination of mating type.

C. gattii genomic DNA for PCR analysis was prepared as described previously by Pitkin et al. (33). Mating type was determined by PCR using primers specific for the STE12α, STE20a, MFα1, and MFa1 genes (Table 1). The STE12α and MFα primers, respectively, amplified 148-bp and 196-bp fragments specific to the α mating type. The STE20a and MFa primers amplified 484-bp and 213-bp fragments, respectively, specific to the a mating type. Ten microliters of each amplification product was electrophoresed on 2% agarose Tris-acetate-EDTA (TAE) gels and visualized by UV transillumination. Strains of known mating type were included as controls (Table 2).

TABLE 1.

Primers used in this study

Primer	Primer designation	Sequence	Reference or source
STE12α
upper	JOHE8644	CAATCTCAAAGCGGGGACAG	9
lower	JOHE8645	CTTTGTTTCGGTCCTAATACAGCC
STE20a
upper	JOHE9421	ATCCGCCCTCGAGTCAAA	9
lower	JOHE9422	TGGCGACCGACTGTAGAT
MFα
upper	JOHE9779	CCTTACTCCATAACCCGCTAC	9
lower	JOHE9780	AATTTCATAACGCTTTGGGAA
MFa
upper	JOHE9787	ACACCGCCTGTTACAATGGAC	9
lower	JOHE9788	CAGCGTTTGAAGATGGACTTT
(GACA)4		GACAGACAGACAGACA	1
URA5 (RFLP)		ATGTCCTCCCAAGCCCTCGACTCCG	29
SJO1		TTAAGACCTCTGAACACCGTACTC	29
URA5
	JOHE10455 upper	CGATACTAAGGCTTCCGTCAT	This study
	JOHE10456 lower	CCGAACTTGATCAGCTAGACC	This study
	JOHE10550 upper	CTGACCAGCACAGCAGCGATG	This study
	JOHE10551 lower	CATCGCTGCTGTGCTGGTCAG	This study
SXI1α
	JOHE10451 upper	TACATCACCGGTCATATCTGC	This study
	JOHE10452 lower	CTGGAGAAGCGCCTCACTGGA	This study
	JOHE10552 upper	CGCCGCTCCTCTTCTGAGTCG	This study
	JOHE10553 lower	CGACTCAGAAGAGGAGCGGCG	This study
	JOHE10554 upper	CCCAATGTGTCCGTCGCCTCT	This study
	JOHE10555 lower	AGAGGCGACGGACACATTGGG	This study
SXI2a
	JOHE10453 lower	TGATCGCACGAGCCAAATCCC	This study
	JOHE10454 upper	GGCTTCCTGACAACACTTCTA	This study
	JOHE10556 upper	TGCCCCGGTATGTTATCTTCA	This study
	JOHE10557 lower	TGAAGATAACATACCGGGGCA	This study
	JOHE10558 upper	CGCCACCCATTGCTTCCTTTA	This study
	JOHE10559 lower	TAAAGGAAGCAATGGGTGGCG	This study
	JOHE10560 upper	AATGTTCCGGCCGATGTTCTC	This study
	JOHE10561 lower	GAGAACATCGGCCGGAACATT	This study
	JOHE10562 upper	TGAGAGTTTGCCTCCCTACGG	This study
	JOHE10563 lower	CCGTAGGGAGGCAAACTCTCA	This study

TABLE 2.

Control and test strains used in this study

Strain	Sero- type	Mating type	Molecular type	Source
JEC20	D	a	VNIV	K. J. Kwon-Chung
JEC21	D	α	VNIV	K. J. Kwon-Chung
CDCB4546	C	a	VGIII	W. Schell
NIH312	C	α	VGIII	K. J. Kwon-Chung
JF109 (CDCB4546 crg1::NEO)	C	a	VGIII	J. Heitman
JF101 (NIH312 crg1::NAT)	C	α	VGIII	J. Heitman
E566	B	a	VGI	M. Krockenberger
WM276	B	α	VGI	W. Meyer
JF9 (E566 crg1::NAT)	B	a	VGI	J. Heitman
JF7 (WM276 crg1::NEO)	B	α	VGI	J. Heitman
Byron WM179	B	α	VGI	W. Meyer
Cotter WM178	B	α	VGII	W. Meyer
689 WM161	B	α	VGIII	W. Meyer
King Cheetah WM779	B	α	VGIV	W. Meyer

Determination of molecular type.

Molecular type was determined by DNA fingerprinting and RFLP analysis. Fingerprinting was performed using the simple repetitive sequence primer (GACA)₄ (1, 30). Amplification conditions were 94°C for 5 min followed by 35 cycles of 94°C for 20 seconds, 50°C for 30 seconds, and 72°C for 20 seconds and a final extension step at 72°C for 7 min. Ten microliters of each amplification product was electrophoresed on 2% agarose TAE gels and visualized by UV transillumination. RFLP analysis employed a method modified from that described previously by Meyer et al. (29). The URA5 gene was amplified using primers JOHE13344 and JOHE13345 (Table 1) and digested with Sau96I and HhaI for 3 h, and restriction fragments were resolved on 3% agarose TAE gels. Molecular type standard strains were included as controls and used to group sample isolates (Table 2).

Staining and microscopy.

Staining and microscopy were performed as previously described by Fraser et al. (9). Cells of opposite mating type were cocultured on V8 medium on glass slides at room temperature for 3 days. Dikaryotic nuclei and filaments were costained with Sytox green (Molecular Probes) and calcofluor white (fluorescent brightener 28 F-3397; Sigma) and visualized via differential interference contrast (DIC) optics (Ziess Axioskop 2 Plus fluorescent microscope equipped with an AxioCam MRM digital camera).

FACS analysis to determine ploidy.

Fluorescence-activated cell sorter (FACS) analysis was performed as described previously by Tanaka et al. (40). Ploidy was determined in a selection of fertile and nonfertile isolates by comparison to previously characterized control haploid and diploid strains.

DNA sequencing.

The URA5 gene was sequenced from all isolates. The SXI1α gene was sequenced from MATα strains, and the SXI2a gene was sequenced from the MATa strains. PCR products were purified and sequenced using an ABI 3700 sequencer with Big Dye chemistry (Applied Biosystems) and assembled using Sequencher 3.1.2 (Gene Codes). Sequencing primers are listed in Table 1. Nucleotide sequences were translated using the program Translate (ANGIS, Biomanager), and all sequences were aligned using ClustalW (41). The phylogenetic analysis program PAUP* (version 4.0b4a) (39) was used to produce a parsimony phylogram from sequence alignments of the SXI1α alleles. The same genes were also sequenced from the control strains WM276, E566, NIH312, and B4546.

Nucleotide sequence accession numbers.

Representative strains of each allele identified for the URA5, SXI1α, and SXI2a genes have been deposited in GenBank under accession numbers AY973637 to AY973640 for URA5 alleles A to D, AY973641 to AY973651 for SXI1α alleles Ai to Av, Bi to Biv, C, and D, and AY973652 to AY973654 for SXI2a alleles A to C, respectively.

RESULTS

Molecular characterization of C. gattii isolates from Australia.

A total of 120 strains from distant geographic locations around Australia were collected, some as part of a concurrent population genetics-based effort to identify evidence of sexual recombination in C. gattii (Fig. 1; see Table S1 in the supplemental material). This included 55 environmental, 17 human clinical, and 48 veterinary clinical isolates (see Table S1 in the supplemental material). These isolates were analyzed for serotype, molecular type, mating type, ploidy, and mating ability.

FIG. 1.

Regional map of Australia showing source locations of Australian isolates. The white arrow indicates the Sydney region primary location for veterinary isolates; dark and light gray arrows indicate the Renmark/Balranald and Western Australian regions, respectively, sources of many environmental isolates; the black arrow indicates the Northern Territory and Arnhamland, where the clinical isolates and some environmental isolates were obtained. Scale bar is 1,000 km.

Analysis using the Crypto Check slide agglutination test, which separates isolates into serotypes A, B, C, D, and AD by virtue of different capsular antigens, revealed that all isolates in the collection were C. gattii serotype B. Isolates were further differentiated by molecular typing. PCR fingerprinting using the microsatellite DNA primer (GACA)₄ and RFLP analysis of the URA5 gene yielded concordant results and revealed three of the four previously established C. gattii genotype groups, namely, VGI, VGII, and VGIII. From the 120 isolates assayed, 97 were VGI, comprising 93% of the environmental isolates, 29% of the human clinical isolates, and 88% of the veterinary isolates. Of the remaining 23 isolates, 22 were the VGII molecular type, and this comprised 7% of the remaining environmental isolates, 71% of the human clinical isolates, and 10% of the veterinary isolates. A single veterinary isolate was molecular type VGIII.

The mating type of each isolate was determined with a PCR-based protocol using both MATa- and MATα-specific primers (Table 1). MATα strains outnumbered MATa strains by a ratio of 113:7, which correlates well with previous studies of mating type distribution in Australia and elsewhere (14, 28). No a/α diploid or aneuploid isolates were observed, based on the absence of strains with both MATa and MATα PCR products.

The seven MATa isolates were all molecular type VGI. Of these, four originated from the environment, two were human clinical isolates, and one was a veterinary isolate. Of the MATα isolates, the environmental isolates (n = 51) were 92.2% VGI and 7.8% VGII, the human clinical isolates (n = 15) were 20% VGI and 80% VGII, and the veterinary isolates (n = 47) were 87.2% VGI, 10.6% VGII, and 2.1% VGIII.

Fertility of Australian C. gattii isolates.

Mating tests used the congenic serotype D strains JEC20 (MATa) and JEC21 (MATα) (21), robustly mating serotype C strains B4546 (MATa) and NIH312 (MATα), and their crg1 mutant derivatives JF109 (MATa crg1Δ) and JF101 (MATα crg1Δ) (9). CRG1 encodes an RGS (regulator of G protein signaling) protein that attenuates pheromone signaling, and as a consequence, the crg1 mutation enhances pheromone response and mating (31, 44). Mating ability for each test isolate was determined by coculturing sample isolates with tester strains on V8 medium in the dark at room temperature for 21 days. Evidence of typical mating structures, including filaments, basidia, and basidiospores, was examined by microscopy. Isolates were considered fertile if they developed any of these structures and were considered robustly fertile if basidiospores were formed.

Of the 120 isolates tested, 27 were observed to produce mating structures when mixed with inter- and/or intravarietal tester strains (Table 3); 18 of these isolates developed filaments and basidia, and 9 isolates developed filaments, basidia, and long chains of basidiospores extending from the basidia (Fig. 2). The remaining 93 isolates showed no mating response.

TABLE 3.

List of 27 fertile Australian isolates

Isolate designation	Isolate name (original)	Source (host)c	Serotype	Mating type	Matinga				DNA sequencing			Molecular type	Sourceb
					Mating ability	× JEC20/JEC21	× B4546/NIH312	× B4546 crg1Δ/NIH312 crg1Δ	URA5 allele	SXI1α allele	SXI2a allele
JH3724	NT-3	Clinical (human)	B	α	R	+	+	+	D	Biii	NA	VGII	1
JH3726	NT-6	Clinical (human)	B	α	R	+	+	+	C	Bi	NA	VGII	1
JH3732	NT-11	Clinical (human)	B	α	R	+	+	+			NA	VGII	1
JH3734	NT-13	Clinical (human)	B	α	R	+	+	+	C	Bi	NA	VGII	1
JH3739	RDH-2	Clinical (human)	B	α	R	+	+	+	D	C	NA	VGII	1
JH3743	RDH-6	Clinical (human)	B	α	R	+	+	+	C	Bi	NA	VGII	1
JH3744	RDH-7	Clinical (human)	B	α	R	+	+	+	D	Biii	NA	VGII	1
JH3745	RDH-9	Clinical (human)	B	α	R	+	+	+	D	Biii	NA	VGII	1
JH3631	571 058 or V4	Clinical (vet-cat)	B	α	R	+	+	+	C	Bi	NA	VGII	5
JH3729	NT-8	Clinical (human)	B	α	I	+	−	+	D	Biii	NA	VGII	1
JH3727	NT-7	Clinical (human)	B	α	I	−	−	+	C	Biv	NA	VGII	1
JH3733	NT-12	Clinical (human)	B	α	I	−	−	+			NA	VGII	1
JH3622	WA 861	Clinical (vet-koala)	B	α	I	−	−	+	C	Bii	NA	VGII	5
JH3628	V21	Clinical (vet-cat)	B	α	I	−	−	+	C	Bi	NA	VGII	5
JH3629	V9	Clinical (vet-cat)	B	α	I	−	−	+	C	Bi	NA	VGII	5
JH3637	571 116 or V20	Clinical (vet-dog)	B	α	I	−	−	+	C	Bi	NA	VGII	5
JH3643	VPB 571 159	Clinical (vet-cat)	B	α	I	−	−	+	B	D	NA	VGII	5
JH3713	V5 or 571 063	Clinical (vet-cat)	B	α	I	−	−	+	C	Bi	NA	VGII	5
JH3715	V11 or 571 083	Clinical (vet-dog)	B	α	I	−	−	+	A	Ai	NA	VGI	5
JH3720	V26 or 571 147	Clinical (vet-cat)	B	α	I	−	−	+	C	Bi	NA	VGII	5
JH3725	NT-4	Clinical (human)	B	a	W	+	−	+	A	NA	B	VGI	1
JH3738	Arn1	Environmental	B	α	W	−	−	+	C	Bi	NA	VGII	1, 2
JH3740	Ram2	Environmental	B	α	W	−	−	+	C	Bi	NA	VGII	1, 2
JH3741	Ram5	Environmental	B	α	W	−	−	+	C	Bi	NA	VGII	1, 2
JH3742	Ram15	Environmental	B	α	W	−	−	+	C	Bi	NA	VGII	1, 2
JH3661	Env71	Environmental	B	α	W	−	−	+	A	Av	NA	VGI	3, 4
JH3665	Env 1a dentritis	Environmental	B	α	W	−	−	+	A	Ai	NA	VGI	3, 4

^aIsolates are listed in decending order from robust to weak mating ability. Mating ability was considered robust (R), intermediate (I), or weak (W). Mating was performed with V8 agar for 21 days at 25°C.

^bSource numbers correspond to the following individuals: Bart Currie, Infectious Diseases Program, Menzies School of Health Research and Northern Territory Clinical School, Royal Darwin Hospital, Northern Territory, Australia (1); David Ellis, Mycology Unit, Women's and Children's Hospital, Adelaide, South Australia, Australia (2); Catriona Halliday, Department of Microbiology, University of Sydney, New South Wales, Australia (3); Mark Krockenberger, Faculty of Veterinary Science, University of Sydney, New South Wales, Australia (4); and Richard Malik, Faculty of Veterinary Science, University of Sydney, New South Wales, Australia (5).

^cVet, veterinary isolate.

FIG. 2.

Mating morphology of Australian C. gattii isolates. Crosses of Australian C. gattii strains with the serotype C crg1 mutant and wild-type strains and serotype D tester strains are shown. Morphology was observed by light microscopy. (A) 3739 (human clinical) × JF109; (B) 3739 × CDCB4546; (C) 3739 × JEC20. All fertile isolates produced mating structures with the crg1 mutant tester strains. Panel A illustrates the robust mating observed in 33.3% of fertile isolates when cocultured with the corresponding serotype C crg1 mutant strain. These crosses produced long chains of oval-shaped basidiospores. Panel B demonstrates the weaker mating observed in crosses with thewild-type serotype C tester strains in which fewer filaments and basidia developed and some basidia failed to produce basidiospores. Panel C illustrates the sexual structures developed in intervarietal crosses. Scale bars are 100 μm (panel) and 10 μm (insert).

Mating ability varied among strains of different origin. This phenotype was seen in a total of 23% (n = 27) of isolates, which included 11% (n = 6) of the environmental isolates, 71% (n = 12) of the human clinical isolates, and 19% (n = 9) of the veterinary isolates. A bias towards the VGII molecular type was observed among the fertile isolates, and this was linked to the higher proportion of this type observed among the human clinical isolates. Complete concordance was seen between their response to the MATα and MATa tester strains and the determination of mating type by PCR analysis. The ratio of MATα to MATa in the fertile collection, 26:1 (n = 27), again reflects the bias toward α strains in C. gattii (Table 4) (14, 22, 25, 28).

TABLE 4.

Molecular and mating types of fertile Australian C. gattii isolates

Population (total no. of isolates)	No. of fertile isolates	No. with molecular type:			No. with mating type:
		VGI	VGII	VGIII	α	a
Environmental (55)	6	2	4	0	6	0
Human clinical (17)	12	1	11	0	11	1
Veterinary (48)	9	2	6	1	9	0
Total (120)	27	5	21	1	26	1

All isolates that produced basidiospores and that were considered to be robustly fertile were MATα and molecular type VGII (eight human clinical isolates and one veterinary isolate). A similar pattern has been seen in the ongoing Vancouver Island outbreak, in which >99% of isolates are molecular type VGII, are fertile, and produce basidiospores, and all typeable isolates are MATα (9, 18) (J. A. Fraser and J. Heitman, unpublished data). This correlation suggests that a link may exist between molecular type, the increased rate of infection as seen in the Vancouver Island population (10), and the relatively high levels of infection in northern Australia by C. gattii, which are also frequently due to VGII strains (4, 5) (L. T. Campbell et al. this issue).

C. gattii produced dikaryotic filaments with fused clamp connections.

In addition to mating, C. gattii could potentially engage in two other forms of filamentous differentiation: monokaryotic fruiting in haploid strains and self-filamentous growth in a/α diploid strains (26). Each of these developmental processes produces basidiospores, and each is characterized by hallmark morphological features. Mating can be distinguished by the presence of dikaryotic filaments with paired nuclei and fused clamp connections as opposed to the monokaryotic filaments and unfused clamps seen in monokaryotic fruiting. Isolates capable of producing basidiospores were crossed with tester strains, cultured on glass slides, and fixed. The cell wall was stained with calcofluor white, DNA in the nuclei was stained with Sytox green, and the filaments were examined by DIC microscopy. All cocultures produced dikaryotic filaments with fused clamp connections and therefore represent bona fide mating (Fig. 3).

FIG. 3.

Dikaryotic filaments and fused clamp connections are formed during C. gattii mating. C. gattii fertile strains and tester strains were mated on V8 medium on glass slides for 3 days at room temperature. Panels Ai to Aiv depict basidiospore development in control strains and isolates from various Australian sources. Ai shows the serotype C control pair (NIH312 × JF109). The remaining Australian isolates (Aii) JH3643 (veterinary clinical), (Aiii) JH3739 (human clinical), and (Aiv) JH3741 (environmental) each crossed with tester strain JF109. Scale bar is 10 μm. Bi and Bii show dikaryotic nuclei both stained with Sytox green and observed by DIC microscopy, and Biii and Biv show fused clamp cells involving the formation of a peg-like protrusion observed with calcofluor white staining and DIC microscopy. Scale bar is 10 μm.

C. gattii diploid a/α isolates developed in the laboratory are thermally dimorphic and at lower growth temperatures produce filaments and sporulate (9). To exclude the possibility that the mating observed here was due to the presence of such isolates, FACS analysis was performed on subsets of mating and nonmating isolates. All sample isolates had a haploid profile when compared to control strains of known ploidy (data not shown). This was further confirmed by the PCR determination of mating types, which found only the a or α mating locus allele to be present. Furthermore, to our knowledge, no diploid C. gattii isolates have been identified from any natural source.

Monokaryotic fruiting was not observed in Australian C. gattii isolates.

In this study, no monokaryotic fruiting was observed for any Australian strain. These results indicate that the Australian isolates tested are incapable of monokaryotic fruiting under conditions that evoked a mating response in competent isolates. However, under these conditions, monokaryotic fruiting, including the development of basidiospores, was observed in the C. neoformans serotype D tester strain JEC21, which acted as a positive control. As an extension of this assay, all mating-competent strains of the same mating type were crossed pairwise with each other on V8 medium and examined. No mating structures (enlarged cells or conjugation tubes) or fruiting structures were observed, indicating that mating was restricted to interactions between strains of opposite mating types.

DNA sequence analysis of URA5, SXI1α, and SXI2a genes.

Sequence analysis was conducted to determine whether genetic variation occurred between fertile and infertile C. gattii isolates. Of the total 120 isolates in the study, 115 were included in the sequence analysis. URA5 sequences divided the isolates into three major allelic groups that correspond to the three VG groups. Five VGII isolates had two single nucleotide polymorphisms distinguishing them from the remaining VGII strains. The VGI and VGIII alleles had 99% sequence identity, and these were 96% identical with the VGII alleles (data not shown).

Analysis of the SXI1α gene in the 108 MATα isolates revealed 11 allelic groups designated Ai to Av, Bi to Biv, C, and D. Phylogenetic analysis using PAUP* (39) found that the alleles clustered according to molecular type and sexual fecundity (Fig. 4). Two major clusters were apparent on the phylogram. Cluster 1 (groups Bi to Biv, C, and D) consisted of 20 isolates, including 19 VGII isolates and the single VGIII isolate. The latter was the only isolate in the divergent allelic group D. All isolates with the SXI1α B, C, or D alleles were fertile, and all the “robust maters” had a B or C allele. Cluster 2 (groups Ai to Av) included 88 isolates, of which 85 were infertile and 3 were weakly fertile (filaments and rare basidia without basidiospore chains).

FIG. 4.

Phylogenetic analysis of the SXI1α gene. The entire SXI1α gene (1,360 bp) was used to generate an unweighted-pair group method using average linkages (UPGMA) tree using the program PAUP* (39). Eleven alleles were identified, and these alleles grouped into two distinct clusters, designated cluster 1 (20 fertile/20 total isolates) and cluster 2 (3 fertile/88 total isolates). Numbers above branches are bootstrap values (1,000 replicates). Only those greater than 70 are shown.

The topology of the two clusters also differed. Cluster 2 had a very limited amount of sequence divergence, and each allele differed from the others by a single base substitution. In contrast, within cluster 1, the B alleles diverged from the consensus sequence by between 3.3% and 3.4% and by 2.3% and 3.7% in the C and D alleles, respectively.

The translated sequences for each SXI1α allele were aligned and compared with the predicted homeodomain region of the Sxi1α C. neoformans protein (16). In this region consisting of 62 amino acids, 18 substitutions occurred between the C. neoformans consensus sequence and the C. gattii alleles (71% sequence identity) (Table 5). One substitution (glutamine [K] to lysine [Q]) occurred at a predicted DNA-binding contact site, residue 44. The B and C alleles, despite being divergent in DNA sequence, had identical protein sequences (Fig. 4). Five substitutions distinguished the A, B, and C allelic groups. The D allele shared three polymorphic residues with the A alleles and two with the B/C alleles and had two unique substitutions.

TABLE 5.

Distribution of amino acid substitutions within the Sxi1α predicted homeodomain region^a

SXI1α allelic group	Substitution at polymorphic amino acid site
	−1	1	2	7	9	10	11	15	22	28	32	33	37	39	40	43	44	45
CN (consensus)	F	D	N	S	P	P	I	V	D	A	D	F	T	G	I	S	Q	V
Ai (consensus)	L	H	I	L	S	A	P	I	N	A	D	S	Y	G	M	G	K	V
Aii	·	·	·	·	·	·	·	·	·	·	·	·	·	·	·	·	·	·
Aiii	·	·	·	·	·	·	·	·	·	·	·	·	·	·	·	·	·	·
Aiv	·	·	·	·	·	·	·	·	·	·	·	·	·	·	·	·	·	·
Av	·	·	·	·	·	·	·	·	·	·	·	·	·	·	·	·	·	·
Avi	·	·	·	·	·	·	·	·	·	·	·	·	·	·	·	·	·	·
Bi	·	·	·	S	·	·	·	·	·	·	E	·	H	R	·	S	·	·
Bii	·	·	·	S	·	·	·	·	·	·	E	·	H	R	·	S	·	·
Biii	·	·	·	S	·	·	·	·	·	·	E	·	H	R	·	S	·	·
Biv	·	·	·	S	·	·	·	·	·	·	E	·	H	R	·	S	·	·
C	·	·	·	S	·	·	·	·	·	·	E	·	H	R	·	S	·	·
D	·	·	·	S	·	·	·	·	·	T	·	·	·	·	·	S	·	I

^aResidue 44, DNA-binding contact site (total of seven sites across region); CN, C. neoformans consensus sequence (JEC21); Ai, C. gattii (Ai) consensus sequence (WM276). Dots indicate that the residue corresponds to the Ai (consensus) residue.

The SXI2a sequence, though relatively large (2,529 bp), contained only three single nucleotide polymorphisms. One allele was found in two isolates, the second was found in a single isolate, and the remaining allele occurred in four isolates, which grouped with the MATa consensus strain (E566) (Table 2).

DISCUSSION

Some Australian C. gattii serotype B isolates retain sexual fecundity. Australia has a higher-than-average incidence of cryptococcosis caused by C. gattii, particularly in the indigenous population (4). However, to date, only three fertile clinical isolates have been identified, and all environmental isolates analyzed have appeared sterile (9). Epidemiological data could not eliminate the possibility that the previously identified fertile clinical isolates were from patients with reactivated infections in which the original disease was acquired elsewhere in the world. Therefore, these isolates were not included as Australian strains. In this study, we screened a collection of Australian environmental, clinical, and veterinary isolates and have identified 26 fertile strains capable of mating, including examples from each of the three different sources.

The sexual cycle of serotype D C. neoformans var. neoformans has been studied extensively, and more recently, the sexual cycle of C. neoformans var. grubii was established (31). Mating in C. gattii has been more of an enigma (9, 14, 24, 28). The sexual cycle of this species was recently recapitulated for the first time more than 25 years after it was first reported (21). This analysis involved screening of a collection of serotypes B and C clinical and environmental isolates and was facilitated by the discovery of a pair of serotype C strains that mate robustly with each other and with a large number of clinical and environmental isolates (9). Mating in previous studies and the current study remains limited to serotype C crossed with C or serotype C crossed with B (9, 21). Mating between two serotype B isolates has never been reported, which may be largely attributed to the rarity of mating-competent MATa strains. The single fertile MATa isolate identified in this study did not mate robustly and failed to mate with any of the 25 fertile MATα isolates. However, the finding of both mating competence and recombination in Australian VGII isolates in this and the accompanying study (2a) suggests that VGII MATa isolates are likely to occur in the Australian environment. We will now direct our search to regions where the VGII molecular type is endemic to identify fertile C. gattii MATa strains.

The development of mating structures in response to coincubation with both serotypes D and C tester strains varied. Not all strains responded to the same testers, and the majority of isolates did not respond to any tester strain. It is therefore possible that given appropriate testers and mating conditions, more strains may emerge as fertile. However, data from this study are strongly supported by the observation of both recombination and clonality in a study of C. gattii populations from Australia (2a). Comparisons of isolates common to both studies revealed that isolates belonging to recombining populations were almost all fertile. In contrast, all isolates analyzed that belonged to clonal populations were infertile or only very weakly fertile. This is one of the first studies that directly correlates the indirect assessment of both recombination and clonal propagation via multilocus genotype analysis with biological data on mating in a pathogenic fungus. A recent study by Litvintseva et al. identified a similar pattern of recombination and clonal expansion in C. neoformans var. grubii populations from Botswana. This study identified 14 isolates as recombining via amplified fragment length polymorphism analysis that also proved fertile and capable of producing recombinant progeny (27).

Fertility in C. gattii is strongly associated with molecular type.

Extensive studies have divided the three varieties of Cryptococcus into molecular types based on differences in fingerprint patterns generated using a variety of molecular techniques (1, 29, 30). The four molecular types identified in C. gattii exhibit an uneven global distribution, and in Australia, VGI predominates in both clinical and environmental collections. In the northern regions of Australia, clinical isolates have frequently been found to belong to molecular type VGII (35). This bias is reflected in the current study, in which the majority of clinical isolates were sourced from the Northern Territory. In contrast, the veterinary and environmental isolates were generally isolated from the southern states and were mostly VGI. A few VGII isolates have been cultured from native trees in northern Australia; however, the exact environmental niche of this genotype remains unknown (5).

The majority of isolates capable of producing mating structures and all of the “robust maters” were found to be the VGII molecular type. This bias towards fertility is consistent with findings for an “outbreak” of cryptococcosis on Vancouver Island, Canada, where VGII isolates were also found to be highly fertile (9, 18). In contrast, 95% of VGI isolates were infertile. Interestingly, the single VGIII isolate in the study was weakly fertile, and considering that the two serotype C robustly mating tester strains also belong to molecular type VGIII, it would be interesting to analyze more VGIII strains to determine if this molecular type is also largely fertile. It is apparent that a link exists between VGII molecular type and fertility. A detailed analysis of the genetic variation between molecular types is required to determine the extent of this link, what genetic alterations might lead to infertility, and what the implications are for the future value of the serotype B C. gattii genome, which is of an apparently infertile VGI Australian isolate (WM276).

Loss of fertility of Australian C. gattii isolates.

Various degrees of mating ability, from robust mating with profuse basidiospore production to the extension of a few dikaryotic filaments to no mating, were observed. Fraser et al. (9) also reported this range of mating response and proposed three possible mechanisms to explain the apparent loss of fertility in many C. gattii isolates. First, genetic barriers preventing mating between isolates of the same phenotypic species may lead to cryptic speciation. It is certainly possible that each of the VG types represents a separate cryptic species within C. gattii, as indicated by the marked genetic differentiation between each VG type when analyzed by DNA fingerprinting, sequencing, RFLP, or amplified fragment length polymorphism (2a, 17, 29, 30). In addition, complete genealogical congruence was seen with the URA5 and SXI1α gene trees, with no evidence of inter-VG hybridization (Fig. 4). However, VGII and VGIII isolates can clearly intermate, as the two serotype C tester strains were VGIII. To test for fertility within VGI, each of the weakly fertile MATα and MATa strains was paired with isolates of opposite mating type, but no evidence of mating was seen. Finally, in the companion study, all isolates that appeared infertile via mating analysis also appeared clonal via population genetic analysis, which strongly suggests that these isolates are truly infertile.

The second mechanism that might explain the preponderance of isolates that do not mate is a loss of sexual ability. Strains of C. neoformans have been found to spontaneously lose sexual ability when cultured for extended periods in the laboratory (48). After approximately 600 mitotic divisions on rich laboratory media, congenic MATa and MATα strains have been observed to lose mating and filamentation ability by more than 67% and 24%, respectively, without any significant loss in the vegetative growth rate of the cells. The vastly clonal population structure of C. gattii in the Australian environment might indicate that, similar to prolonged propagation on laboratory media, the eucalyptus tree might be conducive to asexual propagation and the eventual loss of sexual fecundity over time.

Finally, Fraser and colleagues suggested that genetic alterations within the MAT locus might occur to render it nonfunctional. Sequence analysis of the SXI1α gene found a general partitioning of fertility with allelic groups, but this was confounded by cosegregation according to molecular type (Fig. 4). The translated amino acid sequence revealed a number of substitutions (Table 5). This region contains residues important for base contacts during DNA binding, and all such sites were conserved across the two Cryptococcus species with one exception, glutamine 44, for which all C. gattii alleles had a lysine residue. This is a nonconservative substitution at a critical functional residue and could alter the activity of the protein.

The MAT locus is very large (∼100 kb) and contains at least 20 genes that are essential for mating function. It is therefore possible that other mutations that reduce or abolish fertility exist. As this locus does not recombine, polymorphisms within SXI1α might be linked to loss of function elsewhere in the locus. However, the presence of three weakly fertile VGI isolates within the “infertile” cluster 2 (Fig. 4) indicates that SXI1α does not partition strictly according to fertility. Analysis of the MAT locus of fertile and infertile strains is currently under way to determine whether alterations might occur that make this region nonfunctional.

What is the infectious propagule of infertile C. gattii strains?

In the yeast Cryptococcus, the sexual cycle is important for the development of the basidiospore, which is thought to be the infectious propagule (3, 6). Basidiospores are small enough to penetrate the alveoli of the lung, <2 μm, are easily aerosolized, and have been shown to be infectious in murine models (38, 45, 50). In C. neoformans, basidiospores can also be produced in the absence of sexual recombination via monokaryotic fruiting (46). However, the vast majority of C. gattii strains cannot be induced to fruit, and in the few cases where some fruiting has been reported, this was limited to filament formation without the production of basidiospores (46, 49). In all the Australian C. gattii isolates analyzed here, monokaryotic fruiting was absent, suggesting that this method of spore production may not occur in Australian C. gattii or that the conditions used were not conducive to fruiting in these strains (26). Desiccated yeast cells have been suggested as an alternative infectious propagule to the basidiospore; however, there is evidence in C. neoformans that yeast cells are less infective and rapidly loose viability upon desiccation (38, 45). It would be interesting to analyze the infectivity of desiccated yeast cells of the infertile Australian VGI isolates to determine if these behave in a manner similar to that of desiccated C. neoformans cells.

The endemic nature of cryptococcosis due to C. gattii in some regions of Australia suggests that the infectious propagules, whether basidiospores or desiccated yeast cells, must be present in the environment, driving investigation into both the ecology and population structure of the fungus in this country. The identification of the two recombining VGII populations (2a) which also show evidence of fertility provides strong support that the mating observed under laboratory conditions is actually occurring in the natural environment in Australia. However, it appears that the majority of Australian isolates, including many causing human and animal infection, are infertile. The exact nature of the propagule responsible both for disease and for dispersing the fungus in the environment remains enigmatic.